Construction method and application of transgenic mouse for in-vivo screening of T cell membrane protein gene
By designing sgRNA library plasmids targeting membrane protein target genes and using genetic hybridization technology, the problems of low throughput and high false positive rate in in vivo functional studies of membrane protein genes have been solved, enabling efficient screening and validation of multiple genes in the same animal, thus improving research efficiency and accuracy.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-31
- Publication Date
- 2026-04-03
Smart Images

Figure CN121780609A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of bioengineering, specifically relating to a method for constructing and applying a transgenic mouse for screening T cell membrane protein genes in vivo. Background Technology
[0002] As the core executors of biological membrane functions, membrane proteins are widely involved in key physiological processes such as cell signal transduction, transmembrane transport, and cell-cell recognition and adhesion. Their dysfunction is closely related to the occurrence and development of major diseases such as tumors, neurodegenerative diseases, and autoimmune diseases. Therefore, systematically analyzing the in vivo functions of membrane protein genes and exploring key targets with disease regulation potential has become a research focus in the current biomedical field.
[0003] Current research on membrane protein gene function primarily relies on two major technical systems: in vitro cell models and in vivo animal models. At the in vitro research level, the maturity of CRISPR-Cas9 gene editing technology has promoted the application of high-throughput screening methods. By constructing sgRNA libraries targeting membrane protein genes and combining them with cell lines for gene knockout or activation, candidate genes affecting cell proliferation, apoptosis, and differentiation can be rapidly screened. This method has a short operation cycle, high throughput, and relatively controllable cost, and has been widely used in areas such as membrane protein-mediated signaling pathway analysis and initial screening of drug targets. At the in vivo research level, traditional animal models remain the "gold standard" for verifying the physiological function and pathological significance of membrane protein genes. By constructing systemic or tissue-specific knockout mice of specific membrane protein genes, the effects of gene deletion on animal development, organ function, and disease progression can be directly observed, clarifying the in vivo function of the genes. Meanwhile, in recent years, in vivo gene editing technology based on CRISPR-Cas9 has gradually developed. Researchers can deliver sgRNA and Cas9 protein to specific tissues via viral vectors to achieve local tissue gene editing, providing a new approach for in vivo functional research of membrane protein genes.
[0004] However, existing technologies still face significant bottlenecks in the systematic, high-throughput analysis of the in vivo function of membrane protein genes. Firstly, there is a disconnect between in vitro models and the in vivo physiological environment. In vitro cell models lack the complex tissue microenvironment of in vivo, causing some membrane protein genes that exhibit significant function in in vitro screening to fail to present the expected phenotype or even show functional reversal in vivo due to microenvironmental regulation, resulting in false positives or false negatives. This makes it difficult to directly guide in vivo disease mechanism research and target validation. Secondly, traditional in vivo models suffer from low throughput and high cost. Traditional gene knockout mice require the construction of individual genes. Studying the in vivo function of hundreds or thousands of membrane protein genes requires a significant investment of time and money, and parallel screening of multiple genes within the same animal individual is not feasible, failing to meet the need for systematic functional analysis of membrane protein gene families. Third, in vivo local gene editing technology has limitations. Although viral vector-based in vivo local editing technology can achieve gene editing in specific tissues, the loading capacity of viral vectors is limited, making it difficult to carry large-scale sgRNA libraries. Furthermore, viral infection efficiency is greatly affected by tissue type and cell state, easily leading to uneven editing efficiency. It may also trigger an immune response, interfering with the accuracy of experimental results, and making it impossible to achieve high-throughput screening of membrane protein genes in multiple tissues systemically. Fourth, the stability of libraries and the reliability of screening are insufficient. The few existing animal models that attempt to construct in vivo sgRNA libraries often have problems such as random integration sites, uneven distribution of sgRNA abundance, and sgRNA expression silencing due to promoter methylation. This results in some target genes not being effectively edited or significant differences in editing efficiency, leading to poor reproducibility and a high false negative rate in screening results, making it difficult to support large-scale in vivo functional screening and validation of membrane protein genes.
[0005] Addressing the current technical bottlenecks in in vivo functional studies of membrane protein genes, the development of a stable, efficient, and high-throughput in vivo screening animal model construction system is of great significance and has broad application prospects. This system can directly screen membrane protein gene functions in vivo by simulating the physiological or pathological microenvironment, avoiding the limitations of in vitro models. It provides a reliable in vivo validation platform for in vitro candidate genes, improving the accuracy of target discovery and clinical translation potential. Furthermore, by using models covering a large number of membrane protein genes, it enables parallel screening of multiple genes in the same animal, significantly increasing research throughput to uncover key membrane protein genes that were previously overlooked due to technical limitations and to improve their functional regulatory networks. In disease models such as tumors and neurodegenerative diseases, it can rapidly screen membrane protein genes that regulate disease progression, providing new targets for disease mechanism research and candidate targets and in vivo validation models for the development of targeted membrane protein drugs, shortening the research and development cycle, and promoting the development of the biopharmaceutical industry. Summary of the Invention
[0006] To address the aforementioned shortcomings, this invention provides a systematic technical solution for in vivo screening of animal models for membrane protein genes. The core of this solution involves designing sgRNAs targeting membrane protein target genes and control genes, constructing standardized sgRNA library plasmids, and combining embryo microinjection and genetic hybridization techniques to obtain induced recombinant library mice. Simultaneously, a complete technical system is established, encompassing genotype identification, inducer regulation, disease model construction, multi-tissue sample processing, and high-throughput sequencing analysis. This enables efficient in vivo editing and functional screening of membrane protein genes. This solution bridges the technical gap between in vitro and in vivo research, providing key tools and promoting technological development for systematic analysis of membrane protein genes, disease target discovery, and related research.
[0007] The technical solution of this invention is as follows: On the one hand, the present invention provides a method for constructing an in vivo screening animal model of T cell membrane protein genes, comprising: designing sgRNA sequences containing SEQ ID NO.1-SEQ ID NO.150, constructing a library plasmid containing the 150 sgRNAs; microinjecting the plasmid into an embryo, and then hybridizing it with a mouse containing Cas9 and UBC-CreERT2 to obtain a triple-positive mouse.
[0008] Specifically, the library plasmid containing 150 sgRNAs is composed of 10 plasmid units, each containing 15 sgRNAs, linked to a vector.
[0009] Specifically, the library plasmid also contains the U6 promoter.
[0010] More specifically, the core region of the U6 promoter is unmethylated.
[0011] Specifically, the embryo is a mouse fertilized egg.
[0012] Specifically, the triple-positive mice were identified using primers SEQ ID NO.151-SEQ ID NO.158.
[0013] On the one hand, the present invention provides the application of the triple-positive mice obtained by the aforementioned construction method in the in vivo screening of T cell membrane protein genes.
[0014] Specifically, it includes the following steps: S1. Triple-positive mice were induced to recombine and express the sgRNA library in the target cells; S2. Inoculate tumor cells to create an in vivo screening environment; S3. After the screening period, samples are collected and genomic DNA is extracted from the samples; S4. Sequencing the extracted genomic DNA, analyzing the relative abundance of each sgRNA, and screening potential tumor-regulating membrane protein targets based on abundance differences.
[0015] More specifically, the induction in step S1 uses tamoxifen; the tumor cells in step S2 include, but are not limited to: MC38 cells, B16 melanoma cells, CT26 colorectal cancer cells, 4T1 breast cancer cells or LLC Lewis lung cancer cells, mouse pancreatic cancer cells KPC / Panc02, and mouse liver cancer cells Hepa1-6.
[0016] More specifically, the sample described in step S3 includes, but is not limited to, at least one of the following: tumor tissue, immune cells in the tumor microenvironment, spleen, small intestine, lung, stomach, esophagus, liver, kidney, colon, muscle, white fat, brown fat, lymph nodes, sex organs, brain, cerebellum, thyroid gland, bone marrow, or thymus.
[0017] Preferably, the immune cells in the tumor microenvironment include, but are not limited to, CD45.2. + Cells, CD11b + Cells, BCR + Cells, NK1.1 + Cells or TCR + cell.
[0018] Preferably, the sexual organs of a male mouse are the testes, epididymis, and prostate, and those of a female mouse are the ovaries, fallopian tubes, and uterus.
[0019] More specifically, in step S4, high sgRNA abundance indicates that after the corresponding gene is knocked out, T cells survive / proliferate more effectively in the tumor microenvironment, making it a target related to tumor immunosuppression; low sgRNA abundance indicates that after the corresponding gene is knocked out, T cells survive / proliferate less effectively in the tumor microenvironment, making it a target related to tumor immune activation.
[0020] The beneficial effects of this invention are as follows: (1) This invention breaks through the throughput bottleneck of traditional in vivo research, and can realize parallel editing and functional screening of multimembrane protein genes in the same animal individual, significantly improving the efficiency of systematic research on membrane protein gene families and reducing experimental costs.
[0021] (2) This invention ensures the stability and screening reliability of the sgRNA library, avoids interference with the genome caused by random integration of the library, ensures efficient editing of the target gene, and improves the accuracy and reproducibility of experimental results.
[0022] (3) This invention enables screening of membrane protein genes in multiple tissues and cell types throughout the body, breaking the tissue limitations of local gene editing technology and providing a comprehensive research platform for analyzing the functional differences of membrane proteins in different physiological and pathological microenvironments.
[0023] (4) This invention effectively connects in vitro screening and in vivo functional verification, and can truly simulate the physiological functions and pathological effects of membrane proteins in vivo, eliminate environmental biases of in vitro models, reduce the proportion of false positive targets, and enhance the clinical translation potential of candidate targets. Attached Figure Description
[0024] Figure 1 This represents the number of NGS reads of sgRNA in a 150mer plasmid.
[0025] Figure 2 The integration site was determined for genome detection; A in the figure indicates the location where the library was inserted into mouse chromosome 8; the library identification primers were used to verify the PCR results.
[0026] Figure 3 This indicates the methylation status of the U6 promoter.
[0027] Figure 4 This refers to the reorganization of the iMAP-T library.
[0028] Figure 5 The image shows the Pollr2 knockout status of the iMAP-T library; the second column in the figure shows the relative abundance of Pollr2-SgRNA, which is significantly lower than the left and right sides, indicating that the knockout of Pollr2 leads to cell death and a decrease in SgRNA abundance.
[0029] Figure 6 The proliferation or deletion phenotypes of 150 sgRNAs after knockout in 31 types of tissues and cells. Detailed Implementation
[0030] The following non-limiting embodiments are intended to enable those skilled in the art to gain a more comprehensive understanding of the present invention, but do not limit the invention in any way. The following content is merely an exemplary description of the scope of protection claimed by the present invention, and those skilled in the art can make various changes and modifications to the present invention based on the disclosed content, and such changes should also fall within the scope of protection claimed by the present invention.
[0031] The present invention will be further described below by way of specific embodiments. Unless otherwise specified, all instruments, devices, equipment, reagents, products, etc., used in the embodiments of the present invention are obtained through conventional commercial means.
[0032] Example 1: Target gene and control sRNA sequences This invention relates to 140 target genes. First, corresponding sgRNA sequences were designed for the exon regions of the 140 target genes, and 10 control sgRNAs were designed to obtain 150 target sgRNA sequences. Forward primers (F-primer) and reverse primers (P-primer) were designed for the 150 target sgRNA sequences and synthesized in the form of forward and reverse primers. The primers were annealed to form short double-stranded sg fragments with sticky ends. The sequences of the target sgRNAs are shown in Table 1.
[0033] Table 1
[0034] Example 2: Construction of plasmids for screening T cell membrane protein genes 1. Construction of 1mer plasmid 1.1 Preparation of 150 sg double-stranded short fragments The following is a detailed annealing procedure: For different target sgRNAs, 15 μL of F / R-primer (all at 10 μM) was thoroughly mixed with 6 μL of 10× buffer (NEBuffer™ r2.1, B6002S) and 24 μL of H2O to obtain a mixture. First, the mixture was kept at 95°C for 5 min, followed by 70 cycles. In each cycle, the temperature was first maintained at 95°C for 35 s, then decreased by 1°C. After 70 cycles, the temperature was lowered to 25°C, yielding the product, which consisted of 150 sg double-stranded short fragments. Finally, the product was stored at 25°C for later use.
[0035] 1.2 Construction method of P19 vector plasmid Based on plasmid pUC19 (Addgene #50005) and an insert fragment synthesized from a biotechnology company (Beijing Qingke Biotechnology Co., Ltd.), two fragments were obtained by PCR and constructed using homologous recombination: (1) Acquisition of partial fragments of the carrier Obtain the primer sequences for the vector portion: F:GCTTTTTTTCAGATGAGACCAGCGGTATCAGCTCACT (SEQ ID NO. 151); R: GAAGTTATCTCCTGAGACCAAAGGGCCTCGTGATACGC (SEQ ID NO. 152); Vector partial sequence (SEQ ID NO.153):
[0036] (2) Obtaining the inserted fragment Obtain the primer sequence for the insertion portion: F: ggtctcaGGAGATAACTTCGTATAGTATAAATTATTGCT (SEQ ID NO. 154); R: ggtctcaTCTGAAAAAAAGCACCGACTC (SEQ ID NO.155); Inserted partial sequence (SEQ ID NO.156): .
[0037] Homologous recombination: The vector portion and the insert portion were mixed at a mass ratio of 1:3, and an equal volume of 2X homologous recombinase mixture (Taiwanese Gold CU201-02) was added. After incubation at 50°C for 30 min, the product was transformed. The transformation method is as follows.
[0038] 1.3 Construction of 1mer plasmid The P19 vector was linearized by cutting it with the restriction endonuclease Esp3I (added at a ratio of 1U of enzyme to 1μg of vector), and a sticky end complementary to the above-mentioned sg double-stranded short fragment was generated to ensure that the two could be specifically ligated. The reaction conditions were 37℃ and 40min to obtain the linearized vector.
[0039] The linearized vector was mixed with 150 sg double-stranded short fragments at a molar ratio of 1:10. T4 ligase was added at a ratio of 0.5 μL per ligation reaction and incubated at 37 °C for 40 min to obtain 150 1-mer plasmids, which were then transformed.
[0040] Operating procedures: (1) Thawing of competent cells: DH5a competent cells (purchased from Tolo Harbour, catalog number CC96102) frozen at -80℃ were taken out and placed on ice to thaw.
[0041] (2) Plasmid attachment: Mix 10 μL of competent cells with 1 μL of ligation product (competent cells: plasmid > 10: 1), gently pipette to mix, and incubate on ice for 10 minutes.
[0042] (3) Heat shock: After incubating competent cells on ice, place them in a water bath (preheat the water bath to 42°C) for 40 seconds and then place them on ice to cool for 2 minutes.
[0043] (4) Shake well: Add 90 μL of antibiotic-free LB culture medium to the cooled bacterial culture and shake in a shaker at 37℃ and 220 rpm for 30 minutes.
[0044] (5) Spread culture: Spread 100 μL of bacterial solution onto the solid culture medium of the antibiotic corresponding to the plasmid. After labeling according to the plasmid name and resistance, invert the plate and place it in a 37℃ incubator for overnight culture.
[0045] 2. Construction of 150mer plasmid 2.1 Construction of 15mer plasmid 2.1.1 Construction method of P18 vector plasmid Based on plasmid pUC57 (Addgene #84006) and primers synthesized from a biotechnology company (Beijing Qingke Biotechnology Co., Ltd.), two fragments were obtained by PCR and constructed using homologous recombination: (1) Acquisition of partial fragments of the carrier Obtain the primer sequences for the vector portion: F: AAACGCGCGATGCAGCTCTGG (SEQ ID NO. 157); R: ACGGTTATCCACAGAATCAGGG (SEQ ID NO. 158); Vector partial sequence (SEQ ID NO.159):
[0046] (2) Obtaining the inserted fragment Obtain the primer sequence for the insertion portion: F (SEQ ID NO.160): GATTCTGTGGATAACCGTCGTCTCAGGAGTGAGACATCGAGATATCCACCG; R (SEQ ID NO.161): GCGCGTTTCGGTGATGACCGTCTCAGTGATGAGACCGGTGGATATCTCGATGG; Inserted partial sequence (SEQ ID NO.162): CGTCTCAGGGAGTGAGACCATCGAGATATCCACCGGTCTCATCACTGAGACG; Homologous recombination: The vector and insert portions were mixed at a mass ratio of 1:5, and an equal volume of 2X homologous recombinase mixture (Taiwanese Gold CU201-02) was added. After incubation at 50°C for 30 min, the product was transformed. The transformation method is as follows.
[0047] 2.1.2 15mer plasmid construction method The 150 correctly sequenced 1-mer plasmids were divided into 10 subsets as shown below. Each subset of 15 1-mer plasmids was ligated using NEB Golden Gate reagents, including BsaI-HF®v2 (NEB / R3733S) and T4 DNA Ligase (NEB / M0202T), following the gene sequence from left to right as per the manufacturer's instructions. The 1-mer plasmids were ligated using plasmid P18 as the vector. The reaction conditions were 37℃ for 5 min, 16℃ for 5 min, 30× cycles, and a final 60℃ for 5 min. After the reaction, transformation was performed. Operating procedures: (1) Thawing of competent cells: DH5a competent cells (purchased from Tolo Harbour, catalog number CC96102) frozen at -80℃ were taken out and placed on ice to thaw.
[0048] (2) Plasmid attachment: Mix 10 μL of competent cells with 1 μL of ligation product (competent cells: plasmid > 10: 1), gently pipette to mix, and incubate on ice for 10 minutes.
[0049] (3) Heat shock: After incubating competent cells on ice, place them in a water bath (preheat the water bath to 42°C) for 40 seconds and then place them on ice to cool for 2 minutes.
[0050] (4) Shake well: Add 90 μL of antibiotic-free LB culture medium to the cooled bacterial culture and shake in a shaker at 37℃ and 220 rpm for 30 minutes.
[0051] (5) Spread culture: Spread 100 μL of bacterial solution onto the solid culture medium of the antibiotic corresponding to the plasmid. After labeling according to the plasmid name and resistance, invert the plate and place it in a 37℃ incubator for overnight culture.
[0052] 15mer-1 (composed of the following 1mer plasmids): Cd81, Polr2, Izumo1r, Klrg1, Ccr7, Il2ra, Ccr4, Ccr8, Cd44, Sell, Cd40, Cd19, Il2rb, Cd28, NC1; 15mer-2 (composed of the following 1mer plasmids): Cxcr6, Klrb1c, Fcgr3, Itga2, S1pr5, Cd160, Itgax, Cd3d, Mki67, Tfrc, Tgfbr3, Il6ra, Runx3, Gpr183, NC2; 15mer-3 (composed of the following 1mer plasmids): Cd36, Lat, Cd274, Fosl1, Ccr6, Ccr5, Klrd1, Nr4a1, Ly6a, Itga4, Plaur, Fasl, Il12rb1, Il1r1, NC3; 15mer-4 (composed of the following 1mer plasmids): Itgav, Kit, Mme, Slamf1, Ccr10, Pecam1, Cd80, Cd84, Cd163l1, Cd74, Ptprcap, Rorc, Fosl2, Trgc2, NC4; 15mer-5 (composed of the following 1mer plasmids): Pdgfra, Klrb1b, Ccr1, Ccr3, Ptgdr2, Il21r, Trbc2, Cd8b1, Cd40lg, Itgae, Cd69, Thy1, Entpd1, Nr3c1, NC5; 15mer-6 (composed of the following 1mer plasmids): Cd101, Prf1, Ncam1, Cd2, Fcgr2b, Cd244a, Vsir, Tnfrsf18, Itm2a, Tmem176a, Klrc1, Cd96, Ly6c1, Il1r2, NC6; 15mer-7 (composed of the following 1mer plasmids): Cd83, Trac, Il23r, Cxcr4, Itgb3, Cd200, Tnfrsf8, Cd1d1, Spn, Ahr, Tnfsf8, Trdc, Il4ra, Pdgfrb, NC7; 15mer-8 (composed of the following 1mer plasmids): Il18r1, Klrc2, Cxcr5, Cxcr3, Cd5, Cd6, Cx3cr1, Cd7, Cd38, Cd3g, Fapp5, Grap2, Ly6c2, Ccr2, NC8; 15mer-9 (composed of the following 1mer plasmids): Tnfsf10, Ifngr1, Cd34, Cd24a, Ncr1, Tnfsf11, Il7r, Ccr9, P2rx7, Trbc1, Klrc3, Tyrobp, Nt5e, Cd247, NC9; 15mer-10 (composed of the following 1mer plasmids): Tgfbr2, Arg1, Tnfrsf9, Vipr1, Cd27, Cr2, Flt3, H2-M2, Fcer1g, Pdcd1, Havcr2, Ctla4, Lag3, Tigit, NC10.
[0053] 2.2 Construction of 150mer plasmid 2.2.1 Construction method of P101 vector plasmid Based on plasmid iMAP-61 (Addgene #187460) and primers synthesized from a biotechnology company (Beijing Qingke Biotechnology Co., Ltd.), two fragments were obtained by PCR and constructed using homologous recombination: (1) Acquisition of partial fragments of the carrier Obtain the primer sequences for the vector portion: F:CGAGCCCGTCGACCGATAAAAGTTTTGTTACTTTATAGAAGA (SEQ ID NO. 163); R: CCTCTAGATGCATTCTCGAGCCGACGGTATCGAAGCTAT (SEQ ID NO. 164); Vector partial sequence (SEQ ID NO.165):
[0054] (2) Obtaining the inserted fragment Obtain the primer sequence for the insertion portion: F:CGAGAATGCATCTAGAGGTCTCATCTGCGACGCCGCCAT (SEQ ID NO. 166); R:TATCGGTCGACGGGCTCGGGTCTCAGGAGCAATCGAGACGGG (SEQ ID NO. 167); Inserted partial sequence (SEQ ID NO.168):
[0055] Homologous recombination: The vector and insert portions were mixed at a 1:1 mass ratio, and an equal volume of 2X homologous recombinase mixture (Taiwanese Gold CU201-02) was added. After incubation at 50°C for 30 min, the product was transformed. The transformation method is as follows.
[0056] 2.2.2 Method for constructing 150mer plasmid The ten 15mer plasmids (15mer-1 to 15mer-10) and the P101 vector plasmid obtained above were ligated using NEB GoldenGate reagents, including BsaI-HF®v2 (NEB / R3733S) and T4 DNA Ligase (NEB / M0202T), following the manufacturer's instructions, in the order of 15mer-1→15mer-10, to obtain 150mer plasmids. The reaction conditions were 37℃ for 5 min, 16℃ for 5 min, 30× cycles, and a final temperature of 60℃ for 5 min. After the reaction, E. coli HST08 Premium Electro-Cells (Takara / 9128) competent cells were electroporated.
[0057] 3. Plasmid transformation Thaw competent E. coli HST08 Premium Electro-Cells cells. Take 10 μL of competent cells, add 10 ng of 150mer plasmid, and gently pipette to mix thoroughly. Then, incubate the mixture on ice for 30 min. Perform heat shock treatment by preheating the water bath to 42℃ before transformation. For resuscitation, add 160 μL of antibiotic-free liquid LB medium to the cooled bacterial culture. Preheat the shaker to 37℃ and set the rotation speed to 220 rpm. Place the tubes containing the bacterial culture in the shaker and shake for 30-60 min. For spread culture, pipette 80 μL of the resuscitated bacterial culture and transfer it to a pre-prepared solid culture dish containing the appropriate antibiotic. Spread the culture evenly using an autoclaved spreader. After overnight culture, add approximately 5 mL of LB liquid medium containing the appropriate antibiotic to each shaker tube. The selected bacterial clones were inoculated into a shaker tube, labeled with plasmid information, and then cultured in a shaker at 37°C with a rotation speed of 220 rpm.
[0058] 4. Plasmid extraction (1) Collection of bacteria by centrifugation: Transfer 5 mL of overnight culture to a suitable centrifuge tube. Balance the centrifuge tube and centrifuge at 4000 rpm for 5-10 min. After centrifugation, carefully pour the supernatant culture medium into the waste container, and then invert the centrifuge tube onto a clean paper towel to allow the residual culture medium to flow down and be fully absorbed, reducing the amount of residual culture medium in the tube.
[0059] (2) Bacterial resuspension: Plasmid extraction was performed using a plasmid extraction kit (purchased from Yisheng, catalog number 19001ES70). Before the experiment, the RNase provided in the kit was added to Buffer P1, mixed thoroughly, and stored at 4°C. 250 μL of Buffer P1 was added to the centrifuge tube containing the bacterial precipitate. The precipitate was gently pipetted or vortexed to ensure thorough mixing with Buffer P1. The precipitate was completely resuspended until no visible clumps remained. Incomplete resuspension would result in incomplete bacterial lysis, reducing plasmid yield and quality.
[0060] (3) Bacterial lysis: Add 250 μL of Buffer P2 to the resuspended bacterial solution, and gently invert the centrifuge tube to ensure thorough mixing of the bacterial solution and Buffer P2. Avoid vigorous shaking or vortexing, as this can cause bacterial genomic DNA breaks, resulting in genomic fragments being incorporated into the final plasmid product and reducing plasmid purity. After adding Buffer P2, the fully lysed bacterial solution will gradually become viscous and clear. The lysis step needs to be completed as quickly as possible within 5 minutes; otherwise, plasmid damage will occur, reducing the yield. If the solution remains cloudy, the possible causes are too much bacterial solution or too little Buffer P2. Adjust the amount of bacterial solution or Buffer P2 as needed.
[0061] (4) Neutralization reaction: Add 350 μl of Buffer P3 to the lysis buffer, and gently invert the centrifuge tube to fully neutralize Buffer P3 with Buffer P2. A white flocculent precipitate will appear in the completely neutralized solution. Place the centrifuge tube in a centrifuge and centrifuge at 13,000 rpm for 10 min to centrifuge the flocculent precipitate to the bottom of the centrifuge tube.
[0062] (5) Supernatant Transfer: Place the DNA adsorption column provided with the kit into the collection tube, and use a pipette to transfer the supernatant from step 4 into the adsorption column, being careful not to aspirate the precipitate at the bottom. Then, centrifuge at 13,000 rpm for 30-60 s. After centrifugation, discard the liquid in the collection tube and return the adsorption column to the collection tube. The DNA adsorption column should be conditioned before use to activate its adsorption activity.
[0063] (6) Washing: Add 600 μL of washing buffer W to the DNA adsorption column, centrifuge at 13,000 rpm for 30s, discard the liquid in the collection tube after centrifugation, and then put the adsorption column back into the collection tube.
[0064] (7) Repeat washing: Follow the operation procedure in step 6 to wash the adsorption column again to ensure that the adsorption column is thoroughly cleaned.
[0065] (8) Drying: Put the adsorption column back into the collection tube and centrifuge at 13,000 rpm for 1 min to completely remove any residual washing solution in the adsorption column.
[0066] (9) DNA elution: Transfer the DNA adsorption column to a sterile 1.5 mL centrifuge tube, add 50 μL of Elution Buffer to the center of the adsorption membrane, cap and let stand at room temperature for 2 min to ensure that the Elution Buffer fully wets the adsorption membrane and that the plasmid is fully dissolved in the Elution Buffer. Then centrifuge at 13,000 rpm for 1 min to elute and collect the DNA.
[0067] (10) Storage: Discard the adsorption column. The eluted plasmid solution is the in vivo metabolic gene screening library plasmid (referred to as the 150mer library plasmid). Store it at -20℃ to prevent plasmid DNA degradation. The full length of the 150mer library plasmid is 29 kb. Select the Plasmid-EZ whole plasmid sequencing service offered by Wiz Labs. The full length of the sequence is shown in SEQ ID NO. 169:
[0068] Example 3: Construction and Genotyping of Library Mice 1. Construction of the mouse library CAG-Cas9: This is a CRISPR-Cas9 transgenic mouse strain that can broadly express Cas9 under the regulation of the CAG promoter. This strain was purchased from Jackson Laboratory (strain number: 028555) and is housed at the experimental animal platform of the Institute of Big Health, Hefei Comprehensive National Science Center.
[0069] Ubc-Cre ERT2 Mouse strain: Ubc-Cre ERT2 The mouse strain is a transgenic mouse model in which Cre recombinase is driven by the ubiquitin C (Ubc) promoter. The Cre recombinase is fused to a modified estrogen receptor ligand-binding domain 2 (ERT2), and upon activation by tamoxifen, it can broadly activate Cre recombinase activity. This strain was purchased from the Southern Model Animal Center and housed at the experimental animal platform of the Institute of Big Health, Hefei Comprehensive National Science Center.
[0070] Ubc-Cre ERT2 &CAG-Cas9 Dual-Yang Tool Mouse Series: Composed of the CAG-Cas9 series and Ubc-Cre ERT2 The strain was bred and raised at the experimental animal platform of the Big Health Research Institute of the Hefei Comprehensive National Science Center.
[0071] The constructed 150mer library plasmid was delivered to Southern Model Biotechnology Co., Ltd. (hereinafter referred to as Southern Model Biotechnology) for microinjection of fertilized eggs into C57 mice. Each mouse received 2 plc of plasmid, and the resulting mice were designated as F0 generation library mice. After the F0 generation library mice were constructed, the primary task was to verify the integrity of the library. This verification aimed to ensure that the 150mer library was successfully and completely integrated into the mouse genome, laying the foundation for the reliability of subsequent experiments. The test results are as follows: Figure 1 As shown, the mouse carried a complete 150-mer sgRNA sequence. NGS sequencing analysis of the sgRNA abundance in the 150-mer plasmid revealed uniform sequencing reads for all 150 sgRNAs, indicating that the library contained complete and undeleted sgRNAs. 1.1 Determination of mating and integration sites: Using F0 generation mice that were identified as positive and Ubc-Cre ERT2&CAG-Cas9 double-positive tool mice were bred to obtain F1 generation mice. These mice carried three genetic elements simultaneously: the target gene site edited by the 150mer plasmid, the Cas9 expression gene, and the UBC-Cre-ERT2 gene; these were called "triple-positive mice" or iMAP-T mice. Next, the integration site was determined through genome sequencing. The results are as follows: Figure 2 As shown, the library was inserted into the space between chromosomes 62516580 and 62516601 on mouse chromosome 8. The PCR verification band size of the library identification primers was 100 bp, confirming the library's existence. The homozygous integration site identification primers were designed flanking the library insertion site, and the PCR verification band size was 367 bp. The presence of a band indicated heterozygous integration, while the absence of a band indicated homozygous integration.
[0072] 1.2 Verification of F1 generation and subsequent generations: (1) Single-copy verification: Although information on each integration site has been obtained in the F1 generation, the possibility of contamination by other integration sites cannot be completely ruled out. To ensure that the experimental mice are single-copy, the F1 generation mice are used for further passage and verification is performed according to Mendelian laws of inheritance. If, in the F2 generation, all mice with the genotype 150mer positive show positivity for a certain site, then it can be basically determined that the mice at that site are single-copy integration sites. However, to avoid misjudgment, the site will be further verified through passage.
[0073] (2) Investigation of unknown integration sites: If a certain site is found to be negative in F2 generation genotyping but positive in 150mer mouse library genotyping, it indicates that there may be a second unknown integration site. At this time, further integration site identification is needed to clarify the specific site information.
[0074] 1.3 Methylation detection: After identifying all integration sites, the methylation status of the U6 promoter in each mouse needs to be tested. Based on previous experience with iMAP libraries, mice with methylated U6 promoters exhibit extremely low transcriptional activity, rendering them almost ineffective for iMAP technology. Therefore, this testing step is crucial to ensuring the validity of the IMAP150 mouse model. Typically, preliminary methylation testing is performed at the F0 generation. Analysis of U6 promoter transcriptional activity revealed that while most integration sites can be effectively cleaved in various tissues and organs by Cas9, certain specific sites show extremely high expression levels in specific tissues, resulting in significantly enhanced cleavage efficiency. The results are as follows: Figure 3 As shown, T in the U6 promoter core region indicates no methylation, and C indicates methylation. The results show no methylation (T) in the U6 promoter core region, indicating that the promoter can drive sgRNA expression normally.
[0075] 2. Genotyping of library mice The iMAP-T mouse genome was rapidly identified using PCR. Primers were prepared according to the groups in Table 3, the PCR reaction system was prepared according to the groups in Table 4, and the PCR reaction was performed according to the reaction conditions in Table 5.
[0076] Table 3
[0077] Table 4
[0078] Table 5
[0079] 3. Drug administration to library mice When iMAP-T mice reached a weight of 6g or more (approximately 14 days after birth), tamoxifen was administered via gavage. The specific administration regimen was as follows: gavage was performed on days 1, 3, and 5 after the above conditions were met, with each dose of tamoxifen calculated at 4 μL / g (drug concentration of 20 mg / mL).
[0080] Because tamoxifen is toxic to mice, their weight must be closely monitored throughout the administration period. If a mouse's weight decreases by more than 0.5 g, administration should be stopped immediately, and the mouse's weight trend should be continuously monitored. Once the mouse's weight resumes its normal increase, the remaining dose of tamoxifen should be administered according to the original regimen to ensure the accuracy and effectiveness of the experimental treatment.
[0081] 4. Construction of MC38 tumor transplantation model A subcutaneous xenograft model of MC38 was established. Flow cytometry sorting of immune cells was performed on tumor tissue, bone marrow, and spleen. Genomic DNA was extracted from other tissues and organs, and the abundance of sgRNA in immune cells and other tissues and organs was analyzed by NGS library construction and sequencing. The specific steps are as follows: 4.1 MC38 cell culture (1) Passaged or revived MC38 cells were inoculated in DMEM medium supplemented with 10% FBS and 1% penicillin-streptomycin, and then cultured in an incubator at 37°C and 5% carbon dioxide. The growth status of the cells was observed regularly every day.
[0082] (2) Cell passage: Cell passage should be performed when the cells reach a confluence of 75%-95%. Carefully aspirate the old culture medium into the waste container using a pipette, and wash the cells twice with preheated PBS (37°C). Add preheated trypsin digestion solution to the culture dish, ensuring that the trypsin solution evenly covers the cell layer. Place the culture dish in a 37°C incubator to digest the cells for approximately 1 minute. After 1 minute, observe under a microscope. If most cells are round and some cells begin to detach from the bottom of the culture dish, the digestion is complete. Add serum-containing culture medium to the culture dish to stop the trypsin digestion. Then, use a pipette to gently agitate the culture dish to allow all cells to detach from the bottom. Transfer the cell suspension to a 15 mL centrifuge tube and centrifuge at 1200 rpm for 3 minutes.
[0083] (3) After centrifugation, carefully aspirate the supernatant culture medium into the waste liquid bucket, add an appropriate amount of 1×PBS to the remaining cell pellet for resuspending treatment, and use the resuspended MC38 cell suspension for subsequent experiments.
[0084] 4.2 Construction of the mouse MC38 subcutaneous tumor model (1) Seven-week-old iMAP-T mice that had completed tamoxifen administration were selected. First, the hair on the upper right forelimb of the mouse was carefully removed using a shaver. During the operation, the skin of the mouse should be protected as much as possible to ensure the smooth progress of subsequent injection operations and reduce the risk of infection.
[0085] (2) Prepare a 1 ml syringe and draw 100 μL of MC38 cell suspension (cell concentration of 1×10⁻⁶). 7 / ml). After properly securing the mouse, gently and slowly inject the cell suspension subcutaneously into the shaved area of the mouse. During the injection, pay special attention to the injection site to ensure that the cell suspension is injected only into the subcutaneous tissue and prevent accidental injection into the muscle, which could affect the normal growth of the tumor or lead to other unpredictable results.
[0086] (3) After the injection is completed, the growth of the mouse tumor should be monitored regularly. The size of the tumor should be recorded in detail, and precise measurement can be made using tools such as vernier calipers. At the same time, the health status of the mouse should be closely monitored, including its mental state, diet, and activity level.
[0087] (4) When the tumor diameter reaches 1.5 cm, the mice are euthanized by dislocation in accordance with the experimental procedure in order to carry out subsequent related experiments.
[0088] 5. Flow cytometry detection and sorting To collect immune cells for subsequent NGS sequencing, flow cytometry is required to sort immune cells from tumor tissue, bone marrow, and spleen. The specific procedure is as follows: 5.1 Detection of tumor tissue (1) After the mice were euthanized by cervical dislocation, tumor blocks were carefully cut from the edge of the tumor tissue on their backs. Then, the connective tissue attached to the tumor blocks was carefully removed to reduce interference from non-tumor cells. Afterward, the processed tumor blocks were washed once in 1×DPBS to remove surface impurities and bloodstains.
[0089] (2) Prepare 5 mL of 1× digestive enzyme solution. Specifically, add 50 μL of Collagenase D (100 mg / mL), 50 μL of Hyaluronidase (10 mg / mL), and 50 μL of Dnase I (5 mg / mL) to 5 mL of RPMI-1640 medium and mix thoroughly.
[0090] (3) Take 1 mL of the prepared 1× digestive enzyme and place it in an EP tube. Put the previously cleaned tumor block into the digestive enzyme in the EP tube and cut the tumor block into small pieces with scissors. After cutting, transfer it to a container containing 5 mL of 1× digestive enzyme and add an appropriate amount of sterile steel beads. Place the container on a 37°C rotary digester and perform digestion for 30 min to fully disperse the tumor tissue into single cells.
[0091] (4) At the same time, antibody preparation can begin. Generally, it is done at a rate of 10... 6 The solution was prepared by adding 0.5 μL of antibody to 100 μL of solution for each cell.
[0092] (5) Take a 50 mL centrifuge tube and rinse it once with 1×PBS buffer containing 2% FBS (hereinafter referred to as buffer). This is to prevent cells from adhering to the centrifuge tube wall. Filter the digested cell suspension through a 70 μm filter to remove undigested tissue clumps. If there are undigested cells, they can be ground with a grinding stick while adding buffer to promote cell dispersion.
[0093] (6) Adjust the volume of the filtered and ground cell suspension to 50 mL with 1×DPBS, then centrifuge at 300×g for 10 min. After centrifugation, carefully remove the supernatant.
[0094] (7) Add an appropriate amount of buffer (about 5 mL) to the centrifuged cell pellet and gently pipette to resuspend the cells. Filter the resuspended cells again through a 70 μm filter to remove any remaining cell clumps. Then, add 1×DPBS to bring the cell suspension to 50 mL, centrifuge at 300×g for 10 min, and then discard the supernatant into a waste container.
[0095] (8) Resuspend the cells in an appropriate volume of buffer solution according to the needs of subsequent experiments. Add the previously prepared antibody mixture to the cell suspension, gently shake or gently pipette a few times to mix it thoroughly, place it on ice and incubate in a dark environment for 15-30 min to allow the antibody to fully bind to the antigen.
[0096] (9) Add 1 mL of 1×PBS to the cell suspension after incubation, then centrifuge at 300×g for 10 min and remove the supernatant. Finally, resuspend the cells in 400 μL of buffer, aspirate the cell suspension into a pre-wetted flow cytometry tube, and wait for the instrument to be used for detection.
[0097] The staining schemes for sorting immune cells in tumor tissue are shown in Table 6 below: Table 6
[0098] 5.2 Extraction of genomes from various tissues and organs throughout the body (1) Anatomy of tissues and organs: iMAP-T mice, euthanized by cervical dislocation, were placed on a dissection table. Using surgical instruments, the mice's internal organs and tissues were meticulously dissected. Strict aseptic techniques were followed throughout the dissection process to ensure the obtained tissues remained uncontaminated. For each organ and tissue, a small piece, approximately the size of a grain of rice, was removed using a sharp scalpel. The removed organs and tissues covered a wide range, including the spleen, small intestine, lungs, stomach, esophagus, liver, kidneys, colon, muscles, white fat, brown fat, lymph nodes, sex organs (testes, epididymis, and prostate in male mice; ovaries, fallopian tubes, and uterus in female mice), brain, cerebellum, thyroid gland, bone marrow, and thymus.
[0099] The separated tissue blocks were quickly placed in a preheated metal bath at 90°C to inactivate endogenous nucleases. This step is crucial as it effectively prevents DNA degradation by nucleases, ensuring the integrity of the DNA in subsequent experiments.
[0100] (2) Tissue digestion and lysis: Carefully transfer the heat-treated tissue blocks into the corresponding wells of a 96-well deep-well plate. Accurately add 500 μL of rat tail lysis buffer and 50 μL of proteinase K using a pipette. After addition, thoroughly mix the tissue blocks, lysis buffer, and proteinase K by gentle agitation or repeated pipetting. Place the 96-well plate on a 55°C rotary digester overnight. Ideally, a fully digested solution should be clear, viscous, and homogeneous, without any noticeable lumps. This indicates that the tissue has been adequately digested and intracellular DNA has been effectively released.
[0101] (3) Extraction of genomic DNA from tissues: ① DNA Adsorption with Magnetic Beads: Accurately pipette 300 µL of digestion solution from a 96-well deep-plate into a 1.5 ml EP tube. Next, add 400 µL of DNA extraction magnetic beads (hereinafter referred to as magnetic beads). Within 5 minutes of adding the magnetic beads, gently pipette twice to ensure the DNA binds sufficiently to the beads. Then, place the EP tube stably on a magnetic rack and let it stand for a few moments until the DNA has completely adhered to the magnetic beads. Carefully discard the supernatant.
[0102] ② Magnetic bead cleaning: Remove the EP tube from the magnetic rack and add 500 μL of 80% ethanol solution. Gently pipette to suspend the magnetic beads in the ethanol solution, cleaning any impurities adhering to their surface. Then, place the EP tube back on the magnetic rack. Once the beads have adhered to the tube wall, discard the supernatant. Repeat this cleaning step once to ensure the beads are thoroughly cleaned.
[0103] ③ Magnetic bead drying and DNA elution: After cleaning, place the EP tubes at room temperature to air dry for about 5 minutes, until the surface of the magnetic beads is completely dry. After the magnetic beads are dry, add 80 μL of DEPC water to the tubes and let stand for 2 minutes to allow the magnetic beads to be fully suspended in the water, promoting the elution of DNA from the magnetic beads. Then, place the EP tubes back on the magnetic rack, and after the magnetic beads adhere to the tube wall, carefully aspirate the supernatant and transfer it to a new eight-tube set.
[0104] ④ DNA quality testing: The OD value of the DNA solution transferred to the eight-tube strip was measured using a spectrophotometer. The purity of the DNA was assessed by the ratios of OD260 / OD280 and OD260 / OD230. Simultaneously, the integrity of the DNA was detected by 1% agarose gel electrophoresis. The clarity and size of the electrophoretic bands indicated whether DNA degradation or breakage had occurred.
[0105] 6. NGS Database Construction and Analysis To analyze the abundance of sgRNA at the P0 region after recombination, NGS library construction was performed using PCR. Three rounds of PCR reactions were conducted using extracted genomic DNA as a template. NGS analysis was performed according to the company's standard analytical procedures.
[0106] First-round PCR reaction: A reaction system with a total volume of 80 μL was prepared using 2×Rapid Taq Master Mix (Novizan). To ensure good library complexity and integrity, 1000 ng of DNA template was added to the system.
[0107] Second round PCR reaction: Accurately aspirate 1 μL from the product of the first round PCR, add 2×Rapid Taq MasterMix, and prepare a reaction system with a total volume of 20 μL for amplification.
[0108] Final round of PCR reaction: Take 1 μL of the product from the second round of PCR, add 2×Rapid Taq Master Mix, and prepare a 20 μL reaction system for further amplification.
[0109] Tables 7-9 contain primer information for each round of PCR reactions: Table 7
[0110] Table 8
[0111] Table 9
[0112] The library recombination efficiency was verified after induction. Results showed that recombination occurred after oral administration of tamoxifen, with the abundance difference of 150 sgRNAs being <6-fold, meeting the screening requirements. (See...) Figure 4 Simultaneously, the abundance of the housekeeping gene Porr2a sgRNA was detected, and a significant decrease was found (see...). Figure 5 This indicates that cell death occurred after the Pollr2a gene knockout, proving that the library could be screened normally. NGS analysis was performed according to the company's standard analytical procedures, analyzing sgRNA abundance and obtaining the proliferation or deletion phenotypes of 150 sgRNAs after knockout in 26 tissue cell types (see...). Figure 6The results showed that the Pollr2a gene exhibited a decrease across all tissue types, with a more pronounced decrease in tissues or cells with more frequent proliferation and renewal. Among the tissue type clusters, the most unique case was the perturbation data from the thymus. The abundance of each sgRNA in its library showed no similarity to other tissues, and the abundance curves did not conform to the rules of library recombination. This is hypothesized to be because T cells dominate the cell count in the thymus, and clonal selection of T cells occurs within the thymus. This leads to the separation of cell proliferation and apoptosis states from library perturbation; the cloned T cells proliferate, resulting in a significant increase in their sgRNA abundance. Conversely, the abundance of unselected T cells decreases, or even disappears. Therefore, the thymus data was excluded from the valid data. Most tissues and organs throughout the body, due to the less pronounced library perturbation, were classified into a second major category. The sgRNA abundance changes in this part of the tissues exhibited single-point gene characteristics. The most prominent example was thyroid tissue, where the sgRNA abundance of four genes in its library showed a relatively significant increase. The most obvious characteristic of the third type is that the perturbation of the library genes is mainly concentrated in the lymph nodes, an immune-related organ, which is also related to the library being designed as a marker library on the surface of immune cells.
[0113] Finally, it should be noted that the above content is only used to illustrate the technical solution of the present invention, and is not intended to limit the scope of protection of the present invention. Simple modifications or equivalent substitutions made by those skilled in the art to the technical solution of the present invention do not depart from the essence and scope of the technical solution of the present invention.
Claims
1. A method for constructing a transgenic mouse for in vivo screening of T cell membrane protein genes, characterized in that, The construction method includes injecting a 150mer library plasmid into an embryo to obtain an F0 generation library mouse, and then combining the F0 generation library mice with Ubc-Cre... ERT2 The transgenic mice were obtained by mating with CAG-Cas9 double-positive tool mice; the 150mer library plasmids included the sgRNA sequences shown in SEQ ID NO.1-150.
2. The construction method according to claim 1, characterized in that, The sgRNA sequences described include 140 target gene sgRNA sequences and 10 control sgRNA sequences; The 140 target gene sgRNA sequences are shown in SEQ ID NO.1-14, SEQ ID NO.16-29, SEQ ID NO.31-44, SEQ ID NO.46-59, SEQ ID NO.61-74, SEQ ID NO.76-89, SEQ ID NO.91-104, SEQ ID NO.106-119, SEQ ID NO.121-134 and SEQ ID NO.136-149. The 10 control sgRNA sequences are shown in SEQ NO.15, SEQ ID NO.30, SEQ ID NO.45, SEQ ID NO.60, SEQ ID NO.75, SEQ ID NO.90, SEQ ID NO.105, SEQ ID NO.120, SEQ ID NO.135 and SEQ ID NO.
150.
3. The construction method according to claim 1, characterized in that, The method for preparing the 150mer library plasmid includes the following steps: S1. Assemble the sequences shown in SEQ ID NO. 1-15 into a 15mer-1 plasmid; assemble the sequences shown in SEQ ID NO. 16-30 into a 15mer-2 plasmid; assemble the sequences shown in SEQ ID NO. 31-45 into a 15mer-3 plasmid; assemble the sequences shown in SEQ ID NO. 46-60 into a 15mer-4 plasmid; assemble the sequences shown in SEQ ID NO. 61-75 into a 15mer-5 plasmid; assemble the sequences shown in SEQ ID NO. 76-90 into a 15mer-6 plasmid; assemble the sequences shown in SEQ ID NO. 91-105 into a 15mer-7 plasmid; assemble the sequences shown in SEQ ID NO. 106-120 into a 15mer-8 plasmid; assemble the sequences shown in SEQ ID NO. 121-135 into a 15mer-9 plasmid; assemble the sequences shown in SEQ ID NO. 136-150 into a 15mer-10 plasmid. S2. Assemble 15mer-1 to 15mer-10 plasmids with the vector to obtain 150mer library plasmids.
4. The construction method according to claim 1, characterized in that, The injection volume of the 150mer library plasmid is 1-2 pL; the 150mer library plasmid is integrated into the mouse chromosome 8 between positions 62516580 and 62516601 via microinjection.
5. The construction method according to claim 1, characterized in that, The transgenic mice mentioned above are those that simultaneously carry Ubc-Cre ERT2 Positive mice for three target elements: the Cas9 gene and 150mer sgRNA.
6. The use of the construction method according to any one of claims 1-5 or the transgenic mouse obtained by the construction method according to any one of claims 1-5 for screening T cell membrane protein genes in vivo.
7. The application according to claim 6, characterized in that, The application includes the following steps: (1) Inducing transgenic mice to express sgRNA in target cells; (2) Inoculation of tumor cells to construct an in vivo screening environment; (3) Collect samples after the screening period ends; (4) Extract genomic DNA from the sample and construct an NGS library; (5) Sequencing analysis of the relative abundance of each sgRNA, and screening based on the relative abundance of each sgRNA.
8. The application according to claim 7, characterized in that, The tumor cells mentioned in step (2) include any one or more of the following: mouse colon cancer cells MC38, mouse melanoma cells B16-F10, mouse lung cancer cells LLC, mouse pancreatic cancer cells KPC / Panc02, mouse liver cancer cells Hepa1-6, and mouse breast cancer cells 4T1.
9. The application according to claim 7, characterized in that, The samples mentioned in step (2) include any one or more of the following: tumor tissue, bone marrow, spleen, lymph nodes, peripheral blood, lungs, liver, kidneys, brain, heart, and intestinal tissue.
10. The application according to claim 7, characterized in that, The high relative abundance of sgRNA mentioned in step (5) indicates that after the tissue surface receptor gene targeted by the sgRNA is knocked out, the corresponding cells have a stronger survival advantage or proliferation ability in the tumor microenvironment or in vivo screening system. The loss of function of the receptor gene will not inhibit cell survival, and may even promote cell adaptation to the screening environment. The low relative abundance of sgRNA indicates that knocking out the tissue surface receptor gene targeted by this sgRNA significantly inhibits the survival or proliferation of the corresponding cells in the in vivo screening system. This receptor gene is a key gene for maintaining the survival, proliferation or function of cells in the screening environment.