DsRNA capable of simultaneously targeting three key genes of botrytis cinerea and application of dsRNA

Abstract

The invention provides dsRNA capable of simultaneously targeting three key genes of botrytis cinerea and application of the dsRNA, and belongs to the technical field of crop disease prevention and control genes. The dsRNA can be used for simultaneously interfering the expression of three key genes, namely BcRpd3, BcNat1 and BcArd1, of botrytis cinerea. The dsRNA which interferes with the three genes at the same time can effectively prevent and control tomato gray mold and medicago sativa gray mold. The dsRNA provided by the invention can reduce the expression levels of three target genes at the same time, has a better prevention and treatment effect on gray mold compared with dsRNA only interfering any one of the three genes, can be used for effectively preventing and treating tomato gray mold and alfalfa gray mold, has a good market application prospect, and is worthy of popularization and application. Meanwhile, a theoretical basis is provided for multi-target dsRNA design and application of an RNAi technology to prevention and treatment of gray mold.

Description

Technical Field

[0001] This invention belongs to the field of gene technology for disease control, specifically involving a dsRNA that simultaneously targets three key genes of Botrytis cinerea and its application. Background Technology

[0002] Gray mold is caused by the fungus Botrytis cinerea (Gray mold) Botrytis cinerea Gray mold is a common fungal disease that infects plants, with a wide host range, infecting various agricultural crops and causing serious economic losses. This disease not only causes losses in the field but also harms crops during post-harvest storage and transportation. Currently, chemical control is still the primary method for controlling gray mold. However, due to the wide host range, short life cycle, and high genetic mutation rate of gray mold, it has developed resistance to almost all currently used chemical fungicides, greatly reducing the effectiveness of chemical fungicides and making gray mold control extremely difficult. Furthermore, the use of highly toxic, high-dose traditional chemical pesticides has caused serious environmental pollution and ecological imbalance, and pesticide residues affect food safety and threaten human health. Therefore, it is urgent to develop new and effective green control measures for gray mold to ensure and achieve safe, green, and sustainable agricultural production.

[0003] RNA interference (RNAi) is a cutting-edge gene regulation technology that silences the expression of target genes using double-stranded RNA (dsRNA), showing potential applications in medicine and plant protection. RNA pesticides developed using RNAi technology are a novel type of biological pesticide. Using dsRNA that specifically targets key genes in harmful organisms as their active ingredient, they possess advantages such as strong targeting, excellent efficacy, high environmental and ecological safety, and low likelihood of developing resistance, and are considered the "third revolution" in pesticide development history. RNA pesticides are highly promising new plant protection products that adapt to the future direction of agricultural development. Promoting the creation and development of RNA pesticides is of great significance to the development of green and ecological agriculture in China. Screening key genes in harmful organisms as target genes for RNAi and designing dsRNAs with good interference effects are among the key factors influencing the success of RNA pesticide development.

[0004] Protein acetylation is a ubiquitous, reversible, and highly regulated post-translational modification of proteins, participating in almost all life processes, including growth, development, and pathogenicity. Acetylation is catalyzed by acetyltransferases, while deacetylases remove acetyl groups from lysine residues. These two types of enzymes coexist and synergistically regulate the acetylation level of proteins in organisms. It has been reported that the deacetylase BcRpd3 is a key gene in *Botrytis cinerea*, participating in the regulation of its growth, development, and pathogenicity through enzymatic activity; its absence leads to abnormal growth. Acyl-CoA N-acyltransferases Ard1 and Nat1 play crucial regulatory roles in the growth and development of plant pathogenic fungi and can serve as potential target genes for fungal disease control. Summary of the Invention

[0005] To address the technical problem of insufficient key target genes for Botrytis cinerea in the current development of RNA pesticides, the present invention aims to provide a dsRNA that simultaneously targets three key genes of Botrytis cinerea and its application. The dsRNA provided by the present invention can simultaneously reduce the expression levels of the three target genes and is used for the prevention and control of Botrytis cinerea.

[0006] To achieve the above-mentioned objectives, the present invention is implemented through the following solution: This invention provides a dsRNA that simultaneously targets three key genes of Botrytis cinerea, the sequence of which is shown in SEQ ID No. 5, and the three key genes are BcRpd3, BcNat1, and BcArd1.

[0007] The present invention provides a template for the dsRNA, wherein the template for the dsRNA is BcANR, and its sequence is shown in SEQ ID No. 1.

[0008] Furthermore, the BcANR comprises fragment S1, fragment S2, and fragment S3. Fragment S1 is a partial sequence of the BcRpd3 gene, as shown in SEQ ID No. 2; fragment S2 is a partial sequence of the BcNat1 gene, as shown in SEQ ID No. 3; and fragment S3 is a partial sequence of the BcArd1 gene, as shown in SEQ ID No. 4.

[0009] Furthermore, the BcANR is a dsRNA template created by adding a T7 promoter to the concatenated fragments S1, S2, and S3.

[0010] The present invention also provides the application of the dsRNA in the prevention and control of gray mold in plants.

[0011] Furthermore, the application involves preparing the dsRNA to a usable concentration and spraying it onto plant leaves, whereby the dsRNA can effectively inhibit the infection of plants by gray mold.

[0012] Furthermore, the concentration of the dsRNA used is 200-500 mg / L.

[0013] Furthermore, the plants include tomatoes and alfalfa.

[0014] Furthermore, the dsRNA can simultaneously reduce the mRNA levels of three target genes, BcRpd3, BcNat1, and BcArd1, through RNA interference.

[0015] Compared with existing technologies, this invention has the following advantages and beneficial effects: The dsRNA provided by this invention is an artificially designed tandem dsRNA targeting three different key genes of *Botrytis cinerea*. The dsRNA template contains three independent fragments: a partial sequence S1 fragment of the *BcRpd3* gene, a partial sequence S2 fragment of the *BcNat1* gene, and a partial sequence S3 fragment of the *BcArd1* gene. Applying this dsRNA can simultaneously interfere with the expression levels of all three genes. This dsRNA can effectively inhibit *Botrytis cinerea* infection of tomato and alfalfa leaves. Compared with dsRNAs that only interfere with a single gene, it can more effectively control the occurrence of gray mold. The dsRNA provided by this invention can be used for the creation of novel biological pesticides and has excellent application prospects in the control of gray mold. Attached Figure Description

[0016] Figure 1 This is a schematic diagram of the dsRNA design described in this invention, which includes three independent fragments; wherein S1 is a partial sequence of the BcRpd3 gene, S2 is a partial sequence of the BcNat1 gene, and S3 is a partial sequence of the BcArd1 gene.

[0017] Figure 2 This is the electrophoresis result of dsRNA.

[0018] Figure 3 The study investigated the inhibitory effects of different dsRNAs on botrytis cinerea infection of tomato leaves; BcANR-dsRNA represents dsRNA synthesized using BcANR as a template, which is a partial fragment of three genes (BcRpd3, BcNat1, and BcArd1) tandemly linked. GFP-dsRNA served as the control.

[0019] Figure 4This study investigated the inhibitory effects of different dsRNAs on *Botrytis cinerea* infection of alfalfa leaves; BcANR-dsRNA represents dsRNA synthesized using tandem fragments of three genes (BcRpd3, BcNat1, and BcArd1) as templates. GFP-dsRNA served as a control.

[0020] Figure 5 The different dsRNAs inhibited the biomass of tomato or alfalfa leaves infected by Botrytis cinerea.

[0021] Figure 6 This describes the interference effect of different dsRNAs on target genes in Botrytis cinerea infecting tomatoes or alfalfa. Detailed Implementation

[0022] The technical solution of the present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments. Unless otherwise specified, the experimental methods in the following embodiments are conventional methods and will not be described in detail; unconventional experimental operations are detailed below. Unless otherwise specified, the experimental materials, reagents, instruments, etc., used in the following embodiments are all commercially available products. The quantitative statistics in the following embodiments are all based on three repeated experiments, and the average value is taken.

[0023] Example 1: dsRNA Fragment Design and Synthesis Template Preparation 1. Design of dsRNA targeting key genes in Botrytis cinerea and preparation of its synthetic template The coding sequences of three key genes from Botrytis cinerea (BcRpd3, BcNat1, and BcArd1) were obtained from the database. Small interfering RNA (siRNA) prediction was performed using the siDirect version 2.1 server (http: / / sidirect2.rnai.jp / ). The selection criteria were based on the number of siRNAs generated within a continuous sequence of 50-250 bp. Three fragments (BcRpd3-1, BcRpd3-2, BcRpd3-3, BcNat1-1, BcNat1-2, and BcNat1-3) were selected for BcRpd3 and BcNat1, respectively, and two fragments (BcArd1-1 and BcArd1-2) were selected for BcArd1. These fragments were used for dsRNA synthesis and verification of the silencing effect on target genes. Primers for upstream and downstream amplification of single-gene dsRNA templates were designed using different fragments as templates, and the T7 promoter sequence (TAATACGACTCACTATAGGGAGA) was added to the 5' end of the upstream and downstream primers. Total RNA was extracted from Botrytis cinerea, and cDNA was obtained by reverse transcription. Using cDNA as a template, PCR amplification, agarose gel electrophoresis, and gel recovery were performed to obtain the template for dsRNA synthesis. The PCR products were separated by agarose gel electrophoresis, and the obtained PCR products were purified using a DNA purification and recovery kit. The gel-recovered products were used as templates for in vitro transcription of dsRNA and were used immediately or stored at -20°C.

[0024] Different synthesized dsRNA fragments were used to treat *Botrytis cinerea* mycelia. The expression levels of target genes were detected by quantitative real-time PCR, and the silencing efficiency was calculated. The results are shown in Table 1. Fragment BcRpd3-1 showed the highest silencing efficiency for the BcRpd3 gene, fragment BcNat1-3 showed the highest silencing efficiency for the BcNat1 gene, and fragment BcArd1-1 showed the highest silencing efficiency for the BcArd1 gene. BcRpd3-1, BcNat1-3, and BcArd1-1 were selected for subsequent tandem dsRNA design.

[0025] Table 1. Silenting effects of different dsRNA fragments on three target genes.

[0026] 2. Design of dsRNAs targeting three target genes simultaneously and preparation of their synthetic templates To achieve simultaneous interference with three target genes using a single dsRNA, thereby enhancing the therapeutic effect of dsRNA, the fragments with the best interference effects on the three target genes were tandemly linked to form a new DNA fragment, named BcANR, with the sequence shown in SEQ ID No. 1. BcANR contains partial sequences of the three target genes (BcRpd3, BcNat1, and BcArd1) tandemly linked, as illustrated in the diagram below. Figure 1 As shown in the figure. Fragment S1 is the BcRpd3-1 fragment of the BcRpd3 gene, with the sequence shown in SEQ ID No. 2; fragment S2 is the BcNat1-3 fragment of the BcNat1 gene, with the sequence shown in SEQ ID No. 3; fragment S3 is the BcArd1-1 fragment of the BcArd1 gene, with the sequence shown in SEQ ID No. 4.

[0027] The artificially designed template sequence BcANR was synthesized by a biotechnology company (Qingke Biotechnology) and ligated into the cloning vector pUC57. Using a plasmid containing BcANR as a template, the dsRNA synthesis template for BcANR was obtained by amplification using upstream and downstream primers with an added T7 promoter. The primers used are shown in Table 2. Similarly, the dsRNA template for GFP was amplified from a plasmid containing the green fluorescent protein (GFP) encoding gene. The primers used are shown in Table 2. PCR products were separated by agarose gel electrophoresis and purified using a DNA purification kit. The gel-recovered products were used as templates for in vitro transcription of dsRNA and were either used immediately or stored at -20°C.

[0028] Table 2 Primers for dsRNA template amplification

[0029] The nucleotide sequence of BcANR is shown in SEQ ID No. 1: CACACAGTTTGATTATGAATTATGGAGTCTACCAGAAAATGGAGATTTATCGAGCAAAACCAGCAACCCGACACGAAATGACCCAATTTCATACCGATGAATATATTGACTTTCTTCAGAGAGTCACTCCCGACAACATGGATTCTTTCGCTAAGGAACAAGGGAAGTACAACGTTGGAGATGATTGTCCTCTGCCAAATATCAACTTAGAAATGATGAAAACGAAAACGCCTTGAAGACTATGGGTATGTTTACAAGAGCTGAGACTGTGGGTGGGCCGCTAGCAGATCTTCATGATATGCAATGTGTCTGGTTTTTGACAGAGGACGGAGAGTCTTATGCTCGCCAAAACAAAATTGGCCTGGCTCTCAAGAGATTTACGGCAGTTTACAACATTTTTGATGTCTGGTATGAAGATCAGTTTGATTTCCATTCTTTCTTCTTACGTAAGGGTCGGATATTCCGCATGTTCAACATGCCAACATCACCAATCTCCCCGAAAACTATTTCATGAAATATTA。

[0030] The sequence of the S1 fragment is shown in SEQ ID No. 2: CACACAGTTTGATTATGAATTATGGAGTCTACCAGAAAATGGAGATTTATCGAGCAAAACCAGCAACCCGACACGAAATGACCCAATTTCATACCGATGAATATATTGACTTTCTTCAGAGAGTCACTCCCGACAACATGGATTCTTTCGCTAAGGAACAAGGGAAGTACAACGTTGGAGATGATTGTCCT。

[0031] The sequence of the S2 fragment is shown in SEQ ID No. 3: CTGCCAAATATCAACTTAGAAATGATGAAAACGAAAACGCCTTGAAGACTATGGGTATGTTTACAAGAGCTGAGACTGTGGGTGGGCCGCTAGCAGATCTTCATGATATGCAATGTGTCTGGTTTTTGACA GAGGACGGAGAGTCTTATGCTCGCCAAAACAAAATTGGCCTGGCTCTCAAGAGATTTACGGCAGTTTACAACATTTTTGATGTCTGGTATGAAGATCAGTTTGATTTCCATTCTTTCTTCTTACGTAAGG.

[0032] The sequence of fragment S3 is shown in SEQ ID No. 4: GTCGGATATTCCGCATGTTCAACATGCCAACATCACCATCTCCCCGAAAACTATTTCATGAAATATTA.

[0033] Example 2: In vitro synthesis of dsRNA Using the gel recovery product as a template, dsRNAs targeting different genes were synthesized using a dsRNA in vitro synthesis kit (Thermo Scientific, K0441). The in vitro transcription system for dsRNA consisted of: 8 μL NTPMix, 2 μL 10×Transcription Buffer, 2 μL T7 Enzyme Mix, 8 μL template, and ddH2O to a final volume of 20 μL. The mixture was incubated at 37°C for 6 hours or overnight, adjusting the reaction time based on the amount of white flocculent material in the reaction tube. After the reaction, 2 μL of LDNase I was added, and the mixture was incubated at 37°C for 15 minutes. Then, 2 μL of 0.5 M EDTA was added, and the reaction was terminated by incubation at 65°C for 10 minutes. Sodium acetate, water-saturated phenol, and chloroform were added sequentially to the reaction system, and the mixture was vortexed thoroughly and centrifuged at 4°C for 10 minutes. The supernatant was transferred to a new centrifuge tube, and two volumes of anhydrous ethanol were added. The mixture was then incubated at -20°C to precipitate the dsRNA. Centrifuge at 4℃ for 10 min, discard the supernatant, wash the precipitate with ice-cold 75% ethanol, allow the precipitate to air dry, and dissolve it in 40 μL of sterile ddH2O to obtain highly pure dsRNA, which were designated as BcRpd3-dsRNA, BcNat1-dsRNA, BcArd1-dsRNA, BcANR-dsRNA, and GFP-dsRNA, respectively. The concentration of dsRNA was determined by spectrophotometry, and the purity of dsRNA was detected by agarose gel electrophoresis.

[0034] dsRNA agarose gel electrophoresis image as shown Figure 2 As shown in the kit instructions, the T7 promoter begins transcription from the first guanine (G) after the core recognition sequence, resulting in the BcANR-dsRNA sequence obtained through in vitro transcription, as shown in SEQ ID No. 5.

[0035] The BcANR-dsRNA sequence is shown in SEQ ID No. 5: CACACAGUUUGAUUAUGAAUUAUGGAGUCUACCAGAAAAUGGAGAUUUAUCGAGCAAAACCAGCACCCGACACGAAAUGACCCAAUUUCAUACCGAUGAAUAUAUUGACUUUCUUCAGAGAGUCACUCC CGACAACAUGGAUUCUUUCGCUAAGGAACAAGGGAAGUACAACGUUGGAGAUGAUUGUCCUCUGCCAAAUAUCAACUUAGAAAUGAUGAAAACGAAAACGCCUUGAAGACUAUGGGUAUGUUUACAAGAGC UGAGACUGUGGGUGGGCCGCUAGCAGAUCUUCAUGAUAUGCAAUGUGUCUGGUUUUUGACAGAGGACGGAGAGUCUUAUGCUCGCCAAAACAAAAUUGGCCUGGCUCUCAAGAGAUUUACGGCAGUUUAC AACAUUUUGAUGUCUGGUAUGAAGAUCAGUUUGAUUUCCAUUCUUUCUUCUUACGUAAGGGUCGGAUAUUCCGCAUGUUCAACAUGCCAACAUCACCAAUCUCCCCGAAAACUAUUUCAUGAAAUAUUA.

[0036] Example 3: Application of dsRNA in the prevention and control of gray mold Select 4-5 week old tomato seedlings or alfalfa seedlings with uniform growth, place them on moist filter paper, and randomly divide them into 5 groups, with 8-9 leaves in each group. Dilute the above dsRNA with ddH2O to prepare a dsRNA solution with a concentration of 200ug / ml, and spray it evenly onto the leaves using a small spray bottle. Treat one group of leaves with each type of dsRNA. Prepare a suspension of Botrytis cinerea conidia (10... 6After the dsRNA-treated leaf surface solution has air-dried naturally, the above spore suspension is inoculated onto the leaves, with 4-6 μL added to each leaf. Keep moist for 60-96 hours, observe the gray mold infection, measure the diameter of lesions using the cross-sectional method, and statistically analyze the lesion area on the two groups of leaves. The results are as follows: Figure 3 and Figure 4 As shown, leaf lesions treated with BcRpd3-dsRNA, BcNat1-dsRNA, BcArd1-dsRNA, and BcANR-dsRNA were significantly smaller than those treated with GFP-dsRNA. Furthermore, leaf lesions treated with the same concentration of BcANR-dsRNA were significantly smaller than those treated with other single-gene dsRNAs.

[0037] Leaves of the same size containing lesions were collected, and total DNA from the plant and *Botrytis cinerea* was extracted. Using the tomato *Tubulin* gene or the alfalfa *Actin* gene as internal reference genes, the content of the *BcActin* gene in the samples was detected by quantitative real-time PCR to represent the biomass of *Botrytis cinerea* in the leaves. The primers used are shown in Table 3. Results are as follows: Figure 5 As shown, compared with GFP-dsRNA treatment, treatment with dsRNA of other target genes significantly reduced the biomass of gray mold on lesions. The biomass of gray mold in lesions on leaves treated with the same concentration of BcANR-dsRNA was significantly lower than that in lesions on leaves treated with other single gene dsRNA.

[0038] The above results indicate that dsRNA designed with three key genes as targets has a significant control effect on gray mold, and dsRNA designed with three genes in tandem has a better control effect on gray mold than dsRNA with a single gene.

[0039] Table 3 Primers for Botrytis cinerea biomass detection

[0040] Example 4: Inhibitory effect of dsRNA on target gene expression in Botrytis cinerea Total RNA was extracted from *Botrytis cinerea* lesions, and cDNA was obtained by reverse transcription. Using the *Botrytis cinerea* gene *BcActin* as an internal control, the mRNA levels of the target genes were detected by quantitative real-time PCR. GFP-dsRNA treatment was used as a control. The interference effects of *BcRpd3*-dsRNA, *BcNat1*-dsRNA, and *BcArd1*-dsRNA on the three target genes were analyzed, as well as the simultaneous interference effect of *BcANR*-dsRNA on the three target genes. The primers used for quantitative real-time PCR are shown in Table 4. The results are as follows: Figure 6As shown, treatment with single-gene dsRNA significantly reduced the mRNA levels of the corresponding target genes; treatment with BcANR-dsRNA also significantly reduced the mRNA levels of all three target genes. These results indicate that dsRNAs designed to target three key genes can effectively interfere with the expression of these target genes, and dsRNAs designed in tandem with three genes can simultaneously interfere with the expression of all three target genes, exhibiting stronger interference efficiency.

[0041] Table 4 Primers for detecting target gene expression in Botrytis cinerea

[0042] In summary, the dsRNA designed by tandemly connecting three key genes can effectively interfere with the expression of three target genes simultaneously. Furthermore, the control effect of this tandemly designed dsRNA on gray mold is significantly higher than that of dsRNA targeting a single gene. This indicates that designing a single dsRNA in tandem to interfere with multiple target genes simultaneously is an effective measure to improve the control effect of dsRNA.

[0043] The above embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit them. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of the technical features. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions claimed by the present invention.

Claims

1. A dsRNA that simultaneously targets 3 key genes of Botrytis cinerea, characterized in that, The sequence of the dsRNA is shown as SEQ ID No. 5, and the three key genes are BcRpd3 gene, BcNat1 gene and BcArd1 gene.

2. The template of the dsRNA of claim 1, characterized in that, The template of the dsRNA is BcANR, and the sequence is shown as SEQ ID No.

1.

3. The template for a dsRNA of claim 2, wherein, The BcANR comprises fragment S1, fragment S2 and fragment S3, wherein the fragment S1 is a partial sequence of the BcRpd3 gene, and the sequence is shown as SEQ ID No. 2; the fragment S2 is a partial sequence of the BcNat1 gene, and the sequence is shown as SEQ ID No. 3; and the fragment S3 is a partial sequence of the BcArd1 gene, and the sequence is shown as SEQ ID No.

4.

4. The template for a dsRNA according to claim 3, wherein, The BcANR is used as a dsRNA template after adding a T7 promoter after the fragments S1, S2 and S3 are connected in series.

5. The dsRNA of claim 1 is used for preventing and treating plant gray mold.

6. Use according to claim 5, characterized in that, The application is to formulate the dsRNA into a use concentration, and to give a plant leaf spray treatment, so that the dsRNA can effectively inhibit the infection of Botrytis cinerea on the plant.

7. Use according to claim 6, characterized in that, The use concentration of the dsRNA is 200-500 mg / L.

8. Use according to claim 6, characterized in that, The plant includes tomato and alfalfa.

9. Use according to claim 6, characterized in that, The dsRNA can simultaneously reduce the mRNA levels of the three target genes BcRpd3, BcNat1 and BcArd1 by RNA interference.

Images