Leavening agent containing leuconostoc mesenteroides subsp. Mesenteroides and application of leavening agent in fermented dendrobium milk

Abstract

The invention discloses a leavening agent containing leuconostoc mesenteroides subsp. Mesenteroides and application of the leavening agent in fermentation of dendrobium milk, and belongs to the technical field of fermentation engineering. The fermentation agent is prepared from leuconostoc mesenteroides subsp. Mesenteroides JMCC0041, bifidobacterium animalis subsp. Lactis and lactobacillus mucus fermentation according to the viable count ratio of 1: 1: (1-5). When the fermentation agent is used for fermenting dendrobium nobile milk, the content of polysaccharide, alkaloid and small molecule peptide in a fermentation product can be remarkably increased, and the effect of protecting gastric mucosa is achieved by inhibiting the activity of helicobacter pylori and relieving inflammatory reaction. The fermentation process is simple, convenient and rapid, does not need segmented fermentation, and is suitable for preparing functional products through fermentation.

Description

Technical Field

[0001] This invention belongs to the field of fermentation engineering technology, specifically to a fermentation agent containing Leuconostoc mesenteroides subsp. mesenteroides and its application in fermented Dendrobium officinale milk. Background Technology

[0002] The gastric mucosa is a crucial barrier protecting the stomach from external stimuli, preventing damage to the stomach wall from gastric acid, pepsin, and Helicobacter pylori, and maintaining a stable gastric microenvironment. Currently, non-pharmaceutical, natural gastric mucosa protection products on the market include Hericium erinaceus (monkey head mushroom) products and Dendrobium officinale (Dendrobium) products. Dendrobium officinale, as a traditional Chinese medicine, has various effects such as benefiting the stomach and promoting the production of body fluids; its active ingredients mainly include polysaccharides and alkaloids. However, the dense cell wall structure of Dendrobium officinale leads to low bioavailability, making it difficult to fully realize its efficacy.

[0003] While existing technologies have attempted to promote the dissolution and transformation of Dendrobium components through microbial fermentation, significant limitations remain. On the one hand, traditional fermentation processes often employ single strains or simple combinations, resulting in limited metabolic pathways and insufficient efficiency in the synergistic degradation and transformation of the complex matrix of Dendrobium, making it difficult to simultaneously and efficiently enhance key active ingredients such as polysaccharides, alkaloids, and small molecule peptides. On the other hand, existing Dendrobium fermentation processes are mostly segmented, with complex processes, long cycles, and cumbersome control of temperature and inoculation conditions at each stage, making them prone to contamination by other microorganisms, leading to poor product stability and low reproducibility.

[0004] Furthermore, when existing fermentation agents are applied to Dendrobium-dairy product composite systems, the mismatch between strain compatibility and fermentation conditions often hinders the efficient synergistic fermentation of the composite matrix. This not only affects the generation and retention of active ingredients but also limits its development and application in functional foods. In particular, existing fermentation products generally suffer from insufficient content of active ingredients in areas such as Helicobacter pylori inhibition and inflammatory response relief, failing to meet specific health needs. Summary of the Invention

[0005] The purpose of this invention is to provide a fermentation agent containing *Leuconostoc mesenteroides* subsp. *mesenteroides* and its application in fermented Dendrobium officinale milk. Through the synergistic effect of a fermentation agent containing a specific strain, Dendrobium officinale and milk are fermented. Utilizing the characteristics of the fermenting strain itself producing extracellular polysaccharides and being able to fully ferment the substrate, the content of polysaccharides, alkaloids, and small peptides in the fermentation product is increased. This achieves the purpose of protecting the gastric mucosa by inhibiting Helicobacter pylori activity and reducing inflammatory responses.

[0006] To achieve the above objectives, the technical solution adopted by the present invention is as follows: A starter culture containing *Leuconostoc mesenteroides* subsp. *enteroides* is prepared from the following strains in a live bacteria ratio of 1:1:1~5: *Leuconostoc mesenteroides* subsp. *enteroides* JMCC0041, *Bifidobacterium animalis* subsp. *lactobacter* (…Bifidobacterium animalissubsp. lactis ) and fermenting lactobacillus ( Limosilactobacillusfermentum ); The fermentation temperature of the fermenting agent is 30~35℃.

[0007] Among them, Bifidobacterium animalis subsp. lactis ( Bifidobacterium animalis subsp. lactis The preferred strain is *Bifidobacterium animalis* subsp. *lactamase* i797, with accession number CGMCC NO.18403 from the China General Microbiological Culture Collection Center, and is published in Chinese invention patent application CN111543640A; *Lactobacillus fermentum* (… Limosilactobacillusfermentum The preferred strain is *Lactobacillus fermentum* CGMCC No. 1.1882 or other commercially available *Lactobacillus fermentum*. The 16S rDNA sequence of *Leuconostoc mesenteroides* subspecies *JMCC0041* is shown in SEQ ID NO. 1. This strain is deposited at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, on April 18, 2025, with accession number CGMCC NO. 34266. Its Latin name is... Leucono stocmesenteroides subsp. mesenteroides .

[0008] SEQ ID NO.1 is as follows: Its Phes gene sequence is shown in SEQ ID NO.2, and is as follows: AATAAGTAAGCAATCGTTGTAATTAAATATAGAATAGCGCCCCATCGAACAATCTTTTTCCGTCCGATTAGTTCTAACTCTTTTCCAACTATTAGCCGAGCTATTAACGTTCCTATGATATAAATCCCAGAGGCCAATCCCGCTTGCCCAAACGAAGCATGTAGTTGATTGTGTGCAACAACTGC AATTATAACCATCATCAGATAATACACTAAGTACACGATAAAGTTAATAATAGTAATTGTTAAAAAGCCTTTATTAAATAATTTTTCTTCCATTTTCCCAATCTCAAATTCTATTTAGCAACTCTAACAATAGCAAAGTAGCTATGTAGGTGCAAACTTGAAATCAGATTTTAAAACATGCATGT.

[0009] The present invention also provides the application of the above-mentioned fermentation agent containing Leuconostoc mesenteroides subsp. mesenteroides, which is used to ferment Dendrobium officinale milk to increase the content of polysaccharides, alkaloids and small molecule peptides in the fermentation product.

[0010] Among them, polysaccharides are calculated as glucose, alkaloids are mainly dendrobine, and small molecule peptides refer to peptides with a molecular weight of <1000 Da. Compared with the Dendrobium milk substrate before fermentation, the contents of polysaccharides, alkaloids and small molecule peptides increased by 53.7%, 92.6% and 542.9%, respectively.

[0011] This invention also provides a method for fermenting Dendrobium officinale milk, comprising the following steps performed sequentially: S1. Substrate treatment: Prepare a suspension of Dendrobium powder, raw milk and water in a mass ratio of 1:8~12:5~8, homogenize, sterilize and cool to below 30°C to obtain the substrate; S2. Liquid fermentation: The activated strains of Leuconostoc mesenteroides JMCC0041, Bifidobacterium animalis subsp. lactis, and Lactobacillus fermentum were inoculated into the substrate according to the above-mentioned live bacteria ratio, and fermented until the fermentation endpoint to obtain Dendrobium milk. The substrate contains ≥1×10⁶ viable bacteria. 9 CFU / mL; The fermentation endpoint is pH = 4.0~4.5.

[0012] Furthermore, the Dendrobium powder is dispersed in raw milk and water to form a suspension, which is then homogenized.

[0013] Furthermore, the fermentation is anaerobic fermentation, and the fermentation time is 8-20 hours; activated Leuconostoc mesenteroides subsp. mesenteroides JMCC0041, Bifidobacterium animalis subsp. lactis, and Lactobacillus fermentum are used as starter cultures, and the inoculum amount of starter cultures is 1‰-2‰ of the substrate mass.

[0014] As a limitation of the present invention, the Dendrobium powder is obtained by pulverizing dried Dendrobium and passing it through a 100-140 mesh sieve.

[0015] As another limitation of the present invention, the Dendrobium is Dendrobium officinale, or a mixture of Dendrobium officinale and Dendrobium nobile.

[0016] As a further limitation of the present invention, the homogenization temperature is 65~70°C.

[0017] As a further limitation of the present invention, the sterilization is performed at 95°C for 5 minutes.

[0018] As a further limitation of the present invention, the strain activation is to inoculate the strains into MRS liquid culture medium to obtain Leuconostoc mesenteroides JMCC0041 culture medium, Bifidobacterium animalis lactis culture medium and Lactobacillus fermentum culture medium. The culture broth of Bifidobacterium animalis subsp. lactis and the culture broth of Lactobacillus fermentum were activated by anaerobic culture at 37°C for 20-24 hours. The culture medium of Leuconostoc mesenteroides subsp. JMCC0041 was activated by anaerobic culture at 30°C for 20-24 hours.

[0019] This invention also provides the application of a fermentation agent containing Leuconostoc mesenteroides subsp. mesenteroides in protecting the gastric mucosa.

[0020] As a further limitation of the present invention, the fermentation product of the fermenting agent is taken orally to inhibit Helicobacter pylori activity and reduce inflammatory response.

[0021] Furthermore, when the fermentation product is a food product, auxiliary materials may be added; The excipients are selected from one or more of white sugar, fructose syrup, sweeteners or stabilizers; the sweetener is sucralose; and the stabilizer is sodium carboxymethyl cellulose.

[0022] Furthermore, the fermentation products can be made into various dosage forms such as fermented milk beverages, oral liquids, and capsules, which are suitable for different groups such as children, the elderly, and people with stomach problems. They can be used as daily health food to supplement nutrition, or as an adjunct drug for the repair of gastric mucosal damage.

[0023] By adopting the above technical solution, the technical progress achieved by this invention compared with the prior art is as follows: (1) This invention uses a specific composite fermentation agent composed of Leuconostoc mesenteroides JMCC0041, Bifidobacterium animalis subsp. lactis, and Lactobacillus fermentum, and controls the fermentation temperature to 30~35℃, which realizes the synergistic effect between strains, can efficiently degrade the cell wall of Dendrobium and transform the composite substrate, thereby significantly and synchronously increasing the content of the three key active ingredients of Dendrobium polysaccharides, alkaloids and small molecule peptides in the fermentation product, overcoming the defects of low fermentation conversion efficiency and incomplete improvement of active ingredients in the existing technology; Among them, Leuconostoc mesenteroides subsp. mesenteroides JMCC0041 has good fermentation stability and a wide tolerance range to temperature conditions. Its fermentation ability is stable in the temperature range of 19~35℃. Therefore, it can be co-fermented with Bifidobacterium animalis subsp. lactis culture medium and fermented Lactobacillus mucin without the need for staged fermentation.

[0024] (2) This invention reveals for the first time the application of the above-mentioned fermentation agent and its products in protecting the gastric mucosa, especially in inhibiting the activity of Helicobacter pylori and reducing inflammatory response.

[0025] (3) This invention uses a combination of strains and an integrated, single-stage liquid fermentation method to inoculate and ferment the strains at once, which simplifies the process, shortens the production cycle, and effectively reduces the risk of contamination by miscellaneous bacteria, thereby improving the stability and production efficiency of the product and solving the problems of complex and cumbersome control in the segmented fermentation process of compound fermentation agents.

[0026] (4) This invention, by co-fermenting Dendrobium with raw milk, not only fully releases the active ingredients of Dendrobium, but also promotes the transformation of milk matrix, realizing the synergistic enhancement of plant medicinal source and animal milk source in terms of nutrition and function. Compared with the content of active nutritional substances before fermentation, the content of polysaccharides, alkaloids and small molecule peptides increased by 53.7%, 92.6% and 542.9% respectively compared with Dendrobium milk substrate before fermentation. Detailed Implementation

[0027] The present invention will be further described in detail below through specific embodiments. It should be understood that the described embodiments are only for explaining the present invention and do not limit the present invention.

[0028] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0029] In the following embodiments: Leuconostoc mesenteroides subsp. JM-0008, Leuconostoc mesenteroides subsp. JM-0733, Leuconostoc mesenteroides subsp. JM-0942, Leuconostoc mesenteroides subsp. JM-0962, Bifidobacterium animalis subsp. lactis i797 (accession number CGMCC NO.18403 at the China General Microbiological Culture Collection Center), Lactobacillus fermentum CGMCC No.1.1882, and Leuconostoc mesenteroides subsp. are all deposited in the applicant's laboratory and can be obtained through purchase or other means.

[0030] Example 1 This embodiment is a starter culture containing Leuconostoc mesenteroides subsp. mesenteroides, prepared by mixing a culture medium containing Leuconostoc mesenteroides subsp. mesenteroides JMCC0041, Bifidobacterium animalis subsp. lactis i797, and Lactobacillus fermentum CGMCC No. 1.1882 in a live bacteria ratio of 1:1:2. The fermentation temperature of this starter culture is 30~35℃, that is, any temperature within this range, such as 30℃, 31℃, 31.5℃, 32℃, 33℃, 34℃, and 35℃, can be used for fermentation.

[0031] Among them, *Leuconostoc mesenteroides* subsp. *enteroides* JMCC0041 is deposited at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, on April 18, 2025, with accession number CGMCC NO.34266. Its Latin name is... Leuconostocmesenteroides subsp. mesent eroides .

[0032] The 16S rDNA sequence of Leuconostoc mesenteroides subsp. JMCC0041 is shown in SEQ ID NO.1, and its Phes gene sequence is shown in SEQ ID NO.2.

[0033] Leuconostoc mesenteroides subsp. *enteroides* JMCC0041 exhibited outstanding stability in fermenting raw milk at different temperatures. Equal volumes of homogenized (secondary pressure 3 MPa, primary pressure 10 MPa, temperature 65℃) and sterilized (temperature 95℃, sterilization time 305 s) raw milk were used as fermentation substrates. Fermentation was conducted at temperatures of 19℃, 22℃, 25℃, 28℃, 31℃, and 35℃. The fermentation strains Leuconostoc mesenteroides subsp. *enteroides* JM-0008, JM-0733, JM-0942, JM-0962, and JMCC0041 were used as fermentation strains. The pH of the fermentation products after 24 hours of fermentation was used to analyze the stability of the fermentation capacity.

[0034] The fermentation capacity fluctuation is calculated and expressed as a percentage of pH fluctuation (pHb).

[0035] Where pHb = (highest pH - lowest pH) / lowest pH × 100%.

[0036] The experimental results are shown in Table 1: Table 1. Results of fermentation stability tests at different temperatures Note: Different letters indicate significant differences (p < 0.05). The above results indicate that Leuconostoc mesenteroides subsp. JMCC0041 exhibits good fermentation performance stability at temperatures of 19℃, 20℃, 22℃, 25℃, 28℃, 31℃, or 35℃, and has a wide applicable fermentation temperature range. Further testing revealed that its fermentation performance stability is particularly outstanding at 30~35℃.

[0037] Example 2 This embodiment provides the application of the starter culture of Example 1 in fermenting Dendrobium officinale milk to increase the content of polysaccharides, alkaloids and small molecule peptides in the fermentation product.

[0038] Specifically, it includes the following steps performed sequentially: S1. Substrate preparation: Take 300g of dried Dendrobium officinale, pulverize it and pass it through a 120-mesh sieve to obtain Dendrobium officinale powder; add 3000g of raw milk and 1800g of sterile water (6 times the weight of Dendrobium officinale powder) at a mass ratio of 1:10, stir evenly to prepare a composite suspension; homogenize the composite suspension at 65℃ and 20MPa, then place it in a sterilization device and sterilize it at 95℃ for 5 minutes, cool it to 30℃ to obtain Dendrobium officinale milk substrate for later use; S2. Liquid fermentation: S21. Strain activation: Leuconostoc mesenteroides subsp. mesenteroides JMCC0041, Bifidobacterium animalis subsp. lactis i797, and Lactobacillus fermentum were inoculated into MRS liquid medium. Bifidobacterium animalis subsp. lactis i797 and Lactobacillus fermentum were activated by anaerobic culture at 37℃ for 20 h, and Leuconostoc mesenteroides subsp. mesenteroides JMCC0041 was activated by anaerobic culture at 30℃ for 20 h to obtain three single-strain cultures (i.e., seed cultures). S22. Inoculation with starter culture: A starter culture was prepared by mixing activated *Leuconostoc mesenteroides* subsp. *enteroides* JMCC0041, *Bifidobacterium animalis* subsp. *lactobacter*, and *Lactobacillus fermentum* seed culture according to the viable cell count ratio in Example 1. The starter culture was then inoculated into the *Dendrobium nobile* milk substrate at an inoculation amount of 1‰ of the substrate mass, ensuring a viable cell count ≥ 1 × 10⁻⁶ in the *Dendrobium nobile* milk substrate. 9 CFU / mL; S23. Fermentation: Set the fermentation temperature to 30℃ and anaerobic ferment the inoculated substrate for 18 hours. Monitor the pH during fermentation. When the pH reaches 4.5, the fermentation endpoint is reached, and the fermentation is terminated to obtain Dendrobium milk product SH1.

[0039] Comparative Example 1 This comparative example is a compound fermentation agent D1, which is prepared by mixing a culture medium containing Bifidobacterium animalis subsp. lactis i797 and Lactobacillus fermentum in a live bacteria ratio of 1:2. It is used to ferment Dendrobium officinale milk substrate according to the method of Example 2 to obtain Dendrobium officinale milk product DSH1.

[0040] Comparative Example 2 This comparative example is a compound fermentation agent D2, which is prepared by mixing a culture medium containing Leuconostoc mesenteroides subsp. enterica, Bifidobacterium animalis subsp. lactis i797 and Lactobacillus fermentum in a live bacteria ratio of 1:1:2. It is used to ferment Dendrobium officinale milk substrate according to the method of Example 2 to obtain Dendrobium officinale milk product DSH2.

[0041] Example 1 of effect verification Dendrobium officinale milk substrate and Dendrobium officinale milk product were taken before and after fermentation with the fermenting agent of Example 1 of the present invention and the compound fermenting agents D1 and D2, respectively. The contents of polysaccharides, alkaloids and small molecule peptides with a molecular weight of <1000Da in each sample were detected, and the increase in the contents of the above-mentioned nutritional active substances before and after fermentation was calculated.

[0042] The polysaccharide detection method is the phenol-sulfuric acid method, which involves reacting polysaccharides with phenol-sulfuric acid to generate an orange-yellow compound. The absorbance is measured at a wavelength of 490 nm using a spectrophotometer, and the polysaccharide content is calculated by referring to the glucose standard curve. The alkaloid detection method is high performance liquid chromatography (HPLC). The alkaloid components in the Dendrobium extract are separated by chromatographic column, and the alkaloids are qualitatively identified based on their retention time. The alkaloids are quantitatively identified by comparing their peak area with Dendrobium alkaloid standards. Small molecule peptides were quantitatively detected by reversed-phase high-performance liquid chromatography (RP-HPLC); The test results are shown in Tables 2-4.

[0043] Table 2 Comparison of indicators before and after fermentation with compound fermentation agent D1 Table 3 Comparison of indicators before and after fermentation of the starter culture in Example 1 Table 4 Comparison of indicators before and after fermentation with compound fermentation agent D2 The above results show that the fermentation agent using the specific strain combination of the present invention significantly increases the content of nutrient active substances compared to before fermentation. Compared with the Dendrobium milk substrate before fermentation, the content of polysaccharides, alkaloids and small molecule peptides increased by 53.7%, 92.6% and 542.9% respectively, while the comparative proportion using strains similar to the fermentation agent of the present invention did not show sufficient increase in the content of active substances.

[0044] Example 2 of effect verification The gastric mucosa protective effects of Dendrobium officinale milk product SH1 prepared in Example 2 of this invention and Dendrobium officinale milk products DSH1 and DSH2 prepared in Comparative Examples 1 and 2 were verified. Details are as follows: Model Construction: Seventy-two SPF-grade SD rats were randomly divided into four groups: a blank control group, a model control group, a Dendrobium officinale milk product DSH1 dose group (300 mg / kg), a Dendrobium officinale milk product SH1 dose group (300 mg / kg), a Dendrobium officinale milk product DSH2 dose group (300 mg / kg), and a commercially available Dendrobium officinale extract group (300 mg / kg), with 12 rats in each group. Except for the blank control group, the other groups were treated with Helicobacter pylori (1×10⁻⁶). 8 A gastric mucosal injury model was established by gavage with CFU / mL and aspirin (200mg / kg) for 7 consecutive days.

[0045] Administration method: During the modeling process, each experimental group was administered the corresponding dose of sample by gavage, while the blank control group and the model control group were administered the same amount of physiological saline by gavage. The administration was carried out continuously for 14 days.

[0046] Detection indicators: 24 hours after the last administration, rats were sacrificed, and gastric tissue was collected to observe gastric mucosal damage and calculate the damage index; the levels of inflammatory factors TNF-α and IL-6 in gastric tissue and the amount of Helicobacter pylori colonization in the stomach were detected.

[0047] The gastric mucosal injury index of mice was determined by euthanizing the animals, placing them on an ice box, quickly removing the entire stomach, cutting it open along the greater curvature, rinsing it with cold saline, unfolding it, and observing the degree of gastric mucosal injury under a stereomicroscope. The area of ​​gastric mucosal injury was calculated using a micrometer and used as the gastric mucosal injury index of the mouse. The injury index was scored according to the method reported by Li Zhiman et al. (Protective effect of monkey head stomach-nourishing granules on acute gastric mucosal injury [J] Special Products Research, 2018, 5(4):31-42). The scoring criteria for visual observation of gastric mucosal injury are shown in Table 5. The calculation method is: gastric mucosal injury index = bleeding point score + bleeding band length score + (bleeding band width score × 2).

[0048] Table 5 Gross visual assessment criteria for gastric mucosal injury The levels of inflammatory factors TNF-α and IL-6 in gastric tissue were detected. Serum was extracted according to the method of Liu Ying et al. (Protective effect of propolis on acute alcoholic gastric injury in rats [J] Chinese Journal of Public Health, 2016, 32(10):1336-1339), and the levels of TNF-α and IL-6 were detected by ELISA kit.

[0049] The amount of Helicobacter pylori colonization in the stomach was detected by the method reported by Yan Shuo et al. (proton pump inhibitor pantoprazole promotes the colonization of Helicobacter pylori SS1 in the stomach of mice [J] Chinese Journal of Comparative Medicine, 2025, 35(2):24-32).

[0050] The experimental results are as follows: (I) Results of the Gastric Mucosal Injury Index Table 6 Comparison of gastric mucosal damage index under different treatments The superscripts have the following meanings: 1 indicates p < 0.01 compared with the blank control group; 2 indicates p < 0.01 compared with the model group; 3 indicates p < 0.01 compared with the Dendrobium milk product DSH1 dosage group; 4 indicates p < 0.01 compared with the commercially available Dendrobium extract group; and 5 indicates no statistical difference compared with the Dendrobium milk product DSH1 (p > 0.05).

[0051] The gastric mucosal damage index of rats in the model control group was significantly higher than that in the blank control group (P<0.01); the damage index of the Dendrobium officinale milk product DSH1 group and the Dendrobium officinale milk product SH1 group was significantly lower than that in the model control group (P<0.01). The damage index of Dendrobium officinale milk product SH1 was 56.8% lower than that in the model control group and 23.6% lower than that in the commercially available Dendrobium officinale extract group.

[0052] (II) Results of inflammatory factor content in gastric tissue Table 7 Comparison of TNF-α and IL-6 inflammatory markers in gastric tissue under different treatments The superscripts have the following meanings: 1 indicates p < 0.01 compared with the blank control group; 2 indicates p < 0.01 compared with the model group; 3 indicates p < 0.01 compared with the Dendrobium milk product DSH1 dosage group; 4 indicates p < 0.01 compared with the commercially available Dendrobium extract group; and 5 indicates no statistical difference compared with the Dendrobium milk product DSH1 (p > 0.05).

[0053] The levels of TNF-α and IL-6 in the gastric tissue of the model control group were significantly higher than those in the blank control group (P<0.01); the levels of inflammatory factors in the Dendrobium officinale milk product SH1 group were significantly reduced (P<0.01), and the levels of TNF-α and IL-6 in the Dendrobium officinale milk product SH1 group were reduced by 43.7% and 41.3% respectively compared with the model control group, which was better than the commercial Dendrobium officinale extract group (reduced by 19.6% and 16.4%).

[0054] (III) Results of Helicobacter pylori colonization in the stomach Table 8 Comparison of Helicobacter pylori colonization under different treatments The superscripts have the following meanings: 1 indicates p < 0.01 compared with the blank control group; 2 indicates p < 0.01 compared with the model group; 3 indicates p < 0.01 compared with the Dendrobium milk product DSH1 dosage group; 4 indicates p < 0.01 compared with the commercially available Dendrobium extract group; 5 indicates no statistical difference compared with the model group (p > 0.05); and 6 indicates no statistical difference compared with the Dendrobium milk product DSH1 (p > 0.05).

[0055] The colonization rate of Helicobacter pylori in the stomach of the model control group was significantly higher than that of the blank control group (P < 0.01); the colonization rate of the Dendrobium officinale milk product SH1 group was significantly lower than that of the model control group (P < 0.01), with a 43.1% reduction compared to the model control group, while the commercially available Dendrobium officinale extract group had no significant inhibitory effect on Helicobacter pylori colonization (P > 0.05).

[0056] The above results indicate that the Dendrobium milk product prepared by this invention can achieve efficient gastric mucosal protection by inhibiting Helicobacter pylori and reducing inflammatory response, and its effect is significantly better than that of Dendrobium milk product obtained by fermentation of a single Dendrobium extract and a comparative ratio of bacterial strains.

[0057] Furthermore, acute toxicity tests have verified that the maximum tolerated dose of Dendrobium officinale milk product SH1 in mice is ≥6000mg / kg, with no toxic reactions and no side effects with long-term use.

[0058] Example 3 This embodiment provides the application of Dendrobium officinale milk product SH1, prepared using the starter culture of Example 1, in the preparation of a fermented milk beverage for gastric mucosal protection. Details are as follows: Take 200g of hot pure water, add 40g of white sugar, 50g of fructose syrup, 5g of sodium carboxymethyl cellulose, and 0.05g of sucralose, stir until completely dissolved, and refrigerate to below 25°C to obtain a colloidal solution. Take 350g of the Dendrobium officinale milk product SH1 prepared in Example 1, add it to the cooled colloidal solution and mix well. Adjust the pH to 4.2 with citric acid and sodium citrate, homogenize at 65°C and 20MPa, then sterilize at 90°C for 5 minutes. After cooling to 25°C, dispense into 200mL sterile bottles to obtain a gastric mucosa-protected fermented lactic acid bacteria beverage.

[0059] Example 4 This embodiment describes a method for preparing Dendrobium officinale milk, as detailed below: S1. Substrate treatment: Dendrobium officinale and Dendrobium nobile in a mass ratio of 1:1 are pulverized and passed through a 140-mesh sieve to obtain Dendrobium powder; Dendrobium powder in a mass ratio of 1:10:6, raw milk and water are mixed, homogenized at 70℃, sterilized, and cooled to below 30℃ to obtain the substrate; S2. Liquid fermentation: The culture broth of Bifidobacterium animalis subsp. lactis and the culture broth of fermenting Lactobacillus mucus were activated by anaerobic culture at 37℃ for 22h; the culture broth of Leuconostoc mesenteroides subsp. mesenteroides JMCC0041 was activated by anaerobic culture at 30℃ for 23h. The activated strains of Leuconostoc mesenteroides JMCC0041, Bifidobacterium animalis subsp. lactis i797, and Lactobacillus fermentum were inoculated into the substrate at a live count ratio of 1:1:1 and fermented at 30℃ to pH=4.0 to obtain Dendrobium milk. The fermentation time was 8 h. Among them, the number of viable bacteria in the substrate is ≥1×10 9 The inoculum concentration was CFU / mL, and the amount of fermentation agent was 2‰ of the substrate mass.

[0060] Example 5 This embodiment describes a method for preparing Dendrobium officinale milk, as detailed below: S1. Substrate treatment: Dendrobium officinale and Dendrobium nobile in a mass ratio of 2:1 are pulverized and passed through a 100-mesh sieve to obtain Dendrobium powder; Dendrobium powder in a mass ratio of 1:12:8, raw milk and water are mixed, homogenized at 65°C, sterilized, and cooled to below 30°C to obtain the substrate; S2. Liquid fermentation: The culture broth of Bifidobacterium animalis subsp. lactis and the culture broth of fermenting Lactobacillus mucus were activated by anaerobic culture at 37℃ for 24h; the culture broth of Leuconostoc mesenteroides subsp. mesenteroides JMCC0041 was activated by anaerobic culture at 30℃ for 20h. The activated strains of Leuconostoc mesenteroides JMCC0041, Bifidobacterium animalis subsp. lactis, and Lactobacillus fermentum were inoculated into the substrate at a live count ratio of 1:1:5 and fermented at 33℃ to pH=4.5 to obtain Dendrobium milk. The fermentation time was 10 h. Among them, the number of viable bacteria in the substrate is ≥1×10 9 The inoculum concentration was CFU / mL, and the amount of fermentation agent was 1.2‰ of the substrate mass.

[0061] Example 6 This embodiment describes a method for preparing Dendrobium officinale milk, as detailed below: S1. Substrate treatment: Dendrobium officinale and Dendrobium nobile in a mass ratio of 3:1 are pulverized and passed through a 120-mesh sieve to obtain Dendrobium powder; Dendrobium powder in a mass ratio of 1:8:5, raw milk and water are mixed, homogenized at 68℃, sterilized, and cooled to below 30℃ to obtain the substrate; S2. Liquid fermentation: The culture broth of Bifidobacterium animalis subsp. lactis and the culture broth of fermenting Lactobacillus mucus were activated by anaerobic culture at 37℃ for 20h; the culture broth of Leuconostoc mesenteroides subsp. mesenteroides JMCC0041 was activated by anaerobic culture at 30℃ for 24h. The activated strains of Leuconostoc mesenteroides JMCC0041, Bifidobacterium animalis subsp. lactis, and Lactobacillus fermentum were inoculated into the substrate at a live count ratio of 1:1:4 and fermented at 35°C until pH=3.5 to obtain Dendrobium milk. The fermentation time was 20 h. Among them, the number of viable bacteria in the substrate is ≥1×10 9 The inoculum concentration was CFU / mL, and the amount of fermentation agent was 1‰ of the substrate mass.

[0062] According to the viable cell ratios of Leuconostoc mesenteroides subsp. JMCC0041, Bifidobacterium animalis subsp. lactis, and Lactobacillus fermentum in Examples 4-6, a fermentation agent containing Leuconostoc mesenteroides subsp. JMCC0041, Bifidobacterium animalis subsp. lactis, and Lactobacillus fermentum can be prepared. The fermentation temperature is 30-35℃. All strains used can be obtained through purchase channels and are preserved in the applicant's laboratory.

[0063] Through the detection of the content of nutrient-active substances and the verification of the gastric mucosa protection effect, the above embodiments all obtained fermentation effects similar to those of the fermenting agent in Embodiment 1 of the present invention.

[0064] In other embodiments, fermented milk beverages, oral liquids, or capsules made from the fermentation products of the above-mentioned fermenting agent are used to inhibit Helicobacter pylori activity and reduce inflammatory responses.

[0065] The excipients used in the above-mentioned products are selected from one or more of the following: granulated sugar, fructose syrup, sweeteners, or stabilizers; the sweetener is sucralose; and the stabilizer is sodium carboxymethyl cellulose. These products are suitable for different groups, including children, the elderly, and people with stomach problems. They can be used as daily health supplements to supplement nutrition or as adjunctive medications for repairing gastric mucosal damage.

Claims

1. A fermentation agent containing *Leuconostoc mesenteroides* subsp. *enteroides*, characterized in that, It is made from the following strains with a live bacteria ratio of 1:1:1~5: Leuconostoc mesenteroides JMCC0041, Bifidobacterium animalis subsp. lactis, and Lactobacillus fermentum. The *Leuconostoc mesenteroides* subsp. *enteroides* JMCC0041 strain is deposited at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, with accession number CGMCC NO. 34266 and Latin name [not specified]. Leuconostoc mesenteroides subsp. mesenteroides ; The fermentation temperature of the fermenting agent is 30~35℃.

2. The application of the fermentation agent containing *Leuconostoc mesenteroides* subsp. *enteroides* as described in claim 1, characterized in that, The starter culture is used to ferment Dendrobium officinale milk to increase the content of polysaccharides, alkaloids and small molecule peptides in the fermentation products.

3. A method for fermenting Dendrobium officinale milk, characterized in that, This includes the following steps performed sequentially: S1. Substrate treatment: Mix Dendrobium powder, raw milk and water in a mass ratio of 1:8~12:5~8, homogenize, sterilize and cool to below 30°C to obtain the substrate; S2. Liquid fermentation: The activated strains of Leuconostoc mesenteroides JMCC0041, Bifidobacterium animalis subsp. lactis, and Lactobacillus fermentum were inoculated into the substrate according to the live bacteria ratio described in claim 1, and fermented to the fermentation endpoint to obtain Dendrobium milk; The substrate contains ≥1×10⁶ viable bacteria. 9 CFU / mL; The fermentation endpoint is pH = 4.0~4.

5.

4. The method for fermenting Dendrobium officinale milk according to claim 3, characterized in that, The Dendrobium powder is obtained by pulverizing dried Dendrobium and passing it through a 100-140 mesh sieve.

5. A method for fermenting Dendrobium officinale milk according to claim 3 or 4, characterized in that, Dendrobium is Dendrobium officinale, or a mixture of Dendrobium officinale and Dendrobium nobile.

6. The method for fermenting Dendrobium officinale milk according to claim 5, characterized in that, The homogenization temperature is 65~70℃.

7. The method for fermenting Dendrobium officinale milk according to claim 6, characterized in that, The sterilization process involves sterilizing at 95°C for 5 minutes.

8. The method for fermenting Dendrobium officinale milk according to claim 7, characterized in that, Strain activation involves inoculating the strains separately into MRS liquid medium to obtain culture broths of Leuconostoc mesenteroides JMCC0041, Bifidobacterium animalis subsp. lactis, and Lactobacillus fermentum. The culture broth of Bifidobacterium animalis subsp. lactis and the culture broth of Lactobacillus fermentum were activated by anaerobic culture at 37°C for 20-24 hours. The culture medium of Leuconostoc mesenteroides subsp. JMCC0041 was activated by anaerobic culture at 30°C for 20-24 hours.

9. The use of the fermentation agent containing Leuconostoc mesenteroides subsp. mesenteroides as described in claim 1 in protecting the gastric mucosa.

10. The application of a fermentation inoculum containing *Leuconostoc mesenteroides* subsp. *enteroides* according to claim 9 in protecting the gastric mucosa, characterized in that, By consuming the fermentation products of the aforementioned fermenting agent, Helicobacter pylori activity can be inhibited and inflammatory responses reduced.

Images