PDCoV recombinant rbd protein and ig a elisa kit
An ELISA method established using recombinant RBD protein of PDCoV expressed and purified in CHO-K1 cells solves the problems of cross-reactivity and poor specificity in PDCoV detection in existing technologies, and achieves high sensitivity and specificity for the detection of PDCoV-specific IgA antibodies in porcine milk, making it suitable for large-scale screening of porcine milk samples.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- INST OF ANIMAL HEALTH GUANGDONG ACADEMY OF AGRI SCI
- Filing Date
- 2026-03-20
- Publication Date
- 2026-06-23
Smart Images

Figure CN121895425B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biology, and more particularly to a PDCoV recombinant RBD protein and its IgA ELISA kit. Background Technology
[0002] Porcine deltacoronavirus (PDCoV) is an emerging porcine enteric coronavirus belonging to the genus Deltacoronavirus in the family Coronaviridae. Because PDCoV shares similarities in clinical symptoms and histopathological features with porcine epidemic diarrhea virus (PEDV) and transmissible gastroenteritis virus (TGEV), accurate laboratory diagnosis is crucial for prevention and control.
[0003] The PDCoV genome is a single-stranded positive-sense RNA, approximately 25.4 kb in length, encoding four major structural proteins: spike protein (S), envelope protein (E), membrane protein (M), and nucleocapsid protein (N). The S protein, a type II transmembrane glycoprotein, plays a central role in viral adsorption and invasion of host cells and is one of the virus's main antigenic proteins. The S protein can be further divided into two subunits, S1 and S2. The receptor-binding domain (RBD) of the S1 subunit can recognize and bind to host receptors, determining the virus's tissue tropism and host specificity.
[0004] With the market launch of PDCoV inactivated vaccines, detecting antibody levels in immunized pig herds is a crucial indicator for ensuring immunization efficacy and developing immunization strategies. However, there are currently no commercially available PDCoV serological detection kits. Previous research on PDCoV antibody detection methods has primarily focused on IgG-based indirect ELISA, with relatively few kits available to reflect IgA-related immune levels. IgA is an important effector molecule in the mucosal immune system, playing a key role in blocking enterovirus invasion and limiting viral replication.
[0005] Currently, many domestic scholars have established indirect ELISA methods for detecting PDCOV-specific IgG antibodies based on M and N proteins. Although the M protein is highly conserved, the antibodies it induces have poor specificity and are prone to cross-reaction with porcine epidemic diarrhea virus, making it unsuitable as a diagnostic antigen.
[0006] Sequence alignment revealed that the N-terminus (1-120 AA) of the N protein in both PDCoV and PEDV is relatively conserved in the 76-89 region. This may be a key target for cross-reaction between the two viruses. Conserved or similar epitopes may lead to bidirectional cross-reaction of the antigens of the two viruses. Detailed sequence comparisons can be found [link to relevant information]. Figure 1A Therefore, M and N proteins are not the best antigens for establishing serological detection methods.
[0007] The S protein (especially the S1 region) of coronaviruses is a major determinant of virus specificity, better distinguishing PDCoV from other coronaviruses. Compared to the N protein as a coating antigen, the S protein is the main virulence protein determining the invasion and infection of host cells by coronaviruses, and is a major target gene for differentiating different coronaviruses, possessing unparalleled advantages over the N protein. Antibodies against the S protein have neutralizing activity, providing true resistance to viral invasion. Thachil et al. developed the first IgG indirect ELISA kit based on the PDCoV S1 protein, using the S1 protein as the antigen. This method is highly specific and stable, but it only detects IgG antibodies, failing to cover the early IgA response in infection. Its diagnostic accuracy for acute infection and interference from maternal antibodies in piglets is limited, and the sample size for cutoff value determination is relatively insufficient, potentially leading to misdiagnosis of some weakly positive samples. Therefore, the S1 protein is also unsuitable as a coating antigen for detecting PDCoV IgA antibody levels.
[0008] As the analysis above shows, existing technologies for preparing indirect ELISA kits for detecting PDCoV using S1 and N proteins have inherent flaws. Based on this, this case is proposed. Summary of the Invention
[0009] The purpose of this invention is to provide a recombinant PDCoV RBD protein for use in an indirect ELISA kit. This recombinant RBD protein offers the following advantages: it covers the early IgA response to infection, accurately identifies PDCoV-specific IgA antibodies in breast milk samples, and avoids false positives due to other common porcine pathogens. It specifically reacts only with PDCoV-positive breast milk samples and shows no cross-reactivity with positive breast milk samples from five common porcine viral pathogens: PEDV, CSFV, TGEV, PRRSV, and PORV. The indirect ELISA kit of this invention is not only highly stable (within-assay coefficient of variation of 1.848%~6.062% and inter-assay coefficient of variation of 4.504%~7.790%), but also achieves a 93.26% concordance rate with immunofluorescence assays. While ensuring repeatability and maintaining a high concordance rate, it also combines the advantages of simple operation, short processing time, and high throughput of the ELISA method, making it suitable for large-scale screening of clinical porcine milk samples.
[0010] In addition, the present invention also provides the target gene, plasmid for expressing the recombinant RBD protein, and its applications.
[0011] The method of the present invention is specifically as follows:
[0012] A recombinant RBD protein, the amino acid sequence of which is shown in SEQ ID NO.1; preferably, the recombinant RBD protein is expressed in soluble form using the mammalian eukaryotic expression system CHO-K1 cells.
[0013] The receptor-binding domain (RBD) of the S1 subunit is the receptor-binding domain on the S1 subunit of the PDCoV spike (S) protein, located at the C-terminus of the S protein. It is not only a key functional region mediating viral invasion of host cells, but also contains the main neutralizing epitopes for the production of neutralizing antibodies. The RBD binds only to PDCoV-specific antibodies and is the main target antigen for inducing the body to produce neutralizing antibodies.
[0014] Compared to the full-length S and S1 proteins, the RBD protein is smaller and more specific. Due to its extremely high specificity, detection methods (such as ELISA) based on the RBD (or S1 protein) of PEDV, TGEV, and PDCoV are far superior to methods based on the N protein in distinguishing between different viral infections, effectively avoiding cross-reactivity. However, as the RBD protein is part of the transmembrane glycoprotein S protein, its structure is complex, requiring precise folding, resulting in complex and costly processes, and significant challenges in expression and purification. Therefore, constructing a protein with a structure similar to the natural RBD protein, correct folding, and activity in recognizing PDCOV antibodies is one of the key issues to be addressed in this case. Furthermore, establishing an ELISA detection method with high specificity, sensitivity, reproducibility, and concordance rate using this protein is a significant technical bottleneck in the efficient and accurate clinical monitoring of PDCOV antibodies.
[0015] Although RBD proteins are also used in ELISA methods for other viruses, their inherent limitations are also present. For example, the publication number CN 119661660 A, entitled "An Indirect ELISA Kit for Rapid Detection of Porcine Epidemic Diarrhea Virus IgA Antibodies and Its Application," describes a kit that captures PEDV IgA antibodies in porcine sow milk or serum by expressing RBD proteins in prokaryotes using an ELISA method. However, its detection accuracy against PEDV in sow milk is only 86.9%, and its lower limit of dilution in sow milk is 1024 times.
[0016] This invention establishes an ELISA method for detecting specific IgA levels of PDCoV in breast milk based on recombinant RBD protein and using RBD as an antigen. This method has no cross-reactivity with PEDV, CSFV, TGEV, PRRSV, and PORV positive breast milk, and has good repeatability and high sensitivity. It is superior to M, N, S1-NTD, S1-CTD, and S2 proteins as coating antigens.
[0017] A PDCoV IgA indirect ELISA method was established using purified RBD protein as the coating antigen. This method specifically reacts only with PDCoV-positive breast milk samples and shows no cross-reactivity with breast milk samples positive for five common porcine viral pathogens: PEDV, CSFV, TGEV, PRRSV, and PORV. The OD values of all non-PDCoV samples were also measured. 450nm The values were all below the PDCoV positive threshold (0.253) and showed a clear boundary with the OD value of positive samples (difference ≥0.032), accurately identifying PDCoV-specific IgA antibodies in breast milk samples without false positives due to other common pathogens in the swine herd. The highest detection dilution ratio for PDCoV-positive breast milk samples after serial dilution reached 1:3200, demonstrating accurate detection even at extremely low IgA antibody levels, indicating that this method is also suitable for detection in early-infected or low-immunity swine herds. Furthermore, this method is not only highly stable (within-assay coefficient of variation of 1.848%~6.062%, and between-assay coefficient of variation of 4.504%~7.790%), but also shows a 93.26% concordance rate with immunofluorescence experiments. This invention, while ensuring repeatability and maintaining a high concordance rate, also combines the advantages of ELISA methods—simple operation, short processing time, and high throughput—making it suitable for large-scale screening of clinical swine milk samples.
[0018] Simultaneously, the target gene expressing the recombinant RBD protein as described above; the nucleotide sequence of the target gene is shown in SEQ ID NO.2.
[0019] In addition, the present invention also discloses an expression plasmid, including a vector plasmid and the target gene as described above inserted on the vector plasmid.
[0020] And the use of the recombinant RBD protein described above to prepare an indirect ELISA detection kit for detecting porcine deltacoronavirus.
[0021] In the above-described applications, the indirect ELISA detection kit is used to detect pig breast milk.
[0022] Finally, the present invention also discloses an IgA indirect ELISA detection kit, wherein the antigen in the kit is the recombinant RBD protein as described above.
[0023] This application has at least the following beneficial effects:
[0024] The indirect ELISA detection method for IgA based on the RBD eukaryotic recombinant protein of PDCoV, as proposed in this invention, has the advantages of high specificity, high sensitivity, good stability, and high detection fidelity. It lays the foundation for the development of commercial detection kits for PDCoV-specific IgA antibodies in porcine milk and provides technical support for the prevention and control of PDCoV. Attached Figure Description
[0025] Figure 1A This is the sequence alignment diagram described in the background art;
[0026] Figure 1B The plasmid map of pcDNA3.1(-)-S1-RBD-HIS;
[0027] Figure 1C The results of Western blot analysis of the purified protein;
[0028] Figure 1D SDS-PAGE analysis results of PDCoV-RBD protein expression purification;
[0029] Figure 1E The results of SDS-PAGE analysis of the purified RBD protein concentrate;
[0030] Figures 1C to 1E In the diagram, the meanings of each band are as follows: M: Protein molecular weight standard; 1: Negative control; 2: Cell culture supernatant; 3: Cell culture supernatant stock solution; 4: Flow-through solution; 5, 6: Washing; 7, 8: Elution; 9: Purified RBD protein; 10: Concentrated RBD protein;
[0031] Figure 2A The results are from Western blot analysis of PDCoV negative serum.
[0032] Figure 2B The results of Western blot analysis of PDCoV positive serum;
[0033] Figure 2A and Figure 2B In the diagram, the meanings of each band are as follows: M: protein molecular weight standard; 1, 3: negative control; 2, 4: PDCoV-RBD protein;
[0034] Figure 3 This indicates the specificity of the indirect ELISA method for detecting recombinant N protein IgA in PDCoV.
[0035] Figure 4Results of sensitivity of the indirect ELISA method for detecting recombinant RBD protein IgA of PDCoV. Detailed Implementation
[0036] The present invention will now be clearly and completely described in conjunction with embodiments thereof. It should be noted that, unless specific conditions are specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments whose manufacturers are not specified are all commercially available conventional products.
[0037] Part 1: Plasmid Construction and Protein Expression
[0038] 1.1 Virus strains, cells, and main reagents
[0039] PDCoV-HeN17 isolate (GenBank accession No: OR230676.1); CHO-K1 cells, PDCoV-positive breast milk, PDCoV-negative breast milk, PEDV-positive breast milk, TGEV-positive breast milk, CSFV-positive standard breast milk, and PRRSV-positive breast milk were all preserved by the Biotechnology Laboratory of the Animal Health Institute, Guangdong Academy of Agricultural Sciences. Fetal bovine serum was purchased from Biological Industries. DMEM-F12 medium was purchased from Gibco. BCA protein concentration assay kit and pre-stained protein marker (10~180kDa) LS2311 were purchased from Nanjing Novizan Biotechnology Co., Ltd. Western blotting, ECL chemiluminescence solution (P0018), 5× protein loading buffer, ECL chemiluminescence kit, BCA protein concentration assay kit, Lipofectamine™ 8000, and BeyoGold™ His-tag Purification Resin (reduction-resistant chelating type) were all purchased from Shanghai Beyotime Biotechnology Co., Ltd. Bovine serum albumin Fraction V (BSA) (SRE0096) was purchased from Sigma-Aldrich (Shanghai) Trading Co., Ltd. 10 kDa protein ultrafiltration tubes (UFC9010) were purchased from Millipore. SDS-PAGE protein staining (ADS-RS-50) was purchased from Jiangsu Adison Biotechnology Co., Ltd. Blank ELISA plates (221208-081-A) were purchased from Guangzhou Jetech Biofiltration Co., Ltd. TMB Single Solution (09270221-7) was purchased from Life Technologies. Goat Anti-Pig IgA H&L (HRP) (ab112746) was purchased from Abcam; universal antibody diluent was purchased from Suzhou Xinsaimei Biotechnology Co., Ltd.; secondary antibodies for goat anti-porcine IgA-HRP (AA140P, AA140F, and AD11195420) were purchased from Bio-Rad Biomedical Products (Shanghai) Co., Ltd. and Suzhou Botron Immunotherapy Co., Ltd., respectively.
[0040] 1.2 Construction of S1-RBD plasmid
[0041] Based on the RBD sequence of the PDCoV-HeN17 strain in the NCBI database (GenBank accession No: OR230676.1), mammalian codon optimization and synthesis were performed for the CHO cell expression system to obtain the target gene; the nucleotide sequence of the target gene is shown in SEQ ID NO.2.
[0042] SEQ ID NO.2:
[0043] GTTACACTACCTAAGCTCCCTGAGCTTGAaGTAGTGCATTTAAATATTTCTGCACACATGGATTTTGGCGAAGCCAGACTTGACAGCGTTACCATCAATGGTAACACATCCTATTGTGTCACTAAGCCTTACTTCAGGCTTGAAACTAACTTTATGTGTACAGGTTGCACTATGAATCTGCGCACTGATACCTGTAGT TTTGACCTGTCAGCAGTAAACAATGGCATGTCATTCTCTCAATTCTGTCTAAGCACTGAATCTGGTGCTTGTGAGATGAAAATTATTGTTACCTACGTATGGAATTACTTGCTAAGGCAGCGTTTGTATGTTACTGCTGTAGAGGGCCAGACTCACACTGGAACCACTTCAGTACATGCAACAGACACTTCTAGTGTA
[0044] The target gene sequence was synthesized by Nanjing Genscript Biotech Co., Ltd. and constructed into the pcDNA3.1(-) vector. This recombinant plasmid was named pcDNA3.1(-)-S1-RBD-HIS, and its map is shown below. Figure 1B As shown.
[0045] 1.3 Expression and purification of RBD recombinant protein
[0046] The pcDNA3.1(-)-RBD recombinant plasmid was transfected into CHO-K1 cells according to the Lipofectamine™ 8000 transfection reagent instructions. The medium was changed 6 h after transfection, and the supernatant of the transfected cell culture was collected 24 h later for Western blotting analysis to identify the secretory expression of the recombinant protein. The amino acid sequence of the recombinant RBD protein is shown in SEQ ID NO. 1.
[0047] SEQ ID NO.1:
[0048] VTLPKLPELEVVHLNISAHMDFGEARLDSVTINGNTSYCVTKPYFRLETNFMCTGCTMNLRTDTCSFDLSAVNNGMSFSQFCLSTESGACEMKIIVTYVWNYLLRQRLYVTAVEGQTHTGTTSVHATDTSSV
[0049] The supernatant from the collected recombinant protein cell culture was then centrifuged at 12000 rpm for 20 min. The supernatant was then filtered through a 0.22 μm filter and added to a nickel affinity chromatography column equilibrated with PBS (pH 7.4). The column was inverted overnight at 4°C for binding. Once the protein had bound to the nickel affinity chromatography column, it flowed through. Four column volumes of buffer were used for washing. After washing, the protein was eluted with buffer B, and the purification results were analyzed by SDS-PAGE. The purified protein was concentrated using a 10 kDa ultrafiltration tube (3000 rpm; 15 min / time). After concentration, the liquid was replaced using PBS (3000 rpm; 15 min / time), and SDS-PAGE analysis was performed.
[0050] Western blotting analysis of recombinant protein samples obtained after transfection of pcDNA3.1(-)-S1-RBD-HIS plasmid into CHO-K1 cells showed that the RBD recombinant protein was expressed in the culture supernatant. Figure 1C Cell culture supernatant was collected and purified by nickel affinity chromatography. SDS-PAGE results showed that a large number of impurities were removed in the elution buffer after washing with solution A. After removing a large number of impurities with solution A, the target protein was further eluted with solution B to obtain RBD protein with high purity. Figure 1D The target protein was then concentrated using ultrafiltration. SDS-PAGE analysis showed that the purified RBD protein was the expected size and had a single band. BCA protein concentration determination showed a concentration of 0.4 mg / ml. Figure 1E ).
[0051] 1.4 Reactivity identification of RBD protein
[0052] Reactivity reflects the ability of a protein to bind to a specific antibody. This invention uses Western blot combined with PDCoV positive and negative serological systems to identify reactivity.
[0053] To verify the reactivity of the PDCoV-RBD protein, this invention used PDCoV negative and positive sera as primary antibodies in Western blotting experiments. The results are as follows: Figure 2A and Figure 2BAs shown, no bands were observed in the membrane incubated with PDCoV-negative serum, either in the negative control lane or the PDCoV-RBD lane. In the membrane incubated with PDCoV-positive serum, the PDCoV-RBD lane showed a clear band, the size of which was consistent with the theoretical molecular weight of the PDCoV-RBD protein, while the negative control lane showed no band signal. This indicates that the recombinant PDCoV-RBD protein can be targeted and recognized by specific antibodies in PDCoV-positive serum and has good reactivity.
[0054] The above experiments demonstrate that the present invention utilizes the CHO cell expression system to construct a recombinant expression plasmid of the PDCoV S protein RBD, thereby achieving efficient expression and purification of the RBD protein. This recombinant PDCoV-RBD protein can be targeted and recognized by specific antibodies in PDCoV-positive serum, exhibiting good reactivity.
[0055] Part Two: Establishment of the Indirect ELISA Method
[0056] 2.1 Screening for optimal antigen coating concentration and breast milk dilution
[0057] This experiment used the checkerboard method to determine the optimal antigen coating concentration and the optimal breast milk dilution. The coating antigen (recombinant RBD protein) was diluted to 2, 1, 0.5, 0.75, 0.5, 0.25, 0.125, 0.0625, and 0.03125 μg / mL using antigen coating dilution buffer and coated onto microplates. 100 μL was added to each well, with three replicates. The plates were incubated overnight at 4°C and washed once with PBST. Blocking was performed with 5% BSA (PBS), 120 μL per well, and incubated at 37°C for 2 h. The plates were washed twice with PBST. PDCoV-positive and PDCoV-negative breast milk were serially diluted at ratios of 1:50, 1:75, 1:100, 1:150, 1:200, 1:300, and 1:400, 100 μL per well, and incubated at 37°C for 2 h. The plates were washed three times with PBST. GoatAnti-PigIgAH&L (HRP) was used as the secondary antibody and incubated at 37°C. Incubate for 1 h, dilute to 1:10000, wash 3 times with PBST; finally, add 100 μL of TMB Single Solution for color development, incubate at room temperature in the dark for 15 min; add 50 μL of 2M H2SO4 to stop color development, and read the OD using a microplate reader. 450nm The criteria for determining the optimal results are: the optimal breast milk dilution and the optimal antigen coating concentration are determined based on the principle of maximizing the P / N value and having a P value close to 1.
[0058] The results are shown in Table 1: When the antigen coating concentration was 0.125 μg / mL and the breast milk sample dilution was 1:200, the OD values of PDCoV-positive and PDCoV-negative breast milk were detected. 450nm The ratio (P / N value) is the highest. Therefore, the optimal antigen coating concentration is 0.125 μg / mL, and the optimal dilution for breast milk samples is 1:200.
[0059] Table 1. Optimization of antigen coating concentration and breast milk dilution factor
[0060]
[0061] 2.2 Optimization of Indirect ELISA Conditions
[0062] Based on the optimal antigen coating concentration and breast milk dilution conditions determined in section 2.1 (antigen coating concentration of 0.125 μg / mL, breast milk dilution of 1:200), the optimal blocking solution and blocking time were optimized. This included different blocking solutions (2% skim milk, 5% skim milk, 10% skim milk, 2% BSA, 5% BSA, 10% BSA), different blocking times (30 min, 60 min, 90 min, 120 min), different incubation times for the primary antibody (breast milk) (60 min, 90 min, 120 min, 180 min), and different dilution conditions for the enzyme-labeled secondary antibody IgA (1:2500, 1:5000, 1:10000, and 1:20000). The condition with the highest P / N ratio was selected as the optimal parameter for indirect ELISA.
[0063] For detailed results, please refer to Table 2;
[0064] Table 2 Optimization of sealing conditions, breast milk dilution conditions, and serum incubation time
[0065] Optimize Project Enclosed conditions Breast milk dilution conditions Enzyme-labeled secondary antibody dilution conditions Optimal mass concentration 5% BSA 1:200 abcam, 1:10000 Optimal reaction time 37℃, 120min 37℃, 90min 37℃ for 60 minutes
[0066] 2.3 Determination of the cutoff value for indirect ELISA
[0067] The optimized indirect ELISA detection method described in sections 2.1 and 2.2 was used to detect 30 PDCoV IgA antibody-negative breast milk samples with clear backgrounds using indirect ELISA. Based on statistical analysis principles, a positive value was determined as OD. 450 nm A negative value is defined as OD ≥ the mean + 3 × standard deviation. 450 nm ≤mean + 2×standard deviation, mean + 3×standard deviation <OD 450 nm The value is considered suspected if the mean is less than or equal to 2 × standard deviation. The critical value for this detection method is calculated from this value.
[0068] Based on the optimized ELISA detection method conditions described above, 30 PDCoV antibody-negative breast milk samples identified by immunofluorescence were subjected to ELISA testing (within 3 replicates). The results were obtained based on the OD values of the microplate reader. 450nm The numerical value determines the negative threshold of this ELISA detection method.
[0069] The results showed a mean of 0.156 and a standard deviation of 0.030. Therefore, when the OD of breast milk samples... 450nm A value ≥0.253 is considered positive for breast milk samples. 450nm A result ≤0.221 is considered negative; when the OD of the breast milk sample is... 450nm If the value is between 0.253 and 0.221, it is considered a suspected value.
[0070] 2.4 Indirect ELISA Specificity Assay
[0071] According to the established ELISA method, cross-reactivity tests were performed sequentially on breast milk samples positive for PEDV, CSFV, TGEV, PRRSV, and PORV antibodies. Based on OD... 450 nm The value is used to determine whether there is cross-reactivity, in order to evaluate the specificity of the indirect ELISA method against PDCoV.
[0072] like Figure 3 As shown, ELISA was performed using laboratory-preserved breast milk samples positive for PEDV, CSFV, TGEV, PRRSV, PORV, and PDCoV antibodies, with PDCoV antibody-negative breast milk used as a negative control; three replicates were performed. The indirect ELISA method reacts only with PDCoV-positive breast milk samples; OD values of PEDV, CSFV, TGEV, PRRSV, and PORV-positive breast milk samples were negative. 450nm The value was lower than the cutoff value, indicating that the ELISA detection method has good specificity.
[0073] Figure 3 Specific results of the indirect ELISA detection method for PDCoV recombinant RBD protein IgA
[0074] 2.5 Sensitivity test of indirect ELISA
[0075] Using the established indirect ELISA method, PDCoV-positive breast milk was serially diluted starting at 1:200 to determine the highest detection dilution ratio for PDCoV-positive breast milk, in order to evaluate the sensitivity of the established method.
[0076] Based on the optimized ELISA detection conditions described above, PDCoV-positive breast milk was serially diluted from 1:200 to 1:25600 using a 2-fold dilution method, with three replicates for each dilution, to assess the sensitivity of the indirect ELISA detection method established in this study. The results are as follows: Figure 4 As shown, when PDCoV antibody-positive breast milk was diluted to 1:3200, the indirect ELISA result could still be interpreted as positive, indicating that the ELISA detection method established in this experiment has good sensitivity.
[0077] Figure 4 Results of sensitivity of the indirect ELISA method for detecting recombinant RBD protein IgA of PDCoV.
[0078] 2.6 Indirect ELISA Repeatability Test
[0079] Following the established ELISA method, intra-group replicates were performed on four serum samples, with three replicates per sample. Simultaneously, inter-group replicates were performed using different coated batches of purified RBD recombinant protein. The mean and standard deviation were calculated, and the coefficient of variation was analyzed.
[0080] The repeatability of the indirect ELISA assay was evaluated using intra-assay and inter-assay repeatability tests. Intra-assay ≤10% and inter-assay ≤15% both met the stability requirements for serological assays. Results showed that the intra-assay coefficient of variation (%) ranged from 1.848% to 6.062%, and the inter-assay coefficient of variation ranged from 4.504% to 7.790% (Table 3), indicating that this assay has good repeatability.
[0081] Table 3. Intra-assay and inter-assay repeatability results of the indirect ELISA detection method for PDCoV recombinant RBD protein IgA.
[0082]
[0083] 2.7 Sample Compliance Rate Detection
[0084] The RBD indirect ELISA antibody detection method and the IFA (Immunofluorescence assay) detection method established in this experiment were used to simultaneously detect 89 porcine sow milk samples. Finally, the concordance rate of the two detection methods was verified to be 93.26% (Table 4).
[0085] Table 4. Results of the Compliance Rate Experiment
[0086]
[0087] Results analysis:
[0088] 1. This invention establishes an indirect ELISA method for PDCoV IgA using purified RBD protein as the coating antigen. This method specifically reacts only with PDCoV-positive breast milk samples and shows no cross-reactivity with breast milk samples positive for five common porcine viral pathogens: PEDV, CSFV, TGEV, PRRSV, and PORV. The OD values of all non-PDCoV samples are also negative. 450nm The values were all below the PDCoV positive threshold (0.253) and had a clear boundary with the OD value of positive samples (difference ≥0.032), which can accurately identify PDCoV-specific IgA antibodies in breast milk samples and will not cause false positives due to infection by other common pathogens in the pig herd.
[0089] As mentioned above, traditional indirect ELISA methods based on the N protein are prone to cross-reactivity between the antigens of PDCoV and PEDV due to conserved or similar epitopes. While the M protein is highly conserved, it induces antibodies with poor specificity and is prone to cross-reactivity with porcine epidemic diarrhea virus, making it unsuitable as a diagnostic antigen. Although using the S1 protein as the antigen offers high specificity and stability, it only detects IgG antibodies, failing to cover the early IgA response and limiting its diagnostic accuracy for acute infections and interference from maternal antibodies in piglets.
[0090] Therefore, this invention combines multiple advantages such as specificity, stability, and the specificity of IgA, and has unparalleled advantages over existing indirect ELISA methods for PDCoV.
[0091] 2. The highest detection dilution ratio for PDCoV-positive breast milk samples reached 1:3200 after serial dilution, demonstrating accurate detection even at extremely low IgA antibody levels. This indicates that the method is also suitable for detecting early-infected or low-immunity pig herds. Furthermore, this method is not only highly stable (within-assay coefficient of variation of 1.848%–6.062%, and between-assay coefficient of variation of 4.504%–7.790%), but also exhibits a 93.26% concordance rate with immunofluorescence assays. While ensuring repeatability and maintaining high concordance, it also combines the advantages of ELISA methods—simple operation, short processing time, and high throughput—making it suitable for large-scale screening of clinical pig milk samples.
[0092] In summary, the indirect ELISA detection method for IgA based on the RBD eukaryotic recombinant protein of PDCoV established in this invention has the advantages of high specificity, high sensitivity, good stability and high detection fidelity. It lays the foundation for the development of commercial detection kits for PDCoV-specific IgA antibodies in porcine milk and provides technical support for the prevention and control of PDCoV.
[0093] It will be apparent to those skilled in the art that the present invention is not limited to the details of the exemplary embodiments described above, and that the invention can be implemented in other specific forms without departing from its spirit or essential characteristics. Therefore, the embodiments should be considered in all respects as exemplary and non-limiting, and the scope of the invention is defined by the appended claims rather than the foregoing description. Thus, all variations falling within the meaning and scope of equivalents of the claims are intended to be included within the present invention. No reference numerals in the claims should be construed as limiting the scope of the claims.
Claims
1. The purpose of preparing an indirect ELISA detection kit for detecting porcine deltacoronavirus using recombinant RBD protein; the amino acid sequence of the recombinant RBD protein is shown in SEQ ID NO.
1.
2. The use according to claim 1, characterized in that, The indirect ELISA detection kit is designed to detect pig breast milk.
3. An IgA indirect ELISA detection kit, characterized in that, The antigen in the kit is a recombinant RBD protein; the amino acid sequence of the recombinant RBD protein is shown in SEQ ID NO.1.
Citation Information
Patent Citations
Indirect ELISA kit for rapidly detecting porcine epidemic diarrhea virus IgA antibody and application thereof
CN119661660A
ELISA method for detecting porcine epidemic diarrhea virus antibody SIgA
CN116466079A