Method for identifying or assisting in identifying the glycerol triester content of duck skin and related compositions and applications

Abstract

The application discloses a method for identifying or assisting in identifying the glycerol triester content of duck skin fat and related compositions and applications, and belongs to the field of nucleic acid determination methods. The method for identifying or assisting in identifying the glycerol triester content of duck skin fat comprises the following steps: detecting the genotype of a specific SNP site of a to-be-detected duck, and identifying or assisting in identifying the glycerol triester content of the duck skin fat of the to-be-detected duck according to the genotype of the specific SNP site of the to-be-detected duck. The specific SNP site is an SNP site in a duck genome, the nucleotide type of which is T or C, and is the 70th nucleotide in SEQ ID No. 1. The application can perform early selection on the glycerol triester content of duck skin fat, improve the duck breeding efficiency, and shorten the breeding cycle.

Description

Technical Field

[0001] This invention relates to the field of methods for determining nucleic acids, and particularly to methods, related compositions and applications for identifying or assisting in the identification of triglyceride content in duck skin fat. Background Technology

[0002] Duck meat is one of the major meat consumption categories, second only to pork and chicken in terms of production volume. Different duck breeds exhibit significant differences in skin fat percentage, leading to different cooking methods and thus meeting diverse market demands. For Peking duck to achieve its unique flavor and quality, a skin fat percentage of over 35% is often required; while for foods like salted duck, a lower skin fat content is sufficient. Skin fat deposition in ducks primarily stems from the accumulation of fat (i.e., triglycerides) in subcutaneous fat cells.

[0003] Triglycerides are neutral lipids formed by the dehydration condensation of glycerol with three fatty acid molecules through their three hydroxyl groups. As a major component of very low-density lipoproteins and chylomicrons, triglycerides play a crucial role in metabolism and energy homeostasis. Their energy density is twice that of carbohydrates and proteins, making them an excellent form of energy storage. Ducks, with their exceptionally strong lipid synthesis capacity, are representative species for studying fat deposition. Significant differences exist between the Beijing duck and the Liancheng white duck in their fat deposition capacity; non-targeted lipidomics analysis showed that the subcutaneous fat triglyceride content of the Beijing duck was significantly higher than that of the Liancheng white duck.

[0004] Molecular marker-assisted breeding technology has been widely applied in the cultivation of new varieties of plants and animals. Genome-wide association studies can identify molecular markers closely linked to target traits, allowing for early selection of these traits and significantly reducing breeding costs while accelerating genetic progress. However, currently, there are no molecular markers associated with increasing triglyceride content in duck meat. Summary of the Invention

[0005] One of the technical problems to be solved by the present invention is how to identify or assist in the identification of the content of duck skin fat triglycerides TG (10:0_16:0_18:3) (PubChem ID: 164334463).

[0006] To address the aforementioned technical problems, this invention first provides a method for identifying or assisting in the identification of duck subcutaneous triglyceride (TG) content (10:0_16:0_18:3), comprising the steps of detecting the genotype of a specific SNP locus in the duck to be tested, and identifying or assisting in the identification of the duck subcutaneous triglyceride (TG) content (10:0_16:0_18:3) content based on the genotype of the specific SNP locus in the duck to be tested; wherein the specific SNP locus is a SNP locus in the duck genome, and its nucleotide type is T or C, which is the 70th nucleotide of SEQ ID No. 1.

[0007] In the above method, the detection is performed using PCR primers, which are composed of single-stranded DNA with nucleotide sequence SEQ ID No. 2 and single-stranded DNA with nucleotide sequence SEQ ID No. 3.

[0008] In the above method, the step of identifying or assisting in the identification of the duck's subcutaneous triglyceride (TG) content based on the genotype of the duck to be tested can be that the subcutaneous triglyceride (TG) content of the duck to be tested with genotype TT is higher or candidate higher than that of the duck to be tested with genotype TC or CC, and the subcutaneous triglyceride (TG) content of the duck to be tested with genotype TC is higher than that of the duck to be tested with genotype TC. The content of duck subcutaneous triglycerides (TG) (10:0_16:0_18:3) was higher than or candidate higher than the content of duck subcutaneous triglycerides (TG) (10:0_16:0_18:3) in the tested ducks with genotype CC; TT is a homozygous type of the specific SNP site T in the duck genome, CC is a homozygous type of the specific SNP site C in the duck genome, and TC is a heterozygous type of the specific SNP sites T and C in the duck genome.

[0009] To address the aforementioned technical problems, the present invention also provides a composition for detecting polymorphisms or genotypes (i.e., alleles) of specific SNP sites in the duck genome, the composition being used in any of the following ways:

[0010] Q1. Detect single nucleotide polymorphisms or genotypes associated with the content of triglycerides in duck skin fat;

[0011] Q2. To identify or assist in the identification of the content of triglycerides in duck skin fat;

[0012] Q3. Duck breeding;

[0013] The specific SNP site is a SNP site in the duck genome, and its nucleotide type is T or C, which is the 70th nucleotide of SEQ ID No. 1; the composition contains the PCR primers.

[0014] In the above composition, the composition comprises PCR primers, which are composed of single-stranded DNA with nucleotide sequence SEQ ID No. 2 and single-stranded DNA with nucleotide sequence SEQ ID No. 3.

[0015] In the above composition, the indicators for duck breeding include the content of duck skin polyglycerides.

[0016] In some embodiments of the present invention, the duck breeding is parental hybridization breeding, and the purpose of the duck breeding includes selecting ducks with high (higher than the parent) content of duck skin polyglycerol triglyceride TG (10:0_16:0_18:3) or low (lower than the parent) content of duck skin polyglycerol triglyceride TG (10:0_16:0_18:3).

[0017] The aforementioned parental hybridization breeding refers to a breeding method that involves crossing the male and female parents and selecting new varieties from their offspring (hybrids) that combine the superior traits of both parents.

[0018] Another technical problem that this invention aims to solve is how to breed ducks.

[0019] To solve the above-mentioned technical problems, the present invention provides a method for breeding ducks with high levels of duck sebaceous triglyceride (TG) (10:0_16:0_18:3), comprising: detecting the polymorphism of a specific SNP in the duck genome, selecting a homozygous duck with the specific SNP site T in the duck genome as a parent, and breeding ducks with a higher level of duck sebaceous triglyceride (TG) (10:0_16:0_18:3) than the parent, thereby obtaining ducks with high levels of duck sebaceous triglyceride (TG) (10:0_16:0_18:3).

[0020] To address the aforementioned technical problems, this invention provides a method for breeding ducks with low levels of duck subcutaneous triglycerides (TG) (10:0_16:0_18:3), comprising: detecting the polymorphism of a specific SNP in the duck genome; selecting a homozygous duck with the specific SNP site C in the duck genome as a parent to breed ducks with lower levels of duck subcutaneous triglycerides (TG) (10:0_16:0_18:3) than the parent, thereby obtaining ducks with low levels of duck subcutaneous triglycerides (TG) (10:0_16:0_18:3).

[0021] The application of the following composition for detecting specific SNP genotypes in the duck genome also falls within the scope of protection of this invention:

[0022] A1. Application in identifying or assisting in the identification of triglyceride content in duck skin fat;

[0023] A2. Application in the preparation of products for identification or auxiliary identification of duck skin fat triglyceride content;

[0024] A3. Applications in duck breeding or in the preparation of duck breeding products;

[0025] The specific SNP site is a SNP site in the duck genome, and its nucleotide type is T or C, which is the 70th nucleotide of SEQ ID No. 1.

[0026] The composition comprises PCR primers, which are composed of single-stranded DNA with nucleotide sequence SEQ ID No. 2 and single-stranded DNA with nucleotide sequence SEQ ID No. 3.

[0027] The genotype of the specific SNP site in the duck genome can be TT, TC, or CC. TT is the homozygous type of the specific SNP site T in the duck genome, CC is the homozygous type of the specific SNP site C in the duck genome, and TC is the heterozygous type of the specific SNP site T and C in the duck genome.

[0028] In the above applications, the duck breeding indicators in the above compositions include the content of duck skin polyglycerides.

[0029] In some embodiments of the present invention, the duck breeding is parental hybridization breeding, and the purpose of the duck breeding includes selecting ducks with high (higher than the parent) content of duck skin polyglycerol triglyceride TG (10:0_16:0_18:3) or low (lower than the parent) content of duck skin polyglycerol triglyceride TG (10:0_16:0_18:3).

[0030] The aforementioned parental hybridization breeding refers to a breeding method that involves crossing the male and female parents and selecting new varieties from their offspring (hybrids) that combine the superior traits of both parents.

[0031] In the above methods, compositions, and references, the composition for detecting polymorphisms or genotypes (i.e., alleles) of specific SNP sites in the duck genome can be reagents and / or instruments required to determine the polymorphisms or genotypes of specific SNPs by at least one of the following methods: DNA sequencing, restriction enzyme fragment protein content polymorphism, single-strand conformation polymorphism, denaturing high-performance liquid chromatography, and SNP chips. The SNP chips include chips based on nucleic acid hybridization reactions, chips based on single-base extension reactions, chips based on allele-specific primer extension reactions, chips based on "one-step" reactions, chips based on primer ligation reactions, chips based on restriction endonuclease reactions, chips based on protein-DNA binding reactions, and chips based on fluorescent molecule-DNA binding reactions.

[0032] In the above methods, compositions, and references, the composition for detecting polymorphisms or genotypes (i.e., alleles) of specific SNP sites in the duck genome is P1, P2, or P3 as follows:

[0033] P1. The composition for detecting polymorphism or genotype of specific SNP sites in the duck genome contains PCR primers for amplifying duck genomic DNA fragments including the specific SNP sites.

[0034] P2. The composition for detecting polymorphisms or genotypes of specific SNP sites in the duck genome is a PCR reagent containing the PCR primers.

[0035] P3, a kit containing the PCR primers described in P1 or the PCR reagents described in P2.

[0036] In the methods, compositions, and references described above, the PCR primers may be labeled with a marker. The marker refers to any atom or molecule that can be used to provide a detectable effect and can be linked to nucleic acids. Markers include, but are not limited to, dyes; radioactive markers, such as… 32 P; binding moieties, such as biotin; haptens, such as digoxigenin (DIG); luminescent, phosphorescent, or fluorescent moieties; and fluorescent dyes alone or in combination with moieties whose emission spectra can be inhibited or shifted by fluorescence resonance energy transfer (FRET). The label can provide a signal detectable by fluorescence, radioactivity, colorimetry, gravimetric determination, X-ray diffraction or absorption, magnetism, enzyme activity, etc. The label can be a charged moieties (positive or negative) or, optionally, charge-neutral. The label can include nucleic acid or protein sequences or combinations thereof, provided that the sequence containing the label is detectable. In some embodiments, nucleic acids are detected directly without labeling (e.g., direct sequence reading). PCR primers as described can consist of single-stranded DNA with the nucleotide sequence of SEQ ID No. 2 and single-stranded DNA with the nucleotide sequence of SEQ ID No. 3.

[0037] The present invention also provides reagents or kits, said reagents or kits being used for any of the following purposes:

[0038] Q1. Detect single nucleotide polymorphisms or genotypes associated with the content of triglycerides in duck skin fat;

[0039] Q2. To identify or assist in the identification of the content of triglycerides in duck skin fat;

[0040] Q3. Duck breeding;

[0041] The reagent or kit contains the above-described composition.

[0042] The ducks mentioned above are meat ducks. The ducks are small-sized meat ducks. The meat ducks can be local breeds such as Beijing ducks, Shaoxing ducks, Liancheng white ducks, or Putian black ducks, or their hybrid offspring. For example, in one embodiment of the present invention, it is a hybrid offspring of Beijing ducks and Liancheng white ducks.

[0043] The molecular markers described in this invention were obtained through genome-wide association studies (GWAS). The specific SNP molecular markers of this invention are associated with the duck subcutaneous triglyceride (TG) content trait (10:0-16:0-18:3). By determining the genotype of the specific SNP in the duck to be tested, early selection for the duck subcutaneous triglyceride (TG) content trait can save production costs, increase or decrease subcutaneous triglyceride (TG) content (10:0-16:0-18:3), accelerate genetic progress, improve duck breeding efficiency, and shorten the breeding cycle. Attached Figure Description

[0044] Figure 1 This is the genome-wide association result of TG (10:0_16:0_18:3) in the skin fat of ducks in Example 1 of this invention. In the figure, chr14: 7185833 (position 7185833 on chromosome 14) is the location of the specific SNP. Detailed Implementation

[0045] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0046] Unless otherwise specified, the experimental methods in the following embodiments are conventional methods, performed in accordance with the techniques or conditions described in the literature in this field or in accordance with the product instructions.

[0047] Unless otherwise specified, all materials and reagents used in the following examples are commercially available. All quantitative experiments in the following examples were performed in triplicate, and the results were averaged.

[0048] Example 1: Determination of the correlation between specific SNPs and the content of sebum triglycerides (TG) (10:0-16:0-18:3)

[0049] Experimental animals: 381 individuals from a bloodline gradient group of Beijing ducks and Liancheng white ducks from the Changping Experimental Base of the Beijing Institute of Animal Husbandry and Veterinary Medicine, Chinese Academy of Agricultural Sciences.

[0050] In this embodiment, triglyceride (TG) (10:0_16:0_18:3) was used as a marker indicator, and a correlation analysis was performed between significantly associated molecular markers and triglyceride (TG) (10:0_16:0_18:3) content, as detailed below:

[0051] I. Determination of Triglyceride (TG) Content in Sebum (10:0, 16:0, 18:3)

[0052] Under the same feeding conditions, the ducks were fed a growing-age diet (Table 1) until they reached 6 weeks of age. 2g samples of subcutaneous fat were collected from 381 healthy ducks and frozen in liquid nitrogen.

[0053] Mobile phases were prepared as follows: Phase A was acetonitrile / water (60 / 40, V / V) (containing 0.1% formic acid and 10 mmol / L ammonium formate); Phase B was acetonitrile / isopropanol (10 / 90, V / V) (containing 0.1% formic acid and 10 mmol / L ammonium formate).

[0054] Sample pretreatment: After thawing the sample at 4 °C, weigh 20 ± 1 mg and add it to a numbered 2 mL centrifuge tube. Then add 1 mL of lipid extraction buffer (methyl tert-butyl ether: methanol = 10:3, V / V), shake well, and add a steel ball. Homogenize using a tissue homogenizer. Remove the steel ball, vortex for 5 min, add 250 μL of water, and vortex for another 5 min. Then centrifuge at 12000 r / min and 4 °C for 10 min. Transfer 300 μL of the supernatant to a numbered 1.5 mL centrifuge tube and purge with nitrogen. Finally, reconstitute with 1 mL of organic reagent mixture (dichloromethane: methanol = 2:1, V / V) for use in liquid chromatography-mass spectrometry (LC-MS).

[0055] HPLC and mass spectrometry parameters were set as follows: Ultra-high performance liquid chromatography (ExionLC AD) was used for chromatographic separation. The chromatographic column was an ACQUITY Premier HSS T3 column (1.8 μm, 2.1 mm × 100 mm) and the column temperature was maintained at 50 ℃. The flow rate was controlled at 0.30 ml / min and the injection volume was 2 μL.

[0056] The mobile phase gradient settings are shown in Table 1:

[0057] Table 1. Mobile phase gradient

[0058]

[0059] II. Detection of SNP molecular markers

[0060] 1. Blood sample collection: Collect venous blood from the duck wings using heparin sodium anticoagulant blood collection tubes and store at -20℃ for later use.

[0061] 2. Whole blood genomic DNA extraction: The specific operation method is as follows: refer to the instruction manual of the blood genomic DNA extraction kit (Tiangen Biotech (Beijing) Co., Ltd., DP319).

[0062] 3. Genotyping: Genomic DNA was collected from each duck to be tested, and whole-genome resequencing was performed on each individual using Illumina's HiSeq X-Ten sequencing platform. The sequencing depth for each individual was approximately 5×, following the standard operating procedures provided by Illumina. After quality control, the data were sequenced and genotypes extracted using two bioinformatics software programs: BWA and GATK.

[0063] III. Genome-wide association analysis of sebum triglycerides (TG) (10:0, 16:0, 18:3)

[0064] Genome-wide association analysis of sebum triglycerides (TG) (10:0, 16:0, 18:3) and genotypes was performed using a mixed linear model in GEMMA software. The results of the association analysis are shown in the figure below. Figure 1 The horizontal axis represents chromosome number, and the vertical axis represents -log. 10 (P).

[0065] A SNP significantly associated with the triglyceride (TG) trait (10:0_16:0_18:3) was discovered, located at nucleotide 7185833 on chromosome 14. Therefore, this SNP was named "chr14: 7185833 site SNP", and for brevity, it will be referred to as the specific SNP from now on.

[0066] The specific SNP site is nucleotide 70 of SEQ ID No. 1, and its nucleotide type is either T or C, represented by the letter Y. One allele is TT (i.e., homozygous for T at nucleotide 70 of SEQ ID No. 1), and this type of duck has a high duck skin fat triglyceride (TG) content (10:0_16:0_18:3); another allele is TC (i.e., heterozygous for both T and C at nucleotide 70 of SEQ ID No. 1), and this type of duck has a medium duck skin fat triglyceride (TG) content (10:0_16:0_18:3); the third allele is CC (i.e., homozygous for C at nucleotide 70 of SEQ ID No. 1), and this type of duck has a low duck skin fat triglyceride (TG) content (10:0_16:0_18:3).

[0067] SEQ ID No. 1:

[0068] TTGCTGGCATTTTACCCGGAATGCTTGGCTCCAGCTGGCAGCGGACAGGGGAGGATTTGAGCAACTCTGYAGTGATGAATTGGTGCTGGTGCTTTACTCA

[0069] Design a primer pair based on a specific SNP, consisting of F1 and R1:

[0070] F1: 5'-TTGCTGGCATTTTACCCGGA-3' (as shown in SEQ ID No. 2, the sequence of positions 1-20 is the same as that of SEQ ID No. 1);

[0071] R1: 5'- TGAGTAAAGCACCAGCACCA -3' (as shown in SEQ ID No. 3, the reverse complementary sequence of positions 81-100 of SEQ ID No. 1).

[0072] The raw material composition of the feed used to raise Beijing ducks in this embodiment is shown in Table 2. The mass percentage of the nutrient levels in the feed is as follows: crude protein 17.59%, metabolizable energy 12.64 MJ, lysine 0.91%, methionine 0.4%, calcium 0.99%, and phosphorus 0.42%.

[0073] Table 2. Raw material composition of feed

[0074]

[0075] The premix provides the following per kilogram of feed: Vitamin A 8000 IU, Vitamin D3 3000 IU, Vitamin E 20 IU, Vitamin K3 2 mg, Vitamin B1 0.65 mg, Vitamin B2 2.21 mg, Pantothenic acid 3.51 mg, Niacin 19.8 mg, Pyridoxine 3.25 mg, Biotin 0.20 mg, Folic acid 0.28 mg, Vitamin B12 0.02 mg, Manganese 80 mg, Iron 60 mg, Copper 10 mg, Zinc 60 mg, Iodine 1.0 mg, Selenium 0.3 mg.

[0076] Example 2: Application of specific SNPs in the genetic improvement of the trait of sebum triglyceride (TG) content (10:0_16:0_18:3)

[0077] Individuals from a genetic gradient population of Beijing ducks and Liancheng white ducks (hybrid offspring of Beijing ducks and Liancheng white ducks) from the Changping Experimental Base of the Beijing Institute of Animal Husbandry and Veterinary Medicine, Chinese Academy of Agricultural Sciences, were fed under the same feeding conditions until they reached 6 weeks of age (42 days). The feed for meat duck rearing during this period is shown in Table 2. 381 healthy ducks were randomly selected for the following experiment.

[0078] I. Detection of genotypes based on specific SNP loci

[0079] 1. Blood sample collection

[0080] Blood was collected from the wing veins of 6-week-old experimental animals using heparin sodium anticoagulant blood collection tubes and stored at -20°C for later use.

[0081] 2. Extract genomic DNA

[0082] Take the venous blood obtained in step 1 and extract genomic DNA.

[0083] 3. Genotyping

[0084] Using the genomic DNA obtained in step 2 as a template, PCR amplification was performed using primers consisting of F1 and R1, and then the PCR amplification products were sequenced.

[0085] The PCR reaction system is as follows:

[0086] Table 3 PCR reaction system

[0087]

[0088] The PCR reaction conditions are as follows:

[0089] Table 4 PCR reaction conditions

[0090]

[0091] The results showed that PCR amplification products of 100 bp were obtained from all 381 experimental animals.

[0092] The PCR amplification products were recovered and sequenced. Based on specific SNPs, the 381 experimental animals were divided into three genotypes: TT genotype (304 experimental animals), TC genotype (60 experimental animals), and CC genotype (17 experimental animals).

[0093] II. Determination of triglyceride (TG) content in sebum (10:0, 16:0, 18:3)

[0094] Under the same feeding conditions, the ducks were fed a growing diet during this period, as shown in Table 1. 2g samples of subcutaneous fat were collected from 381 healthy ducks and frozen in liquid nitrogen.

[0095] Mobile phases were prepared as follows: Phase A was acetonitrile / water (60 / 40, V / V) (containing 0.1% formic acid and 10 mmol / L ammonium formate); Phase B was acetonitrile / isopropanol (10 / 90, V / V) (containing 0.1% formic acid and 10 mmol / L ammonium formate).

[0096] Sample pretreatment: After thawing the sample at 4 °C, weigh 20 ± 1 mg and add it to a numbered 2 mL centrifuge tube. Then add 1 mL of lipid extraction buffer (methyl tert-butyl ether: methanol = 10:3, V / V), shake well, and add a steel ball. Homogenize using a tissue homogenizer. Remove the steel ball, vortex for 5 min, add 250 μL of water, and vortex for another 5 min. Then centrifuge at 12000 r / min and 4 °C for 10 min. Transfer 300 μL of the supernatant to a numbered 1.5 mL centrifuge tube and purge with nitrogen. Finally, reconstitute with 1 mL of organic reagent mixture (dichloromethane: methanol = 2:1, V / V) for use in liquid chromatography-mass spectrometry (LC-MS).

[0097] HPLC and mass spectrometry parameters were set as follows: Ultra-high performance liquid chromatography (ExionLC AD) was used for chromatographic separation. The column was an ACQUITY Premier HSS T3 column (1.8 μm, 2.1 mm × 100 mm) and the column temperature was maintained at 50 ℃. The flow rate was controlled at 0.30 ml / min and the injection volume was 2 μL. The mobile phase gradient settings are shown in Table 1.

[0098] In LC-MS analysis, octadecanoic acid-D3(FA_C18:0-D3), 15:0_18:1-d7 PC, 15:0_18:1-d7 PE, 15:0_18:1-d7 PS, 15:0_18:1-d7 PI, 18:1-d7 LPE, 18:1-d7 LPC, CE 18:1-D7, 15:0-18:1-(d7) DAG, 15:0-18:1-(d7):15:0 ​​TAG, d18:1-18:1-(d9) SM 40. 1-Palmitoyl-(d9)-2-Arachidonoyl-3-Palmitoyl-sn-glycerol, DG(16:0-d9 / 16:0 / 0:0), TG(17:1 / 17:1 / 17:1)-d5 (Cayman Chemical products) were used as standards. Qualitative analysis was performed based on the retention time of the standards, and quantitative analysis was performed using the standard curve method (external standard method) for TG(10:0_16:0_18:3).

[0099] The relative contents of TG (10:0_16:0_18:3) in experimental animals of different genotypes are shown in Table 5.

[0100] Table 5. Relative TG (10:0, 16:0, 18:3) content in experimental animals of different genotypes

[0101]

[0102] Note: Different letters in the upper right corner of the data in the same column represent the results of the significance analysis. P <0.05.

[0103] In summary, the triglyceride (TG) content of duck skin fat in ducks with the genotype TT at the specific SNP locus described in this invention is significantly higher than that in ducks with the genotype TC or AA at the specific SNP locus described in this invention.

[0104] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

Claims

1. A method for identifying or assisting in the identification of triglyceride content in duck skin fat, characterized in that: The method includes the steps of detecting the genotype of a specific SNP site in the duck to be tested, and identifying or assisting in identifying the triglyceride content of duck skin fat based on the genotype of the specific SNP site in the duck to be tested; the specific SNP site is a SNP site in the duck genome, and its nucleotide type is T or C, which is the 70th nucleotide of SEQ ID No.

1.

2. The method according to claim 1, characterized in that: The detection is performed using PCR primers, which consist of single-stranded DNA with nucleotide sequence SEQ ID No. 2 and single-stranded DNA with nucleotide sequence SEQ ID No.

3.

3. A method for selecting ducks with high levels of triglycerides in duck skin, characterized by: The method includes: detecting the polymorphism of a specific SNP in the duck genome, selecting a homozygous duck with the specific SNP site T in the duck genome as a parent to breed ducks with higher levels of duck sebaceous polyglycerol triglycerides than the parent, thereby obtaining ducks with high levels of duck sebaceous polyglycerol triglycerides; the specific SNP is a SNP site in the duck genome, and its nucleotide type is T or C, which is the 70th nucleotide of SEQ ID No.

1.

4. A method for breeding ducks with low levels of triglycerides in duck skin fat, characterized by: The method includes: detecting the polymorphism of a specific SNP in the duck genome, selecting a homozygous duck with the specific SNP site C in the duck genome as a parent to breed ducks with lower subcutaneous polyglycerol content than the parent, thereby obtaining ducks with low subcutaneous polyglycerol content; the specific SNP is a SNP site in the duck genome, and its nucleotide type is T or C, which is the 70th nucleotide of SEQ ID No.

1.

5. The application of a composition for detecting specific SNP genotypes in the duck genome, characterized in that: The application is any one of A1-A3: A1. Application in identifying or assisting in the identification of triglyceride content in duck skin fat; A2. Application in the preparation of products for identification or auxiliary identification of duck skin fat triglyceride content; The specific SNP is a SNP site in the duck genome, and its nucleotide type is T or C, which is the 70th nucleotide of SEQ ID No.

1.

6. The application according to claim 5, characterized in that: The composition comprises PCR primers, which are composed of single-stranded DNA with nucleotide sequence SEQ ID No. 2 and single-stranded DNA with nucleotide sequence SEQ ID No. 3.

Images