Extraction method and application of bioactive extract of oryza / camellia plants

Abstract

The invention provides an extraction method of a bioactive extract of oryza / camellia plants, which comprises the following steps: (1) extracting crushed oryza / camellia plants by using a polar solvent, and separating to obtain a crude extract; (2) fermenting and purifying the crude extract under microorganisms to obtain a bioactive extract of oryza / camellia plants; the invention also relates to an application of the bioactive extract of the oryza / camellia plant obtained by the extraction method in preparation of a composition for skin care products and / or in preparation of a composition for stomach health products and / or in preparation of a composition for aquaculture food products, and also relates to an application of the bioactive extract of the oryza / camellia plant obtained by the extraction method in preparation of a composition for skin care products and / or a composition for stomach health products and / or in preparation of a composition for aquaculture food products. Meanwhile, the invention also provides a composition. The composition comprises the bioactive extract of the oryza / camellia plant extracted by the extraction method.

Description

Technical Field

[0001] This invention relates to the field of plant active substance extraction technology, and in particular to a method for extracting bioactive extracts from plants of the genera Orychophragmus and Camellia, and their applications. Background Technology

[0002] Rice belongs to the Poaceae family and has two cultivated species: Asian rice (Oryza sativa) and African rice (Oryza glaberrima). As a cereal crop, rice is grown globally and is the staple food source for more than half of the world's population. Before being consumed by humans, rice grains are typically dried, then milled to remove the outer layers—the husk and bran, which consist mainly of insoluble fiber—and to separate the carbohydrate-rich endosperm.

[0003] Rice bran is typically discarded or used solely as animal feed. However, in recent years, it has been discovered that the rice bran layer contains a variety of phytochemicals and other bioactive compounds with broad potential health benefits. Rice bran is now known to contain various oils, vitamins, and minerals, possessing antioxidant, anti-inflammatory, and anti-cancer properties. For example, polyphenols, such as phenolic acids and flavonoids, have been found in rice bran oil. These chemicals are believed to have health-promoting effects, including antioxidant, antibacterial, anti-cancer, cardioprotective, immune system-boosting, and anti-inflammatory effects, as well as skin-protecting effects against UV radiation.

[0004] Camellia plants, including tea trees or green tea, also possess health-promoting properties. Camellia plants typically grow in tropical and subtropical climates (such as China, Japan, and Korea), and their leaves, buds, or stems are used to prepare tea and other beverages. Camellia flowers, in particular, have been used in traditional herbal medicine to treat a variety of ailments, from promoting wound healing, aiding digestion, improving heart and mental health, to regulating body temperature. These uses suggest that the plant may contain a large number of bioactive compounds with therapeutic and / or regenerative activities. Certain bioactive compounds have been found in camellia (Camellia sinensis) plants, such as the aforementioned phenolic acids and flavonoids, as well as caffeine, vitamins, minerals, amino acids including L-theanine, and trace elements such as magnesium, iron, copper, phosphorus, potassium, calcium, selenium, zinc, and chromium.

[0005] Various methods exist for extracting bioactive compounds from rice and camellia. However, given the diversity of the molecular structures and related solubility distributions of these bioactive compounds, existing extraction techniques inevitably only recover a subset of the compounds present in the plants. For example, crude rice bran oil is known to contain a variety of bioactive compounds, only a portion of which are saponifiable; therefore, we believe that rice bran oil extracted using conventional techniques fails to contain a large amount of unsaponifiable substances that may have beneficial physiological effects on the human body.

[0006] Furthermore, conventional extraction methods for rice and camellia involve solvents or solvent mixtures, such as acetone, acetic acid, or acidified methanol. These solvents are difficult to remove from the extracts and pose a potential hazard to human cells. In other words, the solvents used in these methods should not be included in formulations intended for animals, and especially for humans. In addition, conventional extraction methods often involve harsh conditions, such as high temperatures, which can denature or degrade bioactive compounds into less effective or inactive forms.

[0007] Therefore, developing a new process for extracting bioactive compounds from plants of the Oryza and / or Camellia genera is a technical problem that urgently needs to be solved. Summary of the Invention

[0008] In view of the shortcomings of the prior art described above, the purpose of this invention is to provide a method for extracting bioactive extracts from plants of the genera *Orychophragmus* and *Camellia*, thereby improving the bioavailability of bioactive compounds in these plants and obtaining bioactive extracts that are beneficial to skin health, animal gastric mucosa repair, and aquaculture weight gain.

[0009] To achieve the above and other related objectives, the present invention provides a method for extracting bioactive extracts from plants of the genera *Oryza* and *Camellia*, comprising the following steps:

[0010] (1) Extracting crushed rice / camellia plants with a polar solvent to obtain crude extract;

[0011] (2) The crude extract was fermented and purified under microbial conditions to obtain bioactive extracts of rice / camellia plants.

[0012] The present invention also provides a bioactive extract of rice / camellia plants obtained by the extraction method described above.

[0013] The present invention also provides the use of the bioactive extract of the Oryza / Camellia plants as described above in the preparation of any one or more of the following compositions.

[0014] A) Compositions for use in skin care products;

[0015] B) Compositions for use in stomach health products;

[0016] C) Compositions for use in aquaculture food products.

[0017] The present invention also provides a composition comprising a bioactive extract of a plant of the genus *Oryza* or *Camellia* as described above, wherein the bioactive extract has a mass concentration of 0.1 to 10% w / v in the composition.

[0018] As described above, the extraction method and application of bioactive extracts from Oryza / Camellia plants of the present invention have the following beneficial effects:

[0019] The extraction method of the present invention uses polar solvents to extract bioactive compounds that are usually degraded in conventional extraction processes in the prior art, and improves the bioavailability of bioactive compounds through a fermentation step, so that bioactive compounds with potential physiological and biochemical activities can be effectively and cost-effectively extracted and utilized.

[0020] The bioactive extract obtained by the extraction method of this invention can induce the synthesis of collagen and elastin in dermal fibroblasts, thereby improving the strength, elasticity, toughness, pigmentation and overall appearance of the skin; and the bioactive extract obtained by the extraction method of this invention is beneficial for repairing the gastric mucosa of animals and helps to increase the weight of aquaculture animals. Attached Figure Description

[0021] Figure 1 This is a schematic diagram showing the mRNA expression levels of collagen type 1 and collagen type 3 in fibroblasts treated with bioactive extracts in Example 2 of the present invention.

[0022] Figure 2 The following is a schematic diagram of the H&E staining results of the 3-D skin model in Example 3 of the present invention: (a) Control group: cultured without bioactive extract; (b) Treatment group: cultured with bioactive extract.

[0023] Figure 3 The diagram shows the results of Masson trichrome staining of mouse skin samples in Example 3 of the present invention: (a) Control group: cream without bioactive extract applied; (b) Treatment group: cream containing bioactive extract applied.

[0024] Figure 4 The following is a schematic diagram of the immunofluorescence staining results of mouse skin samples in Example 3 of the present invention: (a) Control group: cream without bioactive extract applied; (b) Treatment group: cream containing bioactive extract applied; wherein, the nuclei of background cells were stained with DAPI (blue).

[0025] Figure 5 a is a schematic diagram of the hydration levels of mouse skin on day 14 and day 28 after applying the cream in Example 4 of the present invention; Figure 5 b shows the skin strength of mice on days 14 and 28 after applying the cream (*p<0.05, ***p<0.005, n=6).

[0026] Figure 6The following is a schematic diagram of the skin elasticity of mice on day 14 and day 28 after applying the cream in Example 4 of the present invention: (a) Total elasticity R2 = the ratio of complete relaxation to immediate penetration after suction; (b) Net elasticity R5 = the ratio of the elastic portion during the suction phase to the immediate recovery during the relaxation phase; (c) Bioelasticity R7 = the ratio of the elastic portion during the suction phase to the immediate recovery after maximum penetration during the relaxation phase; *p<0.05, **p<0.01.

[0027] Figure 7 The diagram shows the epidermal thickness of mice after 14 days of treatment in Example 4 of this invention: (a) Treatment group: cream containing bioactive extract applied; (b) Control group: cream without bioactive extract applied.

[0028] Figure 8 a is a schematic diagram of collagen distribution in skin sections of mice treated with cream containing bioactive extracts; Figure 8 b is a schematic diagram of collagen distribution in skin sections of mice treated with creams containing no bioactive extracts; Figure 8 c is a schematic diagram of the total collagen levels in mouse skin on days 14 and 28 after treatment. ***p<0.005,****p<0.001. Detailed Implementation

[0029] The following specific examples illustrate the implementation of the present invention. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and various details in this specification can also be modified or changed based on different viewpoints and applications without departing from the spirit of the present invention.

[0030] When a numerical range is disclosed herein, the range is considered continuous and includes the minimum and maximum values ​​of the range, as well as every value between the minimum and maximum values. Furthermore, when the range refers to an integer, it includes every integer between the minimum and maximum values ​​of the range. Additionally, when multiple ranges are provided to describe a feature or characteristic, the ranges may be combined. In other words, unless otherwise specified, all ranges disclosed herein should be understood to include any and all subranges to which they are included. For example, a specified range from “1 to 10” should be considered to include any and all subranges between the minimum value 1 and the maximum value 10. Exemplary subranges of the range 1 to 10 include, but are not limited to, 1 to 6.1, 3.5 to 7.8, 5.5 to 10, etc.

[0031] Furthermore, it should be understood that the one or more method steps mentioned in this invention do not preclude the existence of other method steps before or after the combined steps, or the insertion of other method steps between these explicitly mentioned steps, unless otherwise stated; moreover, unless otherwise stated, the numbering of each method step is merely a convenient tool for identifying each method step, and not for limiting the order of the method steps or limiting the scope of the invention. Changes or adjustments to their relative relationships, without substantially altering the technical content, should also be considered as within the scope of the invention.

[0032] Please refer to the accompanying drawings. It should be noted that the illustrations provided in this embodiment are only schematic representations of the basic concept of the present invention. Therefore, the drawings only show the components related to the present invention and are not drawn according to the actual number, shape and size of the components in the actual implementation. In the actual implementation, the form, quantity and proportion of each component can be arbitrarily changed, and the layout of the components may also be more complex.

[0033] The first aspect of this invention provides a method for extracting bioactive extracts from plants of the genera *Oryza* and *Camellia*, comprising the following steps:

[0034] (1) Extracting crushed rice / camellia plants with a polar solvent to obtain crude extract;

[0035] (2) The crude extract was fermented and purified under microbial conditions to obtain bioactive extracts of rice / camellia plants.

[0036] This invention utilizes polar solvents under specific controlled conditions to extract active ingredients from rice and / or camellia plants. This method facilitates the gentle extraction of bioactive compounds, thereby minimizing the degradation of these active ingredients during the extraction process. Crushed plant material is contacted with a polar solvent to extract chemical components from the plant material, including bioactive compounds that are soluble in the polar solvent. The remaining plant solids are separated from the liquid (i.e., the polar solvent) to obtain a crude extract. The crude extract is then fermented with microorganisms (such as yeast) to digest any large chemical compounds (e.g., proteins, peptides, or carbohydrates) into smaller chemical compounds (e.g., amino acids or sugars) for easier absorption when provided to the recipient (e.g., in skincare products).

[0037] The term "plant debris" refers to all or part of a plant containing bioactive components. Plant debris includes, but is not limited to, husks, bran, leaves, stems, bark, roots, flowers, fruits, cuttings, cells, and combinations thereof. In some embodiments, plant debris may be bran, leaves, and / or stems. In some embodiments, plant debris contains at least 60–90%, 60–70%, 70–80%, or 80–90% of the dry weight of plant bran, leaves, and / or stems.

[0038] The term "bioactive extract" refers to an active ingredient capable of influencing the inherent biological pathways of a host, such as by inducing or inhibiting physiological pathways, including upregulating or downregulating protein synthesis, such as collagen and / or elastin synthesis. Bioactive extracts include proteins, minerals, vitamins, and phytochemicals, such as phenolic compounds (e.g., catechins, flavonoids, anthocyanins, and phenolic acids). In some embodiments, the extract contains bioactive compounds capable of upregulating (also referred to herein as inducing) collagen and / or elastin synthesis. In some embodiments, the extract contains at least three, at least four, at least five, or at least six bioactive compounds capable of upregulating collagen and / or elastin synthesis. The bioactive extract also contains other plant products and byproducts, optionally including polar solvents (e.g., water). The term "other plant products and byproducts" refers to natural byproducts and other substances generated during the extraction process, which may include hydrocarbons, amino acids, chlorophyll, or any other bioactive compounds. Other plant products and byproducts present in the extract include, but are not limited to, alkaloids, glycosides, steroids, triterpenoids, tannins, flavonoids, and proteins. These plant products and byproducts are typically components soluble in polar solvents. Plant solids (i.e., fibrous plant material or pulp) are not within the scope of this term.

[0039] In the extraction method of the present invention, the extraction time in step (1) is 10 min to 120 min. For example, it is 10 to 20 min, 20 to 30 min, 30 to 40 min, 40 to 50 min, 50 to 60 min, 60 to 70 min, 70 to 80 min, 80 to 90 min, 90 to 100 min, 100 to 110 min, or 110 to 120 min.

[0040] The extraction temperature in step (1) is 50–120°C. For example, it is 50–60°C, 60–70°C, 70–80°C, 80–90°C, 90–100°C, 100–110°C, or 110–120°C.

[0041] In the extraction method of the present invention, the polar solvent in step (1) is selected from one or more of water and polar organic solvents.

[0042] Using water as a polar solvent is advantageous because it is inexpensive, readily available, and safe, making it suitable for further application of extracts in pharmaceutical and cosmetic products. In some embodiments, water extraction is performed under vacuum. The pressure is 1–20 mbar. For example, it is 1–2 mbar, 2–4 mbar, 4–6 mbar, 6–8 mbar, 8–10 mbar, 10–12 mbar, 12–14 mbar, 14–16 mbar, 16–18 mbar, or 18–20 mbar.

[0043] The polar solvent is selected from short-chain polar organic solvents of C1 to C6. Examples include linear or branched short-chain alcohols (C1 to C6 alcohols, such as methanol, ethanol, and isopropanol), glycerol, and acetone. In some embodiments, combinations of solvents, such as water and alcohol, can be used to produce an aqueous alcohol extract, or water and glycerol to produce an aqueous glycerol extract. In other embodiments, sequential extraction using different solvents can be employed, and the extracts can be combined.

[0044] Due to the significant differences in the types and compositions of bioactive compounds in plant materials, particularly in Asian rice and tea plant materials, extraction efficiency can be affected by extraction techniques and conditions. Various methods for extracting bioactive compounds from Asian rice and tea plant materials are known, including both conventional and advanced extraction methods. Conventional extraction methods include, but are not limited to, decoction, soaking, stirring, or maceration; these methods are based on the diffusion of bioactive compounds from the plant material into the solvent. Advanced extraction methods include, but are not limited to, ultrasound-assisted extraction, microwave-assisted extraction, supercritical fluid extraction, and ultra-high pressure extraction; these techniques may offer advantages in increasing extraction efficiency or shortening extraction time. In summary, factors affecting extraction efficiency include the type of solvent used, stirring conditions, pre-extraction time, extraction temperature, extraction time, sample-to-solvent ratio, initial plant material particle size, and extraction pH.

[0045] In the extraction process, a polar solvent comes into contact with plant debris to extract polar solvent-soluble compounds, which are then dissolved and mixed with the polar solvent. The extract is prepared using polar solvents such as water, ethanol, methanol, acetone, or mixtures thereof.

[0046] During extraction, stirring is used to enhance the efficiency of the extraction process. Stirring is provided by mechanical force, such as shaking, agitation, wading, rotation, or tumbling motion. In some embodiments, rotation or tumbling motion is used for stirring. The speed of the rotation or tumbling motion is 50–800 rpm. For example, it is 50–100 rpm, 100–150 rpm, 150–200 rpm, 200–250 rpm, 250–300 rpm, 300–350 rpm, 350–400 rpm, 400–450 rpm, 450–500 rpm, 500–550 rpm, 550–600 rpm, 600–650 rpm, 650–700 rpm, 700–750 rpm, or 750–800 rpm.

[0047] In the extraction method of this invention, the mass-to-volume ratio of the plant fragments to the polar solvent in step (1) is (1-20 kg): 100 L. For example, it could be (1-2 kg): 100 L, (2-3 kg): 100 L, (3-4 kg): 100 L, (4-5 kg): 100 L, (5-6 kg): 100 L, (6-7 kg): 100 L, (7-8 kg): 100 L, (8-9 kg): 100 L, (9-10 kg): 100 L, or (10-11 kg): 100 L. (11-12kg): 100L, (12-13kg): 100L, (13-14kg): 100L, (14-15kg): 100L, (15-16kg): 100L, (16-17kg): 100L, (17-18kg): 100L, (18-19kg): 100L or (19-20kg): 100L.

[0048] In the extraction method of the present invention, the rice plant mentioned in step (1) is selected from one or more of Asian rice (Oryza sativa L.) and African rice (Oryza glaberrema Steud.).

[0049] In the extraction method of the present invention, the Camellia plant mentioned in step (1) is selected from one or more of Camellia sinensis L. and Camellia oleifera Abel.

[0050] In the extraction method of this invention, the plant fragments described in step (1) can be processed by various methods known in the art, such as cutting, grinding, tearing, stirring, compacting, crushing, or any other suitable mechanical force. Fragmentation of the plant increases the surface area of ​​the treated plant material. In one embodiment, the plant material is fragmented into pieces approximately 1 cm in size. 2 approximately 25cm 2 Fragments of plant material of various sizes. Fragmented plant material can be of any shape (e.g., square, rectangular, polygonal, circular, etc.). For example, fragmented plant material may have four sides of approximately equal length, about 1cm, 2cm, 3cm, 4cm, or 5cm, and have a surface area of ​​about 1 square centimeter to about 25 square centimeters. Alternatively, fragmented plant material may be approximately circular, with the longest dimension being about 1cm, 2cm, 3cm, 4cm, or 5cm, and also having a surface area of ​​about 1cm... 2 up to about 25cm 2The surface area. Devices suitable for fragmenting plant material are known in the art. Example devices suitable for this step include industrial or household grinding or milling machines, cutting or shearing devices (such as scissors, shears, etc.), or pulverizing devices (such as mortars and pestles). In one embodiment, a grinder is used.

[0051] In some embodiments, the plant scraps include bran from Asian rice (Oryza sativa L.) and African rice (Oryza glaberrema Steud.). In some embodiments, the plant scraps include leaves from tea plant (Camellia sinensis L.) and camellia oleifera Abel. In some embodiments, the plant scraps include bran from Asian rice (Oryza sativa L.) and African rice (Oryza glaberrema Steud.), as well as leaves from tea plant (Camellia sinensis L.) and camellia oleifera Abel.

[0052] In some embodiments, the plant scraps include bran from tea plant (Camellia sinensis L.) and Asian rice (Oryza sativa L.). In some embodiments, the plant scraps include bran from tea plant (Camellia sinensis L.) and African rice (Oryza glaberrema Steud.). In some embodiments, the plant scraps include bran from camellia oleifera (Camellia oleifera Abel.) and Asian rice (Oryza sativa L.). In some embodiments, the plant scraps include bran from camellia oleifera (Camellia oleifera Abel.) and African rice (Oryza glaberrema Steud.).

[0053] In a preferred embodiment, the plant scraps include tea leaves and Asian rice bran.

[0054] In the extraction method of the present invention, before soaking the fragments in step (1), a drying step is further included, specifically drying the fragments to a moisture content ≤15%. For example, ≤1%, 1-2%, 2-3%, 3-4%, 4-5%, 5-6%, 6-7%, 7-8%, 8-9%, 9-10%, 10-11%, 11-12%, 12-13%, 13-14%, or 14-15%. In a preferred embodiment of the present invention, the fragments are dried to a moisture content ≤10%. The drying can be performed by hot air drying, vacuum drying, freeze drying, microwave drying, etc.

[0055] In some embodiments, the shredded material in step (1) is dried using hot air. The hot air drying temperature is 50–120°C. For example, it is 50–55°C, 55–60°C, 60–65°C, 65–70°C, 70–75°C, 75–80°C, 80–85°C, 85–90°C, 90–95°C, 95–100°C, 100–105°C, 105–110°C, 110–115°C, or 115–120°C. The hot air drying time is 15–90 minutes. For example, 15-20 min, 20-25 min, 25-30 min, 30-35 min, 35-40 min, 40-45 min, 45-50 min, 50-55 min, 55-60 min, 60-65 min, 65-70 min, 70-75 min, 75-80 min, 80-85 min, or 85-90 min.

[0056] In some embodiments, the shredded material in step (1) is vacuum dried. The pressure of the vacuum drying is 100 to 1000 millibars. For example, it is 100 to 150 millibars, 150 to 200 millibars, 200 to 250 millibars, 250 to 300 millibars, 300 to 350 millibars, 350 to 400 millibars, 400 to 450 millibars, 450 to 500 millibars, 500 to 550 millibars, 550 to 600 millibars, 600 to 650 millibars, 650 to 700 millibars, 700 to 750 millibars, 750 to 800 millibars, 800 to 850 millibars, 850 to 900 millibars, 900 to 950 millibars, or 950 to 1000 millibars.

[0057] In the extraction method of the present invention, after the drying step, a crushing and grinding process is performed to grind the material until the particle size is ≤2000μm. For example, ≤100μm, 100~150μm, 150~200μm, 200~250μm, 250~300μm, 300~400μm, 400~500μm, 500~600μm, 600~700μm, 700~800μm, 800~900μm, 900~1000μm, 1000~1100μm, 1100~1200μm, 1200~1300μm, 1300~1400μm, 1400~1500μm, 1500~1600μm, 1600~1700μm, 1700~1800μm, 1800~1900μm, or 1900~2000μm. Grinding further reduces the particle size of plant debris, thereby improving the efficiency of downstream processes.

[0058] The grinding process can be carried out using a grinding machine or a milling machine.

[0059] In the extraction method of this invention, the crude extract is fermented in the presence of microorganisms to obtain the extract. Various fermentation methods are known, such as batch, open-system, and continuous fermentation. In batch fermentation, all the compounds to be fermented bind with microorganisms, which begin to consume any nutrients in the compounds. The microorganisms progress through a series of growth phases, including an adaptation phase (microorganisms adapt to the environment), an exponential growth phase (microorganisms grow exponentially), a slow growth phase (microorganisms grow non-exponentially), and a final plateau phase (microorganisms begin to die, i.e., all nutrients have been consumed). Factors affecting the fermentation rate and extent include microbial species, nutrient content, processing temperature, and container size.

[0060] In the extraction method of the present invention, the fermentation time in step (2) is 1 to 14 days. For example, it is 1 to 2 days, 2 to 3 days, 3 to 4 days, 4 to 5 days, 5 to 6 days, 6 to 7 days, 7 to 8 days, 8 to 9 days, 9 to 10 days, 10 to 11 days, 11 to 12 days, 12 to 13 days, or 13 to 14 days.

[0061] In the extraction method of the present invention, the fermentation temperature in step (2) is 7-25°C. For example, it is 7-8°C, 8-9°C, 9-10°C, 10-11°C, 11-12°C, 12-13°C, 13-14°C, 14-15°C, 15-16°C, 16-17°C, 17-18°C, 18-19°C, 19-20°C, 20-21°C, 21-22°C, 22-23°C, 23-24°C, or 24-25°C.

[0062] In the extraction method of the present invention, the microorganism in step (2) is a fungus. The fungus is selected from one or more of Aspergillus oryzae or Aspergillus sojae.

[0063] In a preferred embodiment of the present invention, the microorganism is Aspergillus oryzae: A. oryzae RIB40 or A. oryzae 14160.

[0064] In some embodiments, the crude extract contains monosaccharides and / or disaccharides, including but not limited to glucose, fructose, galactose, sucrose, xylose, mannose, arabinose, and ribose.

[0065] In some embodiments, at the start of fermentation, the total monosaccharide content of the crude extract is approximately 0.1–100 g / mL. For example, it is 0.1–1 g / mL, 1–5 g / mL, 5–10 g / mL, 10–20 g / mL, 20–30 g / mL, 30–40 g / mL, 40–50 g / mL, 50–60 g / mL, 60–70 g / mL, 70–80 g / mL, 80–90 g / mL, or 90–100 g / mL.

[0066] In some embodiments, fermentation is carried out in a container of 0.1 to 100 L. For example, it is carried out in a container of 0.1 to 1 L, 1 to 5 L, 5 to 10 L, 10 to 20 L, 20 to 30 L, 30 to 40 L, 40 to 50 L, 50 to 60 L, 60 to 70 L, 70 to 80 L, 80 to 90 L, or 90 to 100 L.

[0067] In the extraction method of the present invention, the purification in step (2) is to remove volatile organic compounds produced by microorganisms during fermentation. The purification process can be carried out by steps such as centrifugation, evaporation, condensation, chromatography, crystallization, separation or freeze-drying.

[0068] In some embodiments, evaporation is used to remove volatile organic compounds. Further, the evaporation is vacuum rotary evaporation. The pressure of the vacuum rotary evaporation is 10–400 mbar. For example, the values ​​are 10–20 mbar, 20–30 mbar, 30–40 mbar, 40–50 mbar, 50–60 mbar, 60–70 mbar, 70–80 mbar, 80–90 mbar, 90–100 mbar, 100–110 mbar, 110–120 mbar, 120–130 mbar, 130–140 mbar, 140–150 mbar, 150–160 mbar, 160–170 mbar, 170–180 mbar, 180–190 mbar, 190–200 mbar, 200–250 mbar, 250–300 mbar, 300–350 mbar, or 350–400 mbar. The temperature of the vacuum rotary evaporation is 20–80°C. For example, 20–30℃, 30–40℃, 40–50℃, 50–60℃, 60–70℃, or 70–80℃.

[0069] In some embodiments, after purification, the amount of polar solvent may be further removed or reduced to obtain a concentrated extract or a powdered extract. The methods for removing or reducing polar solvent are as described above. Additionally, to remove or reduce the amount of polar solvent, the extract or concentrated extract may be further fractionated to separate extracts or concentrated extracts containing specific compounds. In some embodiments, the polar solvent is reduced or removed under vacuum conditions and freeze-dried. The vacuum pressure is 0.001–1 mbar, for example, 0.001–0.005 mbar, 0.005–0.01 mbar, 0.01–0.05 mbar, 0.05–0.1 mbar, 0.1–0.5 mbar, or 0.5–1 mbar. The freeze-drying temperature is -80 to -20°C, for example, -80 to -70°C, -70 to -60°C, -60 to -50°C, -50 to -40°C, -40 to -30°C, or -30 to -20°C.

[0070] The extract obtained by the extraction method of this invention differs from essential oils derived from plants. Essential oils are extracts of the volatile components of plant materials, which are components that can be separated from the plant materials during heating and distillation. Essential oil components include nonpolar compounds, including aromatic compounds, terpenes, and other volatile hydrocarbon products. The term "volatile organic compound" refers to organic compounds with a boiling point (initial boiling point) between 50°C and 250°C at atmospheric pressure (i.e., 1 atm or approximately 101 kPa). Plant components extracted into polar solvents (e.g., aqueous extracts) are nonvolatile compounds, unlike the volatile compounds in essential oils.

[0071] The extract obtained by the extraction method of this invention also differs from fermented beverages (such as beer, cider, spirits, kombucha, and tea beverages) made from plants (e.g., grains such as barley, wheat, rye, rice, fruits, and tea plants). Fermented beverages may contain compounds from the plant material that produces them, but unlike the extracts disclosed herein, fermented beverages are made by fermenting plant solids (rather than compounds extracted from plants), and the general aim is to retain volatile organic compounds (i.e., short-chain alcohols, particularly ethanol) produced by microorganisms during anaerobic respiration as byproducts.

[0072] In the extraction method of this invention, the bioactive extract of the *Oryza* / *Camellia* plants includes one or more of the following bioactive compounds: catechin, epicatechin, epigallocatechin, epicatechin gallate, epigallocatechin gallate, anthocyanins, gallic acid, chlorogenic acid, caffeic acid, p-coumaric acid, ellagic acid, quinic acid, tea gallate, caffeine, theophylline, theobromine, theanine, glutamic acid, arginine, serine, aspartic acid, and γ-aminobutyric acid. Bioactive extracts contain bioactive compounds, some of which have been metabolized by microorganisms, and are essentially free of monosaccharides and / or disaccharides. (The extracts also contain B vitamins, vitamin C, vitamin E, and minerals and mineral oxides.)

[0073] The B vitamins are selected from one or more of thiamine, niacin, riboflavin, vitamin B12, and vitamin B6.

[0074] The mineral elements are selected from one or more of phosphorus, potassium, calcium, magnesium, iron, manganese, aluminum, sulfur, silicon, zinc, copper, and fluorine.

[0075] The extraction method of the present invention can extract at least 60% of the bioactive extract from plants. For example, 60-65%, 65-70%, 70-75%, 75-80%, 80-85%, 85-90%, 90-95%, or 95-100%. That is, if the plant material contains 1 gram of bioactive compound per kilogram, the extraction method according to the present invention will recover at least 60% of the total bioactive extract, i.e., about 0.6 grams per kilogram.

[0076] A second aspect of the present invention provides a bioactive extract of rice / camellia plants obtained by the extraction method described above.

[0077] A third aspect of the present invention provides the use of the bioactive extract of the Oryza / Camellia plants as described above in the preparation of one or more of the following compositions:

[0078] A) Compositions for use in skin care products;

[0079] B) Compositions for use in stomach health products;

[0080] C) Compositions for use in aquaculture food products.

[0081] The composition used in skin care products is a product composition for treating or preventing cosmetic skin conditions. Cosmetic skin conditions include signs of age-related aging or photoaging of the skin, including the skin of the face, body, and scalp. The term "age-related aging" refers to a decrease in skin thickness, tone, elasticity, hydration, hair density, or overall appearance due to the passage of time. The term "photoaging" refers to abnormal skin pigmentation (whether increased or decreased) and / or accelerated decrease in skin thickness, tone, elasticity, hydration, or overall appearance due to exposure to ultraviolet radiation. Cosmetic skin conditions include: thinning skin, wrinkled skin, dry skin, sagging skin, hair loss, hyperpigmentation, or hypopigmentation.

[0082] The skin care products are selected from one or more of the following: lotion, cream, serum, lip gloss, lipstick, lip balm, face mask, facial cleanser, shower gel, and hand sanitizer.

[0083] The composition for use in gastric health products is a product composition for treating or preventing gastric mucosal conditions. Gastric mucosal conditions include gastric mucosal irritation, gastric mucosal inflammation, and gastric ulcers.

[0084] The stomach health product is selected from one or more of the following: tablets, capsules, powders, beverages, and food bars.

[0085] The term "aquaculture food products" refers to products that can be used by farmed aquatic animals (e.g., fish) to increase the weight of the aquatic animals relative to those that do not consume food containing the extracts disclosed in this invention or consume similar food that does not contain the extracts disclosed in this invention.

[0086] In some embodiments, the aquaculture food product exists in granular form.

[0087] A fourth aspect of the present invention provides a composition comprising a bioactive extract of a plant of the genus *Oryza* or *Camellia* as described above, wherein the bioactive extract has a mass concentration of 0.1–10% w / v in the composition. For example, it may be 0.1–0.2% w / v, 0.2–0.3% w / v, 0.3–0.4% w / v, 0.4–0.5% w / v, 0.5–0.6% w / v, 0.6–0.7% w / v, 0.7–0.8% w / v, 0.8–0.9% w / v, 0.9–1% w / v, 1–2% w / v, 2–3% w / v, 3–4% w / v, 4–5% w / v, 5–6% w / v, 6–7% w / v, 7–8% w / v, 8–9% w / v, or 9–10% w / v.

[0088] The compositions of this invention are formulated for external or oral use.

[0089] The compositions of this invention may further include one or more excipients or carriers. Excipients and carriers include chelating agents, wetting agents, gums, viscosity modifiers, anionic emulsifiers, nonionic emulsifiers, thickeners, lipids, preservatives, pH adjusters, and solubilizers. Suitable excipients and carriers for use in skin care products, particularly for topical skin care products, are well known in the art. In some embodiments, the compositions may further include one or more active ingredients, essential oils or fragrances, and / or other plant extracts.

[0090] The extraction methods of this invention disclose the preparation and use of plant extracts; however, specific bioactive compounds can be isolated from plant extracts (and optionally purified), and these active substances can also be used in the methods of this invention. In this invention, the term "extract" also extends to the individual bioactive compounds isolated from said extract.

[0091] The extract obtained by the extraction method of this invention is applicable to both mammals and non-mammals. Mammals include, but are not limited to: humans; non-human primates such as chimpanzees, other apes, and monkeys; livestock such as cattle, horses, sheep, goats, and pigs; domesticated animals such as rabbits, dogs, and cats; and laboratory animals including rodents such as mice, rats, and guinea pigs. Examples of non-mammals include, but are not limited to, birds and fish. In one embodiment, the subject is a human.

[0092] In this invention, the terms "treatment," "curative treatment," or "treatment" are intended to refer to treatment, prevention, or preventive measures aimed at alleviating, preventing, or improving symptoms or characteristic manifestations in a subject. Alternatively, the term may also be used to refer to slowing, reducing, or delaying the progression of characteristic manifestations in a subject. Subjects requiring treatment include those suffering from the disease or its characteristic manifestations, or those at risk of developing the disease or its characteristic manifestations. Treatment also includes improving or preventing signs of worsening existing symptoms, as well as underlying metabolic or physiological processes leading to the development of the disease, and promoting the reversal of the disease.

[0093] The present invention will now be described in further detail, and illustrated in conjunction with the following non-limiting examples.

[0094] Example 1

[0095] Extraction of bioactive extracts

[0096] (1) Dehydration of plants in the genera Orychophragmus and Camellia

[0097] The plants used in this embodiment are: dried green tea and dried rice bran. (The green tea was purchased from Tachvalue Mekong Company Limited; the rice bran was purchased from Delifa Limited Liability Company.)

[0098] (2) Water extraction of bioactive compounds

[0099] 100g of dried green tea leaves and 1kg of dried rice bran were placed in separate containers, and 10L of water was added to each container. The containers were then heated to 90°C and 100°C respectively. Each container was kept at this temperature for 30 minutes. After boiling, the solutions were filtered (200 mesh or 74μm) to remove large pieces of green tea leaves or rice bran. The two filtered solutions were then combined and allowed to cool to room temperature to obtain the crude extract.

[0100] (3) Fermentation of crude extract

[0101] The crude extract (20L) was transferred to a 50L container. Yeast (Aspergillus oryzae RIB 40, 20g) was added, and fermentation was carried out at 18–22°C for one week. After fermentation, the yeast at the bottom of the container was removed and discarded. The mixture was then filtered again (200 mesh) to remove any remaining large particles (i.e., tea leaves and / or rice bran). The extract was heated to 80°C to remove any remaining volatile organic compounds; additional filtration was performed if necessary to ensure that the maximum particle size in the extract was 100μm.

[0102] (4) Dehydration of the extract

[0103] The extract was dried into powder using spray drying or freeze drying methods, and 175g of dry powder rich in bioactive compounds was obtained using methods familiar to those skilled in the art.

[0104] Example 2

[0105] In vitro applications of extracts

[0106] Human fibroblasts were seeded in 10 cm cell culture dishes (2 × 10⁶ cells per ml). 5 Cells were cultured under sterile conditions (37°C, 5% CO2, 95% humidity) for 24 hours. One group of fibroblasts was treated with the extract (1% w / v) prepared according to the method of Example 1. Another group of fibroblasts served as a control and was not treated. Cells were collected for RNA isolation 72 hours after treatment.

[0107] RNA was extracted from fibroblasts using standard materials and methods. cDNA templates for PCR amplification were prepared by reverse transcription. PCR quantification of type I collagen (col 1) and type III collagen (col 3) was performed using custom primers (Table 1). The mRNA expression levels of target genes (i.e., col 1 and col 3) in their respective fibroblast populations were analyzed using internal control genes (18S). Figure 1 As shown, treatment of fibroblasts with the extract upregulated the expression levels of both col1 and col3 types, with the expression level of col1 mRNA in treated cells being approximately 1.5 times that of the control group. Given that young, healthy skin has higher overall collagen levels, and the col1 to col3 ratio (col1:col3:85:15) was significantly higher in young, wrinkled skin than in aged, wrinkled skin, these results indicate that treatment with the extract induced a younger fibroblast phenotype.

[0108] Table 1 Nucleotide sequences of custom primers

[0109] Target Gene Forward Primer (5' to 3') Reverse Primer (5' to 3') GAPDH CTTTGGTATCGTGGAAGGACTC GTAGAGGCAGGGATGATGTTCT COL I GTGCTAAAGGTGCCAATGGT ACCAGGTTCACCGCTGTTAC COL III CCAGGAGCTAACGGTCTCAG CAGGGTTTCCATCTCTTCCA ELN (elastin) GGCCATTCCTGGTGGAGTTCC AACTGGCTTAAGAGGTTTGCCTCCA

[0110] Example 3

[0111] In vivo application of extracts

[0112] 3D skin model

[0113] The beneficial health properties of the extract from Example 1 were further evaluated by comparing skin treated with the extract with control skin on a 3-D skin model.

[0114] An in vitro 3D skin model was prepared using human fibroblasts and epidermal cells. Primary human fibroblasts (3 × 10⁶ cells) were used. 6Human epidermal cells (2 × 10⁻⁶, purchased from ATCC) and type I collagen (rat tail, Sigma Cat No. C3867) (2 μL) were placed in a transfer plate (24-well plate) and cultured (37℃, 5% CO₂, 95% humidity). After the formation of 3-D fibroblast structures, human epidermal cells (2 × 10⁻⁶) were added. 6 HaCat (derived from ATCC) is placed on top of 3-D human fibroblasts to promote the formation of multilayered epidermal cells, thereby obtaining a 3-D skin model.

[0115] In vitro 3D skin models were immersed for 3 days in cell growth medium containing 1% (w / v) extract (experimental group) or without extract (control group). The 3D skin models were then collected for sectioning and Masson staining to assess collagen content. Specifically, skin sections were stained (H&E). The staining results showed that, compared with the control group, the cells (i.e., fibroblasts and epidermal cells) and epidermis of the 3D skin models treated with the extract were healthier and thicker (see [link to original text]). Figure 2 ).

[0116] Figure 2 This image shows H&E-stained collagen hydrogel sections, where the "dermis" layer stains lighter and the "epidermis" layer stains darker. Similar to human skin, the dermis is much thicker than the epidermis and is filled with fibroblasts, while the epidermis is filled with epidermal cells. Figure 2 In (a), the control group skin model showed an uneven, thin epidermis (stained light pink), with unstained gaps between epidermal cells; the nuclei of fibroblasts in the dermis appeared distorted (stained blue). Figure 2 In (b), the skin model of the treatment group showed a uniformly thick epidermis (stained deep pink); the epidermal cells were in close contact with each other, presenting a healthy appearance, and fibroblasts were distributed throughout the dermis, showing intact cell nuclei (stained blue).

[0117] animal models

[0118] This study used two groups of BALB / c mice, with 10 mice in each group. Both groups were housed under normal conditions and maintained a normal diet. An extract-containing cream (see Table 2) was applied to the flanks of the treated group animals, while a cream without the extract was applied to the flanks of the control group animals. Treatment continued for 28 days. The mice were then sacrificed, and the flank skin was collected for collagen (Marshon trichrome staining). Figure 3 ) and elastin (immunofluorescence staining, Figure 4 )dyeing.

[0119] Figure 3 Skin sections from BALB / c mice were shown and stained with Masson's trichrome. Figure 3(a) Skin of control mice, showing full skin thickness. Notably, the collagen (stained blue) in the dermis is scattered with numerous white spots, exhibiting a reticular appearance. Furthermore, the epidermis (visible through staining of epidermal cell nuclei) is very thin. Two sebaceous glands were also observed; the one on the left is indicated by an arrow. Figure 3 In (b), the skin of the treated mice similarly shows the full thickness of the skin; the collagen in the dermis (stained blue) is very dense with few white spots and looks firmer than the control group; the epidermis is also denser than the control group sample; the arrows indicate the three sebaceous glands in the dermis.

[0120] Figure 4 Skin sections from BALB / c mice are shown, and immunofluorescence staining of elastin (red) and cell nuclei (DAPI, blue) is performed. Figure 4 In (a), the skin of the control group mice showed only a small number of dense elastin spots (red) in the dermis, with diffuse, weakly stained elastin in the underlying fat layer. Epidermal cells (stained blue) were distributed along the top of the dermis (i.e., within the epidermis), and additional nuclei (stained blue) were distributed within the dermis, particularly in the upper region between the elastin cells. Additional clusters of nuclei (stained blue) were clustered around spaces that may be sebaceous glands. Figure 4 In (b), skin sections from the treated group of mice showed elastin (stained red) distributed throughout the dermis in a dense, reticular pattern. Elastin staining was also less visible in the adipose layer, similar to the level seen in the control group samples. Cell nuclei (stained blue) were visible in the epidermis, dermis, and adipose layer. A band-like layer of nuclei extended from the top of the dermis (i.e., the epidermis) and between the dermis and adipose layer. Lower layer nuclei surrounded unstained spaces, which may be sebaceous glands.

[0121] Table 2. Formulas of the creams applied to mice in the treatment and control groups.

[0122]

[0123]

[0124] The preparation method of the cream in Table 2 above

[0125] Cream Formulation: The compounds from stage A were mixed to form a homogeneous mixture. The compounds from stage B were then mixed to form a slurry. The compounds from stage A were then added to the slurry from stage B to form a gel, followed by heating to 75°C. Next, the compounds from stage C were added under high-shear stirring and mixed to form a smooth, glossy, homogeneous emulsion, which was then heated again to 75°C. The mixture was then cooled to 40°C under low-shear stirring, and the compounds from stage D were stirred until homogeneous (low-shear stirring until homogeneous). The mixture was cooled to 25°C, allowed to stand overnight, and the pH was adjusted to 5-5.5 if necessary. The control cream was formulated using the same steps, but the extract from stage A was replaced with water.

[0126] like Figure 3 As shown, animal skin treated with the cream containing the extract exhibited higher collagen density and more uniform collagen distribution in the dermis, and the treated skin showed brighter and more regular staining (with fewer unstained gaps) compared to animals treated with the cream alone. Surprisingly, treatment with the extract also induced hair follicle pouches, suggesting a potential related benefit of stimulating hair growth. Hair loss is known to increase (or occur) with age; therefore, the extract's ability to stimulate hair growth further confirms its ability to induce a youthful skin phenotype.

[0127] from Figure 4 It can be seen that topical application of the extract also induced elastin expression, as the elastin staining in the treated animals was significantly brighter than that in the control group. Elastin provides the flexibility associated with youthful skin, which decreases with age, leading to more transparent and fragile skin. Therefore, elastin induction also resulted in younger, healthier skin, i.e., a more youthful skin phenotype.

[0128] Example 4

[0129] In vivo evaluation of the formulation extract in skin care

[0130] The two creams from Example 3 were applied once daily to the back areas of two groups of BALB / c mice (treatment group and control group) to assess skin hydration, skin strength, skin elasticity, epidermal thickness, and skin collagen density. The application areas were covered with bandages to prevent the mice from ingesting the creams.

[0131] Skin hydration:

[0132] After repeated application of the cream (treatment group or control group), skin hydration was measured using a skin hydration meter. CM825) and transepidermal water loss (TEWL) TM HEX (Courage+Khazaka Electronic GmbH, Cologne, Germany) was used to assess hydration. Parameters were recorded at baseline (D0), 1 hour and 24 hours after application, and then again on day 14 and day 28 (D14 and D28).

[0133] like Figure 5 As shown in a, compared with the same cream without the extract (i.e., control treatment), the cream formulated with the extract of the present invention significantly improved skin hydration on days 14 and 28 after treatment.

[0134] Skin strength:

[0135] Skin strength was assessed in the test and control groups on days 14 and 28 post-treatment. Briefly, tissue samples were collected from the dorsal region of mice and cut into strips (20 × 50 mm), which were then mounted between clamps on a mechanical testing instrument (Bioplus). Stress-strain curves were created by stretching the strip samples (10 mm / min) and recording the tensile force and sample length. Young's modulus and tensile strength were extracted from the curves (see [link to relevant documentation]). Figure 5 b).

[0136] like Figure 5 As shown in b, compared with the same cream without the extract (i.e., the control treatment), the cream formulated with the extract of the present invention significantly improved the tensile strength of the skin, whether on day 14 or day 28.

[0137] Skin elasticity:

[0138] Skin elasticity analysis was performed on sampled animals using a suction meter (Cutometer Dual MPA580, Courage+Khazaka Electronic GmbH, Cologne, Germany). Specifically, skin elasticity was measured by laser detection of skin displacement during suction (300 mbar) with a 2 mm suction probe and subsequent release. These tests evaluated total elasticity (R2, calculated as the ratio of complete relaxation to immediate penetration after suction), net elasticity (R5, calculated as the ratio of elastic portion during suction to immediate recovery during relaxation), and bioelasticity (R7, calculated as the ratio of elastic portion during suction to maximum penetration immediately after suction) (each parameter was measured three times, for a total of five "suction / release" measurements).

[0139] like Figure 6 As shown, compared to the control sample, the cream formulated using the extract of this invention showed significant improvements in total elasticity, net elasticity, and bioelasticity on days 14 and 28 after treatment, with a significant improvement on day 28.

[0140] Skin thickness:

[0141] Epidermal thickness is a key indicator of skin aging; as skin ages, the epidermis thins, leading to increased dehydration, which reduces strength and elasticity, making the skin appear older. In this experiment, collected tissue samples were stained (H&E) for visualization to assess epidermal thickness.

[0142] The results showed that, compared with skin treated with the control group cream, skin treated with the cream containing the extract of this invention exhibited a significant change in epidermal thickness (see [link to product description]). Figure 7 In particular, after 14 days of repeated treatment, the epidermis of the skin in the treatment group was significantly thickened, while the epidermis of the skin in the control group remained visually unchanged.

[0143] Figure 7 Skin sample sections collected from BALB / c mice and stained with H&E are shown. Figure 7 In (a), sections of skin from treated mice show the epidermis and dermis. The epidermis is captured as a thick band of blue epidermal cells, the thickness of which is indicated by measurement bars in the top and bottom images; the dermis is stained a bright pink band with intact cell nuclei (stained blue) scattered throughout. Figure 7 (b) The skin sections from the control group mice also show the dermis and epidermis. The epidermis appears as a thin blue band, the thickness of which is indicated by the measurement bars in the top and bottom images. Similar to the treated group skin, the dermis also appears as a bright pink band with cell nuclei (stained blue) distributed within it. Clusters of cell nuclei surrounding four sebaceous glands are also visible in the dermis.

[0144] Skin collagen density:

[0145] The level and type of collagen in the skin also affect skin health and aging. Higher collagen density and more even distribution contribute to healthier, younger-looking skin. Collagen density and distribution were also analyzed by staining (modified Masson's trichrome staining) and observation of collected back skin sections.

[0146] Specifically, skin tissue sections were placed in staining bottles and dewaxed by immersion in three groups of absolute xylene (4 min each), followed by immersion in 100%, 95%, 90%, 80%, and 70% ethanol (4 min each concentration). Next, the sections were immersed in warm boehmén solution (60°C, 45 min). The sections were then washed in running tap water until the yellow color in the sample disappeared. To distinguish cell nuclei, the sections were then immersed in modified hematoxylin and eosin (8 min), followed by washing in running water (2 min). To stain cytoplasm and erythrocytes, the sections were immersed in the anionic dye acid fuchsin (CI42590, Merck, Germany) (5 min), followed by washing in running water (2 min). Subsequently, the sections were treated with phosphomolybdic acid solution (10 min) as a mordant, followed immediately by immersion in methylene blue (CI42780, Merck, Germany) solution (5 min) to stain fibroblasts and collagen. The sections were then washed in running water (2 min) and treated with 1% acetic acid solution (1 min). The sections were then dehydrated by passing them through a series of alcohols (70%, 80%, 95%, and 100%; 1 min each). Finally, the sections were immersed in absolute xylene (1 min), mounted with DPX mounting solution, and subjected to microscopic analysis. Figure 8 ).

[0147] Figure 8 Skin sections collected from BALB / c mice and stained with masson stained are shown. Sections from the treatment and control groups are displayed in the figure. Figure 8 In (a), dark collagen bands (blue) are visible in the dermis of the treated mice. The epidermis is also shown as pink bands covering the top of the dermis. Figure 8 In (b), in the sections of the control group mice, the collagen bands in the dermis were stained lighter, showing a diffused blue color; while the epidermis was stained with thin pink bands covering the top of the dermis.

[0148] Results (see) Figure 8 a) This indicates that skin treated with the extract of the present invention has better collagen distribution compared to the control group skin. Furthermore, at 14 and 28 days of treatment, the total collagen content of the skin treated with the extract was significantly higher than that of the control group skin (see...). Figure 8 c).

[0149] In summary, treatment of the skin with the extract obtained by the method of the present invention significantly improves skin health, including skin hydration, strength and elasticity, which may be attributed to epidermal thickening, increased total collagen content and improved collagen distribution.

[0150] Example 5

[0151] In vivo evaluation of the extract in gastric mucosal care

[0152] Feed containing the extract of Example 1 of the present invention was prepared by dissolving it in sterile water (10 g extract / 100 mL water or 10% w / v). The feed was diluted (to 5% w / v) and administered to BALB / c mice with gastric ulcers via gastric tube (final intake of 250 mg / kg body weight).

[0153] After 7 days of treatment, mice were harvested, and gastric lining samples were prepared in formalin-fixed paraffin blocks. Sections were then prepared for H&E staining and evaluated by a pathologist. Under the same conditions, compared to mice that did not receive extract supplementation, animals receiving the extract of this invention showed up to 50% ulcer repair, and the gastric mucosa appeared healthier.

[0154] Example 6

[0155] In vivo evaluation of extracts in aquatic feed

[0156] Fish feed containing the bioactive extract of Example 1 of the present invention was prepared (by adding the bioactive extract to a standard fish feed at a final concentration of 5% (w / v), purchased from HO KINH DOANH TON CHITHANH, BR No: 37B8008193, Vietnam). Specifically, control and experimental groups were set up for both grouper and pomfret. The experimental group was provided with fish feed containing the bioactive extract of Example 1, and the control group was provided with fish feed without the bioactive extract of Example 1. The corresponding fish (n = 300) were placed in net cages (3 × 3 meters).

[0157] The above-mentioned feed was fed to groups of grouper and pomfret for six months. After six months of experimentation, compared with the fish groups fed the control group (i.e., standard feed), the average harvest of both types of fish increased by 30%.

[0158] In summary, the extraction method for bioactive extracts from *Oryza* and *Camellia* plants of the present invention utilizes polar solvents to extract bioactive compounds that are typically degraded during conventional extraction processes in existing technologies. Furthermore, the fermentation step enhances the bioavailability of these bioactive compounds, enabling the effective and cost-efficient extraction and utilization of bioactive compounds with potential physiological and biochemical activities. Simultaneously, the bioactive extracts obtained using this method can induce the synthesis of collagen and elastin in dermal fibroblasts, thereby improving skin strength, elasticity, resilience, pigmentation, and overall appearance. Moreover, the bioactive extracts obtained using this method are beneficial for repairing the gastric mucosa of animals and contribute to increasing the weight of aquaculture animals. Therefore, this invention effectively overcomes the various shortcomings of existing technologies and possesses high industrial applicability.

[0159] The above embodiments are merely illustrative of the principles and effects of the present invention and are not intended to limit the invention. Any person skilled in the art can modify or alter the above embodiments without departing from the spirit and scope of the present invention. Therefore, all equivalent modifications or alterations made by those skilled in the art without departing from the spirit and technical concept disclosed in the present invention should still be covered by the claims of the present invention.

Claims

1. A method for extracting bioactive extracts from plants of the genera *Oryza* and *Camellia*, characterized in that, Includes the following steps: (1) Extracting crushed rice / camellia plants with a polar solvent to obtain crude extract; (2) The crude extract was fermented and purified under microbial conditions to obtain bioactive extracts of rice / camellia plants.

2. The extraction method according to claim 1, characterized in that, The extraction time in step (1) is 10 min to 120 min; And / or, the extraction temperature in step (1) is 50–120°C; And / or, the polar solvent mentioned in step (1) is selected from one or more of water and polar organic solvents; And / or, the mass-to-volume ratio of the plant debris to the polar solvent in step (1) is (1-20 kg): 100 L; And / or, the rice species mentioned in step (1) are selected from one or more of Asian rice and African rice; And / or, the Camellia plants mentioned in step (1) are selected from one or more of the tea tree and Camellia oleifera; And / or, the fermentation time described in step (2) is 1 to 14 days; And / or, the fermentation temperature in step (2) is 7–25°C; And / or, the microorganism in step (2) is a fungus, which is selected from one or more of Aspergillus oryzae or Aspergillus soysarum; And / or, the purification described in step (2) is to remove volatile organic compounds generated during fermentation.

3. The extraction method according to claim 1, characterized in that, The extraction of plant fragments in step (1) includes a drying step, specifically drying the fragments to a moisture content of ≤15%.

4. The extraction method according to claim 3, characterized in that, After the drying step, the plant material is ground until the particle size is ≤2000μm, and then extracted.

5. The extraction method according to claim 1, characterized in that, The bioactive extracts of the *Oryza* / *Camellia* plants include one or more of the following bioactive compounds: catechins, epicatechin, epigallocatechin, epicatechin gallate, epigallocatechin gallate, anthocyanins, gallic acid, chlorogenic acid, caffeic acid, p-coumaric acid, ellagic acid, quinic acid, theagalic acid, caffeine, theophylline, theobromine, theanine, glutamic acid, arginine, serine, aspartic acid, γ-aminobutyric acid, B vitamins, vitamin C, vitamin E, and mineral elements and mineral oxides.

6. The extraction method according to claim 5, characterized in that, The B vitamins are selected from one or more of thiamine, niacin, riboflavin, vitamin B12, and vitamin B6; And / or, the mineral element is selected from one or more of phosphorus, potassium, calcium, magnesium, iron, manganese, aluminum, sulfur, silicon, zinc, copper, and fluorine.

7. A bioactive extract of rice / camellia plants obtained by the extraction method according to any one of claims 1 to 6.

8. Use of the bioactive extract of Oryza / Camellia plants according to claim 7 in the preparation of any one or more of the following compositions: A) Compositions for use in skin care products; B) Compositions for use in stomach health products; C) Compositions for use in aquaculture food products.

9. The use according to claim 8, characterized in that, The composition for skin care products is a product composition for treating or preventing cosmetic skin conditions; And / or, the skin care product is selected from any one or more of lotion, cream, serum, lip gloss, lipstick, lip balm, face mask, facial cleanser, shower gel, and hand sanitizer; And / or, the composition for gastric health products is a product composition for treating or preventing gastric mucosal conditions; And / or, the stomach health product is selected from any one or more of tablets, capsules, powders, beverages, and food bars.

10. A composition, characterized in that, The composition comprises a bioactive extract of an Oryza / Camellia plant as described in claim 7, wherein the bioactive extract has a mass concentration of 0.1 to 10% w / v in the composition.

Images