Application of Sestrin1 as target in preventing, relieving and / or treating metabolism-related steatohepatitis
By using Sestrin1 as a target to promote its gene expression or enhance its protein activity, the treatment challenge of metabolic-associated steatohepatitis has been solved, providing new drug targets and strategies, and achieving effective prevention and treatment of metabolic-associated steatohepatitis.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- PEOPLES HOSPITAL OF QICHUN COUNTY
- Filing Date
- 2026-01-16
- Publication Date
- 2026-05-01
AI Technical Summary
Current technologies lack effective strategies to reverse advanced fibrosis in metabolic-associated steatohepatitis and prevent end-stage liver disease, and the functional role of Sestrin1 in metabolic dysfunction remains unclear.
Using Sestrin1 as a target, by promoting its gene expression or increasing its protein activity, and by using Sestrin1 activators such as Sestrin1 overexpression vectors, small molecule pathway activators, Sestrin1 protein or its functional fragments, we can inhibit the release of inflammatory factors, reduce fat accumulation, promote lipid breakdown and transport, improve insulin resistance and inhibit liver fibrosis.
Sestrin1 has shown a core protective role as a target in the prevention and treatment of metabolic-associated steatohepatitis, providing a new drug target that enables the direct preparation of highly effective and low-toxicity anti-metabolic-associated steatohepatitis drugs, overcoming the limitations of existing treatments.
Smart Images

Figure CN121944121A_ABST
Abstract
Description
Application of Sestrin1 as a target in the prevention, alleviation, and / or treatment of metabolic-related steatohepatitis Technical Field
[0001] This invention relates to the technical field of novel uses of pharmaceuticals, specifically to the use of Sestrin1 as a target in the prevention and / or treatment of metabolic-associated steatohepatitis. Background Technology
[0002] When the liver is chronically exposed to metabolic stress (such as lipotoxicity, insulin resistance, or oxidative damage), the initial response is an adaptive compensatory response—hepatocytes buffer the toxicity of free fatty acids by accumulating lipid droplets (steatodegeneration) to maintain basic function. This stage is known as simple fatty liver (MAFL), which is usually reversible. However, persistent metabolic overload will trigger a pathological transformation: lipid droplet overload leads to mitochondrial dysfunction and endoplasmic reticulum stress, inducing a burst of reactive oxygen species (ROS) and the release of inflammatory factors (TNF-α, IL-1β), promoting hepatocyte ballooning degeneration, apoptosis, and immune cell infiltration (macrophages, lymphocytes), thus entering the MASH (metabolic dysfunction-associated steatohepatitis) stage. If metabolic damage is not blocked, the inflammatory cascade will activate hepatic stellate cells, which will transform into myofibroblasts and secrete excessive collagen (types I and III), leading to progressive fibrosis. This process is accompanied by abnormal angiogenesis and sinusoidal capillary formation, ultimately leading to structural destruction—progressing from compensated fibrosis (F1-F2) to decompensated cirrhosis (F4), resulting in portal hypertension, liver failure, or hepatocellular carcinoma. Although the core driving mechanisms of MASH (lipotoxicity, inflammation-fibrosis axis) have been thoroughly elucidated, effective treatment strategies to reverse advanced fibrosis and prevent end-stage liver disease still face significant challenges.
[0003] Sestrin1 (SESN1) belongs to the sestrin family (including SESN1 / 2 / 3) and is a class of evolutionarily conserved proteins whose expression is upregulated under oxidative stress, DNA damage, or metabolic disorders, playing a central role in maintaining cellular homeostasis. Sestrin2 is currently a focus of MASH research, with its antioxidant-metabolic regulation-antifibrotic triple mechanism supported by preclinical evidence, and it shows synergistic potential with existing drugs (such as GLP-1 agonists). Sestrin1 is universally expressed at the tissue level. Although there are some reports on the role of sestrin1 in tumor suppression and improvement of oxidative stress damage, its potential functional role in metabolically dysfunctional steatohepatitis remains unclear. Summary of the Invention
[0004] The purpose of this invention is to overcome the shortcomings of the prior art and provide the application of Sestrin1 as a target in the prevention and / or treatment of metabolic-associated steatohepatitis.
[0005] To achieve the above objectives, the technical solution adopted by the present invention is: the application of Sestrin1 as a target in screening drugs for the prevention, relief and / or treatment of metabolic-related steatohepatitis.
[0006] This invention used wild-type mice and Sestrin1 gene knockout mice for experiments. Pathological analysis of liver tissue from each group of mice was performed to study the effect of Sestrin1 gene knockout on MASH (metastatic steatohepatitis). The results showed that Sestrin1 knockout significantly aggravated hepatic steatosis, increased inflammation, and liver fibrosis, impairing liver function. Furthermore, Sestrin1 overexpression inhibited the release of inflammatory factors, lipid accumulation, and fibrosis, while Sestrin1 knockout exacerbated these processes. Therefore, Sestrin1 could serve as a target for screening drugs to prevent, alleviate, and / or treat metabolic steatohepatitis.
[0007] As a preferred embodiment of the application described in this invention, the drug can promote the expression of the Sestrin1 gene or increase the activity of the Sestrin1 protein.
[0008] This invention also provides the use of Sestrin1 activators in the preparation of medicaments for the prevention, relief and / or treatment of metabolic-associated steatohepatitis.
[0009] As a preferred embodiment of the application described in this invention, the Sestrin1 activator includes substances that promote Sestrin1 gene expression, increase Sestrin1 protein activity, or generate Sestrin1.
[0010] As a preferred embodiment of the application described in this invention, the substance includes a Sestrin1 overexpression vector, a small molecule Sestrin1 pathway activator, Sestrin1 protein or its functionally active fragment, and a nucleic acid molecule that promotes Sestrin1 transcription.
[0011] The aforementioned Sestrin1 overexpression vectors include plasmids and viral vectors, which can enhance liver Sestrin1 expression through in vivo delivery; small molecule Sestrin1 pathway activators include specific AMPK / mTOR pathway regulators; Sestrin1 protein or its functional active fragments and nucleic acid molecules that promote Sestrin1 transcription include, for example, the CRISPR activation system.
[0012] As a preferred embodiment of the application described in this invention, the drug prevents, alleviates and / or treats metabolic-related steatohepatitis by reducing fat accumulation, promoting lipid breakdown and transport, inhibiting the release of pro-inflammatory factors and oxidative stress, improving insulin resistance, and inhibiting liver fibrosis by at least one of these methods.
[0013] As a preferred embodiment of the application described in this invention, the metabolic-associated steatohepatitis includes at least one of metabolic dysfunction-associated steatohepatitis, liver metabolic dysfunction, hepatic steatosis, hepatocellular inflammation and injury, and liver fibrosis.
[0014] The present invention also provides a pharmaceutical composition for the prevention, relief and / or treatment of metabolic-associated steatohepatitis, the pharmaceutical composition comprising a substance that promotes Sestrin1 gene expression, increases Sestrin1 protein activity or generates Sestrin1.
[0015] As a preferred embodiment of the pharmaceutical composition of the present invention, the pharmaceutical composition further includes pharmaceutically acceptable excipients and / or adjuvant active ingredients.
[0016] The beneficial effects of this invention are as follows: This invention provides the application of Sestrin1 as a target in the prevention and / or treatment of metabolic-associated steatohepatitis (MASH). This invention reveals for the first time the core protective role of Sestrin1 in inhibiting the pathological process of MASH (steatohepatitis, inflammation, and fibrosis), providing a theoretical basis for targeted therapy; based on the key functions of Sestrin1 in regulating liver metabolic homeostasis and fibrosis, it provides a novel target for the development of anti-MASH drugs; Sestrin1 activators can be directly used to prepare highly effective and low-toxicity anti-MASH drugs, overcoming the limitations of existing treatment methods (such as lifestyle interventions and pan-antioxidants). Attached Figure Description
[0017] Figure 1 shows the HE staining results of liver tissue after Sestrin1 knockout.
[0018] Figure 2 shows the PSR staining results of liver tissue after Sestrin1 knockout.
[0019] Figure 3 shows the results of Oil Red O staining in liver tissue after Sestrin1 knockout.
[0020] Figure 4 shows the Nile Red staining results of mouse primary hepatocytes infected with AdshRNA and AdshSestrin1 under PO stimulation.
[0021] Figure 5 shows the Nile Red staining results of mouse primary hepatocytes infected with AdGFP and AdSestrin1 under PO stimulation. Detailed Implementation
[0022] The following detailed embodiments further illustrate the above-described content of the present invention. However, this should not be construed as limiting the scope of the present invention to the following examples. All technologies implemented based on the above-described content of the present invention fall within the scope of the present invention. Unless otherwise specified, the reagents involved in the embodiments of the present invention are all commercially available products and can be purchased through commercial channels.
[0023] Example 1: In this embodiment of the invention: 1. Experimental animals and their rearing: Experimental animals: Male C57BL / 6J mice aged 8-10 weeks, weighing 23.5-27.5g, were selected as experimental subjects. Rearing environment: SPF-grade experimental animal center. Rearing conditions: Room temperature between 22-24°C, humidity between 40-70%, alternating light and dark lighting for 12 hours, free access to water and food.
[0024] 2. Isolation and Culture of Primary Hepatocytes from Mice: Primary hepatocytes were isolated from 6- to 8-week-old male C57BL / 6J mice. After anesthesia, the liver was digested with a liver wash solution at 37°C to flush out blood. Then, the liver tissue was digested with a perfusion solution containing type IV collagenase. Subsequently, the entire liver was removed, the liver membrane was torn, and all cells were released. The suspension was filtered through a 70 μm cell filter (352350, BD, USA). Primary hepatocytes were isolated by centrifugation at 50 g for 5 minutes and cultured in DMEM medium coated with rat tail collagen containing 10% fetal bovine serum (10099141C, Gibco, USA) and 1% penicillin-streptomycin solution (15140-122, Gibco, USA) in an incubator at 37°C with 5% CO2.
[0025] 3. Construction and design of Sestrin1 interference and Sestrin1 overexpression adenoviruses and synthesis of short hairpin RNA sequences targeting Sestrin1, as shown in Table 1.
[0026] Table 1 Three short hairpin RNA sequences targeting the mouse Sestrin1 gene were synthesized and cloned into the shuttle vector pENTR-U6-CMV-ATG-flag-T2A-EGFP to construct an AdshSestrin1 adenovirus knockdown plasmid. The AdshRNA (sequence CAACAAGATGAAGAGCAGGAA) served as a control.
[0027] The CDS sequence of the Sestrin1 gene was amplified using the primers in Table 2.
[0028] Table 2 The coding region of the mouse Sestrin1 gene was amplified and cloned into the shuttle vector pENTR-U6-CMV-ATG-flag-T2A-EGFP.
[0029] The above product and adenovirus recombinant vector (pAd / PL-DEST, V49420, ThermoFisher, USA™) were specifically recombined at the Gateway site using a Gateway@LR Clonase™ II enzyme mixture (2484478, ThermoFisher, USA™) to obtain either a Sestrin1 overexpression plasmid (pAd-CMV-Sestrin1-flag-T2A-EGFP) or a Sestrin1 knockdown plasmid (pAd-U6-Sestrin1 shRNA-CMV-EGFP). These plasmids were transfected into HEK293A cells using PEI transfection reagent (24765-100, Polysciences, Illinois, USA). The Adeasy adenovirus packaging system (240009, Agilent Technologies, California, USA) was used to package the adenovirus. Primary hepatocytes were then infected with the generated adenovirus at a fold increase of 50.
[0030] 4. For RT-PCR experiments, tissues or cells were lysed with Trizol, and RNA was extracted with chloroform. The obtained RNA was then reverse transcribed using a reverse transcription kit to obtain cDNA. Primers for the target genes were designed, and RT-PCR was performed using cDNA as a template. β-actin was used as an internal control to analyze the relative expression levels of each gene's mRNA. The primers are shown in Table 3.
[0031] Table 3 5. Western Blot: Cells or tissues were added to an appropriate amount of RIPA lysis buffer (65 mM Tris-HCl pH 7.5, 150 mM NaCl, 1 mM EDTA, 1% Nonidet P-40, 0.5% sodium deoxycholate, and 0.1% SDS) containing protease (04693132001; Roche) and phosphatase inhibitor (4906837001; Roche). The mixture was sonicated, centrifuged, and the supernatant was collected to obtain total protein. Protein concentration was determined using the BCA (23225, Thermo) method. Equal masses of protein samples were added to loading buffer and separated by 10% SDS-PAGE electrophoresis. After electrophoresis, the protein was transferred to a 0.45 μm PVDF (IPVH00010, Millipore) membrane. After transfer, the PVDF membrane was blocked with 5% skim milk powder at room temperature for approximately 1 hour. The PVDF membrane was washed three times with TBST for 5 min each time, then incubated overnight at 4°C with primary antibody (anti-Sestrin 1: sc376170, Santa Cruz; anti-ACTIN: AC026, Abclonal). After TBST washing, the membrane was incubated at room temperature for 1 h with the corresponding species-specific secondary antibody (Jackson ImmunoResearch). The membrane was developed with ECL luminescent substrate (1705062, Bio-Rad), and the signal was collected using a Bio-Rad gel imaging system (ChemiDoc XRS+). Quantitative analysis was performed using Image Lab software.
[0032] 6. Construction of Sestrin1 knockout (Sestrin1-KO) mice: A pair of transcription activator-like effector (TALE) nuclease sequences targeting exon 2 of the Sestrin1 gene were designed using an online targeted design tool (https: / / tale-nt.cac.cornell.edu / node / add / talen-old). Subsequently, the TALE expression plasmid was assembled using a "unit assembly" method, as previously described. After linearization with PmeI endonuclease (NEB, R0560L), the plasmid was transcribed and tailed using the mMessage mMachine T7 Ultra Kit (Ambion, AM1345) and purified using the RNeasy Mini Kit (Qiagen, 74104) to obtain mature mRNA. The purified mRNA was then mixed with injection buffer and injected into the cytoplasm of mouse single-cell stage embryos. After 19–21 days, the injected fertilized eggs were transferred into pseudopregnant female mice. The following primers were used to identify the genotype of mice: The knockout sequence of Sestrin1 is: TCGGCCACTAGGACSestrin1 forward: 5'- CACGGGTTTGGCCACTGTGT -3', Sestrin1 reverse: 5'- CAGGTGGAGGGAGGGAGTCA -3'.
[0033] The mice used in the experiment were homozygous for the Sestrin1 mutant.
[0034] The expression level of Sestrin1 protein in the liver tissues of Sestrin1 knockout mice and wild-type mice was determined by Western blotting.
[0035] 7. Animal Tissue Collection: After weighing, blood glucose monitoring, and insulin resistance testing, mice were anesthetized and dissected. The weights of the liver and white fat were recorded. The liver and white fat were aliquoted, some were flash-frozen in liquid nitrogen, and the remainder were fixed in 10% formalin.
[0036] 8. Main procedures for preparing paraffin-embedded specimens for pathological testing: trimming the liver → processing the embedding frame → rinsing with running water → dehydration → clearing → paraffin infiltration → embedding → sectioning → spreading → air-drying or baking for later use.
[0037] The following describes the main steps of hematoxylin-eosin (H&E) staining and Sirius red (PSR) staining used in the embodiments of the present invention: The main steps of hematoxylin-eosin (H&E) staining are as follows: take paraffin specimen sections and bake at 55°C for 30 min → xylene for 5 min, 3 times → 100% alcohol for 1 min → 95% alcohol for 1 min → 70% alcohol for 1 min → double-distilled water for 1 min → hematoxylin solution (G1004, Servicebio) for 5 min → wash with water for 1 min → 1% hydrochloric acid alcohol (take 3 mL of concentrated hydrochloric acid and 297 mL of... Mix thoroughly with 70% alcohol for 1-3 seconds → wash with water for 1 minute → Scott's solution (0.35g sodium bicarbonate, 2g magnesium sulfate heptahydrate, both dissolved in 100mL distilled water) for 1 minute → wash with water for 1 minute → eosin solution (BA-4024, Zhuhai Beso) for 3-5 minutes → wash away excess color with distilled water → 70% alcohol for 1 second → 95% alcohol for 1 second → 100% alcohol for 30 seconds, 3 times → xylene for 2 minutes, 3 times → immediately mount the slide while the xylene is still wet → dry in a fume hood, take pictures with a microscope (ECLIPSE 80i, Nikon), and measure the surface area of liver cells and fat vacuoles using Image-Pro Plus (version 6.0).
[0038] The main steps for Sirius Red (PSR) staining are as follows: Take paraffin-embedded specimen sections and bake at 55°C for 30 minutes → apply xylene for 2 minutes, 3 times → apply 100% ethanol for 1 minute → apply 95% ethanol for 1 minute → apply 70% ethanol for 1 minute → rinse with running water for 10 minutes → apply double-distilled water for 1 minute → apply 0.2% phosphomolybdic acid for 2 minutes → apply 0.1% Sirius Red Picric Acid Solution (26357-02, Hedebiotechnology) to the tissue and stain in a humidified chamber for 90 minutes → remove residual solution → apply 0.01N hydrochloric acid for 4 seconds → apply 70% ethanol once → apply 90% ethanol once → apply 100% ethanol for 30 seconds, 3 times → apply xylene for 2 minutes, 3 times → immediately cover with a slide while the xylene is still wet, photograph with a microscope (ECLIPSE 80i, Nikon), and measure the collagen area using Image-Pro Plus (version 6.0).
[0039] The main steps of Oil Red O staining are as follows: Fresh frozen tissue sections are air-dried at room temperature for 10-15 minutes → fixed in 10% neutral formalin for 10 minutes → rinsed with running water for 5 minutes → rinsed with double-distilled water for 1 minute → rinsed with 60% isopropanol for 1 minute → Oil Red O working solution is added to cover the tissue, and stained in a humidified chamber in the dark for 10-15 minutes → differentiated with 60% isopropanol for a few seconds (controlled under a microscope) → rinsed with running water for 5 minutes → (optional: hematoxylin staining of nuclei for 1-2 minutes → blueing with running water for 5-10 minutes) → rinsed with double-distilled water for 1 minute → mounted with an aqueous mounting medium (such as glycerol gelatin) → observed and photographed under a microscope, and the positive areas are analyzed by software.
[0040] Example 1: Effect of Sestrin1 knockout on liver tissue damage in HFHC-fed mice. Mice in the WT group and the Sestrin1-KO group were fed a high-fat, high-cholesterol (HFHC) diet. At the end of the model construction, the liver meristems of the mice were collected and preserved in liquid nitrogen for paraffin embedding and sectioning. After staining with hematoxylin and eosin, the surface stains were removed, and the liver cell surface area was photographed under a microscope and the surface area of the liver cells was calculated.
[0041] As shown in Figure 1, the ballooning degeneration of liver tissue was aggravated in the KO group, accompanied by increased damage to hepatocytes, indicating that Sestrin1 knockout can aggravate MASH-induced liver damage.
[0042] Example 2 Effect of Sestrin1 knockout on the liver fibrosis process in HFHC-fed mice Mice were divided into WT and KO groups. The liver meristems of mice preserved in liquid nitrogen were paraffin-embedded and sectioned, then stained with Sirius red (PSR), photographed under a microscope, and the surface area of collagen fibers in the liver tissue was calculated.
[0043] As shown in Figure 2, the collagen fiber area of the liver tissue in the KO group was significantly increased, indicating that Sestrin1 knockout can aggravate the liver fibrosis process under MASH.
[0044] Example 3 Effect of Sestrin1 knockout on lipid accumulation in liver tissue of HFHC-fed mice Mice fed with HFHC were divided into WT group and KO group. Frozen sections of mouse liver were air-dried and fixed, then stained with Oil Red O, photographed under a microscope, and the surface area of lipid droplets in liver tissue was calculated.
[0045] As shown in Figure 3, the lipid droplet area in the liver tissue of the KO group was significantly increased, indicating that Sestrin1 knockout can aggravate lipid accumulation under MASH.
[0046] Example 4: Effect of Sestrin1 Knockdown on Lipid Accumulation in PO-Stimulated Primary Mouse Hepatocytes. In this example, primary mouse hepatocytes were isolated and cultured, followed by Sestrin1 gene knockdown (Ad-shSestrin1) and control (Ad-shRNA) treatments using an adenovirus vector. After successful cell infection, an in vitro steatosis model was established by induction with a mixture of palmitic acid (PA) and oleic acid (OA) (PA:OA = 1:2, abbreviated as PO). Bovine serum albumin (BSA) treatment was used as a blank control. Cell experiments were divided into four groups: AdshRNA-BSA group, AdshSestrin1-BSA group, AdshRNA-PO group, and AdshSestrin1-PO group. Cells in each group were cultured for 16 hours after the corresponding treatment, followed by Nile Red fluorescence staining to specifically label intracellular lipid droplets. Finally, the degree of lipid accumulation in hepatocytes of each group was observed and assessed using immunofluorescence microscopy.
[0047] As shown in Figure 4, there was no significant difference between the BSA groups, while PO stimulation significantly aggravated lipid accumulation in mouse primary hepatocytes by Sestrin1 knockdown.
[0048] Example 5: Effect of Sestrin1 overexpression on lipid accumulation in PO-stimulated mouse primary hepatocytes. Primary mouse hepatocytes were isolated and infected with adenovirus AdGFP and AdSestrin1. After PO stimulation, they were divided into four groups: AdGFP-BSA group, AdSestrin1-BSA group, AdGFP-PO group, and AdSestrin1-PO group. The lipid accumulation was observed by Nile Red staining and immunofluorescence microscopy.
[0049] As shown in Figure 5, there was no significant difference among the BSA groups, while PO stimulation significantly reduced lipid accumulation in mouse primary hepatocytes due to Sestrin1 overexpression.
[0050] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the essence and scope of the technical solutions of the present invention.
Claims
1. Application of Sestrin1 as a target in screening drugs for the prevention, relief and / or treatment of metabolic-related steatohepatitis.
2. The application according to claim 1, characterized in that, The drug can promote the expression of the Sestrin1 gene or increase the activity of the Sestrin1 protein.
3. Use of Sestrin1 activators in the preparation of drugs for the prevention, relief and / or treatment of metabolic-related steatohepatitis.
4. The application according to claim 3, characterized in that, The Sestrin1 activator includes substances that promote Sestrin1 gene expression, increase Sestrin1 protein activity, or generate Sestrin1.
5. The application according to claim 3, characterized in that, The substances include a Sestrin1 overexpression vector, a small molecule Sestrin1 pathway activator, Sestrin1 protein or its functionally active fragment, and nucleic acid molecules that promote Sestrin1 transcription.
6. The application according to claim 3, characterized in that, The drug prevents, alleviates and / or treats metabolic-associated steatohepatitis by reducing fat accumulation, promoting lipid breakdown and transport, inhibiting the release of pro-inflammatory factors and oxidative stress, improving insulin resistance, and inhibiting liver fibrosis by at least one of these methods.
7. The application according to claim 3, characterized in that, The metabolic-associated steatohepatitis includes at least one of the following: metabolic dysfunction-associated steatohepatitis, liver metabolic dysfunction, hepatic steatosis, hepatocellular inflammation and damage, and liver fibrosis.
8. A pharmaceutical composition for the prevention, relief, and / or treatment of metabolic-associated steatohepatitis, characterized in that, The pharmaceutical composition includes substances that promote Sestrin1 gene expression, increase Sestrin1 protein activity, or generate Sestrin1.
9. The pharmaceutical composition according to claim 7, characterized in that, The pharmaceutical composition further includes pharmaceutically acceptable excipients and / or adjuvant active ingredients.