Anti-tetanus antibody as well as preparation and application thereof

Abstract

The invention provides an anti-tetanus antibody as well as preparation and application thereof, and relates to the field of antibodies. The amino acid sequence of the tetanus-resistant antibody heavy chain CDR is as shown in SEQ ID NO: 1-3; the amino acid sequence of the light chain CDR of the antibody is as shown in SEQ ID NO: 4-6. The antibody disclosed by the invention is high in activity and affinity, and has the application prospect of preparing a medicine for preventing and / or treating tetanus or a product for detecting the tetanus toxin level with a non-diagnostic purpose and the like.

Description

An anti-tetanus antibody, its preparation and application Technical Field

[0001] This invention belongs to the field of antibodies, specifically relating to an anti-tetanus antibody and its preparation and application. Background Technology

[0002] Tetanus is an extremely serious acute infectious disease caused by Clostridium tetani entering the human body through a skin or mucous membrane wound, where it grows and multiplies locally and produces toxins. After entering the human body, Clostridium tetani produces exotoxins with strong spasmodic and hemolytic toxicity, which can cause functional changes in the central nervous system. Clinical manifestations are mainly characterized by trismus, generalized muscle rigidity, and paroxysmal spasms. Severe cases can lead to suffocation, laryngospasm, lung infection, and organ failure, posing a fatal threat to the patient's life. [1] .

[0003] Currently, my country's tetanus prevention and immunization products mainly include tetanus antitoxin, tetanus human immunoglobulin, and diphtheria, tetanus, and pertussis (dTpa) triple vaccine.

[0004] Tetanus vaccine (tetanus toxoid) is produced by inactivating tetanus toxin isolated from toxin-producing Clostridium tetani cultures with formaldehyde. Tetanus toxin poses a certain risk due to its spore-forming form, and adverse reactions occasionally occur during hyperimmunization due to technological limitations. To eliminate the need for Clostridium tetani cultures or tetanus toxin purification, much research has focused on obtaining ideal recombinant tetanus subunit vaccines. For example, the tetanus toxin C fragment expressed and purified from Escherichia coli and yeast cells is non-toxic and possesses ganglioside-binding activity, inducing a protective immune response against tetanus toxin after immunization. Studies have shown that using the tetanus C fragment (TTC) derived from tobacco leaves can elicit high levels of CD4+ T cells and antitoxin antibodies after vaccination.

[0005] Passive antibody therapy has always been the main strategy for clearing tetanus toxin from the bodies of tetanus patients. Currently, the CFDA-approved formulations for passive immunization therapy of tetanus infection after trauma include: tetanus antitoxin (TAT), equine tetanus immunoglobulin F(ab')2, and human tetanus immunoglobulin (HTIG). In my country, passive immunization therapy for tetanus primarily uses equine serum-derived tetanus antitoxin. However, the production and use of animal-derived therapeutic drugs face many obstacles, such as long immunization cycles, differences in therapeutic efficacy between different batches, potential hypersensitivity reactions in receptors, and the risk of acquiring certain zoonotic diseases. Equine tetanus immunoglobulin is an upgraded product of TAT. Based on the original equine serum TAT production process, it increases the relative content of the active ingredient, the antibody fragment F(ab')2, reduces the incidence of allergic reactions to TAT, and improves safety. However, this drug still cannot overcome the obstacles commonly found in animal-derived therapeutic drugs.

[0006] Compared to horse serum antitoxin, human tetanus immunoglobulin (HTIG) is a human-derived alloprotein, virtually eliminating the possibility of serum sickness and allergic reactions. With a half-life of 15-25 days, it offers higher safety and efficacy. While the use of human-derived products significantly reduces the risk of receptor antigenicity, many challenges remain. HTIG is a blood product, and although improvements in donor selection, virus inactivation procedures, and filtration processes have reduced the risk of pathogen transmission from plasma-derived preparations, no purification method can completely and effectively eliminate these risks. Furthermore, human blood is difficult to obtain, expensive, and complex to produce industrially, resulting in a supply of human tetanus immunoglobulin that falls far short of market demand. [2] .

[0007] In summary, there is a need for a tetanus antibody formulation that can be easily and massively produced in vitro, with high safety and specificity. Fully human monoclonal antibodies can serve as a candidate reagent; therefore, the development of high-affinity, fully human neutralizing antibodies capable of neutralizing tetanus has become a hot topic of research.

[0008] [1] Song Xin, Li Ming, Wang Chuanlin, et al. Current status, problems and prospects of tetanus immunization in China [J]. Chinese Journal of Vaccines and Immunization, 2019, 25(06):743-746. DOI:10.19914 / j.cjvi.2019.06.023. [2] Lin Shujian. Screening and functional study of fully human anti-tetanus toxin monoclonal antibodies [D]. Jinan University, 2019. DOI:10.27167 / d.cnki.gjinu.2019.001243. Summary of the Invention In order to solve the above problems, the present invention provides an anti-tetanus antibody and its preparation and application.

[0009] On the one hand, the present invention provides an anti-tetanus antibody.

[0010] Specifically, the anti-tetanus antibody includes: heavy chain CDR1, CDR2 and CDR3, and light chain CDR1, CDR2 and CDR3.

[0011] More specifically, the heavy chain CDR1 sequence is shown in SEQ ID NO:1, SEQ ID NO:1: GFTFDRYA; the heavy chain CDR2 sequence is shown in SEQ ID NO:2, SEQ ID NO:2: ISRSGETT; the heavy chain CDR3 sequence is shown in SEQ ID NO:3, SEQ ID NO:3: AKAGKQWLASYYFDY; more specifically, the light chain CDR1 sequence is shown in SEQ ID NO:4, SEQ ID NO:4: QSVGTN; the light chain CDR2 sequence is shown in SEQ ID NO:5, SEQ ID NO:5: GAS; the light chain CDR3 sequence is shown in SEQ ID NO:6, SEQ ID NO:6: QQYSDWPPQT.

[0012] Specifically, the anti-tetanus antibody further includes: (1) a heavy chain variable region, wherein the heavy chain variable region is the amino acid sequence shown in SEQ ID NO:7; and a light chain variable region, wherein the light chain variable region is the amino acid sequence shown in SEQ ID NO:8; and (2) an amino acid sequence having more than 60% identity with (1) and having the same CDR region.

[0013] Specifically, the anti-tetanus antibody is a monoclonal antibody.

[0014] Specifically, the tetanus antibody is a humanized antibody.

[0015] On the other hand, the present invention provides a nucleic acid molecule encoding the above-mentioned anti-tetanus antibody.

[0016] Specifically, the nucleic acid molecule sequence is shown in SEQ ID NO:9-10.

[0017] On the other hand, the present invention provides a biological expression vector.

[0018] Specifically, the expression vector includes a nucleic acid molecule encoding an anti-tetanus antibody.

[0019] On the other hand, the present invention provides a host cell.

[0020] Specifically, the host cell contains the aforementioned nucleic acid molecules and / or the aforementioned biological expression vectors.

[0021] Specifically, the host cell includes, but is not limited to, microbial, insect, or mammalian cells.

[0022] More specifically, the host cell is a mammalian cell.

[0023] Preferably, the host cell is a cell of a human, mouse, sheep, horse, dog, or cat.

[0024] In some specific embodiments of the present invention, the host cell is a Chinese hamster ovary cell.

[0025] In another aspect, the present invention provides an immunoconjugate comprising the above-mentioned anti-tetanus antibody.

[0026] On the other hand, the present invention provides a method for preparing the above-mentioned anti-tetanus antibody.

[0027] Specifically, the method for preparing the anti-tetanus antibody is as follows: culturing the above-mentioned host cells in a culture medium and recovering the antibody.

[0028] In another aspect, the present invention provides a pharmaceutical composition.

[0029] Specifically, the pharmaceutical composition comprises the antibody, nucleic acid molecule, biological expression vector, host cell, and / or immune conjugate as described in claim 1.

[0030] In another aspect, the present invention provides the use of the above-mentioned tetanus antibody in the preparation of medicaments for the prevention and / or treatment of tetanus or products for the detection of tetanus toxin levels.

[0031] In another aspect, the present invention provides a method for detecting tetanus toxin levels for non-diagnostic purposes.

[0032] Specifically, the method includes the following steps: (1) obtaining a sample containing tetanus toxin; (2) contacting the sample obtained in step (1) with the antibody according to any one of claims 1-4; and (3) detecting the binding of the sample with the antibody according to any one of claims 1-4.

[0033] Compared with the prior art, the present invention has the following advantages: the antibody of the present invention has high activity and high affinity, and has the potential to be used in the preparation of drugs for the prevention and / or treatment of tetanus or products for non-diagnostic purposes to detect tetanus toxin levels. Attached Figure Description

[0034] Figure 1 shows the affinity analysis spectrum of the first batch in Experiment Example 1.

[0035] Figure 2 shows the affinity analysis spectrum of the second batch in Experiment Example 1.

[0036] Figure 3 shows the affinity analysis spectrum of the third batch in Experiment Example 1. Detailed Implementation

[0037] The present invention will be further described in detail below with reference to specific embodiments. The following embodiments are not intended to limit the present invention, but only to illustrate the present invention. Unless otherwise specified, the experimental methods used in the following embodiments are generally performed under conventional conditions. Unless otherwise specified, the materials and reagents used in the following embodiments are commercially available.

[0038] Table 1 Experimental Instruments

[0039] Table 2 Materials and Reagents

[0040] Example 1 Antibody Screening 1. Animal Immunization Process: Human peripheral blood lymphocytes (PBL) were prepared from heparinized blood of five healthy blood donors who had been immunized with tetanus toxoid (TT).

[0041] 2. Antibody construction process: The fusion procedure for generating hybridoma is as follows: Extract human peripheral blood B cells for immunoadsorption tetanus vaccine. The extraction method is as follows: (1) Sample pretreatment: Take heparin-anticoagulated peripheral blood and dilute it with an equal volume of calcium- and magnesium-free PBS or Hank's solution (to reduce red blood cell aggregation and protect cell activity). The separation temperature is controlled at 18~22℃ (to avoid the effect of temperature change on the separation solution density). (2) Density gradient centrifugation: Add 3~5mL of human peripheral blood lymphocyte separation solution to a 15mL centrifuge tube. Use a pipette to slowly stack the diluted blood along the tube wall (pay attention to keeping the interface clear), and centrifuge horizontally at 2000rpm for 20~30 minutes (centrifugation acceleration 400×g). (3) PBMC collection: After centrifugation, the liquid is divided into four layers: the upper layer is plasma / platelet, the middle layer (milky white ring) is PBMC, the lower layer is the separation solution, and the bottom layer is red blood cells / granulocytes. Carefully aspirate the middle layer of PBMCs using a pipette and transfer them to a new tube. Wash twice with 5 volumes of PBS (centrifuge at 1500 rpm for 10 minutes, discard the supernatant) to obtain highly viable PBMCs (viability typically >95%). Mix the isolated B cells with SHM-D33 cells (cell source: ATCC, catalog number: CRL-1668™) in RPMI 1640 medium containing 15% fetal bovine serum at a cell ratio of 2:1, and add 50% polyethylene glycol (PEG 1500) to achieve cell fusion. Fifteen days after fusion, screen wells for monoclonal antibody-positive results using an enzyme-linked immunosorbent assay (ELISA). Clone hybridomas using the limiting dilution method.

[0042] 3. Antibody Screening Process: The reaction between the antibody and tetanus toxoid was determined by ELISA. The antibody was coated with 10 pg / mL tetanus toxoid, and blocked with 0.1% bovine serum albumin and 0.05% Tween 20 phosphate-buffered saline. Clones exhibiting strong binding to tetanus toxoid were screened.

[0043] 4. FASEBA Screening Process: The antibody expression supernatant was mixed with standard tetanus toxin at a volume ratio of 4:1 to achieve a tetanus toxin dose of 20 MLD. After neutralization at 37°C for 1 hour, the mixture was injected into mice. The toxin control group died within 36 hours. Hybridoma antibody groups that did not result in mouse death after 96 hours were selected for subsequent experiments.

[0044] 5. Antibody sequence identification process: After culturing, the clone is reverse transcribed into cDNA using 9-mer random primers, and then amplified by PCR using primers in the table below.

[0045] Table 3. Primer sequence listing

[0046] Note: S represents G or C; Y represents C or T; W represents A or T; R represents A or G; K represents T or C; D represents G, A or T.

[0047] The amplified products were treated with a DNA recovery kit (Thermo Fisher Scientific, catalog number: K0722), ligated to T-Vector pMD19 (Takara, Code No. 6013) using T4 DNA ligase (Invitrogen, catalog number: 15224041), transformed into E. coli Top10, and plated on Amp-resistant plates. Single clones were selected for sequencing using universal primers M13 / M13F. The sequencing results are shown in Table 4.

[0048] The translated amino acid sequences are shown in Table 5.

[0049] 6. Antibody Expression and Purification: After adding the human IgG1 framework region to the variable regions of the antibody light and heavy chains, a CHO cell expression line was constructed. Shanghai Beijin Eden B101 medium was used, with Eden F100a and Eden F100b added as feed according to the manufacturer's instructions. The expression supernatant was purified using NMab affinity chromatography material. The target protein was eluted with 5 mmol / L sodium acetate-acetic acid buffer at pH 3.8, and the protein concentration was determined using the A280 method.

[0050] Three batches of antibodies were prepared according to the above steps for subsequent experiments. The sample batch numbers are TS20230701, TS20231003 and TS20231101.

[0051] Plasmids for comparative example 1, JP4334995B2 antibody, and antibodies TS20230701, TS20231003 and TS20231101 were constructed, and the antibody expression was consistent.

[0052] The light and heavy chain sequences were inserted into the yeast expression vector pPIC9 to construct the pPIC9-G6 plasmid. The ScFv-G6 expressing yeast strain *Pichia pastoris* GS115 pPIC9-G6 (a transformed strain obtained by introducing yeast DNA through Sal I cleavage of the linear pPIC9-G6) was inoculated into 50 mL of YPD medium and pre-cultured at 30 °C. After 2 days of culture, the cells were collected and suspended in 10 mL of BMMY medium (containing 1% yeast extract, 2% peptone, 100 mM potassium phosphate buffer (1 M K2HPO4, 1 M KH2PO4, pH 6.0), 1.34% YNB, 4 × 10⁻⁵% biotin, and 0.5% methanol) and cultured at 30 °C for 4 days. Antibodies were then collected.

[0053] Heavy chain coding sequence: GAGGTGCAGCTGGTGGAGTCTGGGGGAGGTTTGGTACAGCCGGGGGGGTCCCTGAGACTCTCATGTGCAGCCTCTGGATTCACCTTTGACCGCTATGCCATGAGCTGGGTCCGCCAGGCTCCAGGGAAGGGACTGGAGTGGGTCTCAGGCATTAGTCGTAGTGGTGAAACCACATACTACGCAGACTCCGTGA AGGGCCCGGTTCACCATCTCCAGAGACAGCTCCAAGAACACGGTGTATCTGGAAATGAATAGCCTCAGAGGCGAGGACACGGCCGTATATTACTGTGCGAAAGCAGGAAAGCAGTGGTTGGCCTCTTATTACTTTGACTACTGGGGCCAGGGAGCCCTGGTCACCGTCTCCGCCGCCTCCACCAAGGGCCCATCGGTC (SEQ ID NO:26).

[0054] Light chain coding sequence: GACATCGTGATGACCCAGTCTCCAGCCACCCTGTCTGTGTCTCCAGGGGAGAGAGCCACCCTCTCCTGTCGGGCCAGTCAGAGTGTTGGCACCAACTTAGCCTGGTACCAACAGAAACCTGGCCAGGCTCCCAGGCTCCTCATCTATGGTGCATCCACCA GGGCCACTGGTATCGCAGCCAGGTTCAGTGGCAGTGGGTCTGGGACAGAGTTCACTCTCACCATCAGCAGCCTGCAGTCTGAAGATTTTGCAGTTTTACTGTCAGCAGTACAGTGACTGGCCTCCACAGACTTTCGGCGGAGGGACCAAGGTAGAGATCAAA (SEQ ID NO:27).

[0055] Experiment Example 1 Affinity Experiment 1. Experimental Method The equilibrium dissociation constant KD of recombinant human anti-tetanus toxin monoclonal antibody and tetanus toxoid was detected by the capture method. That is, the recombinant human anti-tetanus toxin monoclonal antibody as ligand was first captured using Protein A chip, and then tetanus toxoid was used as analyte for determination.

[0056] KD constant determination: HBS-EP+ Buffer was diluted 10-fold to serve as the test sample diluent and run buffer. The Method program was run. For ligand capture, the recombinant human anti-tetanus toxin monoclonal antibody was first diluted 1000-2000-fold with run buffer at a flow rate of 10 μL / min and a capture time of 60 sec. Tetanus toxoid was then serially diluted (8-10 concentration points). Run buffer was used as a blank control. The analyte binding time was 60 sec, dissociation time was 1500 sec, and flow rate was 30 μL / min. The regeneration buffer was glycine, with a binding time of 30 sec and a flow rate of 30 μL / min.

[0057] Data Analysis: Open the analysis software, use the 1:1 Binding model to fit the equation, and automatically obtain the KD value.

[0058] 2. Experimental results: The affinity analysis spectra of tetanus toxoid with three batches of antibodies are shown in Figures 1-3, and the KD values ​​are shown in Table 6, which are 10-11 M.

[0059] Table 6. KD values ​​of tetanus toxoid and TAB antibody stock solutions

[0060] Experimental Example 2: Minimum Protective Dose 1 (LD50) of Tetanus Toxin in 17-19g Kunming Mice 100 To determine the absolute minimum lethal dose (LD50) of tetanus toxin, one vial of standard tetanus toxin was dissolved in physiological saline and mixed with an equal volume of neutral glycerol (sterilized at 116°C for 10 minutes) to prepare a 10 mg / mL toxin solution, with each mL containing at least 20 Lf of tetanus toxin. The solution was diluted 20× with borate buffer to the desired concentration. Toxin solutions of this concentration were then diluted at different gradients of 200×, 280×, 392×, 549×, 768×, 1076×, and 1506×. 0.4 mL of each solution was subcutaneously injected into 17-19g Kunming mice, and the mice were observed for 5 days. The absolute minimum lethal dose (LD50) of tetanus toxin was determined based on the mortality rate of the animals. 100 Mouse LD 100 The measurement results are shown in Table 7.

[0061] Table 7 Tetanus Toxin LD50 100 Measurement

[0062] Experimental Results: Mice in groups 1-5 died on day 4. In group 6, all mice died on day 5. In group 7, some mice did not die completely on day 5. Therefore, the 1076× dilution group was selected as one LD50. 100 Further experiments will be conducted.

[0063] Experimental Example 3: Complete Neutralization of 4LD 100 Tetanus toxin dosage of 4LD 100 The toxin dosage was used as the toxin usage in the neutralization test (the toxin was diluted 135×, because the toxin and antibody were mixed 1:1 in the neutralization test). Recombinant human anti-tetanus toxin monoclonal antibody injection stock solution (batch number: TS20230701) was used as the backup antibody. The antibody was diluted 3×, from 333 μg / mL to 0.002 μg / mL in 12 experimental groups. After being mixed with an equal volume of toxin, it was neutralized in vitro at 37℃ for 1 hour. Mice were subcutaneously injected with 0.4 mL, and observed for 21 days. The complete neutralization of the toxin and the neutralization of 4LD were determined based on mouse mortality. 100 Minimum antibody dose for tetanus toxin. The results are shown in Table 8.

[0064]

[0065] Note: No mice in experimental groups 1-8 died, indicating that the antibody could completely neutralize 4LD. 100 Tetanus toxin; mice in the experimental group (9-12) died, indicating that the antibody could not completely neutralize 4LD. 100 Tetanus toxin.

[0066] Three batches of independently prepared antibodies were tested using the above method, with 4LD... 100 The antibody protection 4LD was calculated based on the mortality rate of the mice. 100 The minimum antibody dose for tetanus toxin was 0.03 μg, and the results are shown in Table 9.

[0067] Table 9 shows the neutralization of 4LD in three batches of antibody samples. 100 Minimum antibody dose of a dose-dependent toxin

[0068] Example 4: Mouse Experiment Method (Chinese Pharmacopoeia, see General Chapter 3508 for details). Principle: Based on the neutralizing effect of recombinant human anti-tetanus toxin monoclonal antibody injection, the test sample was compared with a standard to calculate the number of international units (IU / mL) of recombinant human anti-tetanus toxin monoclonal antibody per 1 mL of the test sample. The specific activity coefficient was calculated based on the titer and protein concentration, therefore it was not determined separately.

[0069] Methods: Tetanus antitoxin standard, tetanus toxin, and test sample were diluted according to the specified ratios. Quantitatively, the diluted antitoxin standard solution and test sample solutions of different dilutions were added to separate small test tubes. An equal volume of diluted toxin solution was added to each tube, and the tubes were sealed. After incorporation at 37°C for 1 hour, the solutions were immediately injected. 0.4 mL was subcutaneously injected into the abdomen or groin of 17-19g mice, taking care to prevent leakage. At least three mice were injected for each dilution of the standard and test sample. Injections were performed sequentially from high to low dilutions. Mice were observed at least once daily (morning and afternoon) for 5 consecutive days, and their morbidity and mortality were recorded.

[0070] Results determination: Control mice should all die within 72-120 hours. The potency of the test sample is the highest dilution of mice that died simultaneously with the control mice or showed the most severe tetanus neurotoxicity symptoms.

[0071] The antibody titers of the three independently prepared batches in Example 1 are shown in Table 10.

[0072] Table 10 Antibody Sample Titer

[0073] Finally, it should be noted that the above content is only used to illustrate the technical solution of the present invention, and is not intended to limit the scope of protection of the present invention. Simple modifications or equivalent substitutions made by those skilled in the art to the technical solution of the present invention do not depart from the essence and scope of the technical solution of the present invention.

Claims

1. A tetanus antibody, characterized in that, The anti-tetanus antibody comprises: heavy chain CDR1 shown in SEQ ID NO:1, heavy chain CDR2 shown in SEQ ID NO:2, and heavy chain CDR3 shown in SEQ ID NO:3; and light chain CDR1 shown in SEQ ID NO:4, light chain CDR2 shown in SEQ ID NO:5, and light chain CDR3 shown in SEQ ID NO:

6.

2. The anti-tetanus antibody according to claim 1, characterized in that, The anti-tetanus antibody comprises: (1) a heavy chain variable region, wherein the heavy chain variable region is the amino acid sequence shown in SEQ ID NO:7; and a light chain variable region, wherein the light chain variable region is the amino acid sequence shown in SEQ ID NO:8; and (2) an amino acid sequence having more than 60% identity with (1) and having the same CDR region.

3. The anti-tetanus antibody according to any one of claims 1-2, characterized in that, The anti-tetanus antibody is a monoclonal antibody.

4. The anti-tetanus antibody according to any one of claims 1-2, characterized in that, The anti-tetanus antibody is a humanized antibody.

5. The use of the anti-tetanus antibody according to any one of claims 1-4 in the preparation of a medicament for the prevention and / or treatment of tetanus or a product for detecting tetanus toxin levels.

6. A nucleic acid molecule, characterized in that: The nucleic acid molecule encodes the antibody as described in any one of claims 1-4.

7. The nucleic acid molecule according to claim 6, characterized in that, The sequence of the nucleic acid molecule is shown in SEQ ID NO:9-10.

8. A biological expression vector, characterized in that: The biological expression vector comprises the nucleic acid molecule as described in any one of claims 6-7.

9. A host cell, characterized in that: The host cell comprises the nucleic acid molecule of any one of claims 6-7 or the biological expression vector of claim 8.

10. An immunoconjugate, characterized in that: It includes the antibody as described in any one of claims 1-4.

11. Use in the preparation of a medicament for the prevention and / or treatment of tetanus by the nucleic acid molecule of any one of claims 6-7, the biological expression vector of claim 8, the host cell of claim 9, or the immunoconjugate of claim 10.

12. A pharmaceutical composition, characterized in that: The pharmaceutical composition comprises the antibody according to any one of claims 1-4, the nucleic acid molecule according to any one of claims 6-7, the biological expression vector according to claim 8, the host cell according to claim 9, or the immunoconjugate according to claim 10.

13. A method for detecting tetanus toxin levels for non-diagnostic purposes, characterized in that, The product includes the antibody as described in any one of claims 1-4.

14. The method according to claim 13, characterized in that, The method includes the following steps: (1) obtaining a sample containing tetanus toxin; (2) contacting the sample obtained in step (1) with the antibody according to any one of claims 1-4; and (3) detecting the binding of the sample with the antibody according to any one of claims 1-4.

15. A method for preparing the antibody according to any one of claims 1-4, characterized in that: The method includes culturing the host cell of claim 9 in a culture medium.

16. The method according to claim 15, characterized in that: The method includes recovering antibodies from the host cells or culture medium.

Images