Universal type definitive endoderm culture medium and culture method for inducing pluripotent stem cells to differentiate into definitive endoderm cells

Abstract

The invention discloses a universal type definitive endoderm culture medium for inducing pluripotent stem cells to differentiate into definitive endoderm cells and a culture method, and relates to the technical field of stem cell biology and regenerative medicine. The universal typing endoderm culture medium comprises a basic culture medium, polyvinyl alcohol, an animal-origin-free B-27 supplement, a TGF-beta activator, a Wnt signaling pathway activator, a JNK-JUN inhibitor, a PI3K / mTOR inhibitor, L-ascorbic acid and a ROCK inhibitor, wherein the basic culture medium is used for providing nutritional ingredients required by cell growth; the universal typified endoderm culture medium comprises a typified endoderm culture medium 1 and a typified endoderm culture medium 2, according to the culture method, the general type typing endoderm culture medium is constructed to obtain the typing endoderm cell balls, and the general type typing endoderm culture medium is definite in component and does not contain animal-derived components, so that the general type typing endoderm culture medium meets the requirement of a drug supervision institution on chemical component limitation of cell treatment products; high-density culture is carried out on the typified endoderm cells through suspension culture, so that the method is more suitable for production requirements.

Description

Technical Field

[0001] This invention relates to the fields of stem cell biology and regenerative medicine, and in particular to a universal type-specific endoderm culture medium and culture method for inducing pluripotent stem cells to differentiate into type-specific endoderm cells. Background Technology

[0002] Loss of function in endoderm-derived organs can lead to serious diseases; for example, pathological damage to hepatocellular carcinoma can progress to liver failure, while disruption of pancreatic β-cell function can lead to type 1 diabetes. Therefore, achieving efficient and targeted differentiation of pluripotent stem cells into endoderm-derived organs or tissues with complete physiological function, such as the liver, pancreas, lungs, and intestines, not only provides ideal in vitro models for high-throughput drug screening and drug toxicity evaluation, but also offers potential donor materials for clinical organ transplantation, which is of great significance for promoting the development of regenerative and translational medicine.

[0003] Currently, various techniques exist to induce pluripotent stem cells to differentiate into defined endoderm, providing cellular material for obtaining endoderm-derived organs and tissues. Some current differentiation induction systems still use culture media and coating substrates containing animal-derived proteins. While these proteins primarily provide nutrients, adhesion factors, carrier proteins, and antioxidants, they suffer from inherent drawbacks such as complex composition, batch-to-batch variability, and potential contaminants. These drawbacks can lead to fluctuations in stem cell growth and differentiation efficiency, consequently affecting the quality uniformity and therapeutic stability of subsequent clinical-grade products. Furthermore, residual animal-derived proteins in clinical products may trigger immune rejection, posing additional health risks to patients and severely hindering the translation of related technologies from basic research to clinical application. Establishing a standardized, clearly defined, animal-free culture medium is fundamental to the standardization, safety, and clinical translation of cell therapy products.

[0004] Cell suspension culture technology offers significant advantages in scalability, process controllability, and cost-effectiveness. On the one hand, suspension culture systems overcome the limitations of adherent culture, such as limited yield and uneven surface growth, which restrict process stability and economic efficiency. On the other hand, even cells adapted to suspension growth can still suffer cell damage, apoptosis, or decreased target product expression due to fluid shear forces and mechanical stresses such as air bubbles during scale-up, affecting final yield and quality. Therefore, developing efficient and gentle methods for large-scale suspension culture of adherent cells, or further improving the tolerance and productivity of suspension cells during scale-up, has urgent industrial demand and significant economic value.

[0005] Polyvinyl alcohol (PVA), as a chemically synthesized polymer, allows for precise control of its molecular weight and purity, ensuring the stability and reproducibility of the culture system while effectively avoiding the risks of immune rejection in humans associated with animal-derived materials. Furthermore, PVA's swelling properties provide a certain viscosity base in the culture medium, reducing collisions between cell spheres during suspension culture and buffering the damaging effects of fluid shear forces on cells, thus inhibiting non-physiological aggregation of cell spheres during suspension culture. Combining the suspension culture system with a standardized, well-defined, animal-free culture medium can effectively address the impact of animal-derived components on the quality of the final clinical product, providing an important foundation for the large-scale production of pluripotent stem cell-derived stereotyped endoderm cell products. Therefore, this paper addresses this issue by providing a universal stereotyped endoderm culture medium and method for inducing pluripotent stem cells to differentiate into stereotyped endoderm cells. Summary of the Invention

[0006] In view of this, the present invention addresses the deficiencies of existing technologies, and its main objective is to provide a universal type-specific endoderm culture medium and culture method for inducing pluripotent stem cells to differentiate into type-specific endoderm cells. This method combines a polyvinyl alcohol-based physical protection system with a standardized serum-free culture medium with clearly defined components to construct a stable, safe, and controllable suspension universal type-specific endoderm culture medium for obtaining type-specific endoderm cell spheroids. This universal type-specific endoderm culture medium has clearly defined components and does not contain animal-derived components, thus meeting the requirements of drug regulatory agencies for limiting the chemical composition of cell therapy products, making it more suitable for clinical applications. Simultaneously, the high-density culture of type-specific endoderm cells through suspension culture is more suitable for production needs.

[0007] To achieve the above objectives, the present invention adopts the following technical solution: A universal type-specific endoderm culture medium for inducing pluripotent stem cells to differentiate into type-specific endoderm cells includes a basal culture medium for providing nutrients required for cell growth, polyvinyl alcohol, animal-free B-27 supplement, TGF-β activator, Wnt signaling pathway activator, JNK-JUN inhibitor, PI3K / mTOR inhibitor, L-ascorbic acid, and ROCK inhibitor; the universal type-specific endoderm culture medium includes type-specific endoderm culture medium 1 and type-specific endoderm culture medium 2.

[0008] As a preferred embodiment, the shaped endoderm culture medium 1 comprises the following components: basal culture medium, polyvinyl alcohol at a final concentration of 0.05%-3%, glutamate at a final concentration of 0.5%-1%, animal-free B-27 supplement at a final concentration of 1%-2%, penicillin-streptomycin antibiotic at a final concentration of 1%, L-ascorbic acid at a final concentration of 200-300 μM, TGF-β activator at a final concentration of 50-120 ng / mL, JNK-JUN inhibitor at a final concentration of 0.5-5 μM, PI3K / mTOR inhibitor at a final concentration of 0.5-50 μM, Wnt signaling pathway activator at a final concentration of 1-10 μM, and ROCK inhibitor at a final concentration of 5-15 μM.

[0009] As a preferred embodiment, the shaped endoderm culture medium 1 comprises the following components: basal culture medium, 0.1% polyvinyl alcohol, 1% glutamate, 1% animal-free B-27 supplement, 1% penicillin-streptomycin antibiotic, 250 μM L-ascorbic acid, 100 ng / mL Activin A, 1 μM JNK-IN-8 inhibitor, 10 μM LY294002, 3.5 μM CHIR99021, and 10 μM MY27632, all at final concentrations.

[0010] As a preferred embodiment, the shaped endoderm culture medium 2 comprises the following components: basal culture medium, polyvinyl alcohol at a final concentration of 0.05%-3%, glutamate at a final concentration of 0.5%-1%, animal-free B-27 supplement at a final concentration of 1%-2%, penicillin-streptomycin antibiotic at a final concentration of 1%, L-ascorbic acid at a final concentration of 200-300 μM, and TGF-β activator at a final concentration of 50-120 ng / mL.

[0011] As a preferred embodiment, the shaped endoderm culture medium 2 comprises the following components: basal culture medium, 0.1% polyvinyl alcohol, 1% glutamate, 1% animal-free B-27 supplement, 1% penicillin-streptomycin antibiotic, 250 μM L-ascorbic acid, and 100 ng / mL Activin A, all at final concentrations.

[0012] As a preferred embodiment: the TGF-β activator is Activin A; the JNK-JUN inhibitor is JNK-IN-8; the PI3K / mTOR inhibitor is LY294002; the Wnt signaling pathway activator is CHIR99021; and the ROCK inhibitor is Y27632.

[0013] As a preferred embodiment, the basal culture medium includes DMEM / F12 basal culture medium, DMEM basal culture medium, or MCDB131 basal culture medium; the polyvinyl alcohol has an average molecular weight of 85,000-124,000 Daltons and a degree of hydrolysis of 85%-99.99%.

[0014] A method for obtaining culturing endoderm cells derived from pluripotent stem cell differentiation using the aforementioned universal culturing endoderm culture medium includes the following steps: S1: Pluripotent stem cells are spheroidized and cultured to obtain pluripotent stem cell spheres; S2: Inducing pluripotent stem cell spheres to form fixed endoderm cell spheres.

[0015] As a preferred embodiment: step S1 specifically includes... S1-1. Pluripotent stem cells are cultured in mTeSR1 at 37°C in a carbon dioxide incubator until the cell confluence reaches 80%-90%; these pluripotent stem cells are human embryonic stem cells or human induced pluripotent stem cells. S1-2: Digested pluripotent stem cells were prepared as single-cell suspensions and seeded in ultra-low adsorption plates. They were cultured in mTeSR1 medium containing 10 μMY27632 and 0.1% polyvinyl alcohol for 16-24 hours.

[0016] As a preferred embodiment, step S2 specifically comprises: S2-1. Prepare a standardized endoderm culture medium 1. Replace the culture medium of the pluripotent stem cell spheres obtained in step S1 with standardized endoderm culture medium 1 and culture them in a carbon dioxide incubator at 37°C for 24 hours. S2-2. Prepare a standardized endoderm culture medium 2. Replace the culture medium of the cells cultured in step S2-1 with the standardized endoderm culture medium 2, and culture in a 37°C carbon dioxide incubator for 48-72 hours.

[0017] Compared with the prior art, the present invention has obvious advantages and beneficial effects. Specifically, as can be seen from the above technical solution: First, this invention provides a universal, fixed-type endoderm culture medium with clearly defined components and no animal-derived ingredients. This universal, fixed-type endoderm culture medium is serum-free and contains no animal-derived components, thus avoiding medical safety issues associated with biological products caused by unclear components and residual animal proteins.

[0018] Secondly, the universal endoderm culture medium provided by this invention is universal and can stably and efficiently induce human pluripotent stem cells from different sources to differentiate into endoderm cells. It is highly universal and provides a foundation for obtaining functional cells of the endoderm lineage. It also provides a good application prospect for autologous or allogeneic cell therapy. Third, the polyvinyl alcohol used in this invention is a high-molecular-weight material with a well-defined chemical composition and precise synthesis capabilities. It possesses excellent batch stability and good biocompatibility, not only safely replacing animal-derived components and eliminating associated immune and pathogen risks, but also providing suitable viscosity for suspension culture systems. This effectively buffers fluid shear forces and inhibits non-physiological aggregation of cell spheres during culture and differentiation, thereby ensuring uniform cell cluster size and stable activity. This material system significantly improves the feasibility of large-scale preparation of shaped endoderm cells. While achieving high-quality, highly uniform cell expansion, it lays a reliable technical foundation for the subsequent commercial development and large-scale production of organs and tissues derived from shaped endoderm.

[0019] To more clearly illustrate the structural features and effects of the present invention, a detailed description is provided below in conjunction with the accompanying drawings and specific embodiments. Attached Figure Description

[0020] Figure 1 This document presents the technical route for differentiating human pluripotent stem cells to obtain defined endoderm cells according to the present invention, and microscopic clones of human pluripotent stem cells in various embodiments. Figure 2 Example 1 of this invention demonstrates that PVA can replace BSA, and Examples 2 and 3 demonstrate that the addition of LY294002 can significantly improve the flow cytometry results of human pluripotent stem cell spheres differentiating into shaped endoderm cell spheres. Figure 3 Example 4 of this invention demonstrates the relationship between the addition of PVA and the uniformity of cell spheroid volume during suspension culture; Figure 4 This is a graph showing the results of flow cytometry analysis of the proportion of SOX17 and FOXA2 double-positive cells in stereotyped endoderm cell spheres derived from different strains of human pluripotent stem cells in Example 4 of the present invention. Figure 5 This is a graph showing the results of real-time quantitative PCR analysis of the relative mRNA expression levels of SOX17 and FOXA2 in different strains of human pluripotent stem cell-derived endoderm cells in Example 4 of the present invention. Detailed Implementation

[0021] The present invention is as follows Figure 1 As shown in Figure 5, a universal type-fixed endoderm culture medium for inducing pluripotent stem cells to differentiate into type-fixed endoderm cells includes a basal culture medium for providing nutrients required for cell growth, polyvinyl alcohol, animal-free B-27 supplement, TGF-β activator, Wnt signaling pathway activator, JNK-JUN inhibitor, PI3K / mTOR inhibitor, L-ascorbic acid, and ROCK inhibitor; this universal type-fixed endoderm culture medium includes type-fixed endoderm culture medium 1 and type-fixed endoderm culture medium 2.

[0022] The standardized endoderm culture medium 1 comprises the following components: basal culture medium, polyvinyl alcohol at a final concentration of 0.05%-3%, glutamate at a final concentration of 0.5%-1%, animal-free B-27 supplement at a final concentration of 1%-2%, penicillin-streptomycin antibiotic at a final concentration of 1%, L-ascorbic acid at a final concentration of 200-300 μM, TGF-β activator at a final concentration of 50-120 ng / mL, JNK-JUN inhibitor at a final concentration of 0.5-5 μM, PI3K / mTOR inhibitor at a final concentration of 0.5-50 μM, Wnt signaling pathway activator at a final concentration of 1-10 μM, and ROCK inhibitor at a final concentration of 5-15 μM.

[0023] The final endoderm culture medium 1 comprises the following components: basal medium, 0.1% polyvinyl alcohol, 1% glutamate, 1% animal-free B-27 supplement, 1% penicillin-streptomycin antibiotic, 250 μM L-ascorbic acid, 100 ng / mL Activin A, 1 μM JNK-IN-8 inhibitor, 10 μM LY294002, 3.5 μM CHIR99021, and 10 μM Y27632, all at final concentrations.

[0024] The standardized endoderm culture medium 2 comprises the following components: basal culture medium, polyvinyl alcohol at a final concentration of 0.05%-3%, glutamate at a final concentration of 0.5%-1%, animal-free B-27 supplement at a final concentration of 1%-2%, penicillin-streptomycin antibiotic at a final concentration of 1%, L-ascorbic acid at a final concentration of 200-300 μM, and TGF-β activator at a final concentration of 50-120 ng / mL.

[0025] The final endoderm culture medium 2 comprises the following components: basal medium, 0.1% polyvinyl alcohol, 1% glutamate, 1% animal-free B-27 supplement, 1% penicillin-streptomycin bispecific antibody, 250 μM L-ascorbic acid, and 100 ng / mL Activin A, all at final concentrations.

[0026] The TGF-β activator is Activin A; the JNK-JUN inhibitor is JNK-IN-8; the PI3K / mTOR inhibitor is LY294002; the Wnt signaling pathway activator is CHIR99021; and the ROCK inhibitor is Y27632.

[0027] The basal culture medium includes DMEM / F12 basal medium, DMEM basal medium or MCDB131 basal medium; the polyvinyl alcohol has an average molecular weight of 85,000-124,000 Daltons and a degree of hydrolysis of 85%-99.99%.

[0028] A method for obtaining cultured endoderm cells derived from pluripotent stem cell differentiation using a universal culture medium for shaped endoderm includes the following steps: S1: Pluripotent stem cells are spheroidized and cultured to obtain pluripotent stem cell spheres; S2: Inducing pluripotent stem cell spheres to form fixed endoderm cell spheres.

[0029] Step S1 specifically is as follows: S1-1. Pluripotent stem cells are cultured in mTeSR1 at 37°C in a carbon dioxide incubator until the cell confluence reaches 80%-90%; these pluripotent stem cells are human embryonic stem cells or human induced pluripotent stem cells. S1-2. Digest pluripotent stem cells into a single-cell suspension using Accutase digestion solution, at a concentration of 2.5 × 10⁻⁶ cells / cell. 5 / mL was inoculated into 6-well ultra-low adsorption plates and cultured in mTeSR1 medium containing 10μM Y27632 and 0.1% polyvinyl alcohol for 16-24 hours.

[0030] Step S2 specifically involves: S2-1. Prepare a standardized endoderm culture medium 1. Replace the culture medium of the pluripotent stem cell spheres obtained in step S1 with standardized endoderm culture medium 1 and culture them in a carbon dioxide incubator at 37°C for 24 hours. S2-2. Prepare a standardized endoderm culture medium 2. Replace the culture medium of the cells cultured in step S2-1 with the standardized endoderm culture medium 2, and culture in a 37°C carbon dioxide incubator for 48-72 hours.

[0031] Example 1: In the process of inducing human embryonic stem cells H1 to differentiate into the fixed endoderm, polyvinyl alcohol (PVA) can replace the role of BSA, and LY294002 can further promote the differentiation efficiency of the fixed endoderm.

[0032] 1. Expansion culture of human embryonic stem cells H1 1.1. Human embryonic stem cells H1 were cultured in mTeSR1 medium on a 1:100 diluted matrix gel until cell confluence reached 80%-90%. Cell colonies of human embryonic stem cell line H1 were observed under a microscope. Figure 1 ).

[0033] 1.2. Human embryonic stem cells H1 were digested into single cells using Accutase at a concentration of 2.5 × 10⁻⁶. 5 Cells / well were seeded in 12-well plates pre-embedded with Growth Factor Reducer-Matrigel and cultured in 1 mL of mTeSR containing 10 μM Y27632 for 24 hours to initiate differentiation.

[0034] 2. Inducing human embryonic stem cells H1 to differentiate into mature endoderm cells 2.1. Prepare a standardized endoderm cell culture medium A, and culture the above-mentioned human embryonic stem cells H1 in a 37°C carbon dioxide incubator for 24 hours using the culture medium A. Prepare a standardized endoderm cell culture medium B, replace the human embryonic stem cells H1 cultured in step a) above with the standardized endoderm cell culture medium B, and culture them in a carbon dioxide incubator at 37°C for 2 days, changing the culture medium daily. The shaping endoderm culture medium A is based on MCDB131 and also includes the following components: 0.1% polyvinyl alcohol, 1% glutamate, 1% animal-free B-27 supplement, 1% penicillin-streptomycin antibiotic, 250 μM L-ascorbic acid, 100 ng / mL Activin A, and 3.5 μM CHIR99021. All concentrations are final concentrations.

[0035] The shaping endoderm culture medium B is based on MCDB131 and also includes the following components: 0.1% polyvinyl alcohol, 1% glutamate, 1% animal-free B-27 supplement, 1% penicillin-streptomycin bispecific antibiotic, 250 μM L-ascorbic acid, and 100 ng / mL Activin A, all of which are final concentrations. Polyvinyl alcohol (PVA) has a molecular weight of 85,000–124,000 and a degree of hydrolysis >99%. 3. Flow cytometry analysis of FOXA2 and SOX17 expression in morphologically determined endoderm cells. Adherent cells cultured on endoderm stage culture plates were washed three times with calcium- and magnesium-free PBS (DPBS) to remove residual liquid. Cells were then covered with Accutase and incubated at 37°C for 3 minutes for digestion. Digestion was then terminated with DMEM / F-12. Cell clumps were gently pipetted to obtain homogenized single cells, which were transferred to flow cytometry tubes and centrifuged at 500g for 3 minutes. The supernatant was removed, leaving the cell pellet. The cell pellet was resuspended in DPBS and centrifuged at 500g for 3 minutes. The supernatant was removed, leaving the cell pellet. 0.5 mL of fixation and permeabilization buffer (freshly prepared and protected from light) was added, and the cell pellet was gently resuspended by pipetting. The pellet was then incubated at 4°C for 40 minutes in the dark. The process was terminated with 0.5 mL of freshly prepared washing buffer, centrifuged at 500g for 3 minutes, and the supernatant was removed, leaving the cell pellet. Add 1 mL of washing buffer to the cell pellet, resuspend the cells, centrifuge at 500 g for 3 min, and discard the supernatant. Add the primary fluorescent antibody, incubate at 4°C in the dark for 40 min. After incubation, terminate the incubation with 0.5 mL of washing buffer, centrifuge at 500 g for 3 min, and discard the supernatant. Add 1 mL of washing buffer to the cell pellet, resuspend the cell pellet, centrifuge at 500 g for 3 min, and discard the supernatant. Finally, resuspend the cell pellet with 0.5 mL of DPBS and perform sample analysis using a BD FACSAria III flow cytometer. The fluorescent primary antibodies used in this application are as follows: PEMouse anti-Human FoxA2 (BD Pharmingen, #561589, 1:100), AlexaFluor@647Mouse Anti-Human Sox17 (BD Pharmingen, #562594, 1:100), and the fixation and rupture buffers used are prepared from Transcription Factor Buffer Set (BD Pharmingen, #562574).

[0036] Example 2: In this example, the small molecule drug LY294002 was added to the endoderm cell culture medium A, with a final concentration of 5 μM. Other steps were the same as in Example 1.

[0037] Example 3: In this example, the small molecule drug LY294002 was added to the endoderm cell culture medium A, with a final concentration of 10 μM. Other steps were the same as in Example 1.

[0038] Comparative Example 1: In Comparative Example 1, polyvinyl alcohol was not added to the endoderm cell culture medium A and the endoderm cell culture medium B, which served as negative control groups. Other steps were the same as in Example 1.

[0039] Comparative Example 2: In Comparative Example 2, polyvinyl alcohol was not added to the endodermal cell culture medium A and endodermal cell culture medium B, but 0.2% BSA was added as a control group. Other steps were the same as in Example 1.

[0040] Example 4: A method for directed differentiation of human pluripotent stem cells into well-defined endoderm cell spheres using a suspension culture system. 1. Aggregation of human pluripotent stem cells into spheres in a suspension culture system 1.1. Cell clones of human pluripotent stem cells (human embryonic stem cells H1, human embryonic stem cells HuES8, human induced pluripotent stem cells SZBKi003-A, and human induced pluripotent stem cells SZBKi004-B) observed under a microscope are as follows: Figure 1 (As shown) mTeSR1 cells were cultured in a 37°C CO2 incubator until the cell confluence reached 80%-90%.

[0041] 1.2. Human pluripotent stem cells were digested into single cells using Accutase at a rate of 5 × 10⁻⁶ cells / cell. 5 Cells / well were seeded into 6-well ultra-low adsorption plates and cultured in 2 mL of mTeSR1 medium containing 10 μM Y27632 and 0.1% PVA for 24 hours. The plates were then placed horizontally on a shaker at 100 rpm and incubated at 37°C in a CO2 incubator for 16-24 hours to form spheroids. 2. Inducing human pluripotent stem cell spheres to differentiate into fixed endoderm cell spheres.

[0042] 2.1. Prepare a standardized endoderm cell culture medium 1, and culture the above-mentioned human embryonic stem cells H1 in a 37°C carbon dioxide incubator for 24 hours using the culture medium. 2.2. Prepare a standardized endoderm cell culture medium 2, replace the human embryonic stem cells H1 cultured in step 1.3 above with standardized endoderm cell culture medium 2, and culture in a 37℃ carbon dioxide incubator for 2 days, changing the culture medium daily; The shaping endoderm culture medium 1 is based on MCDB131 and also includes the following components: 0.1% polyvinyl alcohol, 1% glutamate, 1% animal-free B-27 supplement, 1% penicillin-streptomycin antibiotic, 250 μM L-ascorbic acid, 100 ng / mL Activin A, 1 μM JNK-IN-8 inhibitor, 10 μM LY294002, 3.5 μM CHIR99021, and 10 μM MY27632. All concentrations are final concentrations.

[0043] The 2-component endoderm culture medium is based on MCDB131 and also includes the following components: 0.1% polyvinyl alcohol, 1% glutamate, 1% animal-free B-27 supplement, 1% penicillin-streptomycin antibiotic, 250 μM L-ascorbic acid, and 100 ng / mL Activin A, all of which are final concentrations. 3. Flow cytometry was used to detect the expression of FOXA2 and SOX17 in shaped endoderm cells.

[0044] Transfer the cell pellet cultured in the endoderm stage culture plate to a 15 mL tube. After the cell pellet settles naturally, remove the supernatant. Wash three times with 2 mL of calcium- and magnesium-free PBS (DPBS) to remove any residual liquid. Resuspend the cell pellet in 1 mL of Accutase, place it square on a horizontal shaker, and digest at 37°C for 8 min. Then terminate the digestion with an equal volume of DMEM / F-12. Gently pipette the cell pellet to obtain a well-mixed single cell. Transfer the pellet to a flow cytometry tube, centrifuge at 500 g for 3 min, remove the supernatant, and retain the cell pellet. Resuspend the cell pellet in DPBS, centrifuge at 500 g for 3 min, remove the supernatant, and retain the cell pellet. Add 0.5 mL of fixation and permeabilization buffer (freshly prepared and protected from light), gently pipette, resuspend the cell pellet, and incubate at 4°C for 40 min in the dark. Terminate the washing with 0.5 mL of freshly prepared washing buffer, centrifuge at 500 g for 3 min, remove the supernatant, and retain the cell pellet. Add 1 mL of washing buffer to the cell pellet, resuspend the cells, centrifuge at 500 g for 3 min, and discard the supernatant. Add the primary fluorescent antibody, incubate at 4°C for 40 min in the dark. After incubation, terminate the incubation with 0.5 mL of washing buffer, centrifuge at 500 g for 3 min, and discard the supernatant. Add 1 mL of washing buffer to the cell pellet, resuspend the cell pellet, centrifuge at 500 g for 3 min, and discard the supernatant. Finally, resuspend the cell pellet with 0.5 mL of DPBS and analyze the samples using a BDFACSAria III flow cytometer. The fluorescent primary antibodies used in this application are as follows: PE Mouseanti-Human FoxA2 (BD Pharmingen, #561589, 1:100), Alexa Fluor@647 Mouse Anti-Human Sox17 (BD Pharmingen, #562594, 1:100), and the fixation and rupture buffers used are prepared from Transcription Factor Buffer Set (BD Pharmingen, #562574, BD).

[0045] 4. Real-time quantitative PCR detection of FOXA2 and SOX17 expression in the morphological endoderm cell stage. 4.1. Extraction of total RNA from cells 4.1.1. Collect cells cultured in 24-well plates, wash twice with 0.5 mL DPBS, and lyse cells using 350 μL RLT solution from the RNA Extraction Kit (Qiagen, #74104). Repeatedly pipette the cells until complete lysis. Transfer the cell lysate to an RNase-free centrifuge tube. Add 350 μL of 70% ethanol to the lysate in the centrifuge tube and mix thoroughly. Add 700 μL of sample to the centrifuge column containing the collection tube provided in the kit. Centrifuge at 10000 g for 15 s and discard the effluent. Add 700 μL of RW1 solution to the centrifuge column, centrifuge at 10000 g for 15 s, and discard the effluent. Add 500 μL of LPE solution to the centrifuge column, centrifuge at 10000 g for 15 s, and discard the effluent. Add 500 μL of RW1 solution to the centrifuge column, centrifuge at 10000 g for 2 min, and discard the effluent. Place the centrifuge column in a new collection tube and add 30 μL of RNase-free water to the center of the column membrane. Centrifuge at 10,000 g for 1 min. Collect the effluent, which is the extracted RNA. Store the RNA in a -80°C ultra-low temperature freezer.

[0046] 4.2. Preparation of cDNA 4.2.1. The concentration and purity of the extracted total RNA were determined (A260 / A280 absorbance ratio > 1.8). cDNA was prepared using the PrimeScript™ RT reagent Kit with gDNA Eraser (TAKARA, #RR047A). The RNA was placed on ice, and the volume required for reverse transcription of 1 μg of RNA was calculated based on the concentration. Then, 4 μL of 5×gDNA Eraser buffer and 2 μL of gDNA Eraser were added, and the volume was brought up to 20 μL with RNase-free water. The mixture was gently vortexed and centrifuged to the bottom of the PCR tube using a handheld centrifuge. The reaction was performed using a Labnet MULTIGENE OPTIMAX at 42°C for 2 min.

[0047] 4.2.2. Place the reaction solution obtained in step 4.2.1 above on ice, and add 2 μL of PrimerScript RT, 2 μL of RT Primer Mix, 28 μL of 5x PrimerScript Buffer, and 4 μL of RNase-free water from the kit to obtain a total reverse transcription volume of 40 μL. Gently vortex to mix, centrifuge the mixed liquid to the bottom of the PCR tube using a handheld centrifuge, and perform the reaction using a Labnet MULTIGENE OPTIMAX. The reaction conditions are: first react at 37℃ for 15 min, then react at 85℃ for 5 s. The obtained product is stored at -20℃.

[0048] 4.3. SYBR Green real-time quantitative PCR detection of the relative mRNA expression of SOX17 and FOXA2 4.3.1. SYBR Green Realtime PCR was performed using SYBR Green Realtime PCR Master Mix (TOYOBO, QPK-201). 1 μL of cDNA prepared in step 4.2 was added to 7.5 μL of 2X SYBR® Green Realtime PCR Master Mix, 5 μM upstream primer, and 5 μM downstream primer. The volume was then adjusted to 15 μL with RNase-free water. Amplification was performed using a Roche LightCycler 480Ⅱ quantitative PCR instrument employing a three-step method. The reaction conditions were: pre-denaturation at 95℃ for 60 s, followed by 40 PCR cycles (15 s at 95℃, 30 s at 60℃, and 45 s at 72℃). The experimental results were analyzed using the AACT method to compare with the housekeeping gene GAPDH.

[0049] 4.3.2. Primers used in this application: GAPDH forward primer GTCTCCTCTGACTTCAACAGC, GAPDH reverse primer ACCACCCTGTTGCTGTAGCCAA; FOXA2 forward primer GGAACACCACTA CGCCTTCAAC, FOXA2 reverse primer AGTGCATCACCTGTTCGTAGGC; SOX17 forward primer ACGCTTTCATGGTGTGGGCTAAG, SOX17 reverse primer GTCAGCGCCTTCC ACGACTTG.

[0050] 4.3.3. Relative mRNA expression levels of FOXA2 and SOX17 in the morphological endoderm cell stage as detected by real-time quantitative PCR.

[0051] 5. Test Results and Analysis 5.1. Detection of FOXA2 in the shaped endoderm cells of Comparative Example 1, Comparative Example 2, Example 1, Example 2 and Example 3 + SOX17 + Positive rate, specific results as follows Figure 2 As shown.

[0052] Figure 2The results of Comparative Examples 1, 2, and 1 showed that the positive rate of shaped endoderm cells was only 20% in the absence of BSA during the shaped endoderm cell differentiation process. In Comparative Example 2, the addition of BSA significantly increased the positive rate of shaped endoderm cells to 40%. In Example 1, when only PVA was added, the positive rate of shaped endoderm cells was found to be basically consistent with that of Comparative Example 2, indicating that under the same shaped endoderm cell induction system, PVA can replace the function of BSA, making it an effective substitute.

[0053] Figure 2 The results of Examples 1-3 showed that the addition of the PI3K / mTOR signaling inhibitor LY294002 during the differentiation of endodermal cells significantly increased the FOXA2+SOX17+ positivity rate. At a LY294002 concentration of 5 μM in the culture medium, the FOXA2+SOX17+ positivity rate increased to 70%, and as the concentration was increased to 10 μM, the FOXA2+SOX17+ positivity rate of endodermal cells continued to increase to 80%. These results demonstrate that the addition of the PI3K / mTOR signaling inhibitor LY294002 significantly promoted the differentiation of endodermal cells in a concentration-dependent manner.

[0054] 5.2. Detection of FOXA2+ in fixed endoderm cells derived from different cell lines obtained in the suspension culture system of Example 4. SOX17 + Positive rate, specific results as follows Figures 3-4 .

[0055] Figure 4 Mid-flow cytometry results showed that the morphological endoderm culture medium in Example 4 could efficiently differentiate embryonic stem cells (H1, HuES8) and human induced pluripotent stem cells (SZBKi003-A, SZBKi004-B) into morphological endoderm cell spheres in a suspension culture system, with FOXA2... + SOX17 + The positive rate of cells was >80%.

[0056] Figure 5 The qPCR results showed that, under the culture medium for shaping endoderm cells in Example 4, the mRNA expression levels of the markers SOX17 and FOXA2 in the shaping endoderm cells were significantly expressed.

[0057] The key design focus of this invention is: First, this invention provides a universal, fixed-type endoderm culture medium with clearly defined components and no animal-derived ingredients. This universal, fixed-type endoderm culture medium is serum-free and contains no animal-derived components, thus avoiding medical safety issues associated with biological products caused by unclear components and residual animal proteins.

[0058] Secondly, the universal endoderm culture medium provided by this invention is universal and can stably and efficiently induce human pluripotent stem cells from different sources to differentiate into endoderm cells. It is highly universal and provides a foundation for obtaining functional cells of the endoderm lineage. It also provides a good application prospect for autologous or allogeneic cell therapy. Third, the polyvinyl alcohol used in this invention is a high-molecular-weight material with a well-defined chemical composition and precise synthesis capabilities. It possesses excellent batch stability and good biocompatibility, not only safely replacing animal-derived components and eliminating associated immune and pathogen risks, but also providing suitable viscosity for suspension culture systems. This effectively buffers fluid shear forces and inhibits non-physiological aggregation of cell spheres during culture and differentiation, thereby ensuring uniform cell cluster size and stable activity. This material system significantly improves the feasibility of large-scale preparation of shaped endoderm cells. While achieving high-quality, highly uniform cell expansion, it lays a reliable technical foundation for the subsequent commercial development and large-scale production of organs and tissues derived from shaped endoderm.

[0059] The above description is merely a preferred embodiment of the present invention and does not constitute any limitation on the technical scope of the present invention. Therefore, any minor modifications, equivalent changes, and alterations made to the above embodiments based on the technical essence of the present invention shall still fall within the scope of the technical solution of the present invention.

Claims

1. A universal type-specific endoderm culture medium for inducing pluripotent stem cells to differentiate into type-specific endoderm cells, characterized in that: It includes a basal medium for providing nutrients required for cell growth, polyvinyl alcohol, animal-free B-27 supplement, TGF-β activator, Wnt signaling pathway activator, JNK-JUN inhibitor, PI3K / mTOR inhibitor, L-ascorbic acid and ROCK inhibitor; this universal fixed endoderm culture medium includes fixed endoderm culture medium 1 and fixed endoderm culture medium 2.

2. The universal type-fixed endoderm culture medium for inducing pluripotent stem cells to differentiate into type-fixed endoderm cells according to claim 1, characterized in that: The defined endoderm culture medium 1 comprises the following components: basal culture medium, polyvinyl alcohol at a final concentration of 0.05%-3%, glutamate at a final concentration of 0.5%-1%, animal-free B-27 supplement at a final concentration of 1%-2%, penicillin-streptomycin antibiotic at a final concentration of 1%, L-ascorbic acid at a final concentration of 200-300 μM, TGF-β activator at a final concentration of 50-120 ng / mL, JNK-JUN inhibitor at a final concentration of 0.5-5 μM, PI3K / mTOR inhibitor at a final concentration of 0.5-50 μM, Wnt signaling pathway activator at a final concentration of 1-10 μM, and ROCK inhibitor at a final concentration of 5-15 μM.

3. The universal type-fixed endoderm culture medium for inducing pluripotent stem cells to differentiate into type-fixed endoderm cells according to claim 2, characterized in that: The defined endoderm culture medium 1 comprises the following components: basal culture medium, 0.1% polyvinyl alcohol, 1% glutamate, 1% animal-free B-27 supplement, 1% penicillin-streptomycin antibiotic, 250 μM L-ascorbic acid, 100 ng / mL Activin A, 1 μM JNK-IN-8 inhibitor, 10 μM LY294002, 3.5 μM CHIR99021, and 10 μM MY27632, all at final concentrations.

4. The universal type-fixed endoderm culture medium for inducing pluripotent stem cells to differentiate into type-fixed endoderm cells according to claim 2, characterized in that: The defined endoderm culture medium 2 comprises the following components: basal culture medium, polyvinyl alcohol at a final concentration of 0.05%-3%, glutamate at a final concentration of 0.5%-1%, animal-free B-27 supplement at a final concentration of 1%-2%, penicillin-streptomycin antibiotic at a final concentration of 1%, L-ascorbic acid at a final concentration of 200-300 μM, and TGF-β activator at a final concentration of 50-120 ng / mL.

5. The universal type-fixed endoderm culture medium for inducing pluripotent stem cells to differentiate into type-fixed endoderm cells according to claim 4, characterized in that: The defined endoderm culture medium 2 comprises the following components: basal culture medium, 0.1% polyvinyl alcohol, 1% glutamate, 1% animal-free B-27 supplement, 1% penicillin-streptomycin antibiotic, 250 μM L-ascorbic acid, and 100 ng / mL Activin A, all at final concentrations.

6. The universal type-fixed endoderm culture medium for inducing pluripotent stem cells to differentiate into type-fixed endoderm cells according to claim 4, characterized in that: The TGF-β activator is Activin A; the JNK-JUN inhibitor is JNK-IN-8; the PI3K / mTOR inhibitor is LY294002; the Wnt signaling pathway activator is CHIR99021; and the ROCK inhibitor is Y27632.

7. The universal type-fixed endoderm culture medium for inducing pluripotent stem cells to differentiate into type-fixed endoderm cells according to claim 1, characterized in that: The basal culture medium includes DMEM / F12 basal culture medium, DMEM basal culture medium or MCDB131 basal culture medium; the polyvinyl alcohol has an average molecular weight of 85,000-124,000 Daltons and a degree of hydrolysis of 85%-99.99%.

8. A method for culturing pluripotent stem cell-derived endodermal cells using the universal pluripotent endoderm culture medium according to any one of claims 1-7, characterized in that: Includes the following steps: S1: Pluripotent stem cells are spheroidized and cultured to obtain pluripotent stem cell spheres; S2: Inducing pluripotent stem cell spheres to form fixed endoderm cell spheres.

9. The cultivation method according to claim 8, characterized in that: Step S1 specifically involves: S1-1. Pluripotent stem cells are cultured in mTeSR1 at 37°C in a carbon dioxide incubator until the cell confluence reaches 80%-90%; these pluripotent stem cells are human embryonic stem cells or human induced pluripotent stem cells. S1-2: Digested pluripotent stem cells were prepared as single-cell suspensions and seeded in ultra-low adsorption plates. They were cultured in mTeSR1 medium containing 10 μM Y27632 and 0.1% polyvinyl alcohol for 16-24 hours.

10. The cultivation method according to claim 8, characterized in that: Step S2 specifically involves: S2-1. Prepare a standardized endoderm culture medium 1. Replace the culture medium of the pluripotent stem cell spheres obtained in step S1 with standardized endoderm culture medium 1 and culture them in a carbon dioxide incubator at 37°C for 24 hours. S2-2. Prepare a standardized endoderm culture medium 2. Replace the culture medium of the cells cultured in step S2-1 with the standardized endoderm culture medium 2, and culture in a 37°C carbon dioxide incubator for 48-72 hours.

Images