Concealed plasmid mediated genetic engineering probiotics as well as construction method and application thereof

Abstract

The invention belongs to the technical field of genetic engineering, and particularly relates to hidden plasmid mediated genetic engineering probiotics as well as a construction method and application thereof. According to the method, stable genetic expression of exogenous genes is mediated through high-copy hidden plasmids, resistance does not need to be added in the culture process, and the safety, stability and effectiveness of synthesis of food-grade nutritional chemicals are remarkably improved. The modified strain can efficiently utilize glucose as a carbon source to synthesize a functional nutritional chemical VB5 product, the titer of VB5 in shake flask fermentation reaches 102 mg / L, and the product is not detected by a wild strain. The invention provides a new strain and technical support for food-grade efficient synthesis of functional nutritional chemicals, and is beneficial to popularization and application in the field of food.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, and relates to a high-vitamin-producing genetically engineered probiotic using a cryptic plasmid as an expression vector, its construction method and application, and particularly to a high-vitamin B5-producing genetically engineered probiotic using Escherichia coli Nissle 1917 as the chassis strain and a cryptic plasmid as the expression vector, which enhances the pantothenic acid synthesis and metabolism pathway, its construction method and application. Background Technology

[0002] Escherichia coli Nissle 1917 (EcN) was first isolated from the feces of a healthy soldier by German physician Alfred Nissle in 1917. It has since been widely used for the prevention and treatment of infectious diarrhea, enteritis, and Crohn's disease. Furthermore, EcN is currently the only known strain of E. coli with probiotic functions and no pathogenicity, making it an ideal platform for producing metabolites in the food, feed, and pharmaceutical industries, suitable for industrial fermentation production.

[0003] Vitamin B5 (VB5), also known as D-pantothenic acid, is a water-soluble vitamin and a key precursor in the biosynthesis of coenzyme A (CoA) and acyl carrier proteins. As an important vitamin, VB5 helps in cell formation, maintains the normal development of the central nervous system, aids in antibody synthesis, helps fight infectious diseases, reduces the side effects of many antibiotics, and alleviates allergy symptoms. Microorganisms and plants can synthesize VB5 naturally, but animals cannot and must obtain it from external sources. Therefore, VB5 is widely used in the pharmaceutical, food, and feed industries.

[0004] Currently, the development and research of *E. coli* Nissle 1917 as a chassis strain are relatively limited, and reports on VB5 synthesis by *EcN* are scarce. Furthermore, as a probiotic, *EcN* does not produce endotoxins, allowing its genetically engineered strains to be directly applied in industrial production. Wild-type *EcN* cells contain two endogenous cryptic plasmids, pMUT1 and pMUT2, which are used as expression vectors for exogenous genes. The developed engineered cryptic plasmids maintain the genetic stability of the cells, and the high copy numbers of pMUT1 and pMUT2 contribute to the efficient synthesis of VB5.

[0005] Based on this, a cryptic plasmid from *E. coli* Nissle 1917 cells was used as a key gene expression vector. The engineered cryptic plasmid maintained stable genetic expression of the key gene, and its high copy number facilitated efficient VB5 synthesis. Furthermore, a systematic metabolic engineering strategy was employed to construct a high-yield VB5 probiotic that enhanced the pantothenic acid synthesis pathway, increased the precursor supply for VB5 synthesis, and improved VB5 biosynthesis efficiency. Therefore, developing efficient biosynthesis technology for food-grade VB5 is of great significance for expanding the application of VB5 in the pharmaceutical, food, and feed industries. Summary of the Invention

[0006] The present invention aims to overcome the defects of unstable yield and difficulty in adapting to industrial production in the biosynthesis of VB5 in the prior art. It provides a cryptic plasmid-mediated genetically engineered probiotic and its construction method, and applies it to the VB5 synthesis process.

[0007] To achieve the above-mentioned objectives, the present invention is implemented through the following technical solution: A method for constructing genetically engineered probiotics mediated by a cryptic plasmid, comprising the following steps: S1: Using Escherichia coli as the substrate bacteria, the endogenous cryptic plasmid in the substrate bacteria cells was knocked out and replaced with a modified recombinant cryptic plasmid. S2: Overexpression of the green fluorescent protein (GFP) gene at different sites in the modified recombinant cryptic plasmid; S3: Genetically engineered probiotics were obtained by overexpressing the gene used to synthesize VB5 using a modified recombinant cryptic plasmid.

[0008] This invention uses *Escherichia coli* Nissle 1917 as the starting strain. Through systematic metabolic engineering, key genes encoding acetolactate synthase (alsS), ketopantolate hydroxymethyltransferase (panB), and pantothenic acid synthase (panC) in its metabolic pathway are expressed exogenously in *E. coli* Nissle 1917 cells using endogenous cryptic plasmids pMUT1 and pMUT2. This enhances the pantothenic acid synthesis pathway and improves the precursor supply for VB5 synthesis, enabling efficient utilization of substrates such as glucose and efficient production of VB5. Specifically, this invention provides a method for screening positive single clones by inserting kanamycin and spectinomycin resistance genes into endogenous cryptic plasmids pMUT1 and pMUT2. Furthermore, by overexpressing the GFP gene in *E. coli* spp., suitable insertion sites in endogenous cryptic plasmids pMUT1 and pMUT2 are selected for overexpression of key genes. This invention enhances the accumulation of pyruvate to acetolactate by overexpressing the alsS gene from Bacillus subtilis, thereby further enhancing the accumulation of pantothenic acid. Simultaneously, overexpression of the panB and panC genes from Escherichia coli Nissle 1917 enhances the pantothenic acid pathway for synthesizing VB5 precursors and the synthesis of VB5. Furthermore, using high-copy cryptic plasmids to express the alsS, panB, and panC genes, and with exogenous β-alanine addition, stable VB5 synthesis is enhanced.

[0009] Preferably, the substrate bacteria is Escherichia coli Nissle 1917.

[0010] As a further preferred option, the substrate bacteria is wild-type Escherichia coli Nissle 1917.

[0011] Preferably, in step S1, CRISPR / Cas9 technology is used to knock out the endogenous cryptic plasmid.

[0012] Preferably, the endogenous cryptic plasmid is any one or a combination of two of pMUT1 and pMUT2.

[0013] As a further preferred embodiment, the nucleotide sequence of the endogenous cryptic plasmid pMUT1 is shown in SEQ ID NO.6; and the nucleotide sequence of the endogenous cryptic plasmid pMUT2 is shown in SEQ ID NO.7.

[0014] Preferably, the modified recombinant cryptic plasmid is prepared by inserting kanamycin and / or spectinomycin resistance genes into an endogenous cryptic plasmid.

[0015] The above setup aims to provide a method for screening positive monoclonal antibodies.

[0016] Preferably, the gene used to synthesize VB5 in step S3 includes at least one of the alsS gene, panB gene, and panC gene.

[0017] As a preferred option, the GFP gene, alsS gene, panB gene, and panC gene are all expressed using the Trc promoter.

[0018] Preferably, the nucleotide sequence of the promoter Trc is shown in SEQ ID NO.1.

[0019] The promoter Trc was derived from pTrc99a, which was purchased from Addgene, product number VT294.

[0020] Preferably, the nucleotide sequence of the GFP gene is shown in SEQ ID NO.2.

[0021] Preferably, the alsS gene is derived from Bacillus subtilis, the alsS gene is an acetolactate synthase encoding gene, and the nucleotide sequence of the alsS gene is shown in SEQ ID NO.3.

[0022] Preferably, the panB gene is derived from Escherichia coli Nissle 1917, and the panB gene is the gene encoding ketopantolysin hydroxymethyltransferase. The nucleotide sequence of the panB gene is shown in SEQ ID NO.4.

[0023] Preferably, the panC gene is derived from Escherichia coli Nissle 1917, and the panC gene is a pantothenic acid synthase encoding gene. The nucleotide sequence of the panC gene is shown in SEQ ID NO.5.

[0024] As a preferred embodiment, a method for constructing genetically engineered probiotics mediated by cryptic plasmids includes the following steps: S1: Using gene editing technology, Escherichia coli Nissle 1917 (EcN) was used as the chassis bacteria. The endogenous cryptic plasmids pMUT1 and pMUT2 in the chassis bacteria cells were knocked out to obtain the genetically engineered bacteria E-1. S2: Kanamycin and spectinomycin resistance genes were inserted into the endogenous cryptic plasmids pMUT1 and pMUT2, respectively, to obtain the modified recombinant cryptic plasmids pMUT1-K and pMUT2-S. S3: Insert the GFP gene into different sites on the modified recombinant cryptic plasmids pMUT1-K and pMUT2-S, respectively, to obtain the recombinant cryptic plasmid pMUT1-K. 1a -GFP, pMUT 1b -GFP, pMUT 1c -GFP, pMUT2a -GFP, pMUT 2b -GFP and pMUT 2c -GFP; S4: Based on the genetically engineered bacteria E-1, the recombinant cryptic plasmid pMUT was introduced. 1a -GFP, pMUT 1b -GFP, pMUT 1c -GFP, pMUT 2a -GFP, pMUT 2b -GFP and pMUT 2c -GFP, respectively, to obtain the genetically engineered probiotics EGFP-1, EGFP-2, EGFP-3, EGFP-4, EGFP-5 and EGFP-6; S5: Based on the genetically engineered bacterium E-1, the recombinant cryptic plasmid pMUT was introduced. 1a -GFP and pMUT 2b -GFP, to obtain the genetically engineered probiotic EGFP-7; S6: Based on the genetically engineered bacterium E-1, the modified recombinant cryptic plasmids pMUT1-K and pMUT2-S containing the alsS gene, panB gene and panC gene were introduced to obtain the genetically engineered probiotics EPA-1, EPA-2, EPA-3 and EPA-4, respectively.

[0025] Specifically, a method for constructing a cryptic plasmid-mediated genetically engineered probiotic includes the following steps: S1: Using Escherichia coli Nissle 1917 as the chassis strain, the two endogenous cryptic plasmids pMUT1 and pMUT2 in Escherichia coli Nissle 1917 (EcN) cells were knocked out using CRISPR / Cas9 gene editing technology to obtain the genetically engineered strain E-1. S2: Using endogenous cryptic plasmids pMUT1 and pMUT2 as vector plasmids, kanamycin and spectinomycin resistance genes were inserted to obtain modified recombinant cryptic plasmids pMUT1-K and pMUT2-S. S3: Using the modified recombinant cryptic plasmids pMUT1-K and pMUT2-S as vector plasmids, three sites were selected for each, and the GFP gene was integrated into these different sites. Expression was driven by the promoter Trc, resulting in the recombinant cryptic plasmid pMUT1-K. 1a -GFP, pMUT 1b -GFP, pMUT 1c -GFP, pMUT 2a -GFP, pMUT 2b -GFP and pMUT 2c -GFP; S4: The recombinant cryptic plasmid obtained in step S3 is introduced into the genetically engineered bacteria E-1 to obtain the genetically engineered probiotics EGFP-1, EGFP-2, EGFP-3, EGFP-4, EGFP-5 and EGFP-6, respectively. S5: Based on the genetically engineered bacterium E-1, the recombinant cryptic plasmid pMUT was introduced. 1a -GFP and pMUT 2b -GFP, to obtain the genetically engineered probiotic EGFP-7; S6: Based on the genetically engineered bacterium E-1, the alsS gene from Bacillus subtilis and the panB and panC genes from EcN were constructed into modified recombinant cryptic plasmids along the pantothenic acid synthesis pathway. The alsS gene was integrated into pMUT1-K to obtain the recombinant cryptic plasmid pMUT1-alsS, the panB gene was integrated into pMUT2-S to obtain the recombinant cryptic plasmid pMUT2-panB, and the panC gene was integrated into the recombinant cryptic plasmid pMUT2-panB to obtain the recombinant cryptic plasmid pMUT2-panB-panC. pMUT1-alsS and pMUT2-panB-panC were introduced into the substrate bacteria to obtain the genetically engineered probiotic EPA-1. S7: Based on the genetically engineered bacterium E-1, the alsS gene from Bacillus subtilis and the panB and panC genes from EcN were constructed into modified recombinant cryptic plasmids along the pantothenic acid synthesis branch pathway. The alsS gene was integrated into pMUT1-K to obtain the recombinant cryptic plasmid pMUT1-alsS, the panC gene was integrated into pMUT2-S to obtain the recombinant cryptic plasmid pMUT2-panC, and the panB gene was integrated into the recombinant cryptic plasmid pMUT2-panC to obtain the recombinant cryptic plasmid pMUT2-panC-panB. pMUT1-alsS and pMUT2-panC-panB were introduced into the substrate bacteria to obtain the genetically engineered probiotic EPA-2. S8: Based on the genetically engineered bacterium E-1, the alsS gene from Bacillus subtilis and the panB and panC genes from EcN were constructed into modified recombinant cryptic plasmids along the pantothenic acid synthesis branch pathway. The panB gene was integrated into pMUT1-K to obtain the recombinant cryptic plasmid pMUT1-panB, the panC gene was integrated into pMUT2-S to obtain the recombinant cryptic plasmid pMUT2-panC, and the alsS gene was integrated into the recombinant cryptic plasmid pMUT2-panC to obtain the recombinant cryptic plasmid pMUT2-panC-alsS. pMUT1-panB and pMUT2-panC-alsS were introduced into the substrate bacteria to obtain the genetically engineered probiotic EPA-3. S9: Based on the genetically engineered bacterium E-1, the alsS gene from Bacillus subtilis and the panB and panC genes from EcN were respectively constructed into modified recombinant cryptic plasmids along the pantothenic acid synthesis pathway. The panC gene was integrated into pMUT1-K to obtain the recombinant cryptic plasmid pMUT1-panC, the panB gene was integrated into pMUT2-S to obtain the recombinant cryptic plasmid pMUT2-panB, and the alsS gene was integrated into the recombinant cryptic plasmid pMUT2-panB to obtain the recombinant cryptic plasmid pMUT2-panB-alsS. pMUT1-panC and pMUT2-panB-alsS were introduced into substrate bacteria to obtain the genetically engineered probiotic EPA-4. A schematic diagram of the biosynthetic pathway of the cryptic plasmid-mediated genetically engineered probiotic is shown below. Figure 1 As shown.

[0026] Genetically engineered probiotics prepared using the method described above for constructing cryptic plasmid-mediated genetically engineered probiotics.

[0027] The application of genetically engineered probiotics in the preparation of VB5, as described above.

[0028] Preferably, the method of application is as follows: The genetically engineered probiotics were fermented at 30-37℃ and 180-200 rpm for 48-72 hours. After fermentation, the fermentation broth was centrifuged and the supernatant was collected and purified to obtain VB5.

[0029] Specifically, the method used is as follows: The seed culture was inoculated into 30 mL of a 500 mL shake flask at a 2% inoculum rate for fermentation. 0.3 g of sterilized CaCO3 powder was added to adjust the pH of the fermentation broth. 30 μL of concentrated metal salt solution was added per 30 mL of fermentation medium. The concentrated metal salt solution consisted of: 10 g / L CaCl2, 10 g / L FeSO4·7H2O, 1 g / L ZnSO4·7H2O, 0.1 g / L CuSO4, and 0.01 g / L NiCl2·7H2O. Additionally, 366 μL of a four-in-one mixture was added to the fermentation medium. This mixture consisted of: 30 g / L β-alanine, 4 g / L VB1, and 2 g / L VB2. 12 0.5M β-D-thiogalactoside (IPTG) was fermented at 30-37℃ and 180-200rpm for 48-72h. After centrifugation, the supernatant was purified by filtration through a 0.22μm aqueous filter membrane to obtain VB5.

[0030] Using *Escherichia coli* Nissle 1917 as the starting strain, plasmid systems are used to overexpress exogenous genes. However, plasmid loss often occurs during passage, leading to a continuous decrease in the expression levels of key genes and resulting in unstable yields of the target product. Wild-type *E. coli* Nissle 1917 cells contain two endogenous cryptic plasmids, pMUT1 and pMUT2. Using these cryptic plasmids as expression vectors for exogenous genes, the developed recombinant cryptic plasmids maintain the stability of exogenous gene expression. Furthermore, the high copy numbers of the two endogenous cryptic plasmids pMUT1 and pMUT2 enable the efficient and stable synthesis of VB5. Furthermore, the main precursors for VB5 synthesis are β-alanine and pantothenic acid. In the pantothenic acid synthesis pathway, glucose enters the cell and undergoes glycolysis (EMP) to produce pyruvate. Pyruvate then undergoes (S)-2-acetolactate, (R)-2,3-dihydroxyisovalerate, α-ketoisovalerate, and ketopantothenic acid steps to obtain pantothenic acid. This invention enhances the synthesis of pantothenic acid precursors by exogenously adding β-alanine, introducing the alsS and panB genes, and further introducing the panC gene, ultimately obtaining a genetically engineered probiotic strain that produces high levels of VB5.

[0031] Therefore, the present invention has the following beneficial effects: (1) This invention uses high-copy cryptic plasmids to mediate stable genetic expression of exogenous genes, and no resistance needs to be added during the culture process, which significantly improves the safety, stability and effectiveness of food-grade nutritional chemical synthesis; (2) This invention provides a method for screening positive monoclonal antibodies by inserting kanamycin and spectinomycin resistance genes into endogenous cryptic plasmids pMUT1 and pMUT2. Furthermore, it overexpresses key genes by overexpressing GFP genes in cryptic plasmids in EcN sclerotium and screening for suitable insertion sites in endogenous cryptic plasmids pMUT1 and pMUT2. (3) This invention enhances the accumulation of pyruvate to acetolactate by overexpressing the alsS gene derived from Bacillus subtilis, thereby further enhancing the accumulation of pantothenic acid. Simultaneously, by overexpressing the panB and panC genes derived from Escherichia coli Nissle 1917, the pantothenic acid pathway for synthesizing VB5 precursors and the synthesis of VB5 are enhanced. Furthermore, by using high-copy cryptic plasmids to express the alsS, panB, and panC genes, and by adding exogenous β-alanine, the stable synthesis of VB5 is strengthened. (4) The modified strain of this invention can efficiently utilize glucose as a carbon source to synthesize the functional nutrient chemical VB5 product. The VB5 titer reached 102 mg / L during shake-flask fermentation, while the product was not detected in the wild strain. This invention provides new strains and technical support for the efficient synthesis of functional nutrient chemicals at the food grade, which is conducive to their promotion and application in the food field. Attached Figure Description

[0032] Figure 1 A schematic diagram of the biosynthetic pathway of genetically engineered probiotics mediated by cryptic plasmids.

[0033] Figure 2 This is the HPLC chromatogram for the detection of VB5 by high performance liquid chromatography in Example 2.

[0034] Figure 3 The fluorescence value / OD of the EGFP-1, EGFP-2, and EGFP-3 genetically engineered probiotics in Example 4 is shown. 600 Compare the bar charts.

[0035] Figure 4 The fluorescence value / OD of the EGFP-4, EGFP-5, and EGFP-6 genetically engineered probiotics in Example 5 is shown. 600 Compare the bar charts.

[0036] Figure 5 The fluorescence value / OD of the EGFP-1, EGFP-5, and EGFP-7 genetically engineered probiotics in Example 6. 600 Compare the bar charts.

[0037] Figure 6 This is a schematic diagram of the site selection for the integration of the synthesized GFP gene into the cryptic plasmid in Examples 5 and 6.

[0038] Figure 7 The OD values ​​of the EPA-1, EPA-2, EPA-3, and EPA-4 genetically engineered probiotics in Example 7 are... 600 Bar chart comparing the potency of D-pantothenic acid with that of D-pantothenic acid.

[0039] Figure 8 The D-pantothenic acid titer / OD of the EPA-2 genetically engineered probiotics in Example 8 after multiple passages. 600 Compare the bar charts. Detailed Implementation

[0040] The present invention will be further described below with reference to the accompanying drawings and specific embodiments. Those skilled in the art will be able to implement the present invention based on these descriptions. Furthermore, the embodiments of the present invention described below are generally only some, not all, of the embodiments of the present invention. Therefore, all other embodiments obtained by those skilled in the art based on the embodiments of the present invention without inventive effort should fall within the scope of protection of the present invention.

[0041] In the following embodiments of the present invention: (1) LB solid medium: 10 g / L peptone, 5 g / L yeast extract, 10 g / L NaCl and 2 g / L agar powder; (2) LB liquid medium: 10 g / L peptone, 5 g / L yeast extract and 10 g / L NaCl; (3) LLB liquid medium: 10 g / L peptone, 5 g / L yeast extract and 5 g / L NaCl; (4) MS fermentation medium: 20 g / L glucose, 16 g / L (NH4)2SO4, 2 g / L KH2PO4, 0.5 g / L MgSO4, 2 g / L yeast extract; (5) Metal concentrate: 10 g / L CaCl2, 10 g / L FeSO4·7H2O, 1 g / L ZnSO4·7H2O, 0.1 g / L CuSO4, 0.01 g / L NiCl2·7H2O; (6) Four-in-one mixture: 30 g / L β-alanine, 4 g / L VB1, 2 g / L VB 12 0.5M β-D-thiogalactoside (IPTG).

[0042] The nucleotide sequences involved in the following examples are as follows: the nucleotide sequence of the Trc promoter is shown in SEQ ID NO.1 (derived from pTrc99a, this plasmid was purchased from Addgene, product number VT294); the nucleotide sequence of the GFP gene is shown in SEQ ID NO.2; the nucleotide sequence of the alsS gene is shown in SEQ ID NO.3; the nucleotide sequence of the panB gene is shown in SEQ ID NO.4; the nucleotide sequence of the panC gene is shown in SEQ ID NO.5; the nucleotide sequence of the endogenous cryptic plasmid pMUT1 is shown in SEQ ID NO.6; and the nucleotide sequence of the endogenous cryptic plasmid pMUT2 is shown in SEQ ID NO.7.

[0043] The primers used to knock out endogenous cryptic plasmids pMUT1 and pMUT2 are shown in Table 1. The primers used to construct the recombinant cryptic plasmid are shown in Table 2. *Escherichia coli* Nissle 1917 (EcN) was purchased from Hangzhou Baosai Biotechnology Co., Ltd., product code T0023.

[0044] Table 1: Primer Name Sequence (5’-3’) <![CDATA[pMUT1-F]]> AAGAATAAATGGAAAGCTGGGTTTTAGAGCTAGAAATAGCAAGTTAA <![CDATA[pMUT1-R]]> CCAGCTTTCCATTTATTCTTACTAGTATTATACCTAGGACTGAGCTAG <![CDATA[pMUT2-F]]> <![CDATA[pMUT2-R]]> TATGATTTCTATTGATGGTAGTTTTAGAGCTAGAAATAGCAAGTTAAA .

[0045] Table 2: TACCATCAATAGAAATCATAACTAGTATTATACCTAGGACTGAGCTAG Primer Name <![CDATA[X-pMUT1-F]]> Sequence (5’-3’) <![CDATA[X-pMUT1-R]]> GGAGTTAGCGATATGAAAACCG GTATCTAATTCAGGCAGGAAAAAATCT K-F TTTTTCCTGCCTGAATTAGATACGAAGATCCTTTGATCTTTTCTACGGG K-R <![CDATA[X-pMUT2-F]]> CGGTTTTCATATCGCTAACTCCTTAGAAAAACTCATCGAGCATCAAATG <![CDATA[X-pMUT2-R]]> ATTAAATAATGACAATGTTGGGTTGC GTTTCTGCCTATAAGATTACTTACAGT S-F AAGTAATCTTATAGGCAGAAACAAGCTTAGATCTATTACCCTGTTATCC S-R <![CDATA[X-pMUT1-F1]]> GCAACCCAACATTGTCATTATTTAATTTATTTGCCGACTACCTTGGT <![CDATA[X-pMUT1-R1]]> GTTTCAGTGGTGCGTACAATT GCGCTGAACGCGATTCTG GFP-F1 TCAGAATCGCGTTCAGCGCTTGACAATTAATCATCCGGCTCG GFP-R1 <![CDATA[X-pMUT1-F2]]> AATTGTACGCACCACTGAAACAAAAGGCCATCCGTCAGGATGGCCT <![CDATA[X-pMUT1-R2]]> TTGGAGCGAACGACCTACAC GCTGGGCTGTGTGCACG GFP-F2 GTTCGTGCACACAGCCCAGCTTGACAATTAATCATCCGGCTCG GFP-R2 <![CDATA[X-pMUT1-F3]]> TGTAGGTCGTTCGCTCCAAAAAAGGCCATCCGTCAGGATG <![CDATA[X-pMUT1-R3]]> TCCATTGTGCTTTTTTAAGCTGTC ACTGAGCGCGAGCGATGC GFP-F3 GCATCGCTCGCGCTCAGTTTGACAATTAATCATCCGGCTCGT GFP-R3 <![CDATA[X-pMUT2-F1]]> CTTAAAAAAGCACAATGGAAAAAGGCCATCCGTCAGGATGG ACAAGCTTAGATCTATTACCCTGTTATC <![CDATA[X-pMUT2-R1]]> TTCTGCCTATAAGATTACTTACAGTGT GFP-F4 TAATCTTATAGGCAGAAccgcgaaatTTGACAATTAATCATCCGGCTC GFP-R4 ACAGGGTAATAGATCTAAGCTTGTattactttctgttcgacttaagcatt <![CDATA[X-pMUT2-F2]]> GTTGTTTTGTCTCACACGGCA <![CDATA[X-pMUT2-R2]]> CTATATCAGATAACAGCCCTGCTTTTG GFP-F5 GCAGGGCTGTTATCTGATATAGTTGACAATTAATCATCCGGCTCGT GFP-R5 CCGTGTGAGACAAAACAACTCACTTGTACAGTTCGTCCATAC <![CDATA[X-pMUT2-F3]]> ATGTGCTAATATCCTTTCTAGGTTTCG <![CDATA[X-pMUT2-R3]]> GCAGCGTGCAAAACAACAG GFP-F6 CTGTTGTTTTGCACGCTGCTTGACAATTAATCATCCGGCTCGT GFP-R6 CCTAGAAAGGATATTAGCACATTCACTTGTACAGTTCGTCCATACC <![CDATA[pMUT1-alsS-F]]> TCAGAATCGCGTTCAGCGCTTGACAATTAATCATCCGGCTCG <![CDATA[pMUT1-alsS-R]]> TAATTGTACGCACCACTGAAACctagagagctttcgttttcatgag <![CDATA[pMUT1-panB-F]]> CAGAATCGCGTTCAGCGCTTGACAATTAATCATCCGGC <![CDATA[pMUT1-panB-R]]> AATTGTACGCACCACTGAAACTTAATGGAAACTGTGTTCTTCGCC <![CDATA[pMUT1-panC-F]]> CAGAATCGCGTTCAGCGCTTGACAATTAATCATCCGGCTCGTATAATG <![CDATA[pMUT1-panC-R]]> TAATTGTACGCACCACTGAAACTTACGCCAGTTCGACCATTTTG <![CDATA[pMUT2-panB-F1]]> TATAGGCAGAAccgcgaaatTTGACAATTAATCATCCGGCTCGTAT <![CDATA[pMUT2-panB-R1]]> taagcattatgcggccgcaagcttTTAATGGAAACTGTGTTCTTCGCC <![CDATA[pMUT2-panC-F1]]> CTGTTGTTTTGCACGCTGCTTGACAATTAATCATCCGGCTCGT <![CDATA[pMUT2-panC-R1]]> GAAAGGATATTAGCACATTTACGCCAGTTCGACCATTTTGT <![CDATA[pMUT2-panB-F2]]> GTTGTTTTGCACGCTGCTTGACAATTAATCATCCGGCTCGTATAAT <![CDATA[pMUT2-panB-R2]]> CTAGAAAGGATATTAGCACATTTAATGGAAACTGTGTTCTTCGCC <![CDATA[pMUT2-panC-F2]]> TTATAGGCAGAAccgcgaaatTTGACAATTAATCATCCGGCT <![CDATA[pMUT2-panC-R2]]> gcattatgcggccgcaagcttTTACGCCAGTTCGACCATTTTG <![CDATA[pMUT2-alsS-F]]> AACCTAGAAAGGATATTAGCACATctagagagctttcgttttcatgag <![CDATA[pMUT2-alsS-R]]> TCAGAATCGCGTTCAGCGCTTGACAATTAATCATCCGGCTCG .

[0046] Example 1: Preparation of Escherichia coli Nissle 1917 competent cells: (1) Preparation of Escherichia coli Nissle 1917 competent cells by chemical transformation: Streak the bacteria from the glycerol tube onto antibiotic-free LB agar medium and incubate overnight at 37°C, inverted. Pick a single colony and inoculate it into 10 mL of LB liquid medium, incubating overnight at 37°C, 200 rpm. Then, transfer the overnight culture (1% inoculum) to a 500 mL shake flask containing 50 mL of LB liquid medium and incubate at 37°C, 200 rpm for 2.5 h until OD500 reaches zero. 600 ≈0.6; then transfer the bacterial culture to a sterile centrifuge tube, centrifuge at 4℃, 4500rpm for 10min, and discard the supernatant; then add 20mL of pre-chilled sterile 0.1M CaCl2 solution to the centrifuge tube, resuspend the cells, and incubate on ice for 30min; after the ice incubation, centrifuge at 4℃, 4500rpm for 10min, discard the supernatant, add 1mL of pre-chilled sterile CaCl2 + glycerol solution (0.1M CaCl2, 15% glycerol), resuspend the cells, and dispense 100μL of cell resuspension into each sterile 1.5mL Eppendorf tube for immediate use or storage at -80℃ for later use.

[0047] (2) Preparation of Escherichia coli Nissle 1917 competent cells by high-voltage electroporation: Streak the bacteria from the glycerol tube onto LB solid medium containing kanamycin resistance, and incubate overnight at 30°C inverted position. Pick a single colony (containing pCas9 plasmid, purchased from Ubisoft Biotechnology Co., Ltd., product number VT8116), and inoculate it into 10 mL of LLB liquid medium. Add 10 μL of kanamycin (50 mg / mL) resistance and 100 μL of arabinose (1M), and incubate overnight at 30°C and 200 rpm. Then, transfer the overnight culture (1% inoculum) to a 500 mL shake flask containing 50 mL of LLB liquid medium, add 50 μL of kanamycin (50 mg / mL) resistance and 500 μL of arabinose (1M), and incubate at 30°C and 200 rpm for 3-4 hours until OD500. 600≈0.7; Transfer the bacterial culture to a sterile centrifuge tube, centrifuge at 4°C, 4500 rpm for 10 min, and discard the supernatant. Then add 40 mL of pre-chilled sterile water to the centrifuge tube, resuspend the cells, centrifuge at 4°C, 4500 rpm for 10 min, discard the supernatant, and repeat this step once; then add 40 mL of pre-chilled sterile 10% glycerol to the centrifuge tube, resuspend the cells, centrifuge at 4°C, 4500 rpm for 10 min, and discard the supernatant; add 1 mL of pre-chilled sterile 10% glycerol, resuspend the cells, and aliquot 200 μL of the cell resuspension into each sterile 1.5 mL Eppendorf tube for immediate use or storage at -80°C for later use.

[0048] Plasmid transformation: (1) Chemical conversion method: Remove chemically transformed EcN competent cells and place them on ice for 5 minutes to allow them to thaw naturally. Add 5 μL of the constructed recombinant cryptic plasmid, mix well, and place on ice for 30 minutes. After the ice bath, place them in a 42°C water bath for 90 seconds, and immediately place them on ice for 3 minutes. Then add 700 μL of LB medium and incubate at 37°C and 200 rpm for 1 hour. After the incubation, centrifuge at 6000 rpm for 2 minutes, retain a small amount of supernatant, resuspend the cells, and spread them on LB plates (resistance is the same as plasmid resistance). Incubate overnight at 37°C with the plates inverted.

[0049] (2) High-voltage electroporation conversion method: Take one EcN competent cell obtained by high-voltage electroporation and place it on ice for 5 minutes to allow it to thaw naturally. Add 10 μL of the constructed recombinant cryptic plasmid, mix well, and place on ice for 1 minute. Transfer it to a pre-chilled sterile electroporation cuvette and place on ice for 1 minute for electroporation. After electroporation, add 700 μL of pre-chilled LLB liquid medium to the cuvette. Aspirate all the bacterial culture and transfer it to a 1.5 mL sterile Eppendorf tube. Incubate at 30°C and 200 rpm for 3-4 hours. After incubation, centrifuge at 6000 rpm for 2 minutes, retain a small amount of supernatant, resuspend it, and spread it on an LB plate (resistance is the same as plasmid resistance). Incubate at 30°C inverted overnight.

[0050] Example 2 The content of VB5 was determined by HPLC, and the detection method is as follows: VB5 content detection: The diluted fermentation supernatant was treated with a 0.22 μm aqueous filter membrane and then detected by high performance liquid chromatography (HPLC). The HPLC detection conditions for VB5 are as follows: ① Mobile phase: 95% ultrapure water, 4.9% acetonitrile, 0.1% concentrated phosphoric acid, filtered using a 0.22μm microporous organic filter membrane and ultrasonically removed to remove air bubbles; ② Column type: C18 column (250×4.6mm, 5μm, Agilent Technologies Co, Santa Clara, CA, USA); ③ Detection parameters: injection volume 10μL, column temperature 30℃, flow rate 1mL / min, detection wavelength 200nm, acquisition time 20min; ④ Sample preparation for HPLC determination of D-pantothenic acid content in fermentation broth: take 1mL of fermentation broth, centrifuge at 12000rpm for 5min, collect the supernatant, dilute the supernatant with ultrapure water to an appropriate factor, filter through a 0.22μm aqueous filter membrane, and maintain the VB5 content between 50~100mg / L. The HPLC chromatogram for VB5 detection in this example is shown below. Figure 2 As shown. By Figure 2 It can be seen that VB5 will elute at 14 min after HPLC detection.

[0051] Example 3: Construction of genetically engineered bacterium E-1: (1) Construction of pTarget-pMUT1 and pTarget-pMUT2 recombinant plasmids: Using pTarget plasmid as a template (pTarget plasmid purchased from Fenghui Biotechnology Co., Ltd., product number YH095), PCR amplification was performed using pMUT1-F / pMUT1-R and pMUT2-F / pMUT2-R as primers to obtain the 5' first 20 bp for recognizing pMUT1 and pMUT2 cleavage sites. After purification using a DNA purification kit, the DNA fragments pTarget-pMUT1 and pTarget-pMUT2 were obtained and transformed into E. coli DH5α competent cells. Sequencing verified the correct pTarget-pMUT1 and pTarget-pMUT2 recombinant plasmids.

[0052] (2) Construction and preparation of EcN genetically engineered bacteria containing pCas9 plasmid: Escherichia coli Nissle 1917 strain was used to create chemically transformed competent cells. The pCas9 plasmid was then introduced into EcN competent cells via chemical transformation, and sequencing confirmed the correct EcN-pCas9 genetically engineered strain. The constructed EcN-pCas9 genetically engineered bacteria were then used to create high-voltage electroporation competent cells. The methods for chemical transformation and high-voltage electroporation competence preparation have been detailed above and will not be repeated here.

[0053] (3) pTarget-pMUT1 and pTarget-pMUT2 recombinant plasmids were introduced into EcN-pCas9 electroporated competent cells: Take out EcN-pCas9 competent cells obtained by high-voltage electroporation, add 10 μL of pTarget-pMUT1 recombinant plasmid, and mix well; transfer it to a pre-cooled electroporation cuvette, electroporate, add 700 μL of LLB liquid medium after electroporation, aspirate all the liquid and transfer it to a 1.5 mL sterile Eppendorf tube, and incubate at 30℃ and 180 rpm for 3-4 h; spread it on LB plates containing kanamycin and spectinomycin resistance, incubate the plates at 30℃ overnight, and verify the successful knockout of pMUT1 plasmid by colony PCR to obtain EcN-ΔpMUT1 genetically engineered bacteria. The EcN-ΔpMUT1 genetically engineered bacteria were inoculated into LB medium containing 1 mM IPTG to eliminate the pTarget-pMUT1 plasmid. These cells were then converted into competent cells using high-voltage electroporation. 10 μL of the pTarget-pMUT2 recombinant plasmid was added, followed by electroporation. The cells were then plated onto LB agar plates containing kanamycin and spectinomycin resistance and incubated overnight at 30°C. Colony PCR confirmed successful pMUT2 plasmid knockout, yielding the EcN-ΔpMUT1 / ΔpMUT2 genetically engineered bacteria. The EcN-ΔpMUT1 / ΔpMUT2 genetically engineered bacteria were then inoculated into LB medium containing 1 mM IPTG to eliminate the pTarget-pMUT2 plasmid. The cells were then transferred to LB medium and incubated overnight at 37°C to eliminate the pCas9 plasmid (a temperature-sensitive plasmid that is eliminated at 37°C), finally yielding the genetically engineered bacteria E-1.

[0054] Example 4: Construction and shake-flask fermentation of EGFP-1, EGFP-2 and EGFP-3 genetically engineered probiotics: (1) Construction of the modified recombinant cryptic plasmid pMUT1-K: Using the pMUT1 endogenous cryptic plasmid as a template, PCR amplification was performed using X-pMUT1-F / X-pMUT1-R primers. The PCR product was digested with DpnI at 37°C for 1 hour and purified using a DNA purification kit to obtain the linearized vector plasmid fragment X-pMUT1. Using the pCas9 plasmid as a template, PCR amplification was performed using KF / KR primers. The PCR product was purified using a DNA purification kit to obtain the kanamycin resistance gene fragment. The target fragment and the vector were cloned in one step and then transformed into E. coli DH5α. Colony PCR and sequencing verification yielded the correct modified recombinant cryptic plasmid pMUT1-K.

[0055] (2) pMUT 1a-GFP, pMUT 1b -GFP and pMUT 1c Construction of GFP recombinant cryptic plasmid: Using the modified recombinant cryptic plasmid pMUT1-K as a template, PCR amplification was performed using primers X-pMUT1-F1 / X-pMUT1-R1, X-pMUT1-F2 / X-pMUT1-R2, and X-pMUT1-F3 / X-pMUT1-R3. The PCR product was digested with DpnI at 37°C for 1 hour and purified using a DNA purification kit to obtain the linearized vector plasmid fragment X-pMUT1-K. 1a X-pMUT 1b and X-pMUT 1c Using the pET28a-GFP plasmid (derived from a laboratory bacterial culture library) as a template, PCR amplification was performed using GFP-F1 / GFP-R1, GFP-F2 / GFP-R2, and GFP-F3 / GFP-R3 as primers. The PCR product was purified using a DNA purification kit to obtain the GFP gene fragment. The target fragment and vector were cloned in one step, then transformed into E. coli DH5α. Colony PCR and sequencing were performed to verify the correct pMUT. 1a -GFP, pMUT 1b -GFP and pMUT 1c -GFP recombinant cryptic plasmid.

[0056] (3) Constructing EGFP-1, EGFP-2 and EGFP-3 genetically engineered probiotics The successfully built pMUT 1a -GFP, pMUT 1b -GFP and pMUT 1c -GFP recombinant cryptic plasmid was introduced into E-1 chemically transformed competent cells, and colony PCR and sequencing were performed to verify that the correct EGFP-1, EGFP-2 and EGFP-3 genetically engineered probiotics were obtained.

[0057] (4) Shake-flask fermentation of EGFP-1, EGFP-2 and EGFP-3 genetically engineered probiotics: The constructed EGFP-1, EGFP-2, and EGFP-3 genetically engineered probiotics were streaked from glycerol tubes onto LB agar plates containing kanamycin. Single colonies were picked and inoculated into 10 mL LB liquid medium containing kanamycin resistance, with wild-type *EcN* as the control group. The cultures were incubated at 37°C and 200 rpm for 12 h. A 1% inoculum was then transferred to a 500 mL shake flask containing 100 mL LB medium and incubated at 37°C and 200 rpm for 3 h until OD500 was reached. 600≈0.6, add 100μL IPTG (1M) to induce expression; after shake-flask fermentation, detect fluorescence value with a microplate reader and OD with a spectrophotometer. 600 The growth status of the strains was determined. In this example, the fluorescence value / OD value of the EGFP-1, EGFP-2, and EGFP-3 genetically engineered probiotics was measured. 600 Comparison bar charts as follows Figure 3 As shown.

[0058] Depend on Figure 3 It can be seen that the three different sites of the pMUT1 endogenous cryptic plasmid selected from EcN cells overexpressed the GFP gene and showed different fluorescence intensities. Among them, the fluorescence intensity of site 1a of the pMUT1 endogenous cryptic plasmid reached the highest. The modified cryptic plasmid is conducive to the overexpression of key genes, and site 1a lays the foundation for the subsequent overexpression of key genes for D-pantothenic acid synthesis.

[0059] Method for detecting fluorescence values ​​using an ELISA reader: After shake-flask fermentation, take 1 mL of fermentation broth, centrifuge at 12000 rpm for 3 min, discard the supernatant, add 1 mL of phosphate buffer, resuspend the cells, centrifuge at 12000 rpm for 3 min, discard the supernatant, add another 1 mL of phosphate buffer, resuspend the cells, and then dilute to an appropriate multiple. Use an ELISA reader to detect the fluorescence values ​​in the wavelength range of 485~525 nm.

[0060] Spectrophotometer detection of OD 600 Processing method: After shake-flask fermentation, take 1 mL of fermentation broth, centrifuge at 12000 rpm for 3 min, discard the supernatant, add 1 mL of phosphate buffer, resuspend the cells, centrifuge at 12000 rpm for 3 min, discard the supernatant, add another 1 mL of phosphate buffer, resuspend the cells, and then dilute to the appropriate factor. Measure the OD using a spectrophotometer. 600 .

[0061] Example 5: Construction and shake-flask fermentation of EGFP-4, EGFP-5 and EGFP-6 genetically engineered probiotics: (1) Construction of the modified recombinant cryptic plasmid pMUT2-S: Using the pMUT2 endogenous cryptic plasmid as a template, PCR amplification with primers X-pMUT2-F / X-pMUT2-R was performed to obtain the linearized vector plasmid fragment X-pMUT2. Using the pTarget plasmid as a template, PCR amplification with primers SF / SR was performed to obtain the spectinomycin resistance gene fragment. The target fragment and the vector were cloned in one step and then transformed into E. coli DH5α. Colony PCR and sequencing were performed to verify that the correct modified recombinant cryptic plasmid pMUT2-S was obtained.

[0062] (2) pMUT 2a -GFP, pMUT2b -GFP and pMUT 2c Construction of GFP recombinant cryptic plasmid: Using the modified recombinant cryptic plasmid pMUT2-S as a template, PCR amplification was performed using primers X-pMUT2-F1 / X-pMUT2-R1, X-pMUT2-F2 / X-pMUT2-R2, and X-pMUT2-F3 / X-pMUT2-R3 to obtain the linearized vector plasmid fragment X-pMUT2-S. 2a X-pMUT 2b and X-pMUT 2c Using pET28a-GFP plasmid as a template, PCR amplification was performed using GFP-F4 / GFP-R4, GFP-F5 / GFP-R5, and GFP-F6 / GFP-R6 as primers. The PCR product yielded the GFP gene fragment. The target fragment and vector were cloned in one step, then transformed into E. coli DH5α. Colony PCR and sequencing verification yielded the correct pMUT. 2a -GFP, pMUT 2b -GFP and pMUT 2c -GFP recombinant cryptic plasmid.

[0063] (3) Constructing EGFP-4, EGFP-5 and EGFP-6 genetically engineered probiotics The successfully built pMUT 2a -GFP, pMUT 2b -GFP and pMUT 2c -GFP recombinant cryptic plasmid was introduced into E-1 chemically transformed competent cells, and colony PCR and sequencing were performed to verify that the correct EGFP-4, EGFP-5 and EGFP-6 genetically engineered probiotics were obtained.

[0064] (4) Shake-flask fermentation of EGFP-4, EGFP-5 and EGFP-6 genetically engineered probiotics: The constructed EGFP-4, EGFP-5, and EGFP-6 genetically engineered probiotics were streaked from glycerol tubes onto LB agar plates containing spectinomycin resistance. Single colonies were picked and inoculated into 10 mL LB liquid medium containing spectinomycin resistance. Wild-type *EcN* bacteria were used as a control group. The culture was carried out at 37°C and 200 rpm for 12 h. The bacterial culture (1% inoculum) was then transferred to a 500 mL shake flask containing 100 mL LB medium and incubated at 37°C and 200 rpm for 3 h until OD500 was reached. 600≈0.6, add 100μL IPTG (1M) to induce expression; after shake-flask fermentation, the fluorescence value is detected by microplate reader, and the OD600 is detected by spectrophotometer to determine the growth status of the strain. In this example, the fluorescence value / OD600 of the EGFP-4, EGFP-5, and EGFP-6 genetically engineered probiotics are shown. 600 Comparison bar charts as follows Figure 4 As shown in the diagram. The schematic diagram of the site selection for integrating the synthesized GFP gene into the cryptic plasmid in this embodiment is shown below. Figure 6 As shown.

[0065] Depend on Figure 4 , Figure 6 It is evident that overexpressing the GFP gene at three different sites of the pMUT2 endogenous cryptic plasmid derived from EcN cells exhibits different fluorescence intensities. Among them, the fluorescence intensity at site 2b of the pMUT2 endogenous cryptic plasmid is the highest. In addition, site 2a of the pMUT2 endogenous cryptic plasmid shows a higher fluorescence intensity compared to site 2b. The modified cryptic plasmid facilitates the overexpression of key genes, and sites 2a and 2b lay the foundation for the subsequent overexpression of key genes for VB5 synthesis.

[0066] Example 6 Construction and shake-flask fermentation of EGFP-7 genetically engineered probiotics: (1) Constructing EGFP-7 genetically engineered probiotics The successfully built pMUT 1a The -GFP recombinant cryptic plasmid was introduced into E-1 chemically transformed competent cells, and colony PCR and sequencing confirmed the presence of EGFP-1 genetically engineered probiotics. The EGFP-1 genetically engineered probiotics were then used to create high-voltage electroporation competent cells, and the successfully constructed pMUT was then... 2b -GFP recombinant cryptic plasmid was introduced into the bacteria, and colony PCR and sequencing were performed to verify that the correct EGFP-7 genetically engineered probiotics were obtained.

[0067] (4) Shake-flask fermentation of EGFP-1, EGFP-5 and EGFP-7 genetically engineered probiotics: The constructed EGFP-1, EGFP-5, and EGFP-7 genetically engineered probiotics were streaked from glycerol tubes onto LB agar plates containing spectinomycin and / or kanamycin resistance. Single colonies were picked and inoculated into 10 mL LB liquid medium containing spectinomycin and / or kanamycin resistance. Wild-type *EcN* was used as a control group. The cultures were incubated at 37°C and 200 rpm for 12 h. The bacterial culture (1% inoculum) was then transferred to a 500 mL shake flask containing 100 mL LB medium and incubated at 37°C and 200 rpm for 3 h until OD500 was reached. 600≈0.6, add 100μL IPTG (1M) to induce expression; after shake-flask fermentation, detect fluorescence value with a microplate reader and OD with a spectrophotometer. 600 The growth status of the strains was determined. In this example, the fluorescence values / OD values ​​of the genetically engineered probiotics EGFP-1, EGFP-5, and EGFP-7 were measured. 600 Comparison bar charts as follows Figure 5 As shown in the diagram. The schematic diagram of the site selection for integrating the synthesized GFP gene into the cryptic plasmid in this embodiment is shown below. Figure 6 As shown.

[0068] Depend on Figures 5-6 As can be seen, when GFP gene was overexpressed at site 1a of the pMUT1 endogenous cryptic plasmid and site 2b of the pMUT2 endogenous cryptic plasmid derived from EcN cells, the fluorescence intensity of the EGFP-7 genetically engineered probiotic strain was significantly improved compared to the EGFP-1 and EGFP-5 genetically engineered probiotic strains. This indicates that the pMUT1 and pMUT2 endogenous cryptic plasmids can coexist and express key genes, laying the foundation for subsequent overexpression of key genes for VB5 synthesis.

[0069] Example 7: Construction and shake-flask fermentation of EPA-1, EPA-2, EPA-3 and EPA-4 genetically engineered probiotics: (1) Construction of pMUT1-alss, pMUT1-panB and pMUT1-panC recombinant cryptic plasmids: Using pMUT1-K plasmid as a template, and X-pMUT1-F1 / X-pMUT1-R1 as primers, PCR amplification was performed to obtain the linearized vector plasmid fragment X-pMUT1. 1a Using the Bacillus subtilis and EcN genomes as templates, PCR amplification was performed using pMUT1-alsS-F / pMUT1-alsS-R, pMUT1-panB-F / pMUT1-panB-R, and pMUT1-panC-F / pMUT1-panC-R as primers. The PCR products yielded alsS, panB, and panC gene fragments. The target fragments and vectors were cloned in one step and then transformed into E. coli DH5α. Colony PCR and sequencing were performed to verify the correct pMUT1-alsS, pMUT1-panB, and pMUT1-panC recombinant cryptic plasmids.

[0070] (2) Construction of pMUT2-panB-panC, pMUT2-panC-panB, pMUT2-panC-alsS and pMUT2-panB-alsS recombination cryptic plasmids: Using pMUT1-S plasmid as a template, and X-pMUT2-F1 / X-pMUT2-R1 as primers, PCR amplification was performed to obtain the linearized vector plasmid fragment X-pMUT. 2a Using the EcN genome as a template, PCR amplification was performed using pMUT2-panB-F1 / pMUT2-panB-R1 and pMUT2-panC-F1 / pMUT2-panC-R1 primers to obtain the panB and panC gene fragments. The target fragments and vectors were cloned in one step, then transformed into E. coli DH5α. Colony PCR and sequencing verification yielded the correct pMUT2-panB and pMUT2-panC recombinant cryptic plasmids. Using pMUT2-panB and pMUT2-panC plasmids as templates, PCR amplification was performed using X-pMUT2-F2 / X-pMUT2-R2 primers to obtain the linearized vector plasmid fragment X-pMUT2-F1 / X-pMUT2-R2. 2b -panB and X-pMUT 2b Using the Bacillus subtilis and EcN genomes as templates, PCR amplification was performed using pMUT2-panB-F2 / pMUT2-panB-R2, pMUT2-panC-F2 / pMUT2-panC-R2, and pMUT2-alsS-F / pMUT2-alsS-R primers to obtain alsS, panB, and panC gene fragments. The target fragments and vectors were cloned in one step and then transformed into E. coli DH5α. Colony PCR and sequencing were performed to verify the correct pMUT2-panB-panC, pMUT2-panC-panB, pMUT2-panC-alsS, and pMUT2-panB-alsS recombinant cryptic plasmids.

[0071] (3) Constructing EPA-1, EPA-2, EPA-3 and EPA-4 genetically engineered probiotics The successfully constructed pMUT1-alss and pMUT2-panB-panC recombinant cryptic plasmids were introduced into E-1 chemically transformed competent cells, and colony PCR and sequencing were performed to verify the correct EPA-1 genetically engineered probiotics. The successfully constructed pMUT1-alss and pMUT2-panC-panB recombinant cryptic plasmids were introduced into E-1 chemically transformed competent cells, and colony PCR and sequencing were performed to verify the correct EPA-2 genetically engineered probiotics. The successfully constructed pMUT1-panB and pMUT2-panC-alss recombinant cryptic plasmids were introduced into E-1 chemically transformed competent cells, and colony PCR and sequencing were performed to verify the correct EPA-3 genetically engineered probiotics. The successfully constructed pMUT1-panC and pMUT2-panB-alss recombinant cryptic plasmids were introduced into E-1 chemically transformed competent cells, and colony PCR and sequencing were performed to verify the correct EPA-4 genetically engineered probiotics. (4) Shake-flask fermentation of EPA-1, EPA-2, EPA-3 and EPA-4 genetically engineered probiotics: The constructed EPA-1, EPA-2, EPA-3, and EPA-4 genetically engineered probiotics were streaked from glycerol tubes onto LB agar plates containing kanamycin and spectinomycin resistance. Single colonies were picked and inoculated into 10 mL LB liquid medium containing kanamycin and spectinomycin resistance, with EcN bacteria on a basal plate as a control. The culture was incubated overnight at 37°C and 200 rpm. A 2% inoculum was then transferred to a 500 mL shake flask containing 30 mL MS fermentation medium. A 0.1% metal concentrate, 30 μL of kanamycin and spectinomycin (50 mg / mL) resistance, and 366 μL of a four-in-one additive were added to the fermentation medium. The culture was incubated at 30°C and 200 rpm for 48 h. After fermentation, the supernatant was collected by centrifugation, and the VB5 content was determined by HPLC, while the OD was measured by spectrophotometry. 600 The growth status and VB5 content of the strains were determined. In this example, the OD values ​​of the EPA-1, EPA-2, EPA-3, and EPA-4 genetically engineered probiotics were analyzed. 600 The bar chart comparing the potency of D-pantothenic acid is shown below. Figure 7 As shown.

[0072] Depend on Figure 7 It is evident that overexpression of the alsS gene from the Bacillus subtilis genome and the panB and panC genes from the EcN genome significantly increased VB5 production, raising the VB5 titer from almost undetectable in the wild-type EcN strain to 102 mg / L. This indicates that the modified cryptic plasmid and the enhanced pantothenic acid pathway for synthesizing VB5 precursors contribute to increased VB5 production.

[0073] Spectrophotometer detection of OD600 Methods: After shake-flask fermentation, take 1 mL of fermentation broth, centrifuge at 12000 rpm for 5 min, discard the supernatant, add 1 mL of ultrapure water, resuspend the cells, centrifuge at 12000 rpm for 2 min, discard the supernatant, add 800 μL of ultrapure water, resuspend the cells, add 200 μL of glacial acetic acid, let stand for 15 min to allow the glacial acetic acid to fully react with CaCO3, then dilute to the appropriate factor, and measure the OD using a spectrophotometer. 600 .

[0074] Example 8 EPA-2 genetically engineered probiotics through multiple passages of fermentation The constructed EPA-2 genetically engineered probiotics were streaked from glycerol tubes onto LB agar plates containing kanamycin and spectinomycin resistance. Single colonies were picked and inoculated into 10 mL LB liquid medium containing kanamycin and spectinomycin resistance, with EcN bacteria on a substrate as a control. The culture was incubated overnight at 37°C and 200 rpm. A 2% inoculum was then transferred to a 500 mL shake flask containing 30 mL MS fermentation medium. 0.1% metal concentrate, 30 μL of kanamycin and spectinomycin (50 mg / mL) resistance, and 366 μL of a four-in-one additive were added to the fermentation medium. The culture was incubated at 30°C and 200 rpm for 48 h. During this period, every 12 h, a 2% inoculum was transferred to a new 500 mL shake flask containing 30 mL MS fermentation medium. This process was repeated 11 times. After fermentation, the supernatant was collected by centrifugation, and the VB5 content was determined by HPLC, while the OD was measured by spectrophotometry. 600 The growth status and VB5 content of the strain were determined. In this example, the VB5 titer / OD5 content of the EPA-2 genetically engineered probiotics after multiple passages were analyzed. 600 Comparison bar charts as follows Figure 8 As shown.

[0075] Depend on Figure 8 It is evident that after 11 passages, the VB5 production of the EPA-2 genetically engineered probiotic strain remained relatively stable, with the VB5 titer remaining stable at around 102 mg / L. This indicates that the modified cryptic plasmid is beneficial for the stable genetic expression of key genes and contributes to the stability of VB5 synthesis.

[0076] The above description is merely a detailed explanation of preferred embodiments and principles of the present invention. For those skilled in the art, there may be changes in specific implementation methods based on the ideas provided by the present invention, and these changes should also be considered within the scope of protection of the present invention.

Claims

1. A method for constructing genetically engineered probiotics mediated by a cryptic plasmid, characterized in that, Includes the following steps: S1: Using Escherichia coli as the substrate bacteria, the endogenous cryptic plasmid in the substrate bacteria cells was knocked out and replaced with a modified recombinant cryptic plasmid. S2: Overexpression of the green fluorescent protein (GFP) gene at different sites in the modified recombinant cryptic plasmid; S3: Genetically engineered probiotics were obtained by overexpressing the gene used to synthesize VB5 using a modified recombinant cryptic plasmid.

2. The method for constructing a cryptic plasmid-mediated genetically engineered probiotic according to claim 1, characterized in that, The bacteria on the substrate were Escherichia coli Nissle 1917.

3. The method for constructing a cryptic plasmid-mediated genetically engineered probiotic according to claim 1, characterized in that, The endogenous cryptic plasmid is any one or a combination of two of pMUT1 and pMUT2.

4. A method for constructing a cryptic plasmid-mediated genetically engineered probiotic according to claim 1 or 3, characterized in that, The modified recombinant cryptic plasmid was prepared by inserting kanamycin and / or spectinomycin resistance genes into an endogenous cryptic plasmid.

5. The method for constructing a cryptic plasmid-mediated genetically engineered probiotic according to claim 1, characterized in that, The genes used to synthesize VB5 in step S3 include at least one of the alsS gene, panB gene, and panC gene.

6. The method for constructing a cryptic plasmid-mediated genetically engineered probiotic according to claim 5, characterized in that, The GFP gene, alsS gene, panB gene, and panC gene are all expressed using the Trc promoter.

7. The method for constructing a cryptic plasmid-mediated genetically engineered probiotic according to claim 6, characterized in that, The nucleotide sequence of the promoter Trc is shown in SEQ ID NO.1; The nucleotide sequence of the GFP gene is shown in SEQ ID NO.2; The alsS gene is derived from Bacillus subtilis, and the nucleotide sequence of the alsS gene is shown in SEQ ID NO.3; The panB gene is derived from Escherichia coli Nissle 1917, and the nucleotide sequence of the panB gene is shown in SEQ ID NO.4; The panC gene is derived from Escherichia coli Nissle 1917, and the nucleotide sequence of the panC gene is shown in SEQ ID NO.

5.

8. Genetically engineered probiotics prepared by the method for constructing cryptic plasmid-mediated genetically engineered probiotics as described in any one of claims 1 to 7.

9. The application of the genetically engineered probiotics as described in claim 8 in the preparation of VB5.

10. The application according to claim 9, characterized in that, The method of application is as follows: The genetically engineered probiotics were fermented at 30-37℃ and 180-200 rpm for 48-72 hours. After fermentation, the fermentation broth was centrifuged and the supernatant was collected and purified to obtain VB5.

Images