Application of rice OsPAL7 gene in reduction of rice cadmium accumulation

By editing the rice OsPAL7 gene using CRISPR/Cas9 technology and constructing mutant lines, the problem of cadmium accumulation in rice was solved, resulting in a significant reduction in cadmium content and providing a new molecular mechanism for analysis.

CN121950894APending Publication Date: 2026-05-01SICHUAN AGRI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
SICHUAN AGRI UNIV
Filing Date
2025-12-30
Publication Date
2026-05-01

AI Technical Summary

Technical Problem

In the current technology, the problem of cadmium accumulation in rice is serious, and there are no reports on the regulation of cadmium accumulation in rice by the OsPAL7 gene. There is a lack of effective gene targets to achieve long-term and low-cost genetic improvement.

Method used

The rice OsPAL7 gene was directionally edited using CRISPR/Cas9 technology to construct mutant lines, including OsPAL7 gene overexpression lines and loss-of-function lines. These mutant lines were used to restrict cadmium transport in the roots by regulating lignin synthesis.

Benefits of technology

Under cadmium pollution conditions, the OsPAL7 mutant line significantly reduced cadmium accumulation in rice, and the cadmium content in brown rice and panicle of wild-type rice was significantly lower than that in the mutant line, proving that the OsPAL7 gene can regulate cadmium accumulation in rice and providing a new molecular mechanism for analysis.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121950894A_ABST
    Figure CN121950894A_ABST
Patent Text Reader

Abstract

The invention provides application of a rice OsPAL7 gene in reduction of rice cadmium accumulation, and relates to the technical field of gene engineering. The nucleotide sequence of the gene is shown as SEQ ID NO.1. The application comprises the following steps: directionally editing the OsPAL7 gene by using a CRISPR / Cas9 technology, constructing a recombinant vector, transforming the recombinant vector into a rice callus by using an agrobacterium-mediated method, and screening to obtain a mutant strain. The rice OsPAL7 gene is cloned and analyzed for the first time, the nucleotide sequence of the gene is disclosed, and it is proved that the OsPAL7 has the capacity of promoting rice root system lignin deposition and limiting cadmium to the root system so as to reduce rice cadmium accumulation.
Need to check novelty before this filing date? Find Prior Art

Description

Application of the rice OsPAL7 gene in reducing cadmium accumulation in rice Technical Field

[0001] This invention relates to the fields of crop genetics and breeding and heavy metal pollution control, specifically to the application of the rice OsPAL7 gene in reducing cadmium accumulation in rice. Background Technology

[0002] Cadmium is a highly toxic heavy metal that easily accumulates through the soil-plant system. As rice is a major food crop in my country, excessive cadmium levels in rice pose a serious threat to human health. The problem of excessive cadmium in rice caused by paddy field pollution is prominent in my country, with some areas showing a cadmium content exceeding the standard in commercially available rice by 2% to 10%, and in some polluted areas in the south, the rate is as high as 60% to 70%. Currently, methods to reduce cadmium accumulation in rice mainly include agronomic regulation, soil remediation, and genetic improvement. Among these, genetic improvement has advantages such as long-term effectiveness and low cost, making it the core approach to solving the problem of excessive cadmium in rice. A crucial foundation for this work is identifying effective gene targets for reducing cadmium accumulation in rice.

[0003] Phenylalanine ammonia-lyase (PAL) is a key rate-limiting enzyme in phenylpropane metabolism. It catalyzes the biosynthesis of various phenylpropanoids, including lignin, and plays an important regulatory role in plant growth, development, and stress resistance. The regulatory role of the PAL gene family in lignin formation and cell wall modification has been confirmed in plants such as Arabidopsis thaliana and peanut. Furthermore, members of this gene family are upregulated under cadmium stress, indicating that PALs play an important role in responding to cadmium stress. However, research on the regulation of cadmium accumulation in rice by the OsPAL family genes (such as OsPAL7) has not been reported, and related applications are currently lacking.

[0004] Therefore, this study aims to analyze the Cd accumulation mechanism in rice from the perspective of OsPAL7 regulating cadmium accumulation, in order to provide a theoretical basis for improving the Cd accumulation mechanism in rice. Summary of the Invention

[0005] The purpose of this invention is to provide the application of the rice OsPAL7 gene in reducing cadmium accumulation in rice.

[0006] The technical problem solved by this invention is achieved by the following technical solution.

[0007] This application provides the application of the rice OsPAL7 gene in reducing cadmium accumulation in rice. The nucleotide sequence of the gene is shown in SEQ ID No. 1.

[0008] Furthermore, the above application uses CRISPR / Cas9 technology to perform targeted editing of the gene to obtain mutant strains.

[0009] Furthermore, the above-mentioned targeted editing includes the following steps: S1: PCR amplification of the above-mentioned gene to obtain amplification products; S2: ligation of the above-mentioned products into an expression vector to construct a recombinant editing expression vector; S3: transformation of the above-mentioned recombinant editing expression vector into rice callus tissue using Agrobacterium-mediated transformation to obtain mutant lines.

[0010] Furthermore, in step S3, the mutant lines include OsPAL7 gene overexpression lines.

[0011] This invention also provides a biomaterial comprising the genes described above.

[0012] The embodiments of the present invention also provide the application of the above-mentioned biomaterials in reducing cadmium accumulation in rice; and / or in cultivating cadmium-low accumulation rice varieties.

[0013] Compared with the prior art, the embodiments of the present invention have at least the following advantages or beneficial effects: 1. The present invention clones and analyzes the rice OsPAL7 gene for the first time, and publishes the nucleotide sequence of the region of the gene, providing a new perspective for elucidating the unknown molecular mechanism of cadmium absorption and accumulation in rice.

[0014] 2. This invention is the first to knock out the OsPAL7 gene in rice using CRISPR / Cas9 technology, resulting in two homozygous mutant lines. Under cadmium pollution conditions, it was found that there was no significant difference in cadmium content in brown rice between wild-type rice and the OsPAL7 mutant lines, but the cadmium content in brown rice of wild-type lines was significantly lower than that of OsPAL7 mutant lines, proving that OsPAL7 has the ability to regulate cadmium accumulation in rice. Attached Figure Description

[0015] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.

[0016] Figure 1 is a schematic diagram of the target location of OsPAL7 in the CRISPR / Cas9 target system in Example 1 of the present invention; Figure 2 shows the lignin deposition in the roots of wild-type rice and OsPAL7 mutant lines in Example 2 of the present invention; Figure 3 shows the growth of wild-type rice and OsPAL7 mutant lines in Example 3 of the present invention; Figure 4 shows the cadmium content of wild-type rice and OsPAL7 mutant lines in Example 3 of the present invention; Figure 5 shows the vector map used to construct the OsABI3 overexpression mutant in Example 4 of the present invention. Detailed Implementation

[0017] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. Where specific conditions are not specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased commercially.

[0018] It should be noted that, unless otherwise specified, the embodiments and features described in this application can be combined with each other. The present invention will now be described in detail with reference to specific embodiments.

[0019] Example 1: To verify the effect of OsPAL7 in reducing cadmium accumulation in rice, this example first designed control plants, namely, the construction and identification of OsPAL7 mutant lines, including the following steps: The mutant rice material was gene-edited by Wuhan Tianwen Biotechnology Co., Ltd. Based on the OsPAL7 (LOC_Os05g35290) genome sequence information from the Rice Genome Annotation Project (http: / / rice.plantbiology.msu.edu / index.shtml), the nucleotide sequence was sequenced, and the sequencing results are shown in SEQ ID No. 1. Then, based on the above sequencing results, two target sites were designed: target site 1 sequence is shown in SEQ ID No. 3, and target site 2 sequence is shown in SEQ ID No. 4, with a distance of 244 bp between the two target sites. The fragment containing the target site was amplified by PCR, and the PCR fragment was cloned into the PRGEB32 vector using recombinase from Nanjing Novizan Biotechnology Co., Ltd., forming the final CRISPR expression vector. The constructed CRISPR vector was transformed into Escherichia coli DH5α, and positive clones were screened by colony PCR. Two positive clones were selected for sequencing to complete the construction of the recombinant vector.

[0020] After constructing SEQ ID No. 3: TCGAGCTCGACGAGTCGGCG and SEQ ID No. 4: GCCGGAGTAGCCTTGCAGCA, the knockout recombinant vector was transformed into indica rice D62B callus tissue using Agrobacterium-mediated transformation. DNA was extracted from the transgenic candidate plants and wild-type plants, and mutant plants were obtained through PCR amplification and sequencing verification. The verification primer F is shown in SEQ ID No. 5, and primer R is shown in SEQ ID No. 6. The amplification program is shown in Table 1: SEQ ID No. 5: 5' GCTTCCATTGATCACTCGCTCTG 3'SEQ ID No.6: 5' GTTCATCACCTCGCAGAACACG Table 1. PCR amplification system

[0021] Two different mutant lines, ospal7-1 and ospal7-2, were identified and screened. Stable lines were obtained after two generations of propagation in each mutant. As shown in Figure 1, which illustrates the target location of OsPAL7 in the CRISPR / Cas9 target system, the orange and yellow areas indicate the specific location of the gene editing target. The target locations for the two mutant types are as follows: ospal7-1 contains a 262-base deletion, while ospal7-2 contains a 28-base insertion, a 262-base deletion, and a 1-base variation. This mutation causes premature termination or mutation of the amino acid sequence formed by the translation of the OsPAL7 gene in the corresponding ospal7-1 and ospal7-2 lines, resulting in the inability of OsPAL7 to be expressed normally and thus leading to the loss of OsPAL7 function in the corresponding lines.

[0022] Example 2 This example verified the effect of OsPAL7 loss of function on lignin synthesis in rice roots, including the following steps: Seeds of wild-type rice D62B and OsPAL7 mutant lines (ospal7-1 and ospal7-2) were disinfected with 30% H2O2 for 30 min, then soaked in 0.1% NaClO for 1 day, and then germinated in a constant temperature and humidity chamber (temperature 35 ℃, humidity 60%). After the seeds broke through the root tip, they were transferred to a 1 L black hydroponic box. After 7 days of germination, they were treated with 5 μmol / L cadmium. Seven days after cadmium treatment, root segments 1.5-2.5 cm from the root tip were collected and preserved in 0.9% physiological saline. The segments were frozen and sectioned, and the lignin was stained with basic fuchsin. The distribution of fluorescence in the sections was observed using a laser confocal scanning microscope.

[0023] The differences in lignin are shown in Figure 2, where en represents the endodermis, x represents xylem vessels, ex represents the exodermis, pink fluorescence represents lignin deposition, and blue fluorescence represents cellulose deposition. The scale bar is 10 μm. The results indicate that under cadmium treatment, lignin synthesis in the roots of the OsPAL7 mutant was significantly weaker than in wild-type rice, with a greater impact on the endodermis. This suggests that the loss of OsPAL7 function affects lignin synthesis in rice roots and its deposition in the endodermis. Changes in lignin deposition influence the translocation of cadmium from the roots to the aboveground parts, ultimately affecting cadmium accumulation in rice.

[0024] Example 3 This example verifies the difference in biomass and Cd content in different organs of the OsPAL7 mutant lines, including the following steps: Seeds of wild-type rice D62B and OsPAL7 mutant lines (ospal7-1 and ospal7-2) were disinfected with 30% H2O2 for 30 min, then soaked in 0.1% NaClO for 1 day, and then germinated in a constant temperature and humidity chamber (temperature 35 ℃, humidity 60%). After the seeds broke through the bud, they were transferred to well-moistened nutrient soil and watered daily with an appropriate amount of deionized water to maintain a certain humidity. When the seedlings had three leaves and one bud, seedlings with uniform growth were selected for transplanting. The seedlings were transplanted into black plastic buckets containing 15 kg of cadmium-contaminated soil (total cadmium content of 1.22 mg / kg, available cadmium content of 0.46 mg / kg), with 2 seedlings per bucket. Nitrogen (N), phosphorus (P2O5), and potassium (K2O) fertilizers were applied at concentrations of 150, 100, and 105 mg / kg soil, respectively. The fertilizer dosage per pot was 4.82 g urea, 2.88 g potassium dihydrogen phosphate, and 0.95 g potassium chloride. Natural light and conventional water and fertilizer management were used. Samples were collected at rice maturity, including roots, stems, leaves, and panicles. After drying, the dry weight was used as biomass, and the Cd content of the plants was determined according to the national standard (GB 5009.268-2025).

[0025] The biomass differences are shown in Figure 3. * indicates a significant difference between the wild-type line and the OsPAL7 mutant line at p < 0.05. The results show that in cadmium-contaminated soil, there were no significant differences in the number of effective panicles, plant height, and biomass between the wild-type rice and the OsPAL7 mutant line, except for the biomass of ospal7-1 husks and panicles. This indicates that the loss of OsPAL7 function does not affect rice growth.

[0026] The differences in Cd content in different parts are shown in Figure 4. * and ** indicate that there are significant differences between the wild-type line and the OsPAL7 mutant line at p<0.05 and p<0.01, respectively.

[0027] Then, the cadmium accumulation and cadmium allocation ratio were calculated using the following method: Cadmium accumulation = Cadmium content × Biomass; Cadmium allocation ratio at a certain part = Cadmium accumulation at that part / Cadmium accumulation in the whole plant. It was found that the cadmium content in brown rice, husk, and panicle of wild-type rice was significantly lower than that of the OsPAL7 mutant line, while the cadmium content in the root system was significantly higher than that of the OsPAL7 mutant line. There was no significant difference in cadmium content between leaves and stems. This is because OsPAL7 promotes lignin deposition in the inner and outer cortex of rice roots and enhances the Casparian strip. This change restricts the radial transport of cadmium in the roots, thereby reducing cadmium translocation to the aboveground parts and ultimately reducing cadmium accumulation in rice. The cadmium allocation ratio in the roots of wild-type rice was much higher than that of the OsPAL7 mutant line, while the cadmium allocation ratio in brown rice, husk, and panicle was lower than that of the OsPAL7 mutant line. These results indicate that OsPAL7 promotes lignin deposition in the roots, thereby limiting cadmium to the roots and reducing cadmium accumulation in rice.

[0028] Example 4: This example describes the construction of an OsPAL7 overexpression line, including the following steps: Using rice D62B cDNA as a template, the CDS sequence of the OsPAL7 gene was amplified to obtain a PCR amplification product, which was then forward-ligated into the overexpression vector pCAMBIA1300. The CDS sequence of OsPAL7 is shown in SEQ ID No. 2, and the overexpression vector map is shown in Figure 5. The ligation product was transformed into E. coli DH5α competent cells, positive clones were selected, plasmids were propagated, and then transformed into Agrobacterium. Callus infection and tissue culture were used to obtain an OsPAL7-enhanced overexpression line.

[0029] Then, comparing the two different OsPAL7 lines in Examples 1 and 4, it was found that the cadmium content and lignin deposition in the roots of the OsPAL7 overexpression lines were significantly higher than those in the OsPAL7 mutant lines, while the cadmium content in the rice was significantly lower than that in the OsPAL7 mutant lines. Therefore, based on this conclusion, biological materials containing the rice OsPAL7 gene can be prepared to reduce cadmium accumulation in rice.

[0030] In summary, the embodiments of the present invention provide rice OsPAL7 and its application in reducing cadmium accumulation in rice. The present invention is the first to clone and analyze the rice OsPAL7 gene and publish the nucleotide sequence of the gene region, providing a new perspective for elucidating the unknown molecular mechanism of rice regulating cadmium accumulation.

[0031] This invention is the first to knock out the OsPAL7 gene in rice using CRISPR / Cas9 technology, resulting in two homozygous mutant lines. Under cadmium pollution conditions, wild-type rice showed stronger root lignin synthesis than the mutant lines, thus limiting the translocation of cadmium from the roots to the aboveground parts. The cadmium content in brown rice, husk, and panicle decreased significantly, as did the cadmium distribution ratio in rice. This indicates that OsPAL7 has the ability to enhance lignin deposition in rice roots, thereby limiting cadmium to the roots and reducing cadmium accumulation in rice.

[0032] The embodiments described above are some, but not all, embodiments of the present invention. The detailed description of the embodiments of the present invention is not intended to limit the scope of the claimed invention, but merely to illustrate selected embodiments. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without inventive effort are within the scope of protection of the present invention.

Claims

1. The application of the rice OsPAL7 gene in reducing cadmium content in rice, characterized by, The nucleotide sequence of the gene is shown in SEQ ID No.

1.

2. The application according to claim 1, characterized in that, It also includes using CRISPR / Cas9 technology to perform targeted editing of the gene to obtain mutant lines.

3. The application according to claim 2, characterized in that, The targeted editing includes the following steps: S1: performing PCR amplification on the gene to obtain the amplification product; S2: ligating the product into an expression vector to construct a recombinant editing expression vector; S3: transforming the recombinant editing expression vector into rice callus tissue using Agrobacterium-mediated transformation to obtain mutant lines.

4. The application according to claim 3, characterized in that, In step S3, the mutant strains include OsPAL7 gene overexpression strains.

5. A biomaterial, characterized in that, Includes the gene as described in claim 1.

6. The application of the biomaterial as described in claim 5 in reducing cadmium accumulation in rice; and / or in breeding cadmium-low cadmium accumulation rice varieties.