Virus replication essential protein gene NdelF4G and application thereof in inhibition of plant virus infection

By silencing the NbelF4G gene in tobacco plants and using virus-induced gene silencing technology to interfere with virus replication, the problem of limited control scope in existing technologies has been solved, achieving effective inhibition of TSWV and RSV and providing a novel intrinsic control target.

CN121991966APending Publication Date: 2026-05-08NANJING AGRICULTURAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511917166.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-18
Publication Date
2026-05-08

AI Technical Summary

Technical Problem

Existing technologies for controlling tomato spotted wilt virus (TSWV) and rice stripe virus (RSV) have limited scope of control, are susceptible to environmental factors, and the viruses are prone to adaptive mutations. They also lack efficient and broad-spectrum control targets based on virus-host interactions.

Method used

By silencing the NbelF4G gene in tobacco plants, virus replication was inhibited using virus-induced gene silencing (VIGS) technology. Agrobacterium tumefaciens was then used to inoculate the plants with the recombinant tobacco brittle virus vector (TRV::NbelF4G) to interfere with the viral replication cycle.

Benefits of technology

It significantly inhibits the infection of TSWV and RSV, alleviates the symptoms, reduces the accumulation of viral proteins, and provides a novel intrinsic target for the prevention and control of multiple viral co-infections.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121991966A_ABST
    Figure CN121991966A_ABST
Patent Text Reader

Abstract

The invention discloses a virus replication essential protein gene NdelF4G and application thereof in inhibition of plant virus infection, and belongs to the technical field of plant molecular biology and virus resistance. The nucleotide sequence of the gene is as shown in SEQ ID NO: 3, and the coded amino acid sequence of the gene is as shown in SEQ ID NO: 4. According to the invention, the endogenous NhelF4G gene of tobacco is specifically silenced through a virus-induced gene silencing technology, so that the infection and accumulation of tomato spotted wilf virus and rice stripe virus in nicotiana benthamiana can be remarkably inhibited, and the infection and accumulation are shown as reduction of disease symptoms and reduction of virus protein expression level. The discovery shows that the NhelF4G is a key host factor on which virus replication depends, and the NhelF4G can effectively endow plants with antiviral ability when being used as a silence target. The invention provides important gene resources and theoretical basis for creating novel antiviral plant materials and developing broad-spectrum virus prevention and control strategies of targeted host factors.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of plant molecular biology and antiviral technology, specifically relating to a viral replication essential protein gene NbelF4G and its application in inhibiting plant virus infection. Background Technology

[0002] Tomato spotted wilt virus (TSWV) is an important member of the Orthotospovirus genus. It is primarily transmitted through persistent thrips transmission and sap friction. It can infect over 360 plant species, including those in the Solanaceae, Fabaceae, Asteraceae, and Cucurbitaceae families, severely damaging crops such as tomatoes, tobacco, peppers, potatoes, peanuts, lettuce, and impatiens. TSWV ranks second among the world's ten most important plant viruses, causing varying degrees of damage in many tobacco-producing countries and is recognized by major tobacco-producing nations as one of the most potentially threatening viruses. TSWV was first reported in Sichuan sun-cured tobacco in China in 1992. Since then, the scope of TSWV's damage has expanded annually, occurring in flue-cured tobacco grown in Yunnan, Guizhou, Heilongjiang, Shandong, and other regions.

[0003] Rice stripe virus (RSV) is the pathogen of rice stripe leaf blight, and it belongs to the genus *Tenuiviruses*. The virus particles are mostly filamentous, but can also be granular, lumpy, or irregularly shaped. The planthopper is the vector for RSV, and it transmits the virus through eggs via a cyclical reproduction process. It causes severe losses to crop production. When rice stripe virus infects rice, it primarily damages the leaves and leaf sheaths, causing obvious chlorosis or mottling symptoms on the leaves.

[0004] Once plant viral diseases break out, they are often difficult to control effectively, thus becoming a key and challenging issue in contemporary plant disease and virology research. Based on the characteristics of plant viral disease occurrence, the main technical areas for plant viral disease control include virus-free seeds and seedlings, vector insect control, attenuated virus inoculation techniques, and the screening and promotion of resistant varieties. In agricultural production, prevention is generally the primary approach, supplemented by integrated management methods for effective control of plant viral diseases. Summary of the Invention

[0005] Technical Problem to be Solved: Existing plant virus control technologies largely rely on virus-free seedlings, vector insect control, or the breeding of traditional disease-resistant varieties. These methods often suffer from limited control scope, susceptibility to environmental factors, or the tendency of viruses to undergo adaptive mutations. This is especially true for highly damaging viruses with a wide host range, such as Tomato Spotted Wilt Virus (TSWV) and Rice Stripe Virus (RSV), for which there is currently a lack of efficient and broad-spectrum control targets based on key virus-host interactions. This invention provides a viral replication essential protein gene, NbelF4G, and its application in inhibiting plant virus infection.

[0006] Technical solution: The viral replication essential protein gene NbelF4G, silencing the expression of this gene can enhance the plant's resistance to tomato spotted wilt virus and / or rice stripe virus, the nucleotide sequence of which is shown in SEQ ID NO:3.

[0007] The amino acid sequence of the protein encoded by the above gene is shown in SEQ ID NO:4.

[0008] The use of the aforementioned NbelF4G gene in the breeding of virus-resistant tobacco plants.

[0009] The viruses mentioned above are tomato spotted wilt virus and / or rice stripe virus.

[0010] A method for improving tobacco's resistance to plant viruses includes: using virus-induced gene silencing technology to suppress the expression of the NbelF4G gene in tobacco plants, wherein the nucleotide sequence of the NbelF4G gene is shown in SEQ ID NO:3.

[0011] The vector used in the above gene silencing technology is the tobacco brittle virus vector.

[0012] The above method involves introducing a recombinant vector of tobacco brittle virus containing a partial sequence of the NbelF4G gene into tobacco plants via Agrobacterium tumefaciens infiltration.

[0013] The plant viruses mentioned above are tomato spotted wilt virus and / or rice stripe virus.

[0014] A recombinant tobacco brittle virus vector for silencing the NbelF4G gene in tobacco, comprising a fragment of the nucleotide sequence shown in SEQ ID NO:3.

[0015] Agrobacterium strains containing the aforementioned recombinant vector.

[0016] Beneficial Effects: First, existing technologies for controlling Tomato Spotted Wilt Virus (TSWV) and Rice Stripe Virus (RSV) primarily focus on external isolation or vector insect control. This invention, through in-depth research into the virus-host interaction mechanism, discovered and confirmed that the tobacco endogenous gene NbelF4G is a key host factor essential for the replication of these viruses. Specific silencing of this gene using VIGS technology can fundamentally interfere with the viral replication cycle, thereby achieving effective inhibition of TSWV and RSV infection in Nicotiana benthamiana. This provides a novel intrinsic target acting on host factors for plant antiviral breeding and biocontrol. Second, experimental results from this invention show that silencing the same host gene, NbelF4G, can simultaneously produce significant inhibitory effects on TSWV and RSV, which belong to different virus genera, have different transmission modes, and exhibit vastly different disease symptoms. This indicates that targeting this host factor may disrupt a conserved replication mechanism commonly relied upon by multiple viruses. Therefore, compared to traditional single-virus resistance strategies, this invention holds promise for solving the problem of multiple virus co-infection. Third, this invention, through constructing a TRV::NbelF4G silencing vector and inoculating it with Agrobacterium, confirmed by RT-qPCR that the expression of the NbelF4G gene was effectively suppressed. Figure 1 Based on this, virus inoculation experiments showed that, compared with the control (TRV::GUS), the treatment group (TRV::NbelF4G) exhibited significantly reduced disease symptoms in inoculated plants. More importantly, Western blot analysis directly confirmed that the accumulation of NP protein in TSWV and CP protein in RSV in the treatment group was significantly lower than that in the control group. Figure 2 ). Attached Figure Description

[0017] Figure 1 This is a schematic diagram showing the results of RT-qPCR detection of the NbelF4G gene expression level in TRV::NbelF4G-silenced plants in Example 4.

[0018] Figure 2 This is a schematic diagram showing the effect of silencing NbelF4G on the degree of viral infection after inoculation with TSWV and RSV in Nicotiana benthamiana in Example 5, including a comparison of viral infection symptoms and the accumulation of viral proteins detected by Western Blot. Detailed Implementation

[0019] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the description of the embodiments or the prior art will be briefly introduced below. Unless otherwise specified, the experimental methods in the following embodiments are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the experimental materials, reagents, and chemicals used in the following embodiments can be obtained through general channels. In the following embodiments, wild-type Nicotiana benthamiana seeds, TRV2 vector, and Agrobacterium GV3101 were obtained from the Plant Virology Laboratory of Nanjing Agricultural University.

[0020] Example 1

[0021] Cloning of the tobacco NbelF4G gene

[0022] Total RNA was extracted from *Nicotiana benthamiana* using TRIzol reagent, and cDNA was synthesized using total RNA and reverse transcriptase. The synthesized cDNA was used as a template for PCR amplification using specific primers for the *NbelF4G* gene. The amplification primers are as follows:

[0023] SEQ ID NO:1

[0024] F (5'→3'): CTAGTCTAGATTTCTCCTTCCGAGT

[0025] SEQ ID NO:2

[0026] R (3'→5'): GGGGTACCCCTCCAGTTTCTG

[0027] The obtained PCR product was subjected to 1% agarose gel electrophoresis, and after gel recovery, it was subjected to Sanger sequencing. The obtained sequence is shown in SEQ ID NO:3, and the encoded amino acid sequence is shown in SEQ ID NO:4.

[0028] Example 2

[0029] Detection of the efficiency of silent NbelF4G and its effect on plant virus infection of *Nicotiana benthamiana*

[0030] Construction of the NbelF4G silencing vector:

[0031] Using the original tobacco cDNA as a template, amplification was performed using specific primer pairs to obtain a 300 bp gene fragment; the TRV2 vector was digested with (EcoRI) / (KpnI) and ligated with the above PCR amplification product to obtain the silencing vector TRV::NbelF4G, and the plasmid TRV::NbelF4G was extracted and subjected to Agrobacterium electroporation transformation. The operation procedure is as follows: (1) Extraction of electroporation cups for electroporation: The electroporation cups were washed 3 times with ddH2O and 3 times with anhydrous ethanol, sterilized with ultraviolet light in a clean bench for 15 min, then the ultraviolet light was turned off and the cups were blown for 15 min until the alcohol was completely evaporated. (2) Place GV3101 competent cells on ice until completely thawed, add 2 μL of plasmid to the competent cells, gently tap the tube wall to mix, and let stand on ice for 1 min; (3) Transfer the competent cells containing plasmid to a pre-treated electroporation cup; (4) Place the electroporation cup in the electroporator, set the instrument to the "Agr" program, and perform electroporation; (5) After electroporation, add 800 μL of antibiotic-free LB, mix with a pipette, transfer to a new 1.5 mL EP tube, and incubate at 28℃ and 220 rpm for 3 h; (6) Take 100 μL of culture medium onto a solid LB medium containing the carrier resistance, spread it evenly with a spreader, seal with a sealing film, and incubate upside down at 28℃ for 48 h.

[0032] Example 3

[0033] Agrobacterium infiltration inoculation of this type of tobacco

[0034] Colonies grown on the plate were inoculated into LB liquid medium containing 100 μg / mL kanamycin sulfate and 20 μg / mL rifampin, and incubated at 28°C and 200 rpm for 12 h on a shaker. Subsequently, the bacterial cells were collected by centrifugation at 5000 rpm for 10 min, the supernatant was discarded, and the cells were thoroughly resuspended in the inoculation resuspension. The OD 600 value was adjusted to 1.0 using a spectrophotometer, and the cells were incubated at 28°C in the dark for 2–3 h. *Nicotiana benthamiana* was inoculated using a sterile syringe.

[0035] Example 4

[0036] NbelF4G gene silencing efficiency assay

[0037] Agrobacterium containing TRV::GUS and TRV::NbelF4G were inoculated into Nicotiana benthamiana plants. Seven days after inoculation, leaves from the inoculated plant systems were collected, total RNA was extracted, and reverse transcribed into cDNA. The expression level of the NbelF4G gene was detected by RT-qPCR using NbelF4G gene quantitative primers. Figure 1 )

[0038] Example 5

[0039] The effect of silencing NbelF4G on plant virus infection of Nicotiana benthamiana

[0040] Agrobacterium containing TRV::GUS and TRV::NbelF4G were inoculated into Nicotiana benthamiana plants, respectively. TRV-NbelF4G was treated with TSWV and RSV, while TRV::GUS was treated with TSWV and RSV, serving as a control group. Virus infection was assessed at least two weeks post-infection. Results showed that 1-4 days after TSWV and RSV infection, the viral load in the TRV::NbelF4G treatment groups was significantly lower than that in the control group. Figure 2 At 7 dpi, compared with the control, the treatment group showed obvious symptoms of viral infection. Western blotting showed that the TSWV NP and RSV CP protein levels in the treatment group TRV::NbelF4G were lower than those in the control group TRV::GUS. Figure 2 In summary, these results indicate that silencing NbelF4G renders Nicotiana benthamiana insensitive to plant virus infection.

[0041] When TRV-silenced plants were inoculated with TSWV and RSV, the results showed that plants with silenced NbeIF4G had milder symptoms after inoculation with TSWV and RSV. Western blot analysis showed that the expression levels of TSWV NP and RSV CP proteins in TRV:: NbeIF4G plants were downregulated, indicating that silencing NbeIF4G can inhibit TSWV and RSV infection.

[0042] Finally, it should be noted that the above specific embodiments are only used to illustrate the technical solutions of the present invention and not to limit it. Although the present invention has been described in detail with reference to examples, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention, and all such modifications and substitutions should be covered within the scope of the claims of the present invention.

Claims

1. The viral replication essential protein gene NbelF4G, characterized in that, Silencing the expression of this gene can enhance plant resistance to tomato spotted wilt virus and / or rice stripe virus, the nucleotide sequence of which is shown in SEQ ID NO:

3.

2. The gene according to claim 1, characterized in that, The amino acid sequence of the protein it encodes is shown in SEQ ID NO:

4.

3. The use of the NbelF4G gene as described in claim 1 or 2 in the cultivation of virus-resistant plants.

4. The use according to claim 3, characterized in that, The virus in question is tomato spotted wilt virus and / or rice stripe virus.

5. A method for improving tobacco's resistance to plant viruses, characterized in that, include: The expression of the NbelF4G gene in tobacco plants was suppressed using virus-induced gene silencing technology. The nucleotide sequence of the NbelF4G gene is shown in SEQ ID NO:

3.

6. The method according to claim 5, characterized in that, The vector used in the gene silencing technology is the tobacco brittle virus vector.

7. The method according to claim 6, characterized in that, The method involves introducing a recombinant vector of tobacco brittle virus containing a partial sequence of the NbelF4G gene into tobacco plants via Agrobacterium tumefaciens infiltration.

8. The method according to any one of claims 5-7, characterized in that, The plant viruses mentioned are tomato spotted wilt virus and / or rice stripe virus.

9. A recombinant tobacco brittle virus vector for silencing the NbelF4G gene in tobacco, characterized in that, A fragment containing the nucleotide sequence shown in SEQ ID NO:

3.

10. An Agrobacterium strain containing the recombinant vector of claim 9.