Deep-sea cold-resistant thiomonas and application thereof

Abstract

The invention relates to the technical field of microorganisms, in particular to deep sea thiomonas and application thereof. The strain is Sulfurimonas iocasae FCS5, and is preserved in the China General Microbiological Culture Collection Center (CGMCC), and the preservation number is CGMCC No.46387. The invention further discloses a preparation method of the Sulfurimonas iocasae strain. The deep sea thiomonas strain has the functions of carbon sequestration, denitrification, dephosphorization and production of various vitamins, and the application of the deep sea thiomonas strain in the fields of environmental restoration, biological product production and the like.

Description

Technical Field

[0001] This invention relates to the field of microbial technology, specifically to a deep-sea thiomonad bacterium and its applications. Background Technology

[0002] Given the current environmental challenges and the demands of biotechnology development, the search for highly efficient microorganisms capable of adapting to specific environmental conditions is of paramount importance. Microbial activity under low-temperature environments plays a crucial role in the treatment of low-temperature industrial wastewater. Simultaneously, carbon fixation, nitrogen removal, and phosphorus removal functions are essential for mitigating the greenhouse effect and purifying eutrophication, while microbial vitamin production holds potential applications in biopharmaceuticals and pharmaceuticals. However, to date, no bacterial strain has been discovered that simultaneously possesses multiple desirable characteristics and functions effectively at low temperatures. Summary of the Invention

[0003] The purpose of this invention is to provide a novel bacterial strain that can grow in low-temperature environments and has the functions of carbon fixation, denitrification, dephosphorization, and the production of various vitamins, so as to meet the needs of environmental remediation and bioproduct production.

[0004] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0005] A deep-sea psychrophilic sulfur monoclonal bacterium, strain Sulfurimonas iocasae FCS5, is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 46387.

[0006] An application of the aforementioned deep-sea psychrophilic sulfur monoclonal bacterium, specifically its application in environmental carbon sequestration using carbon dioxide.

[0007] An application of the aforementioned deep-sea psychrothermic sulfur monoclonal bacteria, specifically its application in denitrification and / or dephosphorization in the environment.

[0008] An application of the aforementioned deep-sea psychrophilic sulfur monoclonal bacteria: the application of the strain in the removal of nitrogen and phosphorus pollutants from the environment.

[0009] Application of the strain in degrading nitrogen and phosphorus pollutants in low-temperature wastewater or soil.

[0010] An application of the aforementioned deep-sea psychrothermic sulfur monoclonal bacteria: the application of the strain in the production of biological products.

[0011] Application of the strain in the preparation of proteins and vitamins.

[0012] The present invention has the following advantages:

[0013] The bacterial strains of this invention can grow and perform multiple functions in low-temperature environments, broadening the application range of microorganisms in low-temperature environments (5-20℃) and providing new avenues for environmental remediation and biotechnology development in low-temperature regions.

[0014] Its carbon sequestration, nitrogen removal, and phosphorus removal functions help solve current environmental problems, reduce greenhouse gas emissions, and purify water bodies, resulting in significant environmental benefits.

[0015] The ability to produce proteins and various vitamins provides a new source of microorganisms for the production of bioproducts, reduces the production cost of proteins and vitamins, and has potential economic benefits.

[0016] Figure and Table Description

[0017] Figure 1 Temperature growth experiment of strain FCS5 provided in the embodiments of the present invention.

[0018] Figure 2 Carbon dioxide fixation experiment of strain FCS5 provided in the embodiments of the present invention.

[0019] Figure 3 Denitrification and dephosphorization experiments of strain FCS5 provided in this embodiment of the invention. Detailed Implementation

[0020] The present invention will be further described below with reference to embodiments. These embodiments are intended to illustrate the invention and are not intended to limit the invention in any way.

[0021] Example 1

[0022] Obtaining Thiomonas FCS5:

[0023] 1. Isolation of strains

[0024] Samples of the bristles of the submerged armored shrimp collected by the research vessel "Science" in the cold seeps of the South China Sea were enriched and cultured in MJH medium at 10°C for 30 days. After the medium became turbid, the strains were isolated and cultured using the limiting dilution method. After purification, the strains were stored in 15% glycerol at -80°C for long-term preservation. The MJH culture medium consists of the following components: NaCl 30.0 g / L, K₂HPO₄ 0.14 g / L, CaCl₂·2H₂O 0.14 g / L, MgSO₄·7H₂O 3.4 g / L, MgCl₂·6H₂O 4.18 g / L, KCl 0.33 g / L, NH₄Cl 0.25 g / L, Fe(NH₄)₂(SO₄)₂·6H₂O 0.01 g / L, NaNO₃ 2 g / L, NaHCO₃ 1.5 g / L; and a trace element solution of 10.0 ml / L (trace mineral element solution: aminotriacetic acid 1.5 g / L, MgSO₄·7H₂O 3.0 g / L, MnSO₄·H₂O 0.5 g / L, NaCl 1.0 g / L, FeSO₄·7H₂O). 0.1 g / L, CoSO4·7H2O 0.1 g / L, CaCl2·2H2O 0.1 g / L, ZnSO4·7H2O 0.1 g / L, CuSO4·5H2O 0.01 g / L, AlK(SO4)2 0.01 g / L, H3BO3 0.01 g / L, Na2MoO4·2H2O 0.01 g / L. Dissolve aminotriacetic acid, adjust the pH to 6.5 with NaOH solution, add each component in sequence, and finally adjust the pH to 7.0. ), vitamin solution 1 mL (vitamin solution: biotin 2.0 mg / L, folic acid 2.0 mg / L, pyridoxine hydrochloride 10.0 mg / L, thiamine hydrochloride 5.0 mg / L, riboflavin 5.0 mg / L, niacin 5.0 mg / L, DL-calcium pantothenate 5.0 mg / L, vitamin B12 0.1 mg / L, p-aminobenzoic acid 5.0 mg / L, lipoic acid 5.0 mg / L (filtered for sterilization). Culture flasks are filled with 80% hydrogen and 20% carbon dioxide.

[0025] The steps of the extreme dilution method are as follows: The enriched culture is serially diluted 10-1. -1 Up to 10 -8 After one month of cultivation, the most diluted culture that has become turbid will be further diluted in the same serial dilution as above until the strain is purified.

[0026] 2. Identification of strains

[0027] The isolated strain was identified through morphological observation, physiological and biochemical characterization, 16S rRNA gene sequencing, and genome analysis. Strain FCS5 is rod-shaped and can utilize hydrogen as an electron donor and nitrate as an electron acceptor to obtain energy and fix carbon dioxide. 16S rRNA gene sequence analysis showed that the closest similarity type strain was *Sulfurimonas fonticola* CS47. T With a similarity of 96.7%, it was identified as a potential novel strain. Further digital DNA hybridization analysis showed that the FCS genome closely resembled the type strain CS47. T The DNA-DNA hybridization value was 25.3%, less than the 70% intraspecies threshold. The bacterial strain identified as the present invention is a new species of the genus *Sulfurimonas*, named *Sulfurimonas iocasae* FCS5.

[0028] This strain has been deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 46387, on March 12, 2025. The deposit address is No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing.

[0029] The 16S rRNA gene sequence is as follows:

[0030] GGTTACCTTGTTACGACTTCACCCCAGTCGCTAATTCCGCCGTAAGTG

[0031] GTAGCCTCCCGAAGGTTAGCTTCCCAATTTCGGGCGAAATCAACTCCC

[0032] ATGGTGTGACGGGCGGTGAGTACAAGACCCGGGAACGTATTCACCGT

[0033] AGCATTGCTGATCTACGATTACTAGTGATTCCAGCTTCATGAAGTCGAG

[0034] TTGCAGACTTCAATCCGAACTGAGAGACGCTTTATGAGATTGGCTCCA

[0035] CCTCGCGGTATCGCAACTCTCTGTACGCCCCATTGTAGCACGTGTGTA

[0036] GCCCTAGCCATAAGGGCCATGATGACTTGACGTCGTCCTCACCTTCCT

[0037] CCTCCTTGCGAAGGCAGTCTCCTTAGAGTGCCCAGCATAACCTGCTGG

[0038] CAACTAAGGACGAGGGTTGCGCTCGTTGCGGGACTTAACCCAACATC

[0039] TCACGACACGAGCTGACGACAGCCGTGCAGCACCTGTTTTCAAGTTC

[0040] CCCGAAGGGCACCACTCTATCTCTAGGGTGTTCTATCAATGTCAAGGC

[0041] TAGGTAAGGTTCTTCGCGTATCTTCGAATTAAACCACATGCTCCACCA

[0042] CTTGTGCGGGTCCCCGTCTATTCCTTTGAGTTTTAATCTTGCGACCGTA

[0043] CTCCCCAGGCGGAACACTTAATCTGTTAAGTGCATCACCGAGATGACA

[0044] AGCATCCCGACGACTAGTGTTCATCGTTTAGGGCGTGGACTACCGGGG

[0045] TATCTAATCCCGTTTGCTCCCCACGCTTTCACGCCTCAGCGTCAGTTAT

[0046] GTTCCAGGAGATCGCCTTCGCTTTCGGTATTCCTAGTGATATCTACGGA

[0047] TTTTACCCCTACACCACTAATTCCATCTCCCCCTCCCATACTCTAGGCT

[0048] CGTAGTTTCAAATGCAGTTCTATGGTTAAGCCATAGGATTTCACATCTG

[0049] ACTTACGAGCCAGCCTACGCGTCCTTTACGCCCAGTGATTCCGAGTAA

[0050] CGCTTGCACCCTCCGTATTACCGCGGCTGCTGGCACGGAGTTAGCCGG

[0051] TGCTTATTCATGAGCTACCGTCATTTTCTTGACTCATAAAAGGAGTTTA

[0052] CACACCGAAATGCGTCATCCTCCACGGCGGCGTTGCTGCATCAGGGTTT

[0053] CCCCCATTGTGCAATATTCCTCACTGCTGCCTCCCGTAGGAGTCTGGTC

[0054] CGGTTCCAGTACCAGTGTGGCGGATCATCCTCTCAAACCCGCTACCC

[0055] GTCATTGCCTTGGTAGTCTCTTACACTACCAACTAACTGATGGGATATA

[0056] GTCTGATCTCGAAGCGAAAAAACGTTTCCCGACTAAACTTGAGTTTAG

[0057] AAGGTGTATCCAGTATTAATCATCGTTTCCAATGGCTATCCCGGTCTTC

[0058] GAGGTACATTAACTATATATTACTCACCCGTGCGCCACTAATCCCCTAG

[0059] CCTACCACAAGTGATAAGTTTCGGTTCATCGTTCGACTTGCATGTGTTA

[0060] AGCACGCCGCCAGCGTTCACTCTGAGCCAGGATCAAACT

[0061] 3. Optimization of bacterial strain culture conditions: The purified bacterial strain obtained above was inoculated into MJH medium and cultured under different conditions such as temperature, salinity, and pH (see [link to relevant documentation]). Figure 1 The growth temperature range of strain FCS5 was determined to be 5-20℃, with an optimal growth temperature of 20℃; the growth pH range was 5.5-7.5, with an optimal pH of 6.5; and the growth salinity range was 1%-3%, with an optimal salinity of 1%.

[0062] Example 2: Verification experiment on carbon fixation function:

[0063] The purified strain was inoculated into MJH medium containing 80% carbon dioxide and cultured at 20°C, pH 6.5, and salinity 1%. Its carbon fixation function was verified by Raman spectroscopy to detect the consumption of carbon dioxide in the medium (see [link to relevant documentation]). Figure 2 Before culturing, the peak area of ​​the carbon dioxide Raman spectrum in the culture medium was 2912. After two weeks of cultivation with strain FCS5, the peak area of ​​the carbon dioxide Raman spectrum was 1238, indicating that the carbon dioxide in the culture medium decreased and was consumed by strain FCS5. Further genomic analysis confirmed that the carbon fixation pathway was a reducing citric acid cycle.

[0064] Example 3: Denitrification Function Verification Experiment

[0065] The strain obtained above was inoculated into MJH medium containing nitrate (2 g / L) and cultured at 20°C. Changes in nitrogen content, including nitrate nitrogen, during the culture process were monitored using a nutrient measurement device. Figure 3 The nitrate concentration in the culture medium was 26.45 mM before culturing. After adding strain FCS5 and culturing for 9 days, the nitrate concentration was 1.39 mM, and no nitrite was detected throughout the process, confirming its denitrification capacity. Further genomic analysis confirmed that the denitrification mechanism was denitrification.

[0066] Example 4: Dephosphorization Function Verification Experiment

[0067] The strain obtained above was inoculated into MJH medium containing phosphate (K2HPO4 0.14 g / L) and cultured at 20°C. The change in phosphate content in the medium was detected by a nutrient salt measuring device (see [link to nutrient salt measurement]). Figure 3 The dephosphater function was verified. Before culturing, the phosphate concentration in the culture medium was 0.47 mM. After culturing for 9 days with strain FCS5, the phosphate concentration decreased to 0.04 mM. Further genomic analysis revealed polyphosphate-related genes.

[0068] Example 5

[0069] Bacterial protein content verification experiment: FCS5 was cultured in MJH culture medium until OD600 = 0.2. The bacterial cells were collected and the protein content in the bacterial cells was determined by Kjeldahl method. The protein content was determined to be 61.4%.

[0070] Vitamin production function verification experiment: FCS5 was cultured in MJH culture medium without vitamin solution. After culturing to OD600=0.2, the bacterial cells were collected and the metabolomics method was used to detect the types and yields of vitamins produced (see Table 1).

[0071] Table 1. Vitamins detected in strain FCS5. DCW refers to stem cell weight.

[0072]

Claims

1. A psychrophilic Sulfococcus sp. of the deep sea, characterized in that: The strain is Sulfurimonas iocasae FCS5 preserved in China General Microbiological Culture Collection Center, and the preservation number is CGMCC No. 46387.

2. Use of Psychroflexus profundus according to claim 1, characterized in that: Application of the strain in environmental carbon fixation using carbon dioxide.

3. Use of Psychroflexus profundus according to claim 1, characterized in that: Application of the strain in denitrification and / or dephosphorization in the environment.

4. Use of Psychroflexus profundus according to claim 1, characterized in that: Application of the strain in degrading nitrogen and phosphorus pollutants in the environment.

5. The use of Psychroflexus profundus according to claim 4, characterized in that: Application of the strain in degrading nitrogen and phosphorus pollutants in low-temperature sewage or soil.

6. Use of the Psychrosohna profundus of claim 1, characterized in that: Application of the strain in producing biological products.

7. Use of Psychroflexus profundus according to claim 6, characterized in that: Application of the strain in preparing proteins and vitamins.

Images