AnaCas9 mutant as well as gene editing system and application thereof
By modifying the amino acid sequence and guide RNA of the AnaCas9 mutant, the problem of low gene editing efficiency of the CRISPR/Cas9 system in mammalian cells and yeast was solved, achieving more efficient gene editing results.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- SUN YAT SEN UNIV
- Filing Date
- 2026-01-23
- Publication Date
- 2026-05-12
AI Technical Summary
In existing CRISPR/Cas9 systems, the large size and complex PAM sequences of SpCas9 and SaCas9 limit their application in gene editing, especially their low efficiency in mammalian cells and yeast.
A mutant of AnaCas9 was developed, which, through modification of the amino acid sequence, forms a CRISPR complex that binds to the guide RNA and recognizes the 5'-NNRGNN-3' PAM sequence, thereby improving gene editing efficiency. This mutant is applicable to prokaryotes and eukaryotes, and is particularly effective in mammalian cells and yeast.
The AnaCas9 mutant exhibits significantly improved gene editing efficiency in mammalian cells and yeast, enabling broader application prospects.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention relates to an AnaCas9 mutant, its gene editing system, and its applications, and relates to the field of biotechnology. Background Technology
[0002] Since its development as a gene-editing tool, the CRISPR / Cas9 system has demonstrated excellent performance in scientific and clinical research, becoming the most widely used gene-editing tool. CRISPR / Cas9, as a gene-editing tool, requires only the Cas9 protein and its corresponding guide RNA (gRNA) to target specific locations in the DNA sequence, offering advantages such as simplicity, efficiency, and high specificity. Currently, the most studied and widely used Cas9 proteins include Streptococcus pyogenes (SpCas9) and Staphylococcus aureus (SaCas9). However, the large size of spCas9 and the complex PAM sequence of SaCas9 limit their application. Identifying novel Cas9 proteins with smaller size and simpler PAM sequences would be beneficial for gene-editing work in scientific research. Summary of the Invention
[0003] To address the aforementioned issues, this invention provides an AnaCas9 mutant. Compared to the wild-type AnaCas9 protein, the AnaCas9 mutant provided by this invention exhibits significantly enhanced gene editing activity and can be widely applied to gene editing in prokaryotes and eukaryotes, especially in mammalian cells (including human cells) and yeast, where it can achieve highly efficient gene editing.
[0004] This invention provides an AnaCas9 mutant that, compared to the wild-type Cas9 protein, includes amino acid differences at at least one of the following sites: E44, E95, N97, N101, E134, E137, D138, D139, D142, E143, E145, D186, D193, D194, D195, E196, D249, D252, A344, E345, E348. E349, H426, G428, N432, N459, E471, E482, D484, Q877, S878, D888, D895, E897, D898, E910, D914, K916, D928, K930, L936, K976, E979, E980, I992, K993, A994, V1006, D1009, L1012, D1015 or D1016; The amino acid sequence of the wild-type Cas9 protein is shown in SEQ ID NO:1.
[0005] In one embodiment, the amino acid sequence of the AnaCas9 mutant includes a sequence having at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, at least 99.9%, or 100% sequence identity with SEQ ID NO: 1.
[0006] In a specific embodiment of the present invention, the amino acid difference is that the amino acid at the site is replaced by any other amino acid, or the amino acid at the site is absent.
[0007] In a specific embodiment of the present invention, the amino acid sequence of the AnaCas9 mutant has at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, at least 99.9%, or 100% sequence identity with SEQ ID NO: 1.
[0008] In one embodiment, the AnaCas9 mutant has amino acid differences at at least one of the following sites: E44K, E44Q, E95K, E95G, N97K, N97A, N101K, N101A, E134K, E134G, E137Q, D138K, D138N, D138G, D139K, D139G, D142K, D142N, E143K, E143Q, E143G, E145K, E145Q, E145G, D186N, D193K, D193G, D194G, D195K, D195N, E196K, E196G, D249K, D249G, D252K, D252N, D252G, A344K, E3 45Q, E348K, E349Q, E349G, H426K, G428K, N432K, N459K, E471Q, E482K, D484N, Q8 77K, S878K, D888K, D895K, D895N, D895G, E897K, E897Q, E897G, D898K, D898N, E9 10Q, D914N, K916R, D928K, K930R, L936N, K976R, E979K, E979Q, E980K, I992K, K993R, A994S, V1006K, D1009N, L1012K, D1015K, D1015N, D1015G, D1016N or D1016G.
[0009] In one embodiment, the AnaCas9 mutant has amino acid differences at at least one of the following sites: E44Q, E145G, D193K, D195K, D895K, D914N, D1016G, D895N, E897Q, D898N, D1015K, D1015N, or D1015G.
[0010] In some embodiments of the present invention, the AnaCas9 mutant can form a CRISPR complex with a guide RNA (gRNA). In some embodiments of the present invention, the AnaCas9 mutant can form a CRISPR complex with a guide RNA (gRNA) that directs the CRISPR complex to bind specifically to a target sequence. In some embodiments of the present invention, the AnaCas9 mutant can form a CRISPR complex with a guide RNA (gRNA) containing a guide sequence engineered to direct the CRISPR complex to bind specifically to the target sequence. In some embodiments of the present invention, the AnaCas9 mutant can form a CRISPR complex with a guide RNA (gRNA) that directs the CRISPR complex to bind specifically to and cleave the target sequence. Optionally, the target sequence is double-stranded DNA; optionally, the cleavage target sequence cleaves only one single strand of the double-stranded DNA, or the cleavage target sequence cleaves both single strands of the double-stranded DNA. In some embodiments of the present invention, the AnaCas9 mutant can form a CRISPR complex with a guide RNA (gRNA), the guide RNA (gRNA) directing the CRISPR complex sequence to specifically bind to a target sequence and causing the target sequence to be cleaved by a double-strand break.
[0011] In a specific embodiment of the present invention, the gene editing efficiency of the AnaCas9 mutant is at least 10% higher than that of the Cas9 protein with the sequence SEQ ID NO: 1. In a specific embodiment of the present invention, the gene editing efficiency of the AnaCas9 mutant is at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 100%, at least 110%, at least 120%, at least 150%, at least 180%, or at least 200% higher than that of the Cas9 protein with the sequence SEQ ID NO: 1.
[0012] In a specific embodiment of the present invention, the gene editing efficiency is the efficiency of introducing indels. The gene editing efficiency can be tested using conventional methods in the art.
[0013] The present invention also provides a guide RNA that forms a CRISPR complex by binding with the AnaCas9 mutant, thereby guiding the CRISPR complex to specifically bind to a target sequence; the guide RNA includes a guide sequence and a backbone sequence, the backbone sequence being obtained by modifying the sequence shown in SEQ ID NO: 5, the modification including truncation and / or mutation, and the backbone sequence being any one of SEQ ID NO: 6-22.
[0014] In one embodiment, the skeleton sequence is as shown in any of SEQ ID NO:6, 8, 9, 10, 12, 13, 18, 19, 21, 22.
[0015] In one embodiment, the modification includes: Modification (1): The first stem-loop structure from the 5' end to the 3' end of the sequence shown in SEQ ID NO: 5 is shortened; And / or modification (2): Delete the last stem-loop structure from the 5' end to the 3' end of the sequence shown in SEQ ID NO: 5; The skeleton sequences are as follows: SEQ ID NO:8, 10, 21, 22.
[0016] The first stem-loop structure at the 5' end of the sequence shown in SEQ ID NO: 5 is truncated, as follows: Figure 5 As shown in A; the sequence shown in SEQ ID NO: 8 is obtained from this, as follows. Figure 5 As shown in the pink box of A; the last stem-loop structure at the 3' end of the sequence shown in SEQ ID NO: 5 is deleted, as follows: Figure 5 As shown in A; the sequence shown in SEQ ID NO: 10 is obtained from this, as follows. Figure 5 As shown in the green box of A, SEQ ID NO: 21 and 22 are obtained by further modifications based on modifications (1) and (2).
[0017] In a specific embodiment of the present invention, the backbone sequence comprises a direct repeat sequence (DR) and a tracrRNA sequence (full name: Trans-activating CRISPR RNA).
[0018] The present invention also provides a CRISPR-Cas9 system, which includes: a Cas9 protein and the guide RNA; the guide RNA binds to the Cas9 protein to form a CRISPR complex, and guides the CRISPR complex to specifically bind to a target sequence; The Cas9 protein includes: the AnaCas9 mutant, a synthetic Cas9 protein containing the amino acid sequence of the AnaCas9 mutant, a fusion protein or conjugate; the fusion protein or conjugate includes the AnaCas9 mutant linked to a homologous or heterologous functional domain.
[0019] The amino acid sequence of the AnaCas9 mutant in the above-mentioned synthetic Cas9 protein can be obtained by mutating the wild-type Cas9 protein, or by other artificial synthesis methods (such as chemical synthesis, biosynthesis, and semi-synthesis).
[0020] In a specific embodiment of the present invention, the target sequence is dsDNA.
[0021] In a specific embodiment of the present invention, the guide sequence comprises 15-35 nucleotides, and / or the guide sequence hybridizes with the target sequence, wherein the guide sequence and the target sequence are 90%-100% complementary, and preferably the mismatch does not exceed one nucleotide.
[0022] The present invention also discloses a fusion protein or conjugate comprising the AnaCas9 mutant linked to a homologous or heterologous functional domain.
[0023] The homologous or heterologous functional domains are selected from one or more of the following: subcellular localization signals, DNA-binding domains, protein targeting moieties, transcriptional activation domains, transcriptional repression domains, nucleases, base editing domains such as deaminase domains, methyltransferases, demethylases, transcriptional releasing factors, histone deacetylases, polypeptides with ssDNA cleavage activity, polypeptides with dsDNA cleavage activity, DNA ligases, epitope tags, reporter proteins, and detection markers. In specific embodiments of the present invention, the homologous or heterologous functional domains are selected from one or more of the following: subcellular localization signals, DNA-binding domains, protein targeting moieties, transcriptional activation domains, transcriptional repression domains, nucleases, deaminase domains, methyltransferases, demethylases, transcriptional releasing factors, histone deacetylases, DNA ligases, epitope tags, reporter proteins, and detection markers.
[0024] Optionally, the fusion protein or conjugate can recognize PAM with the sequence 5'-NNRGNN-3', where R is A or G and N is A, G, C or T.
[0025] The present invention also provides an expression gene that encodes the AnaCas9 mutant, the guide RNA, or the Cas9 protein in the CRISPR-Cas9 system.
[0026] In a specific embodiment of the present invention, the expressed gene is codon-optimized for expression in eukaryotes, mammals such as humans, or non-human mammals.
[0027] The present invention also provides an expression vector comprising the CRISPR-Cas9 system or the expressed gene.
[0028] In a specific embodiment of the present invention, the expression vector further comprises a regulatory sequence.
[0029] In a specific embodiment of the present invention, the regulatory sequence comprises one or more selected from: promoters, enhancers, internal ribosome entry sites, and transcription termination signals; the promoter is, for example, a constitutive promoter, an inducible promoter, a broad-spectrum promoter, or a tissue-specific promoter, and / or, the transcription termination signal is, for example, a polyadenylation signal or a polyU sequence.
[0030] In a specific embodiment of the present invention, the regulatory sequence is operatively linked to the vector.
[0031] The present invention also provides the use of the AnaCas9 mutant, the guide RNA, the Cas9 protein in the CRISPR-Cas9 system, the CRISPR-Cas9 system, the expression gene, or the expression vector in recombinant cells, pharmaceutical compositions, or kits.
[0032] The present invention also provides the use of the Cas9 protein as described in the present invention, the fusion protein or conjugate as described in the present invention, the isolated nucleic acid as described in the present invention, the CRISPR-Cas9 system as described in the present invention, the vector system as described in the present invention, the cell as described in the present invention, the pharmaceutical composition as described in the present invention, or the kit as described in the present invention in the preparation of reagents or pharmaceuticals for the diagnosis, treatment, and / or prevention of diseases or conditions related to the target sequence.
[0033] The present invention also provides a recombinant cell comprising the AnaCas9 mutant, a fusion protein or conjugate in the CRISPR-Cas9 system, the expression gene, the CRISPR-Cas9 system, or the expression vector.
[0034] In a specific embodiment of the present invention, the recombinant cells are eukaryotic cells and prokaryotic cells.
[0035] In a specific embodiment of the present invention, the eukaryotic cells are mammalian cells and Max Kluyveromycetes cells.
[0036] This invention also provides the application of the CRISPR-Cas9 system in gene editing of mammalian cells and / or yeast cells.
[0037] A pharmaceutical composition comprising the AnaCas9 mutant, a fusion protein or conjugate in the CRISPR-Cas9 system, the expressed gene, the CRISPR-Cas9 system, the expression vector, or the recombinant cell.
[0038] In a specific embodiment of the present invention, the pharmaceutical composition comprises pharmaceutically acceptable excipients.
[0039] A kit comprising the AnaCas9 mutant, a fusion protein or conjugate in the CRISPR-Cas9 system, the expression gene, the CRISPR-Cas9 system, the expression vector, or the recombinant cell.
[0040] One technical solution provided by this invention is the application of the Cas9 protein, fusion protein or conjugate, expression gene, CRISPR-Cas9 system, vector system, cell, pharmaceutical composition, or kit as described in this invention, in any of the following: The ability to cleave or create nicks in one or more target nucleic acid molecules, upregulate the expression of one or more target nucleic acid molecules, downregulate the expression of one or more target nucleic acid molecules, visualize, label or detect one or more target nucleic acid molecules, bind to one or more target nucleic acid molecules, transport one or more target nucleic acid molecules, and mask one or more target nucleic acid molecules.
[0041] One technical solution provided by this invention is the application of the Cas9 protein, fusion protein or conjugate, expression gene, CRISPR-Cas9 system, vector system, cell, pharmaceutical composition, or kit as described in this invention, in any of the following: Upregulate the expression levels of one or more target nucleic acid molecules, downregulate the expression levels of one or more target nucleic acid molecules, and detect the expression levels of one or more target nucleic acid molecules.
[0042] One technical solution provided by the present invention is: a method for detecting, binding, or cleaving a target sequence, the method comprising contacting the target sequence with a Cas9 protein, a fusion protein or conjugate, an expression gene, a CRISPR-Cas9 system, a vector system, a delivery system, a cell, a pharmaceutical composition, or a kit as described in the present invention.
[0043] Compared with the prior art, the present invention has the following beneficial effects: This invention provides an AnaCas9 mutant, its gene editing system, and its applications. This AnaCas9 mutant can be used with the CRISPR / Cas system to achieve gene editing while maintaining its small size and relatively simple PAM sequence. By modifying the gRNA and the Cas9 protein itself, this invention improves editing efficiency. This AnaCas9 mutant can be widely used for gene editing in prokaryotes and eukaryotes, especially in mammalian cells (such as human cells) and yeast, achieving highly efficient gene editing and showing broad application prospects. Attached Figure Description
[0044] Figure 1 This is a schematic diagram of the AnaCas9 structure and its PAM sequence; among which... Figure 1 A represents the genome structure and protein domain information of AnaCas9-related CRISPR / Cas sites; Figure 1 B is the PAM sequence of AnaCas9; Figure 2 For the detection of AnaCas9's in vitro double-stranded DNA cleavage activity; among which, Figure 2 Figure A shows the results of AnaCas9 protein expression and purification in prokaryotes. Figure 2 B shows the results of AnaCas9's in vitro double-stranded DNA cleavage activity. Figure 3 This is due to AnaCas9 E. coli genome interference; among which, Figure 3 A is a schematic diagram of the AnaCas9 E. coli genome interference scheme. Figure 3 B shows the result of AnaCas9 targeting the E. coli genome and causing its death; Figure 4 As a schematic diagram of the reporter system, the target site that AnaCas9 can recognize is inserted before the start codon of the GFP protein, causing a frameshift mutation. When AnaCas9 can recognize and cleave the target site, the broken double-stranded DNA can be repaired in the cell and restore the correct reading frame of the GFP protein, thereby emitting fluorescence. Figure 5 Modification of gRNA; among which, Figure 5 A is a schematic diagram of gRNA modification. Different colored boxes represent the deletion of gRNA fragments or point mutations, and the numbers on the boxes represent different modification schemes. Figure 5 B shows the results of reporter cell detection of gRNA editing efficiency, with spCas9 used as a positive control. Figure 5 C represents the base sequence of the final version gRNA_v1; Figure 5D is a graph showing the results of gRNA_v1 editing efficiency against reporter genes and endogenous sites on the genome. V0 in the graph is the gRNA containing the backbone sequence shown in SEQ ID NO: 5. Figure 6 For screening mutants; among which, Figure 6 A represents the proportion of GFP-positive cells in the reporter cell line; Figure 6 B represents the editing efficiency of the mutant at the HBD-g1 and AAVS1-g4 sites in the genome; Figure 6 C represents the editing efficiency of some mutants at the EMX1-g3 and EMX1-g4 sites in the genome; Figure 7 Gene editing for *Kluyveromyces maximus*; among which, Figure 7 A is a schematic diagram of the structure of the AnaCas9-gRNA co-expression plasmid in yeast; Figure 7 B indicates that after successful ADE2 knockout, *Kluyveromyces maculae* appears pink on YPD plates; Figure 7 C represents the genotype detected by Sanger sequencing (the shaded area represents the PAM sequence). Detailed Implementation
[0045] To facilitate understanding of the present invention, a more complete description will be given below with reference to the accompanying drawings. Preferred embodiments of the invention are shown in the drawings. However, the invention can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a thorough and complete understanding of the disclosure of the invention.
[0046] Unless otherwise specified, all reagents, materials, and equipment used in this embodiment are commercially available; unless otherwise specified, all test methods are conventional test methods in this field.
[0047] The CRISPR / Cas system, as an acquired immune system in bacteria and archaea, can recognize and effectively eliminate exogenous nucleic acids. Gene editing tools developed based on the CRISPR / Cas system have played a significant role in gene editing in various organisms. A CRISPR system consists of a CRISPR array and corresponding Cas proteins. Based on the number of effector proteins, CRISPR / Cas systems can be divided into two categories. The second category of CRISPR / Cas systems requires only one effector protein and has therefore received widespread attention; the CRISPR / Cas9 system is one of the most extensively studied. The CRISPR / Cas9 system relies not only on the guide sequence on the gRNA to recognize the target sequence but also on the recognition of protospacer-jacent motifs (PAMs). Different Cas9 proteins recognize different PAM sequences, and simpler PAMs allow Cas9 to have a wider editing range. Based on size, Cas9 proteins can be mainly divided into two categories: those with 1000 amino acids and those with 1400 amino acids. The most widely used spCas9 belongs to the larger category. The large size of Cas9 limits its application in certain scenarios. For example, its large size prevents it from being directly packaged as an AAV virus. Although studies have found that dual AAV delivery can be used by splitting the Cas9 protein, the dual AAV approach requires that the two AAV viruses enter the same cell, which limits its editing efficiency. Smaller Cas9s can be directly packaged, avoiding the disadvantages of dual AAV delivery.
[0048] This invention modifies the wild-type small Cas9 protein to obtain the AnaCas9 mutant and the gene editing system built upon it. The wild-type small Cas9 protein (named AnaCas9 nuclease) is only 1046 amino acids in size, with the amino acid sequence shown in SEQ ID NO: 1. It can recognize the 5'-NNRGNN-3' PAM sequence. The gene editing system built based on the AnaCas9 mutant can be applied to gene editing in eukaryotes in addition to prokaryotes, especially in mammalian cells (such as human cells) and yeast, where it can achieve highly efficient gene editing effects. While some studies have previously applied Cas9 protein to prokaryotic cells, eukaryotic cells (such as mammalian cells) have more complex chromosome structures than prokaryotic cells (such as E. coli), and the concentration of magnesium ions, which is crucial for Cas9 activity, is also lower in mammalian cells. Therefore, the fact that Cas9 protein can achieve good gene editing effects in prokaryotic cells does not equate to achieving good gene editing effects in eukaryotic cells. On the contrary, it is more difficult to overcome the challenges of achieving good gene editing effects of Cas9 protein in eukaryotic cells.
[0049] This invention mainly studies the activity of AnaCas9 and modifies AnaCas9 to improve its editing efficiency through the following aspects: AnaCas9 protein was obtained through prokaryotic expression. After co-incubation with gRNA, the nuclease activity of AnaCas9 in cleaving double-stranded DNA was verified in vitro. Co-expression of AnaCas9 and gRNA in *E. coli* achieved genomic interference in *E. coli*. Modification of gRNA improved AnaCas9 editing efficiency. Amino acid mutations in AnaCas9 further enhanced its editing efficiency. AnaCas9 mutants can be widely used for gene editing in prokaryotes and eukaryotes, especially in mammalian cells (such as human cells) and yeast, achieving highly efficient gene editing.
[0050] In this invention, unless otherwise stated, the scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. The terminology used herein in the specification of this invention is for the purpose of describing particular embodiments only and is not intended to limit the invention. The term "and / or" as used herein includes any and all combinations of one or more of the associated listed items. Furthermore, the procedures used herein, such as molecular genetics, nucleic acid chemistry, chemistry, molecular biology, biochemistry, cell culture, microbiology, cell biology, genomics, and recombinant DNA, are all conventional procedures widely used in their respective fields. Meanwhile, to better understand this invention, definitions and explanations of relevant terms are provided below.
[0051] In this invention, "more" can refer to ≥2 or ≥3, depending on the context.
[0052] In this invention, the letters in the amino acid sequence represent single-letter abbreviations of amino acids known in the art, such as those described in J. Biol. Chem, 243, p3558 (1968): alanine: Ala-A, arginine: Arg-R, aspartic acid: Asp-D, cysteine: Cys-C, glutamine: Gln-Q, glutamic acid: Glu-E, histidine: His-H, glycine: Gly-G, asparagine: Asn-N, tyrosine: Tyr-Y, proline: Pro-P, serine: Ser-S, methionine: Met-M, lysine: Lys-K, valine: Val-V, isoleucine: Ile-I, phenylalanine: Phe-F, leucine: Leu-L, tryptophan: Trp-W, threonine: Thr-T.
[0053] In this invention, "comprising or being" or "including or being" means that the technical solution has both open-ended and closed-ended expressions.
[0054] In this invention, "amino acid difference" refers to the difference of amino acid residues at specific sites on the amino acid sequence of a protein, including substitution, addition, or reduction.
[0055] As used herein, the term "guide RNA" refers to the molecule in a CRISPR-Cas system that forms a CRISPR complex with the Cas protein and guides the CRISPR complex to the target sequence. Typically, guide RNA contains a backbone sequence linked to a guide sequence that can hybridize with the target sequence. The backbone sequence usually contains a direct repeat sequence and sometimes also contains a tracrRNA sequence, which is required in the Cas9-based CRISPR system described in this invention.
[0056] Guide RNA, directing RNA, directing polynucleotide, gRNA, and sgRNA can be used interchangeably.
[0057] The guiding sequence and the initiating sequence can be used interchangeably.
[0058] In some embodiments, the guide RNA is a chemically modified guide RNA. In some embodiments, the guide RNA comprises at least one chemically modified nucleotide. In some embodiments, the functional domain is optionally selected from one or more of the following: DNA-binding domain, protease domain, transcription activation domain, transcription repression domain, nuclease domain (including polypeptides with ssDNA cleavage activity and / or polypeptides with dsDNA cleavage activity), deaminase domain, uracil DNA glycosylase domain (UDG), uracil DNA glycosylase repression domain (UGI), methylase, demethylase, transcription release factor, histone acetylase domain, histone deacetylase domain, DNA ligase, epitope tag, and reporter domain. In some embodiments, the Cas9 protein may optionally contain 0, 1, 2, 3, or more functional domains at its N-terminus and / or C-terminus. In some embodiments, the Cas9 protein is fused with at least one homologous or heterologous subcellular localization signal. Exemplary subcellular localization signals include organelle localization signals, such as nuclear localization signals (NLS), nuclear export signals (NES), or mitochondrial localization signals. In some embodiments, the functional domain is a nuclear localization signal (NLS), nuclear export signal (NES), or mitochondrial localization signal. In some embodiments, the cell may be eukaryotic or prokaryotic. Examples of such cells include, but are not limited to, bacterial, archaea, plant, fungal, yeast, insect, and mammalian cells, such as Lactobacillus, Lactococcus, Bacillus (e.g., Bacillus subtilis), Escherichia coli (e.g., Escherichia coli), Clostridium, Yeast, or Pichia pastoris (e.g., Saccharomyces cerevisiae or Pichia pastoris), Kluyveromyces lactis, Salmonella typhimurium, Drosophila cells, Caenorhabditis elegans cells, Xenopus laevis cells, SF9 cells, C129 cells, 293 cells, Neurospora, and immortalized mammalian cell lines (e.g., HeLa cells, bone marrow cell lines, and lymphoid cell lines). In some embodiments, the cells are primary eukaryotic cells, stem cells, tumor / cancer cells, circulating tumor cells (CTCs), blood cells (e.g., T cells, B cells, NK cells, Tregs, etc.), hematopoietic stem cells, specialized immune cells (e.g., tumor-infiltrating lymphocytes or tumor suppressor lymphocytes), and stromal cells in the tumor microenvironment (e.g., cancer-associated fibroblasts, etc.). In some embodiments, the cells are brain or neuronal cells of the central or peripheral nervous system (e.g., neurons, astrocytes, microglia, retinal ganglion cells, rod / cone cells, etc.).
[0059] The present invention will be further described below with reference to the embodiments. The following embodiments are intended to illustrate the present invention and not to further limit the present invention, and should not be used to limit the scope of protection of the present invention.
[0060] Example 1: Identification of AnaCas9PAM and Determination of its In Vitro Cleavage Activity The length of Cas9 proteins varies among different species, with most Cas9 proteins being approximately 1000 or 1400 amino acids in length. Cas9 proteins of approximately 1000 amino acids in length have a unique clinical advantage because they can be directly packaged with AAV viruses. We searched the National Center for Biotechnology Information (NCBI) website (https: / / www.ncbi.nlm.nih.gov) for Cas9 proteins and found Cas9 proteins from uncultured anaerobic Vibrio bacteria, which are only 1046 amino acids in size, meeting the requirements for direct co-packaging with gRNA for AAV viruses. We then analyzed their CRISPR locus (…). Figure 1
[0061] Further analysis of the 3' end sequence of the locus yielded the crRNA sequence of this system (SEQ ID NO: 3), which is 36 bp long and located downstream of the Cas9 gene. By aligning the crRNA sequence with the locus sequence, the corresponding tracrRNA sequence (SEQ ID NO: 4) was obtained, which is 126 bp long and located upstream of the Cas9 gene.
[0062] The two were ligated using a 5'-GAAA-3' linker to form a gRNA, the sequence of which is (SEQ ID NO: 5): NNNNNNNNNNNNNNNNNNNNNNNNGTTTTAGTTCTATGTTGGATATTGATAAACTGATAC GAAA TTGTCAGTTTATCAATATCCAACAATAGTTCTAAGATAAGGCCTTATGTGCCGTAGGGTATAGCGGTATCCCGAACAATTCCGCTGCTTTGAGTATTAAGCTGCTACATCATGTAGCAGCTTTTTT. Where NNNNNNNNNNNNNNNNNNNNNNNNNN represents a 24nt guide sequence, N is A, G, C, or T, and the underlined part is the 5'-GAAA-3' linker.
[0063] Further identification of its PAM sequence was performed. First, human codon preference optimization was performed on AnaCas9. The optimized sequence (SEQ ID NO: 2) was modified by adding a BamHI restriction site and a nuclear localization sequence (NLS) to the N-terminus, and adding an SV40 NLS sequence, nucleoplasmin NLS, and XhoI restriction site to the C-terminus for subsequent use. Then, the obtained sequence and pET-28a plasmid were double-digested with BamHI and XhoI, respectively, and ligated using T4 DNA ligase to obtain the prokaryotic expression vector pET-28a-AnaCas9 (SEQ ID NO: 40). This vector was transformed into *E. coli* Rosetta(DE3) competent cells for prokaryotic expression and purified using nickel affinity chromatography to obtain the AnaCas9 protein. Figure 2A). Using the gRNA backbone as a template, the in vitro transcription template of ITIH5-gRNA1 was obtained by amplification with primers T7-ITIH5-g1-F (5'-TAATACGACTCACTATAGCAACGGCTCGGAGATCATCATTGCGTTTTAGTTCTATGTTG-3'SEQ ID NO: 31) and gRNA-R (5'-AAAAAAGCTGCTACATGATGTAGCAGC-3'SEQ ID NO: 32), and then in vitro transcription was performed using the Invitrogen™ MEGAshortscript™ T7 in vitro transcription kit. A random PAM library fragment containing the ITIH5 gene target sequence 5'-CAACGGCTCGGAGATCATCATTGCNNNNNNN-3' (SEQ ID NO: 23) (NNNNNNN is the PAM sequence, N is A, G, C, or T) was obtained by PCR amplification. The library fragment was then digested in vitro using the aforementioned AnaCas9 protein and gRNA. Biotin adapters were added to the digested fragments, and the fragments were recovered using streptavidin magnetic beads. The recovered fragments were then subjected to NGS sequencing. The NGS sequencing results were analyzed, and a WebLogo diagram was created.
[0064] The results showed that AnaCas9 could recognize the PAM sequence 5'-NNRGNN-3' ( Figure 1 B), where R is A or G, and N is A, G, C, or T.
[0065] Furthermore, we selected two target sites on the HEK 293T cell genome for in vitro cleavage experiments, namely GLI1-g1 (5'-CCCACCCATTCCACAGGGCAGCTCAAGGCTC-3'SEQ ID NO: 24) and HBD-g1 (5'-CTGCCTACCTCTTCTCCGCAGCTCTTGGGCA-3', SEQ ID NO: 25). Using HEK 293T cell genomic DNA as templates, in vitro cleavage templates containing the corresponding target sites were amplified using primer pairs GLI1-F (5'-GGTCCACCCACCAACTATGG-3', SEQ ID NO: 33) and GLI1-R (5'-GTTCACTGGAGCTTTAGCACG-3', SEQ ID NO: 34), and HBD-F (5'-GGGCAGAAGTCGTTGCTAGG-3', SEQ ID NO: 35) and HBD-R (5'-ATGCCTTGTACGGTTCCCTT-3', SEQ ID NO: 36). Following the same steps, gRNAs of GLI1-g1 and HBD-g1 were obtained through in vitro transcription and in vitro cleavage experiments were performed.
[0066] The results showed that at the two selected sites, the DNA template could be cleaved when AnaCas9 and the corresponding gRNA were co-present. Figure 2 B). These results demonstrate that AnaCas9 possesses nuclease activity that recognizes the 5'-NNRGNN-3' PAM sequence under gRNA guidance and cleaves double-stranded DNA in vitro.
[0067] Example 2: AnaCas9 has genome targeting capability in prokaryotic cells This invention further verifies the activity of AnaCas9 in prokaryotic cells.
[0068] Because *E. coli* lacks non-homologous end joining repair, genomic DNA breaks cannot be repaired in time without a homologous recombination repair template, leading to *E. coli* death. Therefore, when we express AnaCas9 and its corresponding gRNA in *E. coli*, we can assess the activity of AnaCas9 in *E. coli* by observing the growth status of the bacteria.
[0069] In this embodiment, taking Escherichia coli as an example, the pET-28a-AnaCas9 prokaryotic expression plasmid constructed above was transformed into Escherichia coli Rosetta (DE3) competent cells, and then plated on kanamycin resistance plates. After successfully transformed clones were selected and cultured, competent cells were prepared for later use. Using the Lenti-gRNA-puro plasmid as a template, PCR amplification was performed to obtain a sequence containing the ampicillin resistance gene expression cassette and replication origin site as a backbone. Simultaneously, PCR amplification was performed to obtain the T7 promoter-driven AnaCas9 gRNA expression cassette (targeting the *E. coli* YidR gene, YidR-g1 (5'-AACTGGCATCCGTCAGGAGAATGGTTGGGCT-3', SEQ ID NO: 29)). The AnaCas9 gRNA expression plasmid pAmpR-T7-gRNA-YidR (SEQ ID NO: 41) was assembled using Gibson. The constructed pAmpR-T7-gRNA-YidR plasmid was used to transform the prepared competent cells. An ampicillin resistance gene expression plasmid without gRNA expression was used as a control. Transformed cells were serially diluted 10-fold, mixed, and dropped onto LB agar plates containing IPTG or without IPTG, but containing ampicillin and kanamycin. Figure 3 A), where kanamycin was used to screen AnaCas9 expression plasmids, ampicillin was used to screen gRNA expression plasmids, and IPTG was used to induce AnaCas9 expression. After drying in a clean bench, the plasmids were incubated overnight at 37°C.
[0070] The results showed that only the experimental group containing IPTG and transformed with an expression plasmid targeting E. coli YidRgRNA could not grow normally, indicating that the co-existence of AnaCas9 and gRNA can effectively cleave the E. coli genome. Figure 3 B).
[0071] Example 3: gRNA modification enhances the editing activity of AnaCas9 in mammalian cells To enhance the editing activity of AnaCas9, its gRNA was first modified. To facilitate the detection of changes in editing efficiency, a reporter system was constructed in HEK 293T cells. Using an existing lentiviral plasmid expressing green fluorescent protein (GFP) as a backbone, a sequence containing the HBD gene target (5'-TATCTGCCTACCTCTTCTCCGCAGCTCTTGGGCA-3', SEQ ID NO: 37) was inserted after the start codon (ATG) of GFP, resulting in the reporter plasmid pLenti-HBDGFP-puro (SEQ ID NO: 42). The inserted sequence was 34 bp long, causing a frameshift mutation in GFP, preventing the expression of green fluorescent protein. When AnaCas9 recognizes this target and cleaves it, the broken double-stranded DNA is repaired within the cell, restoring the correct reading frame and emitting fluorescence. The number of green fluorescent positive cells was used to assess the editing efficiency. Lentiviral cells were packaged using the constructed reporter plasmid, and HEK 239T cells were infected with the packaged lentivirus to obtain a stable reporter cell line. Figure 4 Using the px601 plasmid as a backbone, the original SaCas9 sequence was replaced with the codon-optimized AnaCas9 coding sequence (including the NLS sequences at both ends), and the original SaCas9 gRNA backbone was replaced with the AnaCas9 gRNA backbone, resulting in the mammalian cell co-expression plasmid px601-AnaCas9-gRNA (SEQ ID NO: 43).
[0072] Furthermore, by truncating or mutating, gRNA variants of V1-V15 were obtained (sequence numbers: SEQ ID NO: 6 - SEQ ID NO: 20). Figure 5 A) The modified gRNA variant with the HBD target guide sequence was constructed into the px601-AnaCas9-gRNA plasmid, and then transfected into a reporter cell line. Cells were harvested 3 days after transfection for flow cytometry analysis.
[0073] The results showed that truncating the first stem-loop structure (V3) and deleting the last stem-loop structure improved editing efficiency (V5), and combining the two mutations to obtain the V3 / 5 version gRNA (i.e., V3 / 5, SEQ ID NO: 21) further improved editing efficiency. Figure 5B). Since consecutive Ts in the DNA sequence will terminate transcription, we further referred to the gRNA modification scheme in spCas9 and obtained the final version of gRNA (gRNA_v1 (SEQ ID NO: 22), by mutating the 4th position of four consecutive Us in the gRNA backbone to C. For ease of description, subsequent experiments will be based on gRNA_v1, and for the sake of brevity, gRNA will refer to gRNA_v1) Figure 5 C).
[0074] The final version of the gRNA (gRNA_v1) was 71 bp shorter than the original gRNA (SEQ ID NO: 5). When used to edit reporter cells, it increased the proportion of positive cells from approximately 0.15% to approximately 4.07%, and improved the editing efficiency at the HBD-g1 site in the genome to approximately 7.6%. Figure 5 D).
[0075] All of the above SEQ ID NO: 6-22 are gRNAs without a guide sequence, that is, SEQ ID NO: 6-22 are all gRNA backbone sequences.
[0076] Example 4: Construction of AnaCas9 mutants to enhance editing activity in mammalian cells We further improved the editing efficiency of AnaCas9 by mutating it. Through structural prediction, we selected sites that interact with gRNA or target DNA, primarily aspartic acid and glutamate, because these two amino acids typically carry a negative charge under physiological conditions, which would affect the interaction between the Cas9 protein and gRNA or target DNA. Figure 6 A). Transform the px601-AnaCas9-gRNA expression plasmid with different AnaCas9 mutants into reporter cell lines.
[0077] Flow cytometry analysis showed that the constructed mutant effectively improved the editing efficiency of the HBD-g1 site on the reporter gene and increased the proportion of GFP-positive cells. Figure 6 A) indicates that the gene editing efficiency of these variants was improved after mutation.
[0078] The editing efficiency of endogenous sites on chromosomes was tested in a selection of mutants. The selected sites were HBD-g1 (5'-CTGCCTACCTCTTCTCCGCAGCTCTTGGGCA-3', SEQ ID NO: 25), AAVS1-g4 (5'-AACATGCTGTCCTGAAGTGGACATAGGGGCC-3', SEQ ID NO: 26), EMX1-g3 (5'-CCAGAGTCCAGCTTGGGCCCACGCAGGGGCC-3', SEQ ID NO: 27) and EMX1-g4 (5'-GGCCTGAGTCCGAGCAGAAGAAGAAGGGCTC-3', SEQ ID NO: 28).
[0079] The results showed that at the four selected endogenous sites, different mutants exhibited efficiency improvements of up to 2.16-fold, 1.25-fold, 1.49-fold, and 4.38-fold, respectively. This indicates that amino acid point mutations effectively improved the editing efficiency of AnaCas9.
[0080] Example 5: Application of AnaCas9 mutant in Kluyveromyces gene editing Furthermore, to expand the applications of AnaCas9, gene editing was performed in *Kluyveromyces martensii*. The ADE2 gene of *Kluyveromyces martensii* was selected as the target. The ADE2 gene is involved in the synthesis of adenine in yeast. When the adenine on the plate is depleted, the yeast will attempt to synthesize adenine through its own metabolism to meet its needs. When ADE2 is knocked out, adenine synthesis is blocked, but other metabolic genes in the pathway are normal, resulting in the accumulation of the intermediate product P-ribosylaminoimidazole (AIR) in the cells, which makes the colonies appear red. Therefore, it can effectively indicate the occurrence of knockout.
[0081] First, an AnaCas9 / gRNA co-expression plasmid targeting ADE2 was constructed. AnaCas9 (D895K mutant) expression was driven by the AaTEF1 promoter of *Bacillus yeast*, HH-gRNA-HDV expression was driven by the ScTDH3 promoter of *Saccharomyces cerevisiae*, and the hygromycin resistance gene HypR expression was driven by the AgTEF1 promoter of *Ashymexazol*, resulting in pUC-AnaCas9-gRNA-ADE2 (SEQ ID NO: 44). Figure 7 A), wherein the ADE2 gene target sequence is 5'-TTGCACTGAGTCTGGAACTCTAGCTGGGGCG-3', SEQ ID NO: 30.
[0082] The pUC-AnaCas9-gRNA-ADE2 plasmid carrying the AnaCas9 mutant was transformed into wild-type Kluyveromyces martensii using the lithium acetate transformation method. After transformation, the plasmid was plated on YPDS solid medium containing 300 μg / mL hygromycin B and incubated at 30°C. Results showed that red clones appeared on the solid medium on day 5 post-transformation. Figure 7 B). Colony PCR was performed using primer pairs ADE2-KO-F (5'-ATAGTGGAGGCCGCTCACAG-3', SEQ ID NO: 38) and ADE2-KO-R (5'-CCTTACCGTATAAGTACACAGATGC-3', SEQ ID NO: 39), followed by sequencing. The results showed that among the selected clones, there was a homozygous mutation with a single base insertion at position 3 downstream of the target site PAM sequence. Figure 7 C). This indicates that the AnaCas9 mutant can effectively perform gene editing in yeast and has good application prospects.
[0083] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.
[0084] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the protection scope of the present invention. Therefore, the protection scope of this invention patent should be determined by the appended claims.
Claims
1. An AnaCas9 mutant, characterized in that, This AnaCas9 mutant differs from the wild-type Cas9 protein in at least one of the following amino acid sites: E44, E95, N97, N101, E134, E137, D138, D139, D142, E143, E145, D186, D193, D194, D195, E196, D249, D252, A344, E345, E348, E349, H42.
6. G428, N432, N459, E471, E482, D484, Q877, S878, D888, D895, E897, D898, E910, D914, K916, D928, K930, L936, K976, E979, E980, I992, K993, A994, V1006, D1009, L1012, D1015 or D1016; The amino acid sequence of the wild-type Cas9 protein is shown in SEQ ID NO:
1.
2. The AnaCas9 mutant according to claim 1, characterized in that, The AnaCas9 mutant has amino acid differences at at least one of the following sites: E44K, E44Q, E95K, E95G, N97K, N97A, N101K, N101A, E134K, E134G, E137Q, D138K, D138N, D138G, D139K, D139G, D142K, D142N, E143K, E143Q, E143G, E145K, E145Q, E145G, D186N, D193K, D193G, D194G, D195K, D195N, E196K, E196G, D249K, D249G, D252K, D252N, D252G, A344K, E345Q, E 348K, E349Q, E349G, H426K, G428K, N432K, N459K, E471Q, E482K, D484N, Q877K , S878K, D888K, D895K, D895N, D895G, E897K, E897Q, E897G, D898K, D898N, E910 Q, D914N, K916R, D928K, K930R, L936N, K976R, E979K, E979Q, E980K, I992K, K99 3R, A994S, V1006K, D1009N, L1012K, D1015K, D1015N, D1015G, D1016N or D1016G.
3. The AnaCas9 mutant according to claim 2, characterized in that, The AnaCas9 mutant has amino acid differences at at least one of the following sites: E44Q, E145G, D193K, D195K, D895K, D914N, D1016G, D895N, E897Q, D898N, D1015K, D1015N, or D1015G.
4. A guide RNA, characterized in that, The guide RNA forms a CRISPR complex by binding with the AnaCas9 mutant of any one of claims 1-3, and guides the CRISPR complex to specifically bind to the target sequence; the guide RNA includes a guide sequence and a backbone sequence, the backbone sequence being obtained by modifying the sequence shown in SEQ ID NO: 5, the modification including truncation and / or mutation, the backbone sequence being as shown in any one of SEQ ID NO: 6-22.
5. The guide RNA according to claim 4, characterized in that, The skeleton sequence is shown in any one of SEQ ID NO:6, 8, 9, 10, 12, 13, 18, 19, 21, 22.
6. The guide RNA according to claim 5, characterized in that, The modifications include: Modification (1): The first stem-loop structure from the 5' end to the 3' end of the sequence shown in SEQ ID NO: 5 is shortened; And / or modification (2): Delete the last stem-loop structure from the 5' end to the 3' end of the sequence shown in SEQ ID NO: 5; The skeleton sequences are as follows: SEQ ID NO:8, 10, 21, 22.
7. A CRISPR-Cas9 system, characterized in that, The CRISPR-Cas9 system comprises: a Cas9 protein and a guide RNA according to any one of claims 4-6; the guide RNA binds to the Cas9 protein to form a CRISPR complex, guiding the CRISPR complex to specifically bind to a target sequence. The Cas9 protein includes: a fusion protein, a conjugate, a synthetic Cas9 protein containing the amino acid sequence of the AnaCas9 mutant according to any one of claims 1-3, or the AnaCas9 mutant according to any one of claims 1-3; the fusion protein or conjugate includes the AnaCas9 mutant linked to a homologous functional domain or a heterologous functional domain.
8. An expression gene encoding an AnaCas9 mutant as described in any one of claims 1-3, a guide RNA as described in any one of claims 4-6, or the Cas9 protein in the CRISPR-Cas9 system as described in claim 7.
9. An expression carrier, characterized in that, The expression vector includes the CRISPR-Cas9 system of claim 7, or the expression gene of claim 8.
10. A recombinant cell, characterized in that, The recombinant cell comprises the AnaCas9 mutant of any one of claims 1-3, the guide RNA of any one of claims 4-6, the Cas9 protein in the CRISPR-Cas9 system of claim 7, the CRISPR-Cas9 system of claim 7, the expression gene of claim 8, or the expression vector of claim 9.
11. The use of the AnaCas9 mutant of any one of claims 1-3, the guide RNA of any one of claims 4-6, the Cas9 protein in the CRISPR-Cas9 system of claim 7, the CRISPR-Cas9 system of claim 7, the expression gene of claim 8, or the expression vector of claim 9 in recombinant cells, pharmaceutical compositions, or kits.