Genetically engineered bacteria, preparation method thereof and application thereof
Patent Information
- Application Number
- CN202610553534.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2026-04-24
- Publication Date
- 2026-08-28
- Estimated Expiration
- 2046-04-24
AI Technical Summary
[0006]本申请的主要目的在于提供一种基因工程菌、其制备方法及其应用,以解决现有技术中地衣芽孢杆菌2709转化效率低的问题
[0018] By applying the technical solution of this application, the genetically engineered bacteria obtained by knocking out any one or more of the following genes of Bacillus licheniformis 2709: Dmm1 (nucleotide sequence SEQ ID NO: 1), Dmm2 (nucleotide sequence SEQ ID NO: 2), Dcm1 (nucleotide sequence SEQ ID NO: 3), Dcm2 (nucleotide sequence SEQ ID NO: 4), and ngoF (nucleotide sequence SEQ ID NO: 5) can be efficiently transformed into exogenous plasmids (e.g., pjoe8999, PMA5, or phy300).
Smart Images

Figure CN122081369B_ABST
Abstract
Description
Technical Field
[0001] This application relates to the field of genetically engineered bacteria technology, and more specifically, to a genetically engineered bacterium, its preparation method, and its application. Background Technology
[0002] With the development of genetic engineering, it has become possible to explore biological resources from a wider range of Bacillus species. Bacillus licheniformis's safety and the abundant biological resources it produces make it an ideal cell factory. However, due to the presence of restriction modification systems in Bacillus licheniformis, exogenous genes used for editing in Escherichia coli generally cannot be directly transferred into Bacillus licheniformis via vectors. Instead, plasmids must first be transferred into a specific host for modification, extracted, and then transferred into Bacillus licheniformis. This process is complex and results in low conversion efficiency of exogenous plasmids.
[0003] Patent application CN101230329A discloses a method for genetic transformation of industrial-scale Bacillus licheniformis strains. The DNA molecules to be transformed are first methylated using a Bacillus licheniformis-specific methyltransferase-mediated process. The specifically methylated DNA molecules are then genetically transformed using an optimized electroporation method to achieve the transformation of industrial-scale Bacillus licheniformis strains. However, this method requires cloning the Bacillus licheniformis methyltransferase gene (Bli-met) into Escherichia coli for expression. This process is highly complex, time-consuming, and has low transformation efficiency.
[0004] Bacillus licheniformis 2709 has been verified through whole-genome sequencing to lack virulence factor genes, and no secondary toxic metabolites were detected in its fermentation products. Compared to other Bacillus strains that have not undergone safety certification, its safety approval threshold is lower when applied in food, pharmaceutical, and agricultural fields. The fermentation characteristics of Bacillus licheniformis 2709 have been industrially validated and are superior to other host bacteria, such as rapid growth rate, short fermentation cycle, broad substrate utilization, strong stress resistance, high biomass, and stable product yield. Furthermore, in terms of protein secretion, Bacillus licheniformis 2709 exhibits strong extracellular secretion capabilities, making it suitable for enzyme development.
[0005] Therefore, it is of great significance to develop a genetically engineered bacterium based on Bacillus licheniformis 2709 that can efficiently transform exogenous plasmids. Summary of the Invention
[0006] The main purpose of this application is to provide a genetically engineered bacterium, its preparation method and its application, in order to solve the problem of low transformation efficiency of Bacillus licheniformis 2709 in the prior art.
[0007] To achieve the above objectives, according to the first aspect of this application, a method for preparing a genetically engineered bacterium is provided. The method comprises: knocking out any one or more of the following genes from Bacillus licheniformis 2709: Dmm1, Dmm2, Dcm1, Dcm2, or ngoF, to obtain the aforementioned genetically engineered bacterium; wherein the nucleotide sequence of Dmm1 is SEQ ID NO: 1; the nucleotide sequence of Dmm2 is SEQ ID NO: 2; the nucleotide sequence of Dcm1 is SEQ ID NO: 3; the nucleotide sequence of Dcm2 is SEQ ID NO: 4; and the nucleotide sequence of ngoF is SEQ ID NO: 5.
[0008] Furthermore, the above preparation method includes knocking out any of the following gene combinations of Bacillus licheniformis 2709: Dmm1+Dcm1 or Dmm1+ngoF.
[0009] Furthermore, the above knockout was performed using the CRISPR-Cas9 gene editing system.
[0010] Furthermore, the CRISPR-Cas9 gene editing system described above includes sgRNA; the sgRNA includes: sgRNA1 targeting the Dmm1 gene; sgRNA2 targeting the Dmm2 gene; sgRNA3 targeting the Dcm1 gene; sgRNA4 targeting the Dcm2 gene; and sgRNA5 targeting the ngoF gene; wherein the nucleotide sequence of sgRNA1 is SEQ ID NO: 48; the nucleotide sequence of sgRNA2 is SEQ ID NO: 44; the nucleotide sequence of sgRNA3 is SEQ ID NO: 45; the nucleotide sequence of sgRNA4 is SEQ ID NO: 46; and the nucleotide sequence of sgRNA5 is SEQ ID NO: 47.
[0011] To achieve the above objectives, according to a second aspect of this application, a genetically engineered bacterium is provided. This genetically engineered bacterium is *Bacillus licheniformis* 2709, which lacks any one or more of the following genes: Dmm1, Dmm2, Dcm1, Dcm2, or ngoF;
[0012] The nucleotide sequence of Dmm1 is SEQ ID NO: 1; the nucleotide sequence of Dmm2 is SEQ ID NO: 2; the nucleotide sequence of Dcm1 is SEQ ID NO: 3; the nucleotide sequence of Dcm2 is SEQ ID NO: 4; and the nucleotide sequence of ngoF is SEQ ID NO: 5.
[0013] Furthermore, the above-mentioned Bacillus licheniformis 2709 lacks any of the following gene combinations: Dmm1+Dcm1 or Dmm1+ngoF.
[0014] To achieve the above objectives, according to a third aspect of this application, a method for preparing the above-mentioned genetically engineered bacteria or the application of the above-mentioned genetically engineered bacteria in transforming exogenous recombinant plasmids is provided.
[0015] Furthermore, the exogenous recombinant plasmids mentioned above are selected from any one of the following: PHY300, PMA5, or PJOE8999.
[0016] Furthermore, the above applications also include the use of the genetically engineered bacteria transformed with the above-mentioned exogenous recombinant plasmids in protein expression, enzyme preparation development, biopharmaceuticals, and agricultural biotechnology.
[0017] To achieve the above objectives, according to the fourth aspect of this application, a method for preparing the above-mentioned genetically engineered bacteria or the application of the above-mentioned genetically engineered bacteria as chassis bacteria in industrial fermentation is provided.
[0018] By applying the technical solution of this application, the genetically engineered bacteria obtained by knocking out any one or more of the following genes of Bacillus licheniformis 2709: Dmm1 (nucleotide sequence SEQ ID NO: 1), Dmm2 (nucleotide sequence SEQ ID NO: 2), Dcm1 (nucleotide sequence SEQ ID NO: 3), Dcm2 (nucleotide sequence SEQ ID NO: 4), and ngoF (nucleotide sequence SEQ ID NO: 5) can be efficiently transformed into exogenous plasmids (e.g., pjoe8999, PMA5, or phy300). Attached Figure Description
[0019] The accompanying drawings, which form part of this application, are used to provide a further understanding of this application. The illustrative embodiments and descriptions of this application are used to explain this application and do not constitute an undue limitation of this application. In the drawings:
[0020] Figure 1 A linear list of known and presumed restriction-modification systems (RM systems) in the genome according to embodiments of this application is shown.
[0021] Figure 2 The diagram shows the transformation test of the Bacillus licheniformis △Dmm1△Dcm1 mutant strain with different plasmids according to the embodiments of this application, with wild-type strain 2709 as the control.
[0022] Figure 3The diagram shows the transformation of the Bacillus licheniformis △Dmm1△ngoF mutant strain with different plasmids according to the embodiments of this application, with wild-type strain 2709 as the control. Detailed Implementation
[0023] It should be noted that, unless otherwise specified, the embodiments and features described in this application can be combined with each other. The present application will now be described in detail with reference to the embodiments.
[0024] As mentioned in the background section, existing Bacillus licheniformis chassis strains possess a restriction modification system that can recognize and cleave unmethylated exogenous DNA, effectively preventing the invasion of foreign genetic material. However, this presents the following drawbacks when transforming exogenous genes: 1) low transformation efficiency of exogenous plasmids makes chassis strain modification difficult; 2) the transformation process is complex, requiring multiple modifications and over-transformation of intermediates.
[0025] Bacillus licheniformis 2709 does not carry virulence factor genes, and no secondary toxic metabolites were detected in its fermentation products. Compared to other Bacillus strains that have not undergone safety certification, its application in food, pharmaceutical, and agricultural fields faces a lower safety approval threshold. Furthermore, the fermentation characteristics of Bacillus licheniformis 2709 have been industrially validated and are superior to other host bacteria, such as rapid growth rate, short fermentation cycle, broad substrate utilization, strong stress resistance, high biomass, and stable product yield. In terms of protein secretion, Bacillus licheniformis 2709 exhibits strong extracellular secretion capabilities, making it suitable for enzyme development.
[0026] In this application, the inventors attempted to improve the transformation efficiency of Bacillus licheniformis 2709 by knocking out the restriction endonuclease ngoF and / or methylases (e.g., Dmm1, Dmm2, Dcm1, Dcm2 or ngoF) that constitute Bacillus licheniformis 2709, and thus proposed the technical solution of this application.
[0027] The restriction-modification system (RM system) is an immune defense mechanism in bacteria, composed of restriction enzymes and methyltransferases. It recognizes and cleaves invading exogenous DNA (such as bacteriophage DNA), while simultaneously protecting its own DNA from cleavage through methylation modification. *Bacillus licheniformis* 2709 contains the restriction enzyme encoding gene *ngoF* and four methyltransferase encoding genes: *Dmm1*, *Dmm2*, *Dcm1*, and *Dcm2*.
[0028] To overcome the limitations of restrictive modification systems on the transformation efficiency of Bacillus licheniformis, a method for preparing genetically engineered bacteria is provided in a first typical embodiment of this application. This method includes: knocking out any one or more of the following genes from Bacillus licheniformis 2709: Dmm1, Dmm2, Dcm1, Dcm2, or ngoF, to obtain the aforementioned genetically engineered bacteria; wherein the nucleotide sequence of Dmm1 is SEQ ID NO: 1; the nucleotide sequence of Dmm2 is SEQ ID NO: 2; the nucleotide sequence of Dcm1 is SEQ ID NO: 3; the nucleotide sequence of Dcm2 is SEQ ID NO: 4; and the nucleotide sequence of ngoF is SEQ ID NO: 5.
[0029] The genetically engineered bacteria prepared using the above method have the advantage of high plasmid transformation efficiency. During the transformation of exogenous recombinant plasmids, strains with key genes knocked out of the restriction-modification system exhibit higher transformation efficiency, effectively reducing the complexity and cost of the transformation process, accelerating the transformation of research results into practical applications, and demonstrating significant economic and social value.
[0030] The sequence of SEQ ID NO: 1 is as follows:
[0031]
[0032] The sequence of SEQ ID NO: 2 is as follows:
[0033]
[0034] The sequence of SEQ ID NO: 3 is as follows:
[0035]
[0036] The sequence of SEQ ID NO:4 is as follows:
[0037]
[0038] The sequence of SEQ ID NO: 5 is as follows:
[0039]
[0040] In a preferred embodiment of the present invention, the preparation method includes knocking out any one of the following gene combinations of Bacillus licheniformis 2709: Dmm1+Dcm1 or Dmm1+ngoF. Compared with single gene knockout, double gene knockout can further inhibit the function of the restriction-modification system, thereby further optimizing the transformation conditions and making the introduction of exogenous recombinant plasmids smoother and more efficient.
[0041] Gene knockout refers to the deletion or inactivation of a specific gene from an organism's genome using gene editing technology, in order to study the effects of that gene on the organism's physiology, development, or disease.
[0042] In the field of microbiology, methods for achieving gene knockout include, but are not limited to: 1) Linear DNA fragment replacement: Constructing a linear DNA fragment with homologous arms (usually 500bp-2kb) at both ends to the target gene and a selection marker (such as an antibiotic resistance gene) in the middle. This is introduced into microorganisms via electroporation or chemical transformation, where their own homologous recombination system replaces the target gene with the marker gene; 2) CRISPR-Cas9+ homologous repair template (HDR template): Designing gRNA to target the gene while providing a repair template with homologous arms at both ends (usually a selection marker or an unmarked deletion sequence). After Cas9 cleavage, the cell replaces the target gene via HDR; 3) CRISPR-Cas9+ non-homologous end repair: In microorganisms lacking HDR but possessing non-homologous end joining (NHEJ) repair mechanisms (such as some fungi), after Cas9 cleavage, NHEJ repair may introduce frameshift mutations, achieving knockout.
[0043] In a preferred embodiment of the present invention, the above-mentioned knockout is performed using a CRISPR-Cas9 gene editing system. In this system, the sgRNA can precisely locate a specific region of the target gene according to the base pairing principle, guiding the Cas9 nuclease to cleave it, thereby initiating the homologous recombination repair process within the bacteria. During this process, by providing a suitable homologous arm, the knockout or replacement of the target gene can be achieved.
[0044] In a preferred embodiment of the present invention, the CRISPR-Cas9 gene editing system includes sgRNA; the sgRNA includes: sgRNA1 targeting the Dmm1 gene; sgRNA2 targeting the Dmm2 gene; sgRNA3 targeting the Dcm1 gene; sgRNA4 targeting the Dcm2 gene; and sgRNA5 targeting the ngoF gene; wherein the nucleotide sequence of sgRNA1 is SEQ ID NO: 48; the nucleotide sequence of sgRNA2 is SEQ ID NO: 44; the nucleotide sequence of sgRNA3 is SEQ ID NO: 45; the nucleotide sequence of sgRNA4 is SEQ ID NO: 46; and the nucleotide sequence of sgRNA5 is SEQ ID NO: 47.
[0045] In a second typical embodiment of this application, a genetically engineered bacterium is provided, which is *Bacillus licheniformis* 2709 lacking any one or more of the following genes: Dmm1, Dmm2, Dcm1, Dcm2, or ngoF; wherein the nucleotide sequence of Dmm1 is SEQ ID NO: 1; the nucleotide sequence of Dmm2 is SEQ ID NO: 2; the nucleotide sequence of Dcm1 is SEQ ID NO: 3; the nucleotide sequence of Dcm2 is SEQ ID NO: 4; and the nucleotide sequence of ngoF is SEQ ID NO: 5. The above-mentioned genetically engineered bacterium has the beneficial effect of high efficiency in transforming exogenous plasmids.
[0046] In a preferred embodiment of the present invention, the above-mentioned Bacillus licheniformis 2709 is missing any one of the following gene combinations: Dmm1+Dcm1 or Dmm1+ngoF. The genetically engineered bacteria with the specific gene knockout combination described above have significant advantages in transforming exogenous recombinant plasmids.
[0047] In a third typical embodiment of this application, a method for preparing the above-mentioned genetically engineered bacteria or the application of the above-mentioned genetically engineered bacteria in transforming exogenous recombinant plasmids is provided.
[0048] The genetically engineered bacteria prepared using the above method not only eliminates the barriers of genetic manipulation but also retains the original excellent properties of the strain, such as rapid growth, high biomass production, and stable product yield. Therefore, this strain and its preparation method can be applied to a wide range of scenarios, including but not limited to protein expression, enzyme development, biopharmaceuticals, and agricultural biotechnology, providing a powerful microbial foundation for research and production in these fields.
[0049] In a preferred embodiment of the present invention, the exogenous recombinant plasmid is selected from any one of the following: PHY300, PMA5, or PJOE8999. Due to the weakening of the restriction-modification system, the transformation efficiency of the above plasmid in engineered bacteria is significantly improved, which is beneficial for achieving stable expression and functional verification of exogenous genes. This application can promote the rapid deployment of genetic tools in Bacillus licheniformis, providing support for subsequent molecular biology research and engineering modification. It should be noted that the above exogenous recombinant plasmids are all common plasmids commonly used by those skilled in the art.
[0050] After successful introduction of exogenous recombinant plasmids, the aforementioned genetically engineered strains can serve as efficient expression platforms for the production of industrial enzymes, therapeutic proteins, biopesticides, or metabolites. Their high transformation efficiency combined with strong secretion capacity helps improve the yield and purity of exogenous proteins while reducing the complexity of fermentation processes. This strain exhibits good adaptability and application prospects in protein expression systems, industrial enzyme production, pharmaceutical intermediate synthesis, and agricultural microbial preparation development. Therefore, in a preferred embodiment of the present invention, the above applications also include the use of the aforementioned genetically engineered strains transformed with the exogenous recombinant plasmids in protein expression, enzyme development, biopharmaceuticals, and agricultural biotechnology.
[0051] In a fourth typical embodiment of this application, a method for preparing the above-mentioned genetically engineered bacteria or the application of the above-mentioned genetically engineered bacteria as chassis bacteria in industrial fermentation is provided.
[0052] The aforementioned genetically engineered strain can serve as a universal platform for industrial fermentation, suitable for high-density culture, continuous fermentation, and complex metabolic pathway regulation. Its higher genetic compatibility allows for stable replication and expression of various plasmid vectors, helping to shorten strain construction cycles and reduce screening costs. Without sacrificing original fermentation performance, this strain enhances functional programmability, promoting the large-scale production of various bio-based products and improving the flexibility and economy of industrial fermentation processes.
[0053] The present application will be further described in detail below with reference to specific embodiments, which should not be construed as limiting the scope of protection claimed in the present application.
[0054] Example 1: Predicting restriction enzymes and methyltransferases using the REBASE database
[0055] REBASE has its own dedicated web server (http: / / rebase.neb.com / rebase / rebase.html), through which comprehensive searches can be performed.
[0056] The analytical results of Bacillus licheniformis 2709 (GenBank accession number: NZ_CP083238.1) are as follows: Figure 1 As shown, this genome contains a complete restriction-modification system, with the recognition sequence: GCNGC. In addition, this genome also contains four methyltransferase genes.
[0057] Example 2: Construction of gene knockout vector
[0058] 2.1 Molecular cloning procedures
[0059] For routine molecular cloning procedures, refer to the descriptions in the book "Molecular Cloning: A Laboratory Manual". Plasmid DNA extraction, gel DNA recovery, and the recovery of PCR products and enzyme digestion products were performed according to the instruction manuals for the plasmid miniprep kit, gel product recovery kit, and PCR product recovery kit, respectively.
[0060] 2.2 Construction of gene knockout vector
[0061] Five restriction enzyme and methyltransferase genes from the previously predicted genomic sequences—Dmm1 (nucleotide sequence SEQ ID NO: 1), Dmm2 (nucleotide sequence SEQ ID NO: 2), Dcm1 (nucleotide sequence SEQ ID NO: 3), Dcm2 (nucleotide sequence SEQ ID NO: 4), and ngoF (nucleotide sequence SEQ ID NO: 5)—were selected for gene knockout. The strain used in this application is *Bacillus licheniformis* 2709, purchased from the China Industrial Microbial Culture Collection Center, strain number CICC 10266.
[0062] In this embodiment, Bacillus licheniformis 2709 was modified by knocking out the Dmm1, Dmm2, Dcm1, Dcm2, and ngoF genes. The gene knockout method used was CRISPR-Cas9 technology. The original plasmid used in this method was pJoe8999, which was purchased from Biobw (bio-111006). It carried gRNA, homologous repair arm, λ phage Red recombination system, Cas9 protein expression system, kanamycin sulfate (working concentration: 50 mg / L), and ampicillin resistance (working concentration: 100 mg / L).
[0063] The nucleotide sequence of sgRNA1 targeting the Dmm1 gene (SEQ ID NO: 48) is ttaaatcgcccaacttccaa; the nucleotide sequence of sgRNA2 targeting the Dmm2 gene (SEQ ID NO: 44) is tccccgctgaatataaccca; the nucleotide sequence of sgRNA3 targeting the Dcm1 gene (SEQ ID NO: 45) is attachtagcgtattgaacat; the nucleotide sequence of sgRNA4 targeting the Dcm2 gene (SEQ ID NO: 46) is gccaccagttcccatccgag; and the nucleotide sequence of sgRNA5 targeting the ngoF gene (SEQ ID NO: 47) is ggtattaagacttttcttca.
[0064] The strains and plasmids used in this application are listed in Table 1, and the primers are listed in Table 2. Taking the Dmm1 gene knockout as an example, primers for two homologous arms of the Dmm1 gene were designed: Dmm1L-F / R and Dmm1R-F / R. Using the genomic DNA of Bacillus licheniformis 2709 as a template, approximately 800 bp fragments of each upstream and downstream homologous arms were amplified. Then, using Dmm1L-F and Dmm1R-R as primers, SOE-PCR was used to ligate the upstream and downstream homologous arms, resulting in a fragment size of 1600 bp. The pjoe8999 vector was amplified using primer pair vpjoe-F / R to obtain a linear knockout plasmid. The ligation product was transformed into E. coli DH5α. After the transformants were confirmed as positive clones by PCR, the plasmid was extracted for double enzyme digestion verification and sequencing. The resulting recombinant knockout plasmid was pJoe1. Other knockout plasmids, pJoe2-5, were obtained using the same method.
[0065] Table 1. Strains used in this application
[0066]
[0067] Table 2. Primer Sequences
[0068]
[0069] Example 3: Construction of Bacillus licheniformis gene-deleted strain
[0070] 3.1 Transformation by Bacillus licheniformis
[0071] Preparation of competent cells:
[0072] (1) Streak the bacterial culture from the glycerol preservation tube onto an LB agar plate and incubate overnight at 37°C;
[0073] (2) Pick a single colony into a 50 mL Erlenmeyer flask containing 10 mL of competent cells to prepare culture medium, and incubate at 37 degrees Celsius for 10-12 h;
[0074] (3) Inoculate 1% into a 500 mL Erlenmeyer flask containing 100 mL of competent cells in culture medium and incubate at 37 °C until the OD600 reaches about 0.6;
[0075] (4) Aliquot the culture into pre-cooled centrifuge tubes and incubate on ice for 15-20 min; centrifuge at 8000 rpm for 10 min at 4℃.
[0076] (5) Add an appropriate amount of washing buffer, mix well by pipetting, wash the bacterial cells, centrifuge at 8000 rmp for 10 min at 4℃ to recover the bacterial cells, and repeat 2-3 times.
[0077] (6) First, resuspend the cells in a small amount of competent suspension, calculate the cell concentration using a hemocytometer, and dilute to a final concentration of approximately 2 × 10¹⁰.
[0078] (7) Dispense 200 mL / tube and store in an ultra-low temperature freezer.
[0079] The expression plasmid was transformed using electroporation. First, a 2 mm electroporation cuvette was washed with 75% ethanol, air-dried, and pre-chilled on ice. Then, approximately 20 μL of 100 ng recombinant plasmid was added to 100 μL of competent cells, mixed well, and transferred to the pre-chilled cuvette. Electroporation conditions were set as follows: voltage 3.0 kV, electroporation time 5 ms. After electroporation, 1 mL of resuscitation medium was immediately added to the cuvette, and the cells were incubated in sterile centrifuge tubes at 37 ℃ for 3 h, then plated onto the appropriate antibiotic selection plates. This electroporation transformation method had low transformation efficiency.
[0080] 3.2 Screening and Validation of Gene Knockout Strains
[0081] Transformants were obtained in step 3.1, and positive transformants were confirmed by PCR. Using genomic DNA from the knockout candidate strain and the starting strain as templates, PCR verification was performed using primers Dmm1-F / R. The knockout strain was expected to amplify a 1600 bp product, and the starting strain amplified a 2500 bp target fragment. The PCR reaction program was as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 56℃ annealing for 30 s, 72℃ extension for 1 min, for a total of 30 cycles; 72℃ final extension for 10 min; and incubation at 4℃. The PCR products were detected by 1% agarose gel electrophoresis, and the banding was observed. The final strains obtained were Bacillus licheniformis △Dmm1, Bacillus licheniformis △Dmm2, Bacillus licheniformis △Dcm1, Bacillus licheniformis △Dcm2, and Bacillus licheniformis △ngoF.
[0082] Obtaining double mutant strains: The transformation efficiency of the first five mutant strains was tested. Transformation efficiency was statistically analyzed by counting single colonies grown on screening plates. Mutant strains with a high number of transformants were marked. It was found that knocking out △Dmm1, △Dcm1, and △ngoF increased the number of transformants by 5-20 times. The transformation efficiency of mutant strains knocking out △Dmm2 and △Dcm2 also increased, but to a limited extent. Using the same plasmid for transformation tests, the average number of single colonies on a plate after transformation of wild-type strains into phy300 was 3. The average number of single colonies after transformation of △Dmm1, △Dmm2, △Dcm1, △Dcm2, and △ngoF mutant strains into phy300 were 57, 9, 17, 7, and 48, respectively.
[0083] Subsequently, gene knockout was performed on the mutant strains with significant enhancement. This yielded strains Bacillus licheniformis △Dmm1△Dcm1 and Bacillus licheniformis △Dmm1△ngoF.
[0084] Example 4: Transformation efficiency test of gene-deleted strains
[0085] Transformation efficiency was tested on the *Bacillus licheniformis* △Dmm1△Dcm1 and *Bacillus licheniformis* △Dmm1△ngoF mutants obtained in Example 3. Competent cells were prepared under the same conditions, using wild-type bacteria as a reference, and electroporation transformation was performed according to the above method. Commercial plasmids of different sizes were selected for testing, including PHY300 (purchased from Baosai Biotechnology), PMA5 (purchased from Baosai Biotechnology), and PJOE8999. Results are as follows: Figure 2 and Figure 3 As shown, the mutant strains with Dmm1 and Dcm1 knockout had the highest number of transformants, while the mutants with Dmm1 and ngoF knockout had a slight increase compared to the wild-type strain, and different vectors showed the same trend.
[0086] Figure 2 To test the transformation efficiency of the △Dmm1△Dcm1 mutant strain using different plasmids, the transformation efficiency of the pjoe8999, PMA5, and phy300 plasmids on the target mutant strain was systematically evaluated, using the wild-type strain 2709 (labeled phy300(2709)) as a control. Only about four colonies appeared on the control strain plate, confirming the low transformation efficiency of the wild-type strain. Simultaneously, the selection pressure exhibited high specificity, effectively excluding background growth and interference from non-resistant clones. In the transformation experimental group, the colony counts on pjoe8999, PMA5, and phy300 plates were approximately 40, 77, and 86, respectively; after background correction, the effective colony counts were 36, 73, and 82, respectively. The results indicate that all three plasmids can efficiently transform the target mutant strain and confer selection resistance, with the transformation efficiency and strain growth performance of phy300 and PMA5 plasmids significantly superior to pjoe8999.
[0087] Figure 3 To test the transformation efficiency of the △Dmm1△ngoF mutant strain using different plasmids, the wild-type strain 2709 (labeled phy300(2709)) was used as a control. This experiment evaluated the transformation efficiency of three plasmids: pjoe8999, PMA5, and phy300 on the target mutant strain. Only about 6 colonies appeared on the control plate. In the transformation experimental groups, the colony counts on pjoe8999, PMA5, and phy300 plates were approximately 35, 22, and 55, respectively; after background correction, the effective colony counts were 29, 16, and 49, respectively. The results indicate that all three plasmids successfully transformed the target mutant strain and conferred selection resistance. The phy300 plasmid showed the best transformation efficiency and strain growth performance, followed by PMA5, while pjoe8999 was relatively weaker. All three were significantly higher than the background level of the control.
[0088] As can be seen from the above description, the embodiments of this application achieve the following technical effects:
[0089] The genetically engineered bacteria provided in this application have a high transformation efficiency for exogenous recombinant plasmids, effectively solving the limitation of Bacillus licheniformis as a genetic tool due to transformation difficulties. Ultimately, a heritable strain that can be easily transformed by various types of plasmids (e.g., pjoe8999, PMA5, or phy300) was obtained.
[0090] The above description is merely a preferred embodiment of this application and is not intended to limit this application. Various modifications and variations can be made to this application by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of this application should be included within the protection scope of this application.
Claims
1. A method for preparing genetically engineered bacteria, characterized in that, The preparation method includes: knocking out any one or a combination of the following genes in Bacillus licheniformis 2709: Dmm1, Dmm1+Dcm1 or Dmm1+ngoF, to obtain the genetically engineered bacteria; The nucleotide sequence of Dmm1 is SEQ ID NO: 1; The nucleotide sequence of Dcm1 is SEQ ID NO: 3; The nucleotide sequence of the ngoF is SEQ ID NO:
5.
2. The preparation method according to claim 1, characterized in that, The knockout was performed using the CRISPR-Cas9 gene editing system.
3. The preparation method according to claim 2, characterized in that, The CRISPR-Cas9 gene editing system includes sgRNA; The sgRNAs include: sgRNA1 targeting the Dmm1 gene; sgRNA3 targeting the Dcm1 gene; and sgRNA5 targeting the ngoF gene. The nucleotide sequence of sgRNA1 is SEQ ID NO: 48; The nucleotide sequence of the sgRNA3 is SEQ ID NO: 45; The nucleotide sequence of the sgRNA5 is SEQ ID NO:
47.
4. A genetically engineered bacterium, characterized in that, The genetically engineered bacteria is Bacillus licheniformis 2709 which lacks any one or a combination of the following genes: Dmm1, Dmm1+Dcm1 or Dmm1+ngoF. The nucleotide sequence of Dmm1 is SEQ ID NO: 1; The nucleotide sequence of Dcm1 is SEQ ID NO: 3; The nucleotide sequence of the ngoF is SEQ ID NO:
5.
5. The method for preparing the genetically engineered bacteria according to any one of claims 1 to 3, or the application of the genetically engineered bacteria according to claim 4 in transforming exogenous recombinant plasmids.
6. The application according to claim 5, characterized in that, The exogenous recombinant plasmid is selected from any one of the following: PHY300, PMA5, or PJOE8999.
7. The application according to claim 5, characterized in that, The application also includes the use of the genetically engineered bacteria transformed with the exogenous recombinant plasmid in protein expression.
8. The application according to claim 5, characterized in that, The application also includes the use of the genetically engineered bacteria transformed with the exogenous recombinant plasmid in enzyme preparation development.
9. The application according to claim 5, characterized in that, The applications also include the use of the genetically engineered bacteria transformed with the exogenous recombinant plasmid in biopharmaceuticals.
10. The application according to claim 5, characterized in that, The application also includes the use of the genetically engineered bacteria transformed with the exogenous recombinant plasmid in agricultural biotechnology.
11. The application of genetically engineered bacteria obtained by the preparation method of any one of claims 1 to 3, or the genetically engineered bacteria of claim 4, as chassis bacteria in industrial fermentation.
Citation Information
Patent Citations
Bacillus licheniformis industrial production strain genetic transformation method
CN101230329A