F-circP3F / miR-326 / GLI1 / PI3K-Akt-mTOR axis in the diagnosis and treatment of rhabdomyosarcoma
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-30
- Publication Date
- 2026-05-29
AI Technical Summary
The existing technology lacks sufficient understanding of the ceRNA regulatory mechanism of PAX3-FOXO1-related circRNAs in rhabdomyosarcoma, resulting in a lack of effective means for the diagnosis and treatment of ARMS.
The signal regulation mechanism of the F-circP3F/miR-326/GLI1/PI3K-AKT-mTOR axis was revealed. ARMS growth was inhibited by using F-circP3F inhibitors, miR-326 promoters, GLI1 inhibitors and PI3K inhibitors, especially the combined application of GANT61 and LY294002.
It significantly inhibited ARMS cell proliferation, migration and tumor growth in in vitro and in vivo experiments, providing new diagnostic biomarkers and therapeutic targets, and opening up new avenues for targeted therapy of ARMS.
Smart Images

Figure CN122097582A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biomedical technology, specifically to the ceRNA regulatory mechanism of F-circP3F and its application in rhabdomyosarcoma, and particularly to the application of the F-circP3F / miR-326 / GLI1 / PI3K-AKT-mTOR axis in the diagnosis and treatment of rhabdomyosarcoma. Background Technology
[0002] Rhabdomyosarcoma (RMS) is a highly aggressive soft tissue sarcoma commonly seen in children and adolescents. Alveolar RMS (ARMS) is the second most common subtype of RMS after embryonal RMS (ERMS), but it has a higher metastasis rate, poorer prognosis, and is far more malignant than ERMS. The molecular genetic characteristic of ARMS patients is the presence of a specific chromosomal translocation t(2;13)(q35;q14), forming a specific PAX3-FOXO1 fusion gene. This fusion gene reshapes cell fate through an abnormal transcriptional regulatory network of downstream signaling pathways, driving the development and progression of ARMS. In recent years, significant progress has been made in research on the function of the PAX3-FOXO1 fusion gene, the activation of target genes, and its interaction with the tumor microenvironment. However, further investigation is needed regarding PAX3-FOXO1-related circRNAs and their multi-pathway synergistic mechanisms. The inventors have identified the circular RNA F-circP3F associated with the PAX3-FOXO1 fusion gene in rhabdomyosarcoma in previous studies (see CN113981101A and CN114182023A, which are incorporated herein by reference), but the signaling pathway and regulatory mechanism of F-circP3F are still unclear.
[0003] Recent studies have shown that circRNAs located in the cytoplasm can participate in posttranscriptional gene regulation by acting as competitive endogenous RNAs (ceRNAs) and thus "sponging" microRNAs (miRNAs). This mechanism can prevent the interaction between specific miRNAs and their target mRNAs, thereby playing an important regulatory role in tumor progression. Therefore, exploring the regulatory mechanisms of circRNAs and ceRNAs related to the fusion gene PAX3-FOXO1 may open up new avenues and potential targets for the diagnosis and treatment of ARMS.
[0004] In view of this, the present invention is proposed. Summary of the Invention
[0005] The purpose of this invention is to reveal the regulatory mechanism of F-circP3F in the progression of rhabdomyosarcoma, and to provide new targets and approaches for the diagnosis and treatment of rhabdomyosarcoma.
[0006] This invention provides systematic experimental evidence for F-circP3F as a novel prognostic biomarker and therapeutic target for ARMS, elucidates the molecular mechanism by which the "F-circP3F / miR-326 / GLI1 / PI3K-AKT-mTOR" signaling axis promotes tumor progression, and verifies that the combined use of GLI1 and PI3K inhibitors can effectively inhibit RMS growth in vitro and in vivo, providing an important theoretical basis and experimental evidence for developing diagnostic and therapeutic strategies targeting this pathway.
[0007] On the one hand, the present invention provides the use of agents targeting the F-circP3F / miR-326 / GLI1 / PI3K-AKT-mTOR axis in the preparation of drugs or kits for treating rhabdomyosarcoma.
[0008] In some embodiments of the present invention, the agent includes an F-circP3F inhibitor, a miR-326 promoter, a GLI1 inhibitor, and / or a PI3K inhibitor. The inhibitor includes an agent capable of inhibiting the expression and / or activity of the target molecule; for example, the F-circP3F inhibitor includes an agent capable of inhibiting the expression and / or activity of F-circP3F, such as an agent capable of interfering with the binding of F-circP3F to miR-326. The promoter includes an agent capable of enhancing the expression and / or activity of the target molecule.
[0009] In some embodiments of the present invention, the agent comprises an F-circP3F inhibitor, wherein the F-circP3F inhibitor is selected from one or more small interfering RNAs, short hairpin RNAs, antisense oligonucleotides, and CRISPR gene editing systems that target F-circP3F, as long as it can reduce the expression level of F-circP3F or interfere with the binding of F-circP3F to miR-326. In some preferred embodiments, the agent comprises the nucleotide sequence shown in SEQ ID NO: 1.
[0010] In some embodiments of the present invention, the agent includes a miR-326 promoter, which includes miR-326 mimics, etc., as long as it can enhance the expression level of miR-326 or enhance the activity of miR-326. In some preferred embodiments, the nucleotide sequence of the miR-326 mimic is shown in SEQ ID NO: 2 and SEQ ID NO: 3.
[0011] In some embodiments of the present invention, the agent comprises a GLI1 inhibitor. In some specific embodiments, the GLI1 inhibitor is selected from one or more of GANT61 (CAS 500579-04-4), arsenic trioxide (CAS 1327-53-3), Vismodegib (CAS 879085-55-9), curcumin (CAS 458-37-7), and cyclophosphamide (CAS 4449-51-8).
[0012] In some embodiments of the present invention, the pharmaceutical agent comprises a PI3K inhibitor. In some specific embodiments, the PI3K inhibitor is selected from one or more of LY294002, edalalisib, copanlisib, duvelisib, alpelisib, and umbralisib.
[0013] In some embodiments of the present invention, the pharmaceutical agent comprises a GLI1 inhibitor and a PI3K inhibitor. In some preferred embodiments, the GLI1 inhibitor is GANT61 and the PI3K inhibitor is LY294002.
[0014] In some embodiments of the present invention, the rhabdomyosarcoma is an alveolar rhabdomyosarcoma.
[0015] On the other hand, the present invention provides a pharmaceutical composition or kit, characterized in that it comprises the nucleotide sequence shown in SEQ ID NO: 1 or the double-stranded RNA or its DNA sequence shown in SEQ ID NO: 2 and SEQ ID NO: 3.
[0016] On the other hand, the present invention provides a pharmaceutical composition or kit, characterized in that it comprises a GLI1 inhibitor and a PI3K inhibitor. The GLI1 inhibitor is selected from GANT61 (CAS No. 500579-04-4), arsenic trioxide (CAS No. 1327-53-3), vismodegib (CAS No. 879085-55-9), curcumin (CAS No. 458-37-7), and / or cyclopramine (CAS No. 4449-51-8), etc. The PI3K inhibitor is selected from LY294002 (CAS No. 154447-36-6), edelalisib (CAS No. 870281-82-6), copanlisib (CAS No. 1032568-63-0), duvelisib (CAS No. 1201438-56-3), alpelisib (CAS No. 1217486-61-7), and / or umbralisib (CAS No. 1532533-67-7), etc. In some preferred embodiments, preferably, the GLI1 inhibitor is GANT61, and the PI3K inhibitor is LY294002.
[0017] On the other hand, the present invention provides the use of a detection reagent for the F-circP3F / miR-326 / GLI1 / PI3K-AKT-mTOR axis in the preparation of kits for the diagnosis, prognostic assessment, or treatment monitoring of rhabdomyosarcoma. In some preferred embodiments, the detection reagent comprises a detection reagent for F-circP3F and miR-326. In some preferred embodiments, the detection reagent comprises a detection reagent for GLI1, p-PI3K, p-AKT, and / or p-mTOR. In some specific embodiments, the detection reagent comprises an oligonucleotide at least partially complementary to F-circP3F or miR-326, or an antibody specifically binding to GLI1, PI3K, AKT, or mTOR.
[0018] The beneficial effects of this invention are at least as follows: This invention systematically reveals for the first time the key role of F-circP3F and its ceRNA regulatory network in the occurrence and development of ARMS, providing new molecular markers for the diagnosis, prognostic assessment and treatment monitoring of ARMS, and opening up new avenues for targeted therapy of the disease.
[0019] This invention validates a therapeutic strategy targeting the F-circP3F / miR-326 / GLI1 / PI3K-AKT-mTOR axis. In in vitro and in vivo experiments, the combined use of the GLI1 inhibitor (GANT61) and the PI3K inhibitor (LY294002) exhibited a synergistic anti-tumor effect, significantly inhibiting tumor cell proliferation and migration, inducing apoptosis, and effectively suppressing tumor growth in a nude mouse xenograft model. Attached Figure Description
[0020] To more clearly illustrate the technical solutions in the specific embodiments of this disclosure or the prior art, the drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of this disclosure. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.
[0021] Figure 1 Clinical characteristic map of ARMS patients carrying F-circP3F; among which, Figure 1 A is a diagram showing the rearrangement of FOXO1 in ARMS formalin-fixed paraffin-embedded (FFPE) tissue detected by DNA FISH. Figure 1 B shows the expression of PAX3-FOXO1 mRNA in 45 RMSFFPE tissues detected by qRT-PCR (Note: Brown curve represents PAX3-FOXO1 standard, red curve represents positive sample, and green curves represent negative control and blank control, respectively). Figure 1 C represents the expression of PAX3-FOXO1 mRNA in 45 RMS FFPE tissues detected by ddPCR; Figure 1 D indicates that F-circP3F was detected in 17 ARMS FFPE tissues using a one-step RT-PCR method. Figure 1 E represents the expression of F-circP3F transcripts in 17 ARMS FFPE tissues detected by qRT-PCR (Note: Brown curve represents PAX3-FOXO1 standard, red curve represents positive sample, and green curves represent negative control and blank control, respectively). Figure 1 F represents the expression of F-circP3F transcripts in 17 ARMS FFPE tissues detected by ddPCR.
[0022] Figure 2 A survival analysis graph for ARMS patients carrying PAX3-FOXO1 and F-circP3F; where, Figure 2 A represents the overall survival (OS) of ARMS patients carrying F-circP3F, as analyzed by Kaplan-Meier. Figure 2B represents the overall survival (OS) of patients carrying PAX3-FOXO1, as analyzed by Kaplan-Meier.
[0023] Figure 3 The graph shows the molecular characterization results of F-circP3F. Figure 3 A represents the RT-PCR detection of F-circP3F in RH30 cells as cDNA (red arrows represent divergent primer pairs of F-circP3F and β-actin, and green arrows represent convergent primer pairs of F-circP3F and β-actin). Figure 3 B is a graph showing the qRT-PCR analysis of F-circP3F and PAX3-FOXO1 mRNA in RH30 cells treated with actinomycin D at a specified time point. Figure 3 Figure C shows the qRT-PCR analysis of F-circP3F and PAX3-FOXO1 mRNA in RH30 cells treated with RNase R.
[0024] Figure 4 This is a cytoplasmic localization map of F-circP3F; where, Figure 4 A shows the relative expression levels of F-circP3F in the nucleus and cytoplasm of RH30 cells as determined by qRT-PCR. U6 and GAPDH were used as nuclear and cytoplasmic markers, respectively. Figure 4 B shows the location of F-circP3F (red) in the cytoplasm of RH30 cells using RNA-FISH technology. U6 and 18S rRNA were used as nuclear and cytoplasmic markers, respectively, and DAPI was used to stain the nucleus. Figure 4 C represents the localization of F-circP3F (red) in ARMS FFPE tissue using RNA-FISH technology, with 18S rRNA as a cytoplasmic marker and DAPI staining of the cell nucleus.
[0025] Figure 5 The figure shows the results of in vitro functional experiments of F-circP3F; Figure 5 A is the EdU assay used to detect the proliferation capacity of RH30 cells expressing empty vector or sh-F-circP3F and RD cells expressing empty vector or F-circP3F. Figure 5 B is the TUNEL assay used to detect the apoptosis ability of RH30 cells expressing empty vector or sh-F-circP3F and RD cells expressing empty vector or F-circP3F. Figure 5 C shows representative immunofluorescence staining images of E-cadherin, Vimentin, N-cadherin, and slug expression in RH30 cells with the sh-F-circP3F vector and RD cells without F-circP3F overexpression. Figure 5D represents Western blot analysis of the protein expression of EMT-related markers (Vimentin, N-cadherin, Snail, Slug, Twist, Zeb1, and ZO-1) in RH30 cells with or without the sh-F-circP3F vector and in RD cells with or without F-circP3F.
[0026] Figure 6 The in vivo tumor growth curve of F-circP3F is shown in the figure. Figure 6 A shows the growth curves of mouse RH30 cells expressing the empty vector and RH30 cells expressing sh-F-circP3F. Figure 6 B shows the growth curves of mouse RD cells expressing the empty vector and RD cells expressing F-circP3F.
[0027] Figure 7 The results of tumorigenesis experiments using F-circP3F in animals are shown. Figure 7 A showed that knocking down F-circP3F (sh-F-circP3F) in RH30 cells significantly reduced its fluorescence signal compared to the empty vector control group. Figure 7 B indicates that overexpression of F-circP3F in RD cells significantly enhanced the fluorescence signal compared to the control group. These in vitro imaging results... Figure 7 The evidence is directly confirmed by photographs of nude mice and xenografts from C and 7D: Figure 7 C corresponds to the RH30 experimental group, and it can be seen that the tumor volume is smaller in the sh-F-circP3F group; Figure 7 D corresponds to the RD experimental group, and it can be seen that the tumor volume is larger in the F-circP3F overexpression group.
[0028] Figure 8 The tumor weight of mice in different treatment groups is shown as a comparison. Figure 8 A represents the tumor weight formed by RH30 cells inoculated with empty vector and sh-F-circP3F; Figure 8 B represents the tumor weight formed by inoculating empty vectors and RD cells overexpressing F-circP3F.
[0029] Figure 9 The experimental results of F-circP3F binding to miR-326 are shown. Figure 9 A is a schematic diagram of the selection of direct downstream targets of F-circP3F. The analysis of upregulated or downregulated miRNAs identified by microarray analysis of RH30 cells treated with sh-F-circP3F and sh-sc is shown in the miRNA database analysis (left) and qRT-PCR verification (right). Figure 9B is the colocalization map of F-circP3F and miR-326 in RH30 cells analyzed using RNA-FISH technology; Figure 9 C represents the use of AGO2 antibody for RIP detection in RH30 cells, followed by qRT-PCR detection of enriched F-circP3F. Figure 9 D represents the biotin antibody enrichment of the miR-326-biotin complex from RH30 cells. The enriched F-circP3F and miR-326 were detected by qRT-PCR. Figure 9 E is a schematic diagram illustrating the interaction between F-circP3F and miR-326 as verified by luciferase assay. Figure 9 F shows the detection of luciferase reporter gene activity in HEK293T cells co-transfected with miR-326 mimics; Figure 9 G represents the expression levels of F-circP3F and miR-326 in RH30 cells after F-circP3F knockdown, as detected by qRT-PCR. Figure 9 H represents the expression levels of F-circP3F and miR-326 in RD cells after overexpression of F-circP3F, as detected by qRT-PCR.
[0030] Figure 10 The functional relationship between F-circP3F and miR-326 in the malignant phenotype of rhabdomyosarcoma cells was shown; among them, Figure 10 A represents the proliferation capacity of RH30 cells treated with EdU as a control, sh-F-circP3F, or sh-F-circP3F+miR-326 inhibitor; Figure 10 B represents the EdU experiment revealing the proliferative capacity of RD cells treated with control, F-circP3F, or F-circP3F+miR-326 inhibitor; Figure 10 C represents the apoptotic capacity of RH30 cells treated with control, sh-F-circP3F, or sh-F-circP3F + miR-326 inhibitor in the TUNEL assay; Figure 10 D represents the apoptotic capacity of RD cells treated with control, F-circP3F, or F-circP3F+miR-326 inhibitor in the TUNEL assay; Figure 10 E represents the migration and invasion abilities of RH30 cells treated with control, sh-F-circP3F, or sh-F-circP3F + miR-326 inhibitor in a Transwell assay. Figure 10 F represents the migration and invasion capabilities of RD cells treated with control, F-circP3F, or F-circP3F + miR-326 inhibitor in a Transwell assay. Figure 10G represents the immunofluorescence staining images of E-cadherin, Vimentin, N-cadherin, and slug expressed in RH30 cells treated with control, sh-F-circP3F, or sh-F-circP3F+miR-326 inhibitor. Figure 10 H shows representative immunofluorescence staining images of E-cadherin, Vimentin, N-cadherin, and slug expressed in RD cells treated with control, F-circP3F, or F-circP3F+miR-326 inhibitor.
[0031] Figure 11 This illustrates the screening strategy for direct downstream targets of miR-326; among which, Figure 11 A is a schematic diagram illustrating how to select the direct downstream target of miR-326; Figure 11 B shows the predicted GLI1 protein structure based on the Uniprot database and the results of rigid molecular docking using the ZDOCK program.
[0032] Figure 12 The results of the verification of the interaction between miR-326 and GLI1 are shown; Figure 12 A. The colocalization of miR-326 (green) and GLI1 protein (red) in cells was shown by RNA FISH and immunofluorescence (IF) analysis (cell nuclei stained with DAPI, blue). Figure 12 B is a schematic diagram of the RIP experiment detecting the interaction between miR-326 and GLI1; Figure 12 C represents the enrichment level of miR-326 in RH30 cells after RIP with GLI1 antibody, analyzed by qRT-PCR. Figure 12 D represents RNA pull-down in RH30 cells using biotin-labeled miR-326, and the enrichment of GLI1 and miR-326 was detected by qRT-PCR. Figure 12 E is a schematic diagram of the construction of the GLI1 3′-UTR wild-type luciferase reporter vector; Figure 12 F represents the luciferase activity measured after co-transfecting HEK293T cells with miR-326 mimic and wild-type GLI1 3′-UTR reporter vector.
[0033] Figure 13 The results of the analysis on the regulation of GLI1 expression by the F-circP3F / miR-326 axis are presented; Figure 13 A represents the qRT-PCR analysis results of miR-326 and GLI1 mRNA expression in RH30 cells after intervention with miR-326 mimic; Figure 13B represents the qRT-PCR analysis results of miR-326 and GLI1 mRNA expression in RD cells after appropriate treatment; Figure 13 C represents the Western blot results of GLI1 protein expression in RH30 cells after appropriate treatment. Figure 13 D represents the Western blot analysis results of GLI1 protein after appropriate treatment in RD cells.
[0034] Figure 14 The results show that F-circP3F affects RMS in vitro functional outcomes via miR-326; among which, Figure 14 A shows the proliferation capacity of control or GANT61-treated (30 μM GANT61 treatment for 24 h) RH30 and RD cells as indicated by EdU assay. Figure 14 B represents the proliferative capacity of control or GANT61-treated RH30 and RD cells as shown by CCK8 assay. Figure 14 C represents the migration and invasion abilities of RH30 and RD cells treated with control or GANT61 as shown in the Transwell assay; Figure 14 D represents the migration ability of control or GANT61-treated RH30 and RD cells as shown by the scratch assay. Figure 14 E represents the apoptotic capacity of RH30 and RD cells treated with control or GANT61 as shown in the TUNEL assay.
[0035] Figure 15 This study demonstrates the results of a rescue experiment that shows miR-326 regulates the malignant phenotype of rhabdomyosarcoma cells through GLI1. Figure 15 A represents the EdU assay results, showing the changes in cell proliferation capacity in RH30 and RD cells after intervention with miR-326 inhibitors and GLI1 inhibitors; Figure 15 B represents the effect of the corresponding treatments on the apoptotic capacity of the two cell types, as shown by the TUNEL assay. Figure 15 C demonstrated through Transwell experiments that RH30 and RD cells showed changes in migration and invasion abilities after appropriate treatment; Figure 15 D was further verified by flow cytometry to determine the effect of the corresponding treatments on the apoptosis capacity of the two cell types. Figure 15 E represents the immunofluorescence staining images of epithelial-mesenchymal transition (EMT) markers (E-cadherin, Vimentin, N-cadherin, and Slug) expression in RH30 and RD cells after the corresponding treatments.
[0036] Figure 16 The study results on the interaction and targeted inhibition of GLI1 with the PI3K / AKT / mTOR signaling pathway are presented; Figure 16A shows the co-localization of GLI1 and PI3K in RH30 and RD cells analyzed using the IF method (green represents GLI1, red represents PI3K, and blue represents DAPI). Figure 16 B represents the Co-IP assay performed in RH30 and RD cells using an anti-PI3K antibody to detect the interaction between endogenous GLI1 and PI3K. Figure 16 C represents the Co-IP assay performed in RH30 and RD cells using an anti-GLI1 antibody to detect the interaction between endogenous GLI1 and PI3K. Figure 16 D represents the detection of protein levels of GLI1, PI3K, Akt, mTOR, p-PI3K, p-AKT, and p-mTOR in GANT61-treated RH30 and RD cells by Western blot. Figure 16 E represents the detection of protein levels of GLI1, PI3K, Akt, mTOR, p-PI3K, p-AKT, and p-mTOR in LY294002-treated RH30 and RD cells by Western blot. Figure 16 F represents Western blot analysis of PI3K and p-PI3K protein levels in 740Y-P treated RH30 and RD cells; Figure 16 G represents the MTT assay showing the proliferation capacity of RH30 and RD cells treated with control GANT61+LY294002 or GANT61+LY294002+740Y-P; Figure 16 H represents the cloning ability of RH30 and RD cells treated with control GANT61+LY294002 or GANT61+LY294002+740Y-P; Figure 16 I represents acridine orange (AO) staining, which shows the death of RH30 and RD cells treated with control GANT61+LY294002 or GANT61+LY294002+740Y-P.
[0037] Figure 17 The therapeutic effect of combined GLI1 and PI3K inhibition in an in vivo model of rhabdomyosarcoma was demonstrated. Figure 17 A shows a whole photograph of a nude mouse carrying a xenograft tumor of RH30 cells (left) and a tumor sample removed after treatment (right). Figure 17 B showed that, compared with the control group, the GANT61 monotherapy group and the LY294002 monotherapy group, the tumor volume of mice in the GANT61 and LY294002 combination therapy group was significantly reduced. Figure 17 C indicates that the tumor weight in the combined treatment group was also significantly lower than that in the control groups; Figure 17 D represents the dynamic curve of tumor growth in mice during the treatment period; Figure 17 E represents the change in mouse body weight during the corresponding period, reflecting the systemic toxicity of the treatment regimen; Figure 17F represents the Western blot results of tumor tissues taken after treatment, showing the expression levels of GLI1, p-PI3K, p-AKT, and p-mTOR proteins in each group.
[0038] Figure 18 The diagram illustrates the mechanism by which F-circP3F promotes ARMS progress via the miR-326 / GLI1 / PI3K-AKT-mTOR axis. Detailed Implementation
[0039] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of this application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.
[0040] It should be noted that the terminology used herein is for the purpose of describing particular implementations only and is not intended to limit the exemplary implementations according to this application. As used herein, the singular form includes the plural form unless the context clearly indicates otherwise. Furthermore, it should be understood that when the terms "comprising" and / or "including" are used in this description, they indicate the presence of features, steps, operations, devices, components, and / or combinations thereof.
[0041] In this document, the term "pharmaceutical" is intended to include small molecule compounds, their pharmaceutically acceptable salts or combinations thereof, or biological macromolecules, their analogs or combinations thereof.
[0042] In this document, the term "treatment" is intended to include prevention and treatment, methods by which beneficial or desired outcomes, including clinical outcomes, can be obtained. For the purposes of this application, beneficial or desired clinical outcomes include, but are not limited to, one or more of the following: relief of one or more symptoms caused by the disease, reduction of the severity of the disease, stabilization of the disease (e.g., prevention or delay of disease progression), prevention or delay of disease spread (e.g., metastasis), prevention or delay of disease recurrence, delay or slowing of disease progression, improvement of disease status, provision of disease remission (partial or complete), reduction of the dosage of one or more other medications required to treat the disease, delay of disease progression, improvement or enhancement of quality of life, increased weight gain and / or prolonged survival. "Treatment" also includes a reduction in the pathological outcome of cancer (e.g., tumor volume). In the context of cancer, "treatment" includes any or all of the following: inhibition of cancer cell growth, inhibition of cancer cell replication and metastasis, reduction of overall tumor burden, and improvement of one or more symptoms associated with the disease.
[0043] In this document, the term "drug combination" refers to a combination of one or more components suitable for administration of different drug components, which may be administered simultaneously, separately, or sequentially. Different drug components may form a composition together (e.g., a pharmaceutical composition) or may exist independently, for example, with separate formulations and / or packaging.
[0044] In this document, the term "pharmacy box" refers to one or more components packaged together, which may be individually packaged or placed in a container, such as a tube, bottle, vial, bag, blister pack, syringe, or other suitable container device. The pharmaceutical boxes described herein may also include instructions for using the components of the pharmaceutical box to carry out the subject method (e.g., instructions for preparing and / or using the drug combination described herein). Instructions for carrying out the subject method are typically recorded on a suitable recording medium. For example, instructions may be printed on a substrate such as paper or plastic. Thus, instructions may exist in the form of a package insert within the pharmaceutical box, or on a label of the container of the pharmaceutical box or its components (i.e., components associated with the packaging or sub-package). In some embodiments, instructions are present as a suitable computer-readable storage medium (e.g., CD). Electronic storage data documents exist on ROM, disks, etc. In other embodiments, the actual instruction manual is not present in the pillbox, but means are provided for obtaining the manual from a remote source, such as via the Internet. An example of this embodiment is a pillbox that includes a URL where the manual is located and / or from which the manual can be downloaded.
[0045] Those skilled in the art will understand that while specific nucleotide sequences are provided in this invention, it should be understood that these nucleotide sequences include conserved sequence variants, such as sequences having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% identity. The nucleotide sequences can be optimized through truncation, base substitution, base deletion, etc., as long as the optimized nucleotide sequence retains its corresponding function, all of which should be within the equivalent protection scope of this invention. In this document, unless otherwise specified, the orientation of the nucleotide sequence is from the 5' to the 3' end. In accordance with the requirements for sequence listing documents, the "U" in the RNA sequence herein is replaced with "T" in the sequence listing.
[0046] This invention includes the following aspects: Discovery and Clinical Significance of F-circP3F: This invention identifies a circular RNA, F-circP3F, in ARMS patient tissues. Multiple techniques, including qRT-PCR and ddPCR, confirmed its high specific expression in ARMS tissues and its significant association with lymph node metastasis, distant metastasis, and poor overall survival in PAX3-FOXO1-positive patients, suggesting that F-circP3F could serve as a potential independent prognostic molecular marker for ARMS.
[0047] Molecular characteristics and functions of F-circP3F: Experiments have confirmed that F-circP3F possesses a typical circular structure, exhibiting higher stability and less susceptibility to degradation compared to linear PAX3-FOXO1 mRNA, and is primarily localized in the cytoplasm. Functional studies have shown that F-circP3F promotes the proliferation, migration, invasion, and epithelial-mesenchymal transition (EMT) of ARMS cells in vitro, and inhibits apoptosis; in vivo tumorigenesis experiments in nude mice also demonstrated a significant pro-tumor growth effect.
[0048] Elucidation of the ceRNA mechanism: This invention elucidates the ceRNA adsorption mechanism of F-circP3F as a molecular sponge (miRNA sponge) for miR-326. Through bioinformatics prediction and a series of experimental verifications (including RNA-FISH, RIP, RNA pull-down, and dual-luciferase reporter gene experiments), it was confirmed that F-circP3F can directly bind to miR-326 and negatively regulate its expression.
[0049] Establishment of the signaling axis: Further research revealed that the direct downstream target gene of miR-326 is the oncogene GLI1. F-circP3F upregulates GLI1 expression by adsorbing miR-326, thereby relieving its inhibition of GLI1. Furthermore, GLI1 was found to interact with PI3K and activate the PI3K / AKT / mTOR pathway, forming the "F-circP3F / miR-326 / GLI1 / PI3K-AKT-mTOR" oncogenic signaling axis, driving the malignant progression of ARMS.
[0050] Validation of Targeted Therapy Strategy: Based on the above mechanism, this invention validates a combined therapy strategy targeting this signaling axis. In in vitro and in vivo experiments, the combined use of the GLI1 inhibitor (GANT61) and the PI3K inhibitor (LY294002) exhibited a synergistic anti-tumor effect, significantly inhibiting tumor cell proliferation and migration, inducing apoptosis, and effectively suppressing tumor growth in a nude mouse xenograft model, providing solid experimental evidence for the development of ARMS-targeted therapies against the F-circP3F signaling axis.
[0051] The technical solution of the present invention will be clearly and completely described below with reference to the embodiments. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0052] The cell culture, molecular biology, immunology, microbiology, genetics, analytical chemistry, organic synthetic chemistry, medical and medicinal chemistry, and protein and nucleic acid hybridization described herein are well-known and widely used by those skilled in the art. Unless otherwise stated, all reagents used in the examples are commercially available or prepared according to conventional or disclosed methods and are ready for direct use without further processing; similarly, the instruments used in the examples are commercially available. Unless otherwise stated, molecular biology reagents are used according to the manufacturer's specifications.
[0053] Example 1. Expression characteristics and clinical significance of F-circP3F in patients with alveolar rhabdomyosarcoma Formalin-fixed paraffin-embedded (FFPE) tissue samples from 45 rhabdomyosarcoma (RMS) cases were collected for FOXO1 rearrangement testing. The sample composition included 25 cases of ARMS, 17 cases of embryonic RMS (ERMS), 6 cases of polymorphic RMS (PRMS), and 1 case of spindle cell RMS (SRMS).
[0054] First, DNA FISH technology was used to detect the rearrangement of FOXO1 in ARMS and ERMS samples. The PAX3-FOXO1 probe was an FKHR(13q14) gene breakage probe (fluorescence in situ hybridization) (catalog number: F.01018-01, Anbiping). The detection results are as follows: Figure 1 As shown in Figure A.
[0055] The expression level of PAX3-FOXO1 mRNA was then systematically evaluated using real-time quantitative PCR (qRT-PCR) and droplet digital PCR (ddPCR). The qRT-PCR method followed CN114182023A. The primer sequences used in ddPCR were: forward primer: TACAGACAGCTTTGTGCCTC (SEQ ID NO: 5); reverse primer: AACTTGCTGTGTAGGGACAG (SEQ ID NO: 6); probe sequence: CY5-TTCGTCATAATCTGTCCCTACACAGCA-BHQ2 (SEQ ID NO: 7). The results of qRT-PCR and ddPCR are shown below. Figure 1 B and Figure 1 As shown in C.
[0056]
[0057] Subsequently, the positive expression of F-circP3F was detected by one-step RT-PCR, qRT-PCR, and ddPCR. Figure 1 (DF). The one-step RT-PCR and qRT-PCR methods are based on CN114182023A. The primer sequences used in ddPCR are: forward primer: GGGTGTCAGGCTGAGGGTTA (SEQ ID NO: 8); reverse primer: TGTTCTGCTGTGAAGGTGGTT (SEQ ID NO: 9); probe sequence: FAM-AGTGAGCAGCCTCAGCACCCCAATCAGAT-BHQ1 (SEQ ID NO: 10). Notably, ddPCR technology exhibits higher detection sensitivity compared to traditional RT-PCR or qRT-PCR methods (Table 1). These results provide important evidence for a deeper understanding of the molecular characteristics and clinical value of F-circP3F in ARMS.
[0058] KM correlation analysis showed that F-circP3F expression was associated with lymph node metastasis and distant metastasis. Similarly, PAX3-FOXO1 expression was also associated with distant metastasis, and the overall survival of F-circP3F-positive patients was significantly shorter than that of F-circP3F-negative patients. Figure 2 A), similar to PAX3-FOXO1 positive patients ( Figure 2 B). These results suggest that F-circP3F may serve as a novel molecular biomarker for prognostic assessment in ARMS patients.
[0059] Example 2. Circulation, stability, and positioning of F-circP3F Based on the observation in Example 1 that the expression of F-circP3F in ARMS patient tissues indicated a poor prognosis, this example explores the cyclization, stability, and localization of F-circP3F.
[0060] To verify that F-circP3F is a circular RNA formed by reverse splicing of the PAX3-FOXO1 gene transcript, cDNA and gDNA were extracted from RH30 cells, and PCR amplification was performed using divergent and convergent primers targeting F-circP3F and β-actin (primer information is shown in Table 2). RT-PCR results showed that the divergent primers specifically amplified the F-circP3F band only in cDNA, while no corresponding product was observed in gDNA; in contrast, β-actin was stably detected in both cDNA and gDNA using the convergent primers. Figure 3 A). The above results demonstrate that F-circP3F is a post-transcriptional circular RNA. Furthermore, qRT-PCR experiments performed on RH30 cells treated with actinomycin D showed that linear PAX3-FOXO1 mRNA degraded rapidly, while F-circP3F remained relatively stable, indicating that the F-circP3F transcript is more stable than PAX3-FOXO1 mRNA. Figure 3 B). The primer sequences used for PAX3-FOXO1 in this qRT-PCR experiment are: forward primer: TACAGACAGCTTTGTGCCTC (SEQ ID NO: 5); reverse primer: AACTTGCTGTGTAGGGACAG (SEQ ID NO: 6). The primer sequences used for F-circP3F in this qRT-PCR experiment are: forward primer: GGGTGTCAGGCTGAGGGTTA (SEQ ID NO: 8); reverse primer: TGTTCTGCTGTGAAGGTGGTT (SEQ ID NO: 9). The primer sequences used for GAPDH in this qRT-PCR experiment are: forward primer: GGAGCGAGАТСССТССАAAAТ (SEQ ID NO: 15); reverse primer: GGCTGTTGTCATACTTCTCATGG (SEQ ID NO: 16). Similarly, RNase R exonuclease assays showed that PAX3-FOXO1 mRNA was degraded, while F-circP3F remained unaffected, further confirming the cyclization properties of F-circP3F. Figure 3 C).
[0061] Table 2. PCR primer sequence listing
[0062] Regarding the subcellular localization of F-circP3F in ARMS cells and tissues, after isolating the nucleus and cytoplasm of RH30 cells, western blot and qRT-PCR showed that F-circP3F was mainly located in the cytoplasm of RH30 cells. Figure 4 A), this was confirmed by RNA fluorescence in situ hybridization (RNA-FISH) of ARMS cells (18S rRNA hybridization probe: Biotin-CTTCCTTGGATGTGGTAGCCGTTTC (SEQ ID NO: 17), U6 hybridization probe: Biotin-5'-TTGCGCAGGGGGCCATGCTAATCTTCT (SEQ ID NO: 18), F-circP3F hybridization probe: Biotin-CATCTGATTGGGGTGCTGAGGCTGCTACCCTCAGCCT (SEQ ID NO: 19)). Figure 4 B). RNA-FISH results from human ARMS tissue showed that F-circP3F was also mainly localized in the cytoplasm of tumor cells. Figure 4 C). These results indicate that F-circP3F is a stable circular RNA that is primarily located in the cytoplasm of ARMS cells.
[0063] Example 3. F-circP3F promotes the proliferation of ARMS and ERMS cells and the EMT process in vitro. Based on the exploration of F-circP3F expression and characteristics in Examples 1 and 2 above, this example examines the effect of F-circP3F on cell biological behavior in vitro.
[0064] Stable RH30 cell lines with silenced F-circP3F and stable RD cell lines with overexpression of F-circP3F were constructed. F-circP3F overexpression lentiviral vector (F-circP3F) and overexpression control lentiviral vector (NC), as well as F-circP3F silenced lentiviral vector (sh-F-circP3F) and silenced control lentivirus (sh-NC), were all purchased from Shanghai Jima Gene Chemical Technology Co., Ltd. The specific DNA sequence corresponding to sh-F-circP3F is as follows: AGGGTTAGTGAGCAGCCTCAG (SEQ ID NO: 1). The F-circP3F overexpression vector includes a single copy of the full-length F-circP3F sequence with added circular structures. First, this example investigated the effect of F-circP3F on cell proliferation. EdU detection results showed that, compared with control cells, knockdown of F-circP3F in RH30 cells significantly reduced the proportion of EdU-positive cell nuclei, while overexpression of F-circP3F in RD cells showed the opposite effect. Figure 5 A). Secondly, the effect of F-circP3F on apoptosis was investigated. TUNEL assays and flow cytometry showed that decreased F-circP3F levels promoted apoptosis in RMS cells, while increased F-circP3F levels had the opposite effect. Figure 5 B). To investigate whether F-cirP3F is involved in the epithelial-mesenchymal transition (EMT) process in ARMS, immunofluorescence (IF) staining and Western blotting were used to detect the expression of EMT-related markers. IF staining showed that F-cirP3F enhanced the fluorescence intensity of mesenchymal markers (N-cadherin, Vimentin, Slug) and decreased the fluorescence intensity of epithelial marker (E-cadherin). Figure 5C). Western blot showed that downregulated F-circP3F significantly increased the expression of E-cadherin and ZO-1, but decreased the expression of N-cadherin, Vimentin, Snail, Slug, and ZEB1. Figure 5 D). In summary, these in vitro experiments demonstrate that F-circP3F can promote cell proliferation, inhibit apoptosis, and promote the EMT process in ARMS cells.
[0065] Example 4. F-circP3F promotes tumor formation in nude mice in vivo. To further investigate the effect of F-circP3F on RMS progression in vivo, two BALB / c nude mouse models were constructed in this embodiment: one group was inoculated with 4 × 10⁴ RH30 cells stably interfered with F-circP3F (sh-F-circP3F) or empty vector control (sh-NC) (same as in Example 3). 6 / 100μl, another group was inoculated with RD cells overexpressing F-circP3F (OE-F-circP3F) or empty vector (NC) (same as Example 3) 1×10 7 / 100μl. Tumor volume changes were monitored every three days after inoculation. Results showed that in the RH30 model, tumor development in the sh-F-circP3F group was later than in the control group, and the tumor growth rate was significantly slower. Figure 6 A); while in the RD model, although tumor formation in the OE-F-circP3F group was slightly later than in the control group, the subsequent growth rate was significantly faster ( Figure 6 B).
[0066] When the tumor volume reached 1 cm³, in vivo imaging showed that the tumor fluorescence intensity in the sh-F-circP3F group was weaker than that in the control group. Figure 7 A), while the OE-F-circP3F group was significantly stronger than the control group ( Figure 7 B). The mice were euthanized after the experiment. Gross observation showed that the tumor volume in the sh-F-circP3F group was smaller ( Figure 7 C), the tumor volume in the OE-F-circP3F group was larger ( Figure 7 (D) This trend is consistent with in vivo imaging results. Tumor weight detection showed that the average tumor weight in the sh-F-circP3F group was significantly lower than that in the control group (D). Figure 8 A), while the average tumor weight in the OE-F-circP3F group was significantly higher than that in the control group ( Figure 8 B). The above results suggest that F-circP3F promotes the growth and progression of RMS tumors in vivo.
[0067] Example 5. F-circP3F acts as a competitive ceRNA sponge for miR-326 This embodiment investigates whether F-circP3F exerts its pro-tumorigenic effect by binding to miRNAs and acting as a competitive endogenous RNA (ceRNA). Based on the classic "miRNA sponge" mechanism of circRNAs, and combined with the results found in Examples 1-4 that F-circP3F can promote the progression of rhabdomyosarcoma (RMS) in vitro and in vivo, five databases (miRanda, RNAhybrid, targetscan, circInteractome, and circbank) were used to screen for potential miRNA binding sites on F-circP3F. Four candidate miRNAs were screened. qRT-PCR results showed that in RH30 cells, hsa-miR-769-3p expression was downregulated, while hsa-miR-326, hsa-miR-330-5p, and hsa-miR-941 expression was upregulated, with miR-326 showing the most significant change. Figure 9 (A), therefore it was selected as the subject of subsequent research.
[0068] To confirm the direct binding between F-circP3F and miR-326, several experiments were conducted in this embodiment: RNA-FISH showed that the two co-localized in the cytoplasm of RH30 cells. Figure 9 B); Ago2 RIP experiments confirmed that F-circP3F can be co-enriched with miR-326 in the RISC complex (B); Figure 9 C); RNA pull-down experiments based on biotin-labeled miR-326 further demonstrated that F-circP3F could be directly pulled by miR-326 ( Figure 9 D). Dual-luciferase reporter assays also showed that miR-326 could inhibit the luciferase activity of the wild-type F-circP3F reporter gene (the 3' UTR sequence of wild-type F-circP3F is GGGAGGAACTGGCCCAGAGGGCGAAGCTCA (SEQ ID NO: 20), which can bind to a portion of the miR-326 sequence GACCUCCUUCCCGGGUCUCCGCUAGACUCG (SEQ ID NO: 21)). This effect was significantly weakened after mutation of its binding site (the 3' UTR sequence of the mutated F-circP3F is GGGAGGAACTCCGGGTCTCCGCGAAGCTCA (SEQ ID NO: 22)). Figure 9 EF). Furthermore, miR-326 expression was increased in RH30 cells with sh-F-circP3F (EF). Figure 9G), while its expression is suppressed in RD cells that overexpress F-circP3F (G), Figure 9 H), further illustrating the mutual regulatory relationship between the two.
[0069] To clarify whether F-circP3F regulates the malignant phenotype of RMS by adsorbing miR-326, this embodiment further conducted a reversal experiment. In RH30 cells, interference with F-circP3F inhibited cell proliferation, migration, and invasion and promoted apoptosis, while co-transfection with a miR-326 inhibitor (a plasmid containing hsa-miR-326, the single-stranded oligonucleotide sequence of hsa-miR-326 is CUGGAGGAAGGGCCCAGAGG (SEQ ID NO: 4)) reversed the above effects; in RD cells, overexpression of F-circP3F enhanced proliferation, migration, and invasion, and inhibition of miR-326 further aggravated this phenotype. Figure 10 AF). Immunofluorescence results showed that interfering with F-circP3F inhibited epithelial-mesenchymal transition (EMT), while inhibition of miR-326 counteracted this effect. Figure 10 G); Correspondingly, overexpression of F-circP3F promotes EMT, a process further enhanced upon inhibition of miR-326 (G). Figure 10 H).
[0070] In summary, this embodiment systematically elucidates the molecular mechanism by which F-circP3F promotes RMS cell proliferation, migration, invasion, and EMT processes by directly binding to miR-326 and acting as ceRNA, providing new experimental evidence for understanding the regulatory role of circRNA in RMS progression.
[0071] Example 6. Competitive binding of F-circP3F and miR-326 to GLI1 modulates RMS function To identify new downstream molecules, four bioinformatics databases (miRWalk, diana-microt, miRDB, and TargetScan) were analyzed to predict potential targets of miR-326. The analysis revealed 55 genes, including GLI1, as potential target genes of miR-326. Figure 11 A). Using the Uniprot database (https: / / www.uniprot.org) to predict protein structures, it was found that miR-326 forms hydrophobic bonds with ESR159, ARG161, LEU179, LYS180, and LYS2837 in the GLI1 molecule. Figure 11 B).
[0072] Furthermore, IF and RNA FISH experiments showed that miR-326 and GLI1 proteins were co-localized in the cytoplasm of RH30 cells. Figure 12 A). Subsequently, RNA immunoprecipitation (RIP) experiments were performed to verify the interaction between miR-326 and GLI1 in RH30 cells. Figure 12 BC). Pull-down experiments using biotin-labeled miR-326 further confirmed the above hypothesis ( Figure 12 D). Finally, the luciferase reporter gene assay showed that co-transfection with miR-326 significantly inhibited the expression of GLI1-driven luciferase (where the 3' UTR sequence of GLI1 is AÇATGAGGTGCCCAGGGATG (SEQ ID NO: 23), which can bind to a partial sequence of miR-326, UGUGGUUACGGGUCCCUACGC (SEQ ID NO: 24)). Figure 12 These observations in different experiments confirm that miR-326 can directly interact with GLI1.
[0073] To investigate the regulatory role of the F-circP3F / miR-326 axis on the downstream target gene GLI1, overexpression and inhibition of miR-326 were performed in RH30 and RD cells, respectively, and changes in GLI1 mRNA expression were detected. The results showed that after transfection of RH30 cells with a plasmid containing a miR-326 mimic (hsa-miR-326 double-stranded mimic, sense strand: CCUCUGGGCCCUUCCUCCAG (SEQ ID NO: 2), antisense strand: GGAGGAAGGGCCCAGAGGUU (SEQ ID NO: 3)), GLI1 mRNA levels decreased. Figure 13 A); and after transfecting RD cells with a miR-326 inhibitor (a plasmid containing hsa-miR-326, the sequence of hsa-miR-326 is: CUGGAGGAAGGGCCCAGAGG (SEQ ID NO: 4)), the level of GLI1 mRNA increased ( Figure 13 B). To further verify whether F-circP3F regulates GLI1 expression by competitively binding to miR-326, a reversion experiment was conducted. In RH30 cells, interfering with F-circP3F reduced GLI1 protein expression, while co-transfection with a miR-326 mimic alleviated this downregulation effect, and a miR-326 inhibitor further enhanced this effect. Figure 13 C). In RD cells, overexpression of F-circP3F increases GLI1 protein levels; this effect can be inhibited by miR-326 overexpression but enhanced by miR-326 inhibitors. Figure 13D). The above results indicate that F-circP3F negatively regulates miR-326 in both RH30 and RD cells, and consequently positively regulates GLI1 expression, suggesting that F-circP3F relieves the inhibitory effect of miR-326 on GLI1 by adsorbing miR-326, thereby promoting GLI1 expression.
[0074] Furthermore, to investigate the function of GLI1 in the progression of rhabdomyosarcoma (RMS), a series of experiments, including EDU staining, CCK-8 assay, Transwell assay, scratch assay, and flow cytometry, were conducted to evaluate the effect of the GLI1-specific inhibitor GANT61 on the malignant phenotype of RMS cells. The results showed that, compared with the negative control, GANT61-treated RH30 and RD cells exhibited significantly reduced proliferation (…). Figure 14 AB), migration and invasion ( Figure 14 The ability to perform CD (crystal lysate) was significantly weakened, while the level of apoptosis was significantly enhanced. Figure 14 E).
[0075] Furthermore, rescue experiments were performed to verify that miR-326 exerts its effects through GLI1. EDU, TUNEL, flow cytometry, and Transwell assays showed that, compared to the negative control group, miR-326 inhibitors promoted the proliferation, migration, and invasion of RH30 cells, but inhibited apoptosis, while GLI1 inhibitors restored these effects of miR-326 inhibitors. These results were also consistently observed in different RD cell lines. Figure 15 To verify the role of miR-326 in promoting EMT via GLI1, an inductively coupled plasma exchange (IF) assay was performed. The results showed that downregulation of miR-326 significantly promoted the expression of the intermediate marker (Vimentin) in RH30 and RD cells, but decreased the expression of the epithelial marker (E-cadherin). Conversely, the addition of the GLI1 inhibitor (GANT61) significantly inhibited miR-326-induced EMT. Figure 15 E). In summary, these findings suggest that F-circP3F can act as a competitive intron RNA (ceRNA) of miR-326 to regulate GLI1 expression.
[0076] Example 7. Simultaneous inhibition of GLI1 and PI3K disrupts the proliferation of RMS cells in vivo and in vitro. The results of the above examples indicate that F-circP3F regulates GLI1 expression through miR-326. Other studies have reported the regulatory role of GLI1 on PI3K. Therefore, it is hypothesized that a "hierarchical regulation" relationship may exist between these molecules. Accordingly, this example investigates whether GLI1 can regulate the progression of RMS through the PI3K / AKT / mTOR signaling pathway. First, co-localization experiments were performed using IF technology. The results showed that, consistent with expectations, the distribution of GLI1 and PI3K molecules was consistent in RMS cells (RH30 and RD), mainly located in the cytoplasm, with a few located in the nucleus. Figure 16 A). Next, the co-immunoprecipitation (Co-IP) experiment showed that GLI1 and PI3K co-precipitated in RMS cells. Figure 16 B, 16C). Western blot analysis showed that the levels of GLI1, p-PI3K, p-AKT, and p-mTOR proteins in RH30 and RD cells treated with the GLI1 inhibitor (GANT61) were significantly reduced. Figure 16 D). After application of an effective PI3K inhibitor (LY294002), the levels of p-PI3K, p-AKT, and p-mTOR were significantly reduced ( Figure 16 E). To verify the reproducibility of these observations, a rescue experiment was performed. Western blot results showed that treatment of RMS cells with 740Y-P (a PI3K activator) increased p-PI3K expression (E). Figure 16 F. Upregulation of p-PI3K expression levels promotes cell proliferation and clonal capacity. Figure 16 GH), and reduced the number of apoptotic cells ( Figure 16 I). Therefore, this set of experiments shows that combined inhibition of the GLI1 and PI3K / AKT / mTOR phosphorylation pathways can synergistically disrupt the proliferation of RMS cells.
[0077] To evaluate the combined therapeutic effect of the inhibitors GANT61 and LY294002 on in vivo tumor growth, a subcutaneous xenograft model of RH30 cells was established in nude mice. On day 13 after tumor formation, when the tumor volume increased to approximately 50 mm... 3 At that time, the optimal dose of GANT61 (40 mg / kg) or LY294002 (100 mg / kg) or both compounds were administered intraperitoneally three times a week. In mice treated with the combination of GANT61 and LY294002, tumor volume and tumor weight were significantly reduced compared with mice treated with inhibitors alone or in the untreated control group. Figure 17AC). Mice treated with the combination of GANT61 and LY294002 showed significantly better therapeutic effects than the control group and mice treated with either GANT61 or LY294002 alone. Interestingly, in the GANT61 plus LY294002 combination therapy group, tumor growth completely ceased during treatment. Figure 17 D). Mice that tolerated GANT61, LY294002, or a combination of both showed only slight weight loss but no obvious signs of toxicity. Figure 17 E). Furthermore, Western blot analysis showed that GANT61 inhibited the expression of GLI1, p-PI3K, p-AKT, and p-mTOR. Figure 17 These observations suggest that the combination therapy of GANT61 and LY294002 can significantly improve the anti-tumor efficacy of xenograft tumor treatment by dually inhibiting the GLI1 and PI3K / AKT / mTOR phosphorylation pathways.
[0078] In summary, this invention systematically reveals for the first time the crucial role of F-circP3F and its ceRNA regulatory network in the development and progression of ARMS, and validates the therapeutic strategy of targeting the F-circP3F / miR-326 / GLI1 / PI3K-AKT-mTOR axis. Figure 18 This not only provides new molecular markers for the diagnosis, prognostic assessment, and treatment monitoring of ARMS, but also opens up new avenues for targeted therapy of the disease.
[0079] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.
Claims
1. Application of agents targeting the F-circP3F / miR-326 / GLI1 / PI3K-AKT-mTOR axis in the preparation of drugs or kits for the treatment of rhabdomyosarcoma.
2. The application according to claim 1, characterized in that, The agents include F-circP3F inhibitors, miR-326 promoters, GLI1 inhibitors, and / or PI3K inhibitors.
3. The application according to claim 1, characterized in that, The agent includes an F-circP3F inhibitor, which is selected from one or more small interfering RNAs, short hairpin RNAs, antisense oligonucleotides, and CRISPR gene editing systems that target F-circP3F; preferably, the agent includes a nucleotide sequence as shown in SEQ ID NO:
1.
4. The application according to claim 1, characterized in that, The agent includes a miR-326 promoter, which includes a miR-326 mimic; preferably, the nucleotide sequence of the miR-326 mimic is shown in SEQ ID NO: 2 and SEQ ID NO:
3.
5. The application according to claim 1, characterized in that, The agent includes a GLI1 inhibitor; preferably, the GLI1 inhibitor is selected from one or more of GANT61, arsenic trioxide, vemodilution, curcumin and cyclophosphamide.
6. The application according to claim 1, characterized in that, The agent includes a PI3K inhibitor; preferably, the PI3K inhibitor is selected from one or more of LY294002, edralani, cupannisic, duvelisse, apeliximab, and blisseu.
7. The application according to claim 1, characterized in that, The agent includes a GLI1 inhibitor and a PI3K inhibitor; preferably, the GLI1 inhibitor is GANT61 and the PI3K inhibitor is LY294002.
8. A pharmaceutical composition or pillbox, characterized in that, This includes nucleotide sequences as shown in SEQ ID NO: 1 or double-stranded RNA or its DNA sequence as shown in SEQ ID NO: 2 and SEQ ID NO:
3.
9. A drug combination or pillbox, characterized in that, It includes a GLI1 inhibitor and a PI3K inhibitor; preferably, the GLI1 inhibitor is GANT61 and the PI3K inhibitor is LY294002.
10. The use of a detection reagent for the F-circP3F / miR-326 / GLI1 / PI3K-AKT-mTOR axis in the preparation of a kit for the diagnosis, prognostic assessment, or treatment monitoring of rhabdomyosarcoma; preferably, the detection reagent comprises a detection reagent for F-circP3F and miR-326; preferably, the detection reagent comprises a detection reagent for GLI1, p-PI3K, p-AKT, and / or p-mTOR.
Citation Information
Patent Citations
Tape recording and / or reproducing apparatus
CA1327533C
Molecular marker of rhabdomyosarcoma fusion gene related circular RNA and application of molecular marker
CN113981101A
Kit and method for detecting F-circP3F in rhabdomyosarcoma
CN114182023A