Application of Tie1 in grass carp reovirus type II as a receptor

Abstract

The application belongs to the technical field of fish disease resistance genes or the field of viruses, and discloses application of Tie1 in serving as a receptor of grass carp reovirus type II. The applicant finds that knocking down and overexpressing a Tie1 gene in a sensitive cell line affects the load of grass carp reovirus type II. Experiments prove that fish Tie1 has the functions of promoting virus adhesion and invasion, and knocking down the gene can effectively reduce virus adhesion to host cells and inhibit GCRV-II infection. Therefore, the Tie1 gene can serve as a new target for preventing and treating GCRV-II infection, be used for preparing a preparation for preventing or treating anti-GCRV-II infection, or be used for a cell model for resisting GCRV-II infection or gene editing of a new grass carp variety.

Description

Technical Field

[0001] This invention belongs to the field of fish disease resistance gene technology or the field of viruses, specifically involving the application of Tie1 as a receptor for grass carp reovirus type II. Background Technology

[0002] Tyrosine kinase with immunoglobulin-like and EGF-like domains 1 (Tie1) is a highly conserved transmembrane glycoprotein and a vascular endothelial cell-specific receptor tyrosine kinase that plays a crucial regulatory role in angiogenesis, vascular homeostasis maintenance, and remodeling. Recent studies have found that Tie1 is primarily an endothelial cell-specific receptor, indirectly participating in immune responses by regulating angiogenesis and maturation, suggesting its potential involvement in the cross-regulatory mechanism between pathogen recognition and host immune responses.

[0003] Grass carp reovirus (GCRV) causes grass carp hemorrhagic disease (GCHD). The GCRV-II genotype is highly pathogenic, has a short incubation period, and can cause widespread hemorrhage in multiple organs, including the gills, muscles, and intestines, resulting in high mortality. Current control measures for GCRV-II are limited, with the key bottleneck being the unclear molecular basis of viral invasion of host cells, particularly the unidentified functional receptors mediating specific adsorption and transmembrane invasion. This restricts the development of targeted antiviral strategies and resistant strains.

[0004] Identifying the key molecules upon which viruses enter host cells is fundamental to understanding viral pathogenic mechanisms and achieving precise prevention and control. Current research is primarily limited to validating the infectivity of GCRV-II in grass carp cell lines, lacking direct functional evidence of conferring infectivity to non-permitted cell lines through receptor remodeling. This makes it difficult to identify key host factors at the molecular level that viral invasion depends on. Our single-cell transcriptome analysis revealed that GCRV-II primarily targets and infects epithelial cells, while the receptor tyrosine kinase Tie1 is significantly highly expressed in vascular endothelial cells. This difference and correlation between cell tropism and receptor distribution provides important clues that Tie1 may be involved in the specific recognition and invasion of GCRV-II. However, to date, Tie1 has not been reported as a key functional receptor mediating GCRV-II invasion of host cells. Identifying and validating the core host factors in the GCRV-II infection process will provide clear molecular targets for screening anti-GCRV-II drugs, rationally designing receptor-guided vaccines, and precisely breeding disease-resistant grass carp, possessing significant scientific value and application prospects. Summary of the Invention

[0005] The purpose of this invention is to provide the application of an inhibitor targeting the fish Tie1 protein in the preparation of a drug for the treatment or prevention of grass carp reovirus type II (GCRV-II) infection.

[0006] To achieve the above objectives, the present invention adopts the following technical measures:

[0007] The applicant discovered that the in vitro purified recombinant GCRV-II structural proteins VP4 and VP35 can specifically bind to the Tie1 protein in fish (e.g., grass carp); knockdown and overexpression of the grass carp Tie1 gene in GCRV-II-sensitive grass carp cell lines can affect viral load. Furthermore, reconstructing the grass carp Tie1 gene in the GCRV-II-permissive cell line 293T endowed 293T cells with GCRV-II infectivity. These results demonstrate that Tie1 is a key receptor for GCRV-II virus infection in grass carp.

[0008] The scope of protection of this invention includes:

[0009] Application of inhibiting the expression of the Tie1 gene in fish in the preparation of transgenic fish resistant to reovirus type II infection.

[0010] The above-described application involves introducing a substance that inhibits or prevents the expression of the Tie1 gene in fish into the fish. The substance is an expression cassette, recombinant vector, or recombinant microorganism that inhibits the expression of the Tie1 gene in fish.

[0011] The above-mentioned methods of inhibition include: DNA methylation, histone deacetylation or modification such as H3K27me3, blocking RNA polymerase activity, CRISPRi, RNA interference (RNAi), antisense oligonucleotides (ASO), translation inhibitors, upstream open reading frame editing, gene editing technology, ribozyme methods or triple-stranded DNA technology.

[0012] Application of reagents for detecting the Tie1 gene in fish in the screening or breeding of transgenic fish resistant to reovirus type II.

[0013] The method for determining the application described above is as follows: fish that do not have the gene detected or whose gene expression level is significantly reduced compared to normal are reovirus type II resistant transgenic fish.

[0014] Application of inhibitors targeting proteins encoded by the fish Tie1 gene in the preparation of drugs for the treatment or prevention of GCRV-II infection.

[0015] Application of overexpression of fish Tie1 gene in constructing a drug screening model against grass carp reovirus type II;

[0016] The above-described applications involve overexpressing the Tie1 protein in fish or cell lines to prepare a drug screening model sensitive to grass carp reovirus type II.

[0017] The above-mentioned drug screening model was applied in the preparation of grass carp reovirus type II vaccine.

[0018] In the above-described applications, preferably, the fish is grass carp or rare gudgeon, the protein encoded by the Tie1 gene of grass carp is shown in SEQ ID NO.2, and the protein encoded by the Tie1 gene of rare gudgeon is shown in SEQ ID NO.3.

[0019] Compared with the prior art, the present invention has the following advantages:

[0020] This invention provides Tie1, a key receptor for grass carp reovirus type II (GCRV-II) infection in grass carp. The in vitro purified recombinant structural proteins VP4 and VP35 of GCRV-II specifically bind to the Tie1 protein; knockdown and overexpression of the Tie1 gene in sensitive cell lines affect viral load. Furthermore, using rare gudgeon as a model, gene editing technology was employed to knock out the Tie1 gene, and the results showed that heterozygotes with knockout of this host protein significantly inhibited GCRV-II infection in rare gudgeon. This provides a foundation for disease-resistant breeding in grass carp and also offers important reference value for disease-resistant breeding in other farmed fish species. Attached Figure Description

[0021] Figure 1 SPR interaction of viral capsid proteins VP4, VP35 and Tie1.

[0022] Figure 2 Changes in viral load due to knockdown and overexpression in GCB75-sensitive cell lines.

[0023] Figure 3 Non-permissive cell lines that overexpress the Tie1 gene allow GCRV-II virus to enter.

[0024] Figure 4 This is a schematic diagram of the target mutation sites of the Tie1 gene.

[0025] Figure 5 It is a rare wild gudgeon Tie1 + / + and Tie1 + / - Survival rate of rare gudgeon infected with GCRV-II.

[0026] Figure 6 It is a rare wild gudgeon Tie1 + / + and Tie1 + / -Phenotype of rare gudgeon infected with GCRV-II. Detailed Implementation

[0027] Unless otherwise specified, the technical solutions described in this invention are all conventional methods in the art; the reagents or materials used, unless otherwise specified, are all from commercial sources. The application methods of this invention are applicable not only to grass carp and rare gudgeon, but also to other fish species. Other GCRV-II susceptible fish (such as black carp Mylopharyngodon piceus and zebrafish Daniorerio (GenBank: NM_001442781.1)) also possess the same function, but due to space limitations, they will not be described further in the embodiments of this application. Those skilled in the art can verify and apply the methods provided by this invention based on the Tie1 gene sequences of various species.

[0028] Example 1:

[0029] SPR interaction between GCRV-II virus capsid proteins VP4 and VP35 and grass carp Tie1 protein:

[0030] The VP4 protein sequence is available in GenBank: PQ553631.1.

[0031] The VP35 protein sequence is available in GenBank: PQ553636.1.

[0032] The grass carp Tie1 protein is shown in SEQ ID NO.2.

[0033] (1) Amino-coupled protein

[0034] The experiment used 1×HBS-EP+ (pH 7.4) buffer as the run buffer. Following the amino-coupling kit, protein A was coupled to channels 3 and 4 of the CM5 chip at a flow rate of 10 μL / min. First, the chip surface was activated with freshly prepared 1:1 50 mM N-Hydroxysuccinimide (NHS) and 200 mM 1-Ethyl-3 (3-Dimethylaminopropy) Carbodiimid Hydrochloride (EDC) for 420 s. Then, protein A was diluted to 30 μg / mL with 10 mM pH 4.5 sodium acetate and flowed through channels 3 and 4 of the chip for 1800 s. Finally, the chip was blocked with Ethanolamine-HCl for 420 s. The final coupling level of protein A in channel 3 was approximately 17000 RU, and the coupling level in channel 4 was approximately 18000 RU.

[0035] (2) Solvent correction

[0036] Solutions containing 4% DMSO, 5% DMSO, and 6% DMSO were prepared using PBST (0.05% P20) solution. Then, solvent calibration curve solutions (unit: μL) were prepared by mixing the 4% and 6% DMSO solutions in a certain proportion.

[0037] (3) Combined with experiments

[0038] When analyzing the interaction between VP4, VP35, and Tie1 proteins, PBST (0.05% P20, 5% DMSO) solution was used as the run and dilution buffer. First, the small molecule was dissolved in DMSO to prepare a 10 mM solution. Then, the solution was diluted 20-fold with PBST (0.05% P20) to a DMSO concentration of 5%. Serial dilutions were then performed using the same 5% DMSO dilution buffer. During the experiment, channel 1 was used as the reference channel, and channels 3 and 4 were used as active channels. The diluted Tie1 protein was injected sequentially into channels 1, 2, 3, and 4 according to the concentration gradient, using a multi-cycle kinetic mode.

[0039] The results are as follows Figure 1 As shown, the SPR results indicate that VP4, VP35 proteins interact with Tie1 protein.

[0040] Therefore, the Tie1 protein is considered to be the binding receptor for GCRV-II virus.

[0041] Example 2:

[0042] The effect of intracellular Tie1 gene expression level on GCRV-II viral load:

[0043] The applicant investigated the effect of Tie1 gene expression on GCRV-II viral load in fish cells by knocking down or overexpressing the grass carp Tie1 gene in GCRV-II-sensitive GCB75 cell lines.

[0044] (1) Cell preparation

[0045] Grass carp brain astrocyte cell line GCB75 (CN120699903A) was cultured using conventional cell culture methods. Once the cells were in good condition and reached a density suitable for transfection, they were used for subsequent experiments.

[0046] (2) Plasmid construction and overexpression treatment

[0047] The grass carp Tie1 gene (shown in SEQ ID NO.1) was inserted into the p3×FLAG-CMV-14 vector (Invitrogen) by restriction endonuclease digestion combined with recombination ligation, so that the Tie1 gene and the 3×FLAG tag are in the same reading frame, and the recombinant expression plasmid pCMV-3×FLAG-Tie1 was constructed.

[0048] p3×FLAG-CMV-14 empty vector was used as a blank control.

[0049] The recombinant vector and empty vector were transfected into GCB75 cells to obtain Tie1 gene overexpression group and control group cells, respectively. After transfection, the cells were cultured at 28°C to ensure effective expression of the target protein.

[0050] (3) siRNA synthesis and Tie1 gene knockdown treatment

[0051] Specific small interfering RNA (siRNA) targeting the Tie1 gene in grass carp was designed and synthesized to inhibit its expression in cells. The siRNA was synthesized by AuGCT Biotech Co., Ltd., and a random sequence NC that does not target any known gene sequence was designed and used as a negative control.

[0052] The sequence of the synthesized Tie1-siRNA is as follows:

[0053] HE-Tie1_si5a:UUCCGAACAUCAGCACUCGGATT

[0054] HE-Tie1_si5s: CGAGUGCUGAUGUUCGGAACATT.

[0055] The synthesized Tie1-siRNA and the negative control NC were transfected into the GCB75 cell line. Transfection was performed using standard nucleic acid transfection methods, and the cells were cultured under suitable conditions to achieve effective knockdown of the Tie1 gene.

[0056] After transfection, cells were cultured at 28°C for 2 days. Changes in Tie1 gene mRNA or protein expression levels were detected to verify the knockdown effect of small interfering RNA on the Tie1 gene. Tie1 knockdown group and negative control group cells were obtained for subsequent functional experiments.

[0057] (4) GCRV-II infection

[0058] After one day of overexpression and two days of knockdown, cells were gently washed once with PBS containing 1% penicillin antibody and then 500 μL of GCRV-II cytotoxic agent prepared in serum-free MEM medium (Gibco, catalog number C11095500BT) was added. The cells were then incubated at 28°C in a 5% CO2 incubator. One hour later, 500 μL of MEM medium containing 4% fetal bovine serum and 1% penicillin antibody was added to the culture flask for continued culture. Cells infected for one day were collected, and RIPA lysis buffer (Thermo Fisher Scientific) containing a protease inhibitor was added. Cells were lysed for 30 minutes, and the supernatant was collected for Western blotting to detect GCRV-II virus VP4 protein expression. The antibody used was rabbit anti-GCRV-II VP4 antibody, diluted 1:1000.

[0059] (5) Protein extraction and Western blot detection

[0060] Cells were collected and lysed to extract total protein. After protein quantification, SDS-PAGE electrophoresis and membrane transfer were performed. Tie1 expression level was detected using anti-Tie1 antibody (or anti-FLAG antibody), and expression level of virus infection-related proteins was detected using anti-GCRV-II VP4 antibody. β-actin was used as an internal control protein for sample loading calibration.

[0061] The results are as follows Figure 2 As shown, Western blot experiments revealed that in the sensitive cell line GCB75, cells overexpressing the Tie1 gene showed increased expression of the GCRV-II viral protein VP4 after viral infection. Figure 2 (Top-middle figure); Conversely, after knocking down the Tie1 gene in the sensitive cell line GCB75, viral infection revealed a decrease in the expression of the GCRV-II viral protein VP4, indicating that Tie1 has a significant effect on GCRV-II infection.

[0062] Example 3:

[0063] Non-permissive cell lines overexpressing the grass carp Tie1 gene allow GCRV-II virus to enter.

[0064] (1) Cell preparation

[0065] Healthy human embryonic kidney 293T cells (HEK293T cells) were seeded into 12-well plates containing glass slides and cultured overnight.

[0066] (2) Plasmid construction and overexpression treatment

[0067] The grass carp Tie1 gene (shown in SEQ ID NO.1) was inserted into the expression vector pTurboGFP-N with a fluorescent GFP tag by restriction endonuclease digestion and recombination ligation, so that the Tie1 gene and the GFP tag are in the same reading frame, and the recombinant expression plasmid pTurboGFP-N-Tie1 was constructed.

[0068] pTurboGFP-N empty vector was used as a blank control.

[0069] The recombinant vector and empty vector were transfected into HEK293T cells to obtain Tie1 overexpression group and control group cells, respectively. After transfection, the cells were cultured at 37°C to ensure effective expression of the target protein.

[0070] (3) GCRV-II infection

[0071] Cells were infected with GCRV-II virus filtrate, with an uninfected control group. One day after infection, cells were washed twice with PBS, then fixed with 4% paraformaldehyde at room temperature for 1 h. After washing three times with PBS, cells were treated with PBS containing 0.1% Triton® X 100 for 15 min. After washing three times with PBS, cells were blocked with PBS containing 3% BSA at 37°C for 1 h. After washing three times with PBS containing 1% BSA, cells were incubated overnight with rabbit anti-GCRV-II VP4 antibody at a dilution of 1:1000. After washing three times with PBS containing 1% BSA, cells were incubated overnight with Cy3-conjugated Goat anti-Rabbit IgG (H+L) antibody (purchased from ABclonal, catalog number A5007) at a dilution of 1:1000 for 1 h. After washing three times with PBS containing 1% BSA, cell nuclei were stained with blue fluorescent dye, i.e., NucBlue™ Fixed Cell. ReadyProbes™, abbreviated as DAPI (purchased from Invitrogen, catalog number R37606), was used to wash the cells three times with PBS containing 1% BSA, then mounted the slides. After the slides dried, they were photographed using a Leica fluorescence confocal microscope.

[0072] The results are as follows Figure 3 As shown in the results of immunofluorescence experiments, after overexpression of Tie1, the GCRV-II viral protein VP4 was distributed in the cell membrane and cytoplasm of the permissive cell line HEK293T. However, the GCRV-II viral protein VP4 was not present in the cell membrane and cytoplasm of the permissive cell line HEK293T overexpressing the empty pTurboGFP-N vector.

[0073] Example 4:

[0074] Application of inhibitors targeting the rare gudgeon Tie1 protein in the preparation of drugs for the treatment or prevention of GCRV-II infection:

[0075] 1. Selection of sgRNA targets

[0076] First, the complete Tie1 gene sequence was located using the genome of the rare gudgeon (the protein sequence encoded by the Tie1 gene in the rare gudgeon is shown in SEQ ID NO. 3). Based on the different sequences of Tie1 in the second exon, Tie1-specific knockout target sites were designed. Target sites were predicted and screened using http: / / crispor.tefor.net. The Tie1 target sequence selected in this invention is: CCAACTCTCCTGCATTTATGGAG, shown in SEQ ID NO. 4.

[0077] 2. Chemical synthesis of sgRNA

[0078] Tie1-sgRNA (containing the crRNA target sequence and the tracrRNA backbone sequence) was designed with the assistance of AuGCTBiotech Co., Ltd., and chemically synthesized using solid-phase chemical synthesis. The synthesized RNA was purified by high-performance liquid chromatography (HPLC) and confirmed by mass spectrometry. The purity was ≥90%. The sequence of the synthesized Tie1-sgRNA is shown in SEQ ID NO. 5.

[0079] 3. Microinjection

[0080] After mixing Cas9 RNA (0.75–1.25 ng per embryo) with sgRNA-Tie1 (0.075 ng per embryo), artificial insemination was performed using sperm from rare gudgeon and mature fish eggs. The mixture was injected into the fertilized rare gudgeon eggs using a nitrogen-pressurized PLI100A quantitative microinjection instrument (Warner), with approximately 200 eggs injected each time. Some uninjected eggs were left as a control. The injected eggs were then transferred to a hatching tank for incubation to obtain the F0 generation (Tie1 gene knockout chimeras).

[0081] 4. F0 target mutation efficiency detection and heritable screening

[0082] (1) Take the tail fins of 15 1-month-old fish fry from the injection group and the control group, mix them separately, add 40 µL NaOH (50 mM) lysis buffer using the alkaline lysis method, lyse at 90℃ for 40 min, then add 4 µL HCl (1 M) to terminate the reaction, and store as PCR template at 4℃ for later use.

[0083] (2) Using the above product as a template, a 524 bp fragment near the Tie1 target site was amplified by conventional PCR. The primers were F: TGTGTCAAAGCAGGAATGTGGA and R: GTCACCATACCTTTGCTGTAGT.

[0084] (3) Take 2 μL of PCR product for 1.5% agarose gel electrophoresis to verify the size of the target band. Send the PCR product to the sequencing company (Wuhan Hece Gene Technology Co., Ltd.) for sequencing. The results show that the sequencing peaks appear at the designed knockout target site. The PCR product is TA cloned. The sequencing results show a 2 bp deletion compared with the wild type, indicating that the knockout was successful.

[0085] 5. Screening of homozygous F1 adult fish carrying target site mutations

[0086] (1) The sperm of the F0 generation chimeric male fish that was successfully knocked out was artificially fertilized with rare wild-type female gudgeon and hatched to produce the F1 generation;

[0087] (2) Extract DNA from the tail fins of F1 generation fish fry using alkaline lysis method;

[0088] (3) PCR amplification was performed using the Tie1 target site detection primers. After verifying the band size by agarose gel electrophoresis, the PCR products were sent to a sequencing company for sequencing.

[0089] (4) The chimeric F0 obtained through screening produced fish that were the Tie1 heterozygous deletion mutant line F1. Ultimately, the heterozygous Tie1 gene-deleted rare gudgeon Tie1 was obtained. + / - It contains the mutated sequence: CCAACTCCTGCATTTATGGAG, as shown in SEQ ID NO.6, specifically as follows: Figure 4 As shown.

[0090] 6. GCRV-II infection experiment

[0091] (1) Wild-type rare gudgeon Tie1 + / + and the Tie1 knockout rare gudgeon prepared above (Tie1 + / - Rare gudgeon were kept in an aquarium measuring 40 cm × 40 cm × 30 cm, with the water temperature maintained at 26℃ (±1℃). The experimental fish were observed for any abnormalities after one week of rearing.

[0092] (2) Healthy rare gudgeon of approximately 1.5 g each, both wild-type and Tie1 knockout, were injected intraperitoneally with 30 μL (4.16 × 10⁻⁶ g) of each. 4 TCID 50 / mL) GCRV-II virus fluid, 30 tails per group.

[0093] (3) The aquaculture water should be kept at 26℃ (±1℃) and filtered continuously. Dead individuals should be removed in time to keep the water clean.

[0094] (4) Record the mortality of rare gudgeon every day after infection, and continue to count until 15 dpi (days postinfection).

[0095] (5) Use Prism8.0 to analyze the fish survival rate.

[0096] The results are as follows Figure 5 This indicates that the survival rate of rare gudgeon infected with GCRV-II in the WT group was 3.3% on day 15, while the survival rate in Tie1 was... + / - The survival rate of rare gudgeon was 33.3%, an increase of 30%, indicating that Tie1 + / - Rare gudgeon exhibits significantly enhanced resistance to GCRV-II virus infection.

[0097] To evaluate the role of the Tie1 gene in the in vivo anti-GCRV-II infection process, wild-type Tie1 was used... + / + Individuals and Tie1 heterozygous Tie1 + / - Individuals were challenged with GCRV-II virus under the same conditions, and the appearance and tissue damage of the fish were observed and compared at the same time point after infection.

[0098] Figure 6 The results showed that after the virus attack, Tie1 + / + Individuals exhibited typical symptoms of viral hemorrhagic disease, including obvious bleeding, surface damage, and tissue necrosis; however, under the same challenge conditions, Tie1... + / - The degree of external damage to individuals was significantly reduced, the body surface structure was relatively intact, and the degree of bleeding and tissue destruction was significantly lower than that of Tie1. + / + individual.

[0099] The above results indicate that under GCRV-II challenge conditions, the heterozygous state of the Tie1 gene can significantly alleviate the pathological phenotype caused by viral infection, suggesting that the Tie1 gene plays an important role in regulating the susceptibility and severity of grass carp to GCRV-II virus infection.

[0100] Example 5:

[0101] Application of grass carp tie1 protein inhibitors in the preparation of drugs for the treatment or prevention of GCRV-II infection:

[0102] 1. Preparation of grass carp ti1 protein

[0103] (1) Molecular docking prediction of the binding site between tie1 protein and GCRV-II capsid protein vp4

[0104] First, the amino acid sequence of grass carp tie1 (the protein sequence encoded by the grass carp Tie1 gene is shown in SEQ ID NO.2) and the amino acid sequence of GCRV-II capsid protein vp4 were searched using NCBI. Molecular docking was then performed using Alpha Fold software to predict the binding sites of grass carp tie1 and vp4.

[0105] (2) Molecular docking results showed that the extracellular domain of tie1 is the main binding region of vp4. Therefore, the eukaryotic expression of the His-tagged tie1 extracellular domain protein was performed, and the protein sequence is shown in SEQ ID NO.7.

[0106] 2. GCRV-II infection experiment

[0107] (1) Preparation of grass carp

[0108] Approximately 2g of healthy grass carp were raised in a cylindrical aquaculture tank with circulating water. The water and ambient temperature were maintained at 28℃ (±1℃). The experimental fish were observed for any abnormalities after one week of rearing.

[0109] (2) Preparation of GCRV-II virus

[0110] The eukaryotically purified grass carp tie1 protein from step 1 was combined with in vitro enriched GCRV-II cytotoxicity (4.16 × 10⁻⁶). 4 TCID 50 The mixture was incubated at 4°C for 1 h with His protein and GCRV-II virus incubated together. The control group was incubated with His protein and GCRV-II virus. The mixture was then injected into 30 grass carp that had been prepared in advance, with an injection volume of 75 μL / fish.

[0111] (3) The aquaculture water should be kept at 28℃ (±1℃) and filtered continuously. Dead individuals should be removed in time to keep the water clean.

[0112] (4) Record the mortality of each group of grass carp every day after infection, and continue to count until 15 dpi (days postinfection).

[0113] (5) Use Prism8.0 to analyze the fish survival rate.

[0114] The results showed that the survival rate of grass carp infected with GCRV-II in the Tie1 protein-blocked group was 26% on day 12, while the survival rate in the His control group was 4%, an increase of 22%, indicating that the grass carp in the receptor-blocked group had a significantly improved ability to resist GCRV-II virus infection.

[0115] The above results indicate that under GCRV-II challenge conditions, the Tie1 protein blocking state can significantly reduce viral infection in the host, suggesting that the Tie1 gene plays an important role in regulating the susceptibility of grass carp to GCRV-II virus infection.

[0116] The above embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit them. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of the technical features. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions claimed by the present invention.

Claims

1. Inhibit fish Tie1 Application of gene expression in the preparation of transgenic fish resistant to reovirus type II infection.

2. The application according to claim 1, wherein the application process involves inhibiting fish... Tie1 The substance that inhibits gene expression or suppresses gene expression is introduced into fish; the substance is an inhibitor of fish gene expression. Tie1 Gene expression cassettes, recombinant vectors, or recombinant microorganisms.

3. The application according to claim 2, wherein the inhibition method is: DNA methylation, histone deacetylation or H3K27me3 modification, blocking RNA polymerase activity, CRISPRi, RNA interference, antisense oligonucleotides, translation inhibitors, upstream open reading frame editing, gene editing technology, ribozyme method or triple-stranded DNA technology.

4. Fish Tie1 The application of inhibitors targeting gene-encoded proteins in the preparation of drugs for the treatment or prevention of GCRV-II infection.

5. Detecting fish Tie1 Application of gene reagents in screening or breeding transgenic fish resistant to reovirus type II.

6. The application according to claim 5, wherein the determination method in the application is: the fish that does not detect the gene or whose expression level is significantly reduced compared with normal is a reovirus type II resistant transgenic fish.

7. Overexpression in fish Tie1 Application of genes in constructing a drug screening model against grass carp reovirus type II.

8. The application according to claim 7, wherein the application process includes overexpressing Tie1 protein in fish or cell lines to prepare a drug screening model sensitive to grass carp reovirus type II.

9. The application according to claim 7, wherein the drug screening model prepared by the application is used in the preparation of grass carp reovirus type II vaccine.

10. The application according to claim 1, 4, 5 or 7, wherein the fish is grass carp or rare gudgeon, and the grass carp... Tie1 The protein encoded by the gene is shown in SEQ ID NO.2, and is the rare gudgeon. Tie1 The protein encoded by the gene is shown in SEQ ID NO.3.

Images