Cold-adapted xylose isomerase mutant, method for preparing same, and use thereof

By rationally designing thermophilic xylose isomerase guided by ΔΔG and co-expressing it with a highly efficient xylulose transporter, the problem of insufficient xylose utilization capacity in Saccharomyces cerevisiae was solved, achieving efficient xylose utilization and increased ethanol production, which has good potential for industrial application.

CN122128291APending Publication Date: 2026-06-02HUBEI UNIV

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
HUBEI UNIV
Filing Date
2026-03-03
Publication Date
2026-06-02

AI Technical Summary

Technical Problem

Wild-type brewer's yeast lacks efficient metabolic pathways for utilizing xylose, resulting in a significant waste of xylose in lignocellulose hydrolysate, which severely restricts the utilization efficiency and economic feasibility of total sugar.

Method used

By rationally designing thermophilic xylose isomerase guided by ΔΔG, its 30th amino acid was mutated to glycine to prepare a cold-adapted xylose isomerase mutant, which was then co-expressed with a highly efficient xylulose transporter to construct an enhanced "extracellular conversion-intracellular uptake" system.

Benefits of technology

It significantly improves the xylose utilization capacity of Saccharomyces cerevisiae at the fermentation temperature, achieving simultaneous and efficient utilization of glucose and xylose, increasing xylose utilization rate and ethanol yield, and has good prospects for industrial application.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

This invention discloses a cold-adapted xylose isomerase mutant, its preparation method, and its applications. Compared to the amino acid sequence of the wild-type xylose isomerase shown in SEQ ID NO: 1, the cold-adapted xylose isomerase mutant has a mutation at position 30, where alanine is replaced with glycine. This invention obtains a cold-adapted xylose isomerase mutant through rational design guided by ΔΔG on a heat-sourced xylose isomerase. This cold-adapted xylose isomerase mutant exhibits significantly enhanced activity at the fermentation temperature of *Saccharomyces cerevisiae*.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the fields of metabolic engineering and synthetic biology, specifically to a cold-adapted xylose isomerase mutant, its preparation method, and its applications. Background Technology

[0002] Lignocellulose is the most abundant renewable biomass resource on Earth, and its hydrolysis products mainly include glucose and xylose. Xylose is the second most abundant monosaccharide, accounting for 20-40% of fermentable sugars. Saccharomyces cerevisiae, due to its strong fermentation performance, good tolerance, and high safety, is an ideal chassis cell for the production of biofuels and chemicals. However, wild-type Saccharomyces cerevisiae lacks efficient metabolic pathways for xylose utilization, leading to a significant waste of xylose in lignocellulose hydrolysates, severely limiting the efficiency of total sugar utilization and economic feasibility.

[0003] To endow brewer's yeast with the ability to utilize xylose, existing technologies mainly focus on introducing exogenous xylose metabolic pathways, including: (1) Redox pathway: introducing xylose reductase and xylitol dehydrogenase. This pathway suffers from coenzyme imbalance, leading to a large accumulation of xylitol and a low yield of the target product. (2) Xylose isomerase pathway: introducing xylose isomerase to directly isomerize xylose into xylulose. This pathway does not involve coenzyme imbalance and is theoretically more advantageous. However, most of the identified highly active xylose isomerases are derived from thermophilic microorganisms, whose optimal temperature is much higher than the fermentation temperature of brewer's yeast (28-30℃), resulting in low activity in the host cell and becoming a key bottleneck.

[0004] Therefore, there is an urgent need for a xylose isomerase with high activity at the fermentation temperature of Saccharomyces cerevisiae to improve the xylose utilization capacity of Saccharomyces cerevisiae. Summary of the Invention

[0005] The purpose of this invention is to overcome the shortcomings of existing technologies and provide a cold-adapted xylose isomerase mutant, its preparation method, and its applications. This invention obtains a cold-adapted xylose isomerase mutant through rational design guided by ΔΔG on thermophilic xylose isomerase, which exhibits significantly enhanced activity at the fermentation temperature of *Saccharomyces cerevisiae*.

[0006] To achieve the above objectives, the technical solution designed by the present invention is as follows: The present invention provides a cold-adapted xylose isomerase mutant, wherein the alanine at position 30 of the cold-adapted xylose isomerase mutant is mutated to glycine compared with the amino acid sequence of the wild-type xylose isomerase shown in SEQ ID NO: 1.

[0007] Furthermore, the amino acid sequence of the cold-adapted xylose isomerase mutant is shown in SEQ ID NO: 2.

[0008] The present invention also provides a gene encoding the cold-adapted xylose isomerase mutant, the nucleotide sequence of which is shown in SEQ ID NO: 7.

[0009] The present invention also provides a method for preparing the cold-adapted xylose isomerase mutant, comprising the following steps: (1) Obtain the gene of the cold-adapted xylose isomerase mutant as shown in SEQ ID NO: 7, and construct the gene of the cold-adapted xylose isomerase mutant into the pET-23a(+) vector to obtain the plasmid pET23a-xylA-A30G; (2) The plasmid pET23a-xylA-A30G was transformed into Escherichia coli BL21 (DE3), and induction expression, lysis and Ni column purification were performed sequentially to obtain the cold-adapted xylose isomerase mutant.

[0010] The present invention also provides an engineered strain of Saccharomyces cerevisiae, comprising the plasmid PUMRI-GRE3-ssxylA-A30G, wherein the host cell of the engineered strain of Saccharomyces cerevisiae is Saccharomyces cerevisiae; The plasmid PUMRI-GRE3-ssxylA-A30G uses PUMRI-GRE3-ss as a vector and inserts the cold-adapted xylose isomerase mutant gene shown in SEQ ID NO: 7.

[0011] Furthermore, the nucleotide sequence of the vector PUMRI-GRE3-ss is shown in SEQ ID NO: 5.

[0012] The present invention also provides a method for preparing the engineered strain of *Saccharomyces cerevisiae*, comprising the following steps: S1. The cold-adapted xylose isomerase mutant gene was amplified by PCR using primers ssxylA-F and ssxylA-R to obtain the DNA fragment xylA-A30G. S2. The vector PUMRI-GRE3-ss was amplified by PCR using primers kuo-GRE3-ssxylA-F and kuo-GRE3-ssxylA-R to obtain the vector fragment PUMRI-GRE3-ss. S3. Homologous recombination of DNA fragment xylA-A30G and vector fragment PUMRI-GRE3-ss was performed using homologous recombination technology to obtain plasmid PUMRI-GRE3-ssxylA-A30G. S4. Plasmid PUMRI-GRE3-ssxylA-A30G was transferred into Saccharomyces cerevisiae to obtain the engineered Saccharomyces cerevisiae strain INVSC-ssxylA-A30G.

[0013] Furthermore, the primers are as follows: ssxylA-F:ATGGGTGATGttggtacatggcaac; ssxylA-R: gctgaagctatgactaaggaatatttc; kuo-GRE3-ssxylA-F:cttagtcatagcttcagcctctctttt; kuo-GRE3-ssxylA-R:atgtaccaaCATCACCATCACCAT.

[0014] The present invention also provides a co-expression strain, comprising the plasmid PUMRI-GRE3-ssxylA-A30G-Nc2, wherein the host cell of the co-expression strain is Saccharomyces cerevisiae; The plasmid PUMRI-GRE3-ssxylA-A30G-Nc2 uses PUMRI-GRE3-ss as a vector and inserts the cold-adapted xylose isomerase mutant gene shown in SEQ ID NO: 7 and the transporter NcSW2 shown in SEQ ID NO: 4.

[0015] Furthermore, the nucleotide sequence of the vector PUMRI-GRE3-ss is shown in SEQ ID NO: 5.

[0016] The present invention also provides a method for preparing the co-expression strain, comprising the following steps: ① The NcSW2 gene was amplified by PCR using primers Nc2-F and Nc2-R to obtain the DNA fragment NcSW2; ② The plasmid PUMRI-GRE3-ssxylA-A30G was amplified by PCR using primers kuo-A30G-Nc2-F and kuo-A30G-Nc2-R to obtain the vector fragment PUMRI-GRE3-ssxylA-A30G-2; ③ The DNA fragment NcSW2 and the vector fragment PUMRI-GRE3-ssxylA-A30G-2 were homologously recombinated using homologous recombination technology to obtain the plasmid PUMRI-GRE3-ssxylA-A30G-Nc2; ④ The plasmid PUMRI-GRE3-ssxylA-A30G-Nc2 was transferred into Saccharomyces cerevisiae to obtain the engineered strain INVSC-ssxylA-A30G-NcSW2.

[0017] Furthermore, the primers are as follows: Nc2-F: acaGGATCCATGGTTGAATGT; Nc2-R: TCGTATTACtcaAACAATGTTAGA; kuo-A30G-Nc2-F:AACATTGTTtgaGTAATACGACTC; kuo-A30G-Nc2-R: ACATTCAACCATGGATCCtgtttttat.

[0018] The present invention also provides an application of the co-expressed strain in the fermentation of mixed sugars to produce ethanol. The specific steps are as follows: the co-expressed strain is cultured in a mixed sugar environment to produce ethanol.

[0019] Furthermore, the mixed sugar environment is any one of YPDX culture medium, high-sugar YPDX simulated culture medium, and corn straw hydrolysate; The culture time is 72-120 h, the culture temperature is 28-30℃, and the culture rotation speed is 200-220 rpm; The YPDX medium contains 20 g / L tryptone, 10 g / L yeast extract, 8 g / L glucose and 20 g / L xylose; The high-sugar YPDX simulated culture medium contains 20 g / L tryptone, 10 g / L yeast extract, 40 g / L glucose, and 40 g / L xylose. The corn stalk hydrolysate contains 40 g / L glucose and 20 g / L xylose.

[0020] The beneficial effects of this invention are: Compared with the prior art, the present invention has the following advantages: (1) This invention uses a rational design strategy guided by ΔΔG to perform point mutation modification on xylose isomerase, successfully endowing it with cold-adaptive characteristics, effectively solving the key bottleneck of low activity of thermophilic xylose isomerase at the fermentation temperature of Saccharomyces cerevisiae.

[0021] (2) The present invention has identified and identified the SWEET family transporters from anaerobic intestinal fungi. These transporters show a high preference for xylulose and effectively break through the transport bottleneck of xylulose transmembrane uptake.

[0022] (3) This invention constructs an “extracellular conversion-intracellular uptake” enhancement system by co-expressing a secretory-expressed cold-adapted xylose isomerase mutant with a high-efficiency xylulose transporter. This system achieves synergistic enhancement of high-efficiency extracellular conversion of xylose and high-efficiency intracellular uptake of xylulose, enabling Saccharomyces cerevisiae to utilize glucose and xylose simultaneously, effectively avoiding the sequential utilization mode caused by the inhibition of traditional carbon metabolites.

[0023] (4) The engineered strain constructed in this invention showed good robustness in real corn straw hydrolysate, and the xylose utilization rate and ethanol yield were significantly improved, showing good prospects for industrial application.

[0024] (5) The rational design strategy and synergistic expression system established in this invention have good versatility and can be extended to the cold adaptation modification of other xylose isomerases and the functional optimization of other sugar transporters, providing a new technical path for the production of biofuels and chemicals using lignocellulose hydrolysate. Attached Figure Description

[0025] Figure 1 A schematic diagram of the 30th amino acid position of xylA, a wild-type xylose isomerase; Figure 2 The colorimetric reaction and specific enzyme activity results for the cold-adapted xylose isomerase mutant xylA-A30G are shown in the figure. In the figure, A, from left to right, are the colorimetric reactions of the blank control group, the colorimetric reaction of the wild-type xylose isomerase xylA, and the colorimetric reaction of the cold-adapted xylose isomerase mutant xylA-A30G. Figure 3 Figure showing the enzymatic characterization results of the cold-adapted xylose isomerase mutant xylA-A30G; In the figure, A represents the optimal temperature result; B represents the thermal stability result at 28°C; C represents the thermal stability result at 37°C; and D represents the thermal stability result at the optimal temperature (70°C). Figure 4 Figure showing the fermentation performance evaluation results of an engineered Saccharomyces cerevisiae strain that secretes xylose isomerase; In the figure, A is the cell growth curve in YPX medium; B is the extracellular xylose consumption curve in YPX medium; C is the cell growth curve in YPDX medium; and D is the extracellular xylose consumption curve in YPDX medium. Figure 5 A schematic diagram of the molecular mechanism by which the cold-adapted xylose isomerase mutant xylA-A30G enhances the low-temperature activity of xylose isomerase; In the figure, A represents the residue interaction distance analysis within a 5A range of the 30th amino acid site in wild-type xylose isomerase xylA; B represents the residue interaction distance analysis within a 5A range of the 30th amino acid site in the cold-adapted xylose isomerase mutant xylA-A30G; C represents the residue interaction distance analysis within a 10A range of the 30th amino acid site in wild-type xylose isomerase xylA; and D represents the residue interaction distance analysis within a 10A range of the 30th amino acid site in the cold-adapted xylose isomerase mutant xylA-A30G. The numbers represent the distances between residues (A). Figure 6Figure showing the results of sugar uptake function identification of SWEET transporters from anaerobic fungi; In the figure, A represents the uptake of xylose by the transporter; B represents the uptake of glucose by the transporter; and C represents the uptake of xylulose by the transporter. Figure 7 Figure showing the construction and fermentation performance verification results of the co-expression system; In the figure, A is the cell growth curve in YPX medium; B is the extracellular xylose consumption curve in YPX medium; C is the cell growth curve in YPDX medium; and D is the extracellular xylose consumption curve in YPDX medium. Figure 8 Figure showing the evaluation results of the industrial application potential of YPDX in high-sugar simulated culture medium; In the figure, A is the cell growth curve; B is the extracellular glucose and xylose utilization curve, where -G in Figure B represents glucose utilization and -X represents xylose utilization; C is the ethanol production curve. Figure 9 The image shows the fermentation verification results in real corn stalk hydrolysate. In the figure, A is the extracellular glucose and xylose utilization curve, where -G represents glucose utilization and -X represents xylose utilization; B is the ethanol production curve. Figure 10 This is a plasmid map of plasmid pET23a-xylA-A30G; Figure 11 The image shows the plasmid map of plasmid PUMRI-GRE3-ssxylA-A30G. Figure 12 The image shows the plasmid map of plasmid PUMRI-GRE3-ssxylA-A30G-Nc1. Figure 13 This is a plasmid map of plasmid PUMRI-GRE3-ssxylA-A30G-Nc2. Detailed Implementation

[0026] The present invention will now be described in further detail with reference to specific embodiments, so that those skilled in the art can understand it.

[0027] Description of culture medium components or bacterial strains: 1. YPX medium: 20 g / L tryptone, 10 g / L yeast extract, 10 g / L xylose.

[0028] 2. YPDX medium: 20 g / L tryptone, 10 g / L yeast extract, 8 g / L glucose, 20 g / L xylose.

[0029] 3. Tris-HCl medium (supplemented with sugars) is 50mM Tris-HCl buffer (pH=5.0) supplemented with 10g / L of sugars (xylose, glucose or xylulose).

[0030] 4. High-glucose YPDX simulated culture medium: 20 g / L tryptone, 10 g / L yeast extract, 40 g / L glucose, 40 g / L xylose.

[0031] 5. In this embodiment, INVSc is the wild-type brewer's yeast S. cerevisiae INVSc1(Ura-) in Chinese invention patent application number 202410317709.8.

[0032] 6. Preparation of corn stalk hydrolysate: Corn stalks dried and pulverized to 40 mesh were added to an acid treatment solution (40% ethanol solution and 1.0% dilute sulfuric acid solution mixed in a 1:10 solid-liquid ratio) and reacted at 121℃ and 0.5 MPa for 2 h. After centrifugation and washing of the residue, the solid residue was suspended in a citrate-sodium citrate buffer solution at pH 5.0. A compound enzyme preparation was added at a ratio of 10 FPU / g cellulase to 5 IU / g hemicellulase and enzymatically hydrolyzed at 50℃ and 200 r / min for 48 h. The residue was removed by centrifugation again, and the supernatant was filtered through a 0.22 μm filter membrane to obtain the corn stalk hydrolysate. The corn stalk hydrolysate was found to contain 40 g / L glucose, 20 g / L xylose, and 1 g / L phenolic inhibitors.

[0033] Example 1: Rational design and construction of cold-adapted xylose isomerase mutants From Orpinomyces sp Using the xylase gene xylA of ukk1 as a template, homology modeling was performed using SWISS-MODEL to obtain its three-dimensional structural model, as shown below. Figure 1 As shown in SEQ ID NO: 1, the amino acid sequence of the wild-type xylose isomerase xylA is shown in SEQ ID NO: 6, and the sequence after codon optimization by Saccharomyces cerevisiae is shown in SEQ ID NO: 6.

[0034] Using the Rosetta ddG_monomer application, all alanine and proline residues in the wild-type xylose isomerase xylA were virtually mutated to glycine, and the change in folding free energy resulting from each mutation was calculated. Sites with ΔΔG>0 were screened, and combined with sequence conservation analysis and three-dimensional structure surface accessibility analysis, the 30th amino acid of the wild-type xylose isomerase xylA was finally selected for mutation, replacing alanine with glycine.

[0035] Using site-directed mutagenesis PCR, the 30th amino acid of wild-type xylose isomerase xylA was mutated (alanine was mutated to glycine) to obtain the cold-adapted xylose isomerase mutant xylA-A30G. The amino acid sequence of the cold-adapted xylose isomerase mutant xylA-A30G is shown in SEQ ID NO: 2, and the sequence after codon optimization by Saccharomyces cerevisiae is shown in SEQ ID NO: 7.

[0036] The cold-adapted xylose isomerase mutant xylA-A30G and the wild-type xylose isomerase xylA were constructed into the pET-23a(+) vector, respectively, to obtain plasmids pET23a-xylA-A30G and pET23a-xylA, respectively. The plasmid map of plasmid pET23a-xylA-A30G is shown below. Figure 10 As shown.

[0037] Example 2: Expression, purification and enzyme activity assay of cold-adapted xylose isomerase mutant The plasmids pET23a-xylA-A30G and pET23a-xylA constructed in Example 1 were transformed into Escherichia coli, respectively. E. coli In BL21(DE3), the proteins xylA-A30G and xylA were obtained by induction of expression, lysis, and purification using Ni column.

[0038] The enzyme activities of the cold-adapted xylose isomerase mutant xylA-A30G and the wild-type xylose isomerase xylA at 37°C were determined using the cysteine ​​hydrochloride-carbazole colorimetric method. Water was used instead of enzyme solution as a blank control group. Results are as follows: Figure 2 As shown, the specific enzyme activity of the cold-adapted xylose isomerase mutant xylA-A30G was 0.139 U / mg, which was 2.99 times higher than that of the wild-type xylose isomerase xylA.

[0039] Example 3: Characterization of the enzymatic properties of mutants 1. Determine the enzyme activity of cold-adapted xylose isomerase mutant xylA-A30G and wild-type xylose isomerase xylA at 30-90℃ to determine the optimal temperature.

[0040] The results are as follows Figure 3 As shown in Figure A, the optimal temperature for the cold-adapted xylose isomerase mutant xylA-A30G remains 70℃. However, the specific enzyme activity of the cold-adapted xylose isomerase mutant xylA-A30G at the optimal temperature is 0.33 times higher than that of the wild-type xylose isomerase. At the optimal temperature of 30~40℃ for ethanol fermentation, the specific enzyme activity of the cold-adapted xylose isomerase mutant xylA-A30G is 1.89 times and 2.10 times higher than that of the wild-type xylose isomerase, respectively.

[0041] 2. The cold-adapted xylose isomerase mutant xylA-A30G and wild-type xylose isomerase xylA were incubated at 28℃ (fermentation temperature), 37℃ and the optimum temperature (70℃) for 0 to 480 min respectively. The residual enzyme activity was measured, and the enzyme activity of the unincubated protein was defined as 100%.

[0042] The results are as follows Figure 3 B~ Figure 3 Data showed that after incubation at 28°C for 480 minutes, the residual activity of the cold-adapted xylose isomerase mutant xylA-A30G was 80.94%, while the residual activity of the wild-type xylose isomerase was 53.64%. The residual activity of xylA-A30G was 1.51 times that of the wild-type xylose isomerase, demonstrating that the cold-adapted xylose isomerase mutant possesses cold-adaptive characteristics. After incubation at 37°C for 480 minutes, the residual activity of xylA-A30G was 80.02%, while the residual activity of the wild-type xylose isomerase was 30.60%. The residual activity of xylA-A30G was 2.61 times that of the wild-type xylose isomerase, demonstrating that the cold-adapted xylose isomerase mutant still possesses cold-adaptive characteristics under mesophilic conditions. At 70℃, the cold-adapted xylose isomerase mutant xylA-A30G lost all activity in 240 min, while the residual activity of the wild-type xylose isomerase was 4.39% at this time. This indicates that the cold-adapted xylose isomerase is more sensitive to high-temperature treatment, which is also related to the increased structural flexibility of the cold-adapted mutation.

[0043] Example 4: Construction and evaluation of an engineered Saccharomyces cerevisiae strain that secretes xylose isomerase 1. The gene sequence of the cold-adapted xylose isomerase mutant xylA-A30G was amplified by PCR using primers ssxylA-F and ssxylA-R to obtain the DNA fragment xylA-A30G.

[0044] 2. The secretory expression vector PUMRI-GRE3-ss (shown in SEQ ID NO: 5) was amplified by PCR using primers kuo-GRE3-ssxylA-F and kuo-GRE3-ssxylA-R to obtain the vector fragment PUMRI-GRE3-ss. PUMRI-GRE3-ss includes the homologous arms GRE3-up and GRE3-down integrated into the Saccharomyces cerevisiae genome, the selection markers Ura3 and KanR genes, the promoter gene, the secretory expression signal peptide gene ss, and a 6×his tag.

[0045] Table 1 Primer sequence listing 3. Homologous recombination was then performed between the DNA fragment xylA-A30G and the vector fragment PUMRI-GRE3-ss to obtain the cold-adapted xylose isomerase mutant secretory expression plasmid PUMRI-GRE3-ssxylA-A30G. The plasmid map of PUMRI-GRE3-ssxylA-A30G is shown below. Figure 11 As shown.

[0046] 4. The plasmid PUMRI-GRE3-ssxylA-A30G was linearized with SfiI and integrated into the GRE3 locus of Saccharomyces cerevisiae INVSC (INVSc1) to obtain the engineered strain INVSC-ssxylA-A30G.

[0047] The engineered strain INVSC-ssxylA was obtained using the same steps as described above.

[0048] 5. The engineered strain INVSc-ssxylA-A30G was fermented in YPX and YPDX media for 120 hours (28℃, 200rpm), respectively. The initial OD... 600 The value was set to 1, and samples were taken to determine the sugar utilization of the strain. Meanwhile, *Saccharomyces cerevisiae* INVSC and the engineered strain INVSC-ssxylA were used as control groups.

[0049] The results are as follows Figure 4 As shown, the xylose consumption rate of the engineered strain INVSC-ssxylA-A30G was significantly higher than that of Saccharomyces cerevisiae INVSC and the engineered strain INVSC-ssxylA. In fermentation with xylose as the sole carbon source, after 120 hours of fermentation, the xylose utilization rate of the engineered strain INVSC-ssxylA was 6.39%, while that of the engineered strain INVSC-ssxylA-A30G reached 11.45%, which was 76% higher than that of the wild type. Notably, although the final biomass of the engineered strain INVSC-ssxylA-A30G was slightly lower, its total xylose consumption was significantly higher, indicating that the engineered strain INVSC-ssxylA-A30G achieved a substantial improvement in xylose conversion efficiency per unit cell.

[0050] The performance of the strains was further evaluated in YPDX medium. All engineered strains completely depleted glucose within 12 hours. In terms of biomass, after 24 hours of culture, the OD600 of the engineered strain INVSc-ssxylA-A30G was slightly lower than that of INVSc-ssxylA. However, the lower biomass was not accompanied by a reduction in total xylose consumption; on the contrary, the engineered strain INVSc-ssxylA-A30G showed stronger xylose utilization. After 120 hours of fermentation, the xylose consumption of INVSc-ssxylA was 5.536 g / L (utilization rate of 27.68%), while the consumption of the engineered strain INVSc-ssxylA-A30G reached 7.116 g / L (35.58%), an increase of 28.55% compared to the wild type.

[0051] Example 5: Mechanistic analysis of the cold-adapted xylose isomerase mutant xylA-A30G Mechanistic analysis was performed on the cold-adapted xylose isomerase mutant xylA-A30G. Homology modeling of xylose isomerase xylA and its mutant xylA-A30G was performed using SWISS-MODEL, and the model was imported into Pymol. Amino acid residues within the 5A and 10A range of the 30th amino acid site were searched, and the changes in the distance between amino acid residues caused by the mutation were measured.

[0052] The results are as follows Figure 5 The image shows a three-dimensional model of the interactions between the subunits surrounding wild-type xylose isomerase xylA and the cold-adapted xylose isomerase mutant xylA-A30G. The 30th amino acid residue is shown in green, and the other amino acid residues are shown in yellow. The distances (A) between different atoms are shown below: Within the 5A range, the distance between amino acid A (position 30) and amino acid YO (position 28) in xylose isomerase xylA is 3.8A and 3.9A, respectively. The cold-adapted xylose isomerase mutant xylA-A30G increases the distance between side chains, with the distance between amino acid G (position 30) and amino acid YO (position 28) being 4.2A and 4.0A. Replacing amino acid A (position 30) with glycine (Gly) weakens the intermolecular interactions, thereby increasing the activity of xylA at low temperatures. Within the 10A range, the changes in intermolecular distances are more pronounced; the cold-adapted xylose isomerase mutant increases the distance between side chains, thus improving the activity of xylA at low temperatures.

[0053] Example 6: Discovery and functional identification of SWEET transporters from anaerobic fungi Xylose entry into cells is inefficient, and cellular xylose uptake is strongly competitively inhibited by glucose, limiting overall cellular metabolic flux. Recent studies have attempted to bypass intracellular competition and redox limitations by secreting xylose isomerases to convert xylose extracellularly into xylulose. However, this shifts the bottleneck to transmembrane uptake of xylulose. Currently known *Saccharomyces cerevisiae* hexose transporters generally have insufficient affinity and transport efficiency for xylulose. There is an urgent need to develop a systematic strategy to simultaneously address the two tandem bottlenecks of "efficient extracellular conversion of xylose to xylulose" and "efficient intracellular uptake of xylulose" in *Saccharomyces cerevisiae*, in order to achieve efficient and simultaneous co-utilization of glucose and xylose.

[0054] In this embodiment, the validated NcSWEET1 was used as a probe. A search was conducted in NCBI to screen for unvalidated transporters from Neocallimastix California. After protein domain annotation and transmembrane domain prediction using pfam and HAMMER, NcSWEET1 (positive control, as shown in SEQ ID NO: 3) and NcSW2 (as shown in SEQ ID NO: 4) were selected for functional studies.

[0055] 1. The gene sequence of NcSWEET1 was amplified by PCR using primers Nc1-F and Nc1-R to obtain the DNA fragment NcSWEET1. The gene sequence of NcSW2 was amplified by PCR using primers Nc2-F and Nc2-R to obtain the DNA fragment NcSW2.

[0056] 2. The plasmid PUMRI-GRE3-ssxylA-A30G was amplified by PCR using primer pairs kuo-A30G-Nc1-F and kuo-A30G-Nc1-R to obtain the vector fragment PUMRI-GRE3-ssxylA-A30G-1. The plasmid PUMRI-GRE3-ssxylA-A30G was amplified by PCR using primer pairs kuo-A30G-Nc2-F and kuo-A30G-Nc2-R to obtain the vector fragment PUMRI-GRE3-ssxylA-A30G-2.

[0057] 3. Homologous recombination of DNA fragment NcSWEET1 and vector fragment PUMRI-GRE3-ssxylA-A30G-1 was performed to obtain plasmid PUMRI-GRE3-ssxylA-A30G-NcSW1. Homologous recombination of DNA fragment NcSW2 and vector fragment PUMRI-GRE3-ssxylA-A30G-2 was performed to obtain plasmid PUMRI-GRE3-ssxylA-A30G-Nc2. The plasmid maps of PUMRI-GRE3-ssxylA-A30G-Nc1 and PUMRI-GRE3-ssxylA-A30G-Nc2 are shown below. Figures 12-13 As shown.

[0058] 4. Plasmids PUMRI-GRE3-ssxylA-A30G-Nc1 and PUMRI-GRE3-ssxylA-A30G-Nc2 were integrated into Saccharomyces cerevisiae INVSC to obtain engineered strains INVSC-ssxylA-A30G-NcSW1 and INVSC-ssxylA-A30G-NcSW2.

[0059] 5. Exogenous sugar uptake experiment: After centrifuging the bacterial cultures of engineered strains INVSc-ssxylA-A30G-NcSW1 and INVSc-ssxylA-A30G-NcSW2, the bacterial precipitates were obtained. The precipitates were washed three times with sterile water, and the cells were resuspended in 0.05M Tris-HCl (pH=5.0) buffer. After incubation at 28℃ overnight (8~12 h), the cells were transferred to Tris-HCl medium for exogenous sugar uptake experiment (28℃, 200rpm). In this example, the sugars supplemented in the Tris-HCl medium were glucose, xylose, or xylulose.

[0060] The results are as follows Figure 6 As shown, both transporters NcSWEET1 and NcSW2 can transport three sugars (glucose, xylose, and xylulose), but both show a clear preference for xylulose. NcSW2 exhibits the highest xylulose transport activity, consuming 7.958 g / L xylulose and only 0.619 g / L xylose within 180 minutes, resulting in a xylulose preference ratio of 12.86:1. Therefore, transporter NcSW2 was selected for subsequent experiments in this invention. The xylulose preference ratio is calculated by dividing the total xylulose utilization by the total xylose utilization.

[0061] Example 7: Performance Validation of Co-expression Strains The co-expression strain in this embodiment is the engineered strain INVSC-ssxylA-A30G-NcSW2 constructed in Example 6.

[0062] The engineered strain INVSC-ssxylA-A30G-NcSW2 was cultured and fermented in YPX and YPDX media for 120 h (28℃, 200 rpm), respectively. Initial OD... 600 The value was 1, and samples were taken to determine the sugar utilization of the strains. Meanwhile, engineered strains INVSC-ssxylA-A30G, INVSC-ssxylA, and INVSC-ssxylA-A30G-NcSW1 were used as controls.

[0063] The results are as follows Figure 7 As shown, the engineered strain INVSC-ssxylA-A30G-NcSW2 exhibited the best performance. In mixed sugar fermentation, the xylose consumption of engineered strain INVSC-ssxylA-A30G-NcSW2 (10.48 g / L) was 1.62 times and 1.50 times that of engineered strains INVSC-ssxylA-A30G and INVSC-ssxylA-A30G-NcSW1, respectively.

[0064] Example 8: Industrial Application Potential Assessment 1. The engineered strain INVSC-ssxylA-A30G-NcSW2 was fermented in high-sugar YPDX simulated medium for 72 h (28℃, 200 rpm). The initial OD... 600 The value was set to 1, and samples were taken to determine the sugar utilization and ethanol production of the strains. Engineered strains INVSC-ssxylA-A30G, INVSC-ssxylA, and INVSC-ssxylA-A30G-NcSW1 were used as controls. The formula for sugar-ethanol conversion rate is as follows: The results are as follows Figure 8As shown, in a high-sugar environment, INVSC-ssxylA-A30G-NcSW2 exhibits the ability to simultaneously utilize xylose and glucose. This is reflected in its slower glucose uptake rate compared to INVSC-ssxylA and INVSC-ssxylA-A30G, but its xylose uptake rate is significantly higher than that of INVSC-ssxylA and INVSC-ssxylA-A30G strains. This is also consistent with the previous results of SWEETs' determination of the transport capacity of different carbon sources. Ethanol production of all strains peaked at 12 h. At 12 h, INVSc-ssxylA had an ethanol production of 17.383 g / L, and INVSc-ssxylA-A30G had an ethanol production of 18.787 g / L. The best performing strain was INVSc-ssxylA-A30G-NcSW2, with an ethanol production of 20.684 g / L, which was 3.301 g / L higher than the starting strain INVSc-ssxylA. As a positive control, the strain INVSc-ssxylA-A30G-NcSW1 had an ethanol production of 19.023 g / L at 12 h, which was lower than that of INVSc-ssxylA-A30G-NcSW2. The most significant improvement in sugar alcohol conversion rate was observed at 8 hours, with INVsc-ssxylA, INVSc-ssxylA-A30G, INVSc-ssxylA-A30G-NcSW1, and INVSc-ssxylA-A30G-NcSW2 showing conversion rates of 33.78%, 34.68%, 35.50%, and 44.07%, respectively. INVSc-ssxylA-A30G-NcSW2 showed a 30.48% increase in conversion rate compared to the starting strain INVSc-ssxylA. Furthermore, INVSc-ssxylA-A30G-NcSW2 exhibited the highest xylose consumption and the strongest cell growth capacity. This demonstrates that INVSc-ssxylA-A30G-NcSW2 can utilize xylose more efficiently in the presence of high glucose concentrations compared to the control strain, while simultaneously enhancing its cell growth and ethanol production capabilities.

[0065] 2. The engineered strain INVSC-ssxylA-A30G-NcSW2 was fermented in corn straw hydrolysate for 120 h (28℃, 200 rpm). The initial OD... 600 The value was 1, and samples were taken to determine the sugar utilization and ethanol production of the strains, while engineered strains INVSC-ssxylA-A30G and INVSC-ssxylA were used as controls.

[0066] The results are as follows Figure 9As shown, the xylose consumption (12.32 g / L at 120 h) and peak ethanol yield (14.89 g / L at 8 h) of the engineered strain INVSc-ssxylA-A30G-NcSW2 were significantly higher than those of other strains, verifying its robustness in complex industrial raw materials. The co-expressed strain INVSc-ssxylA-A30G-NcSW2 consumed both glucose and xylose simultaneously, with a significantly faster xylose consumption rate than the control strain. Ethanol yield reached its peak at 8 h for all strains. The co-expressed strain achieved the highest ethanol yield of 14.89 g / L, a 17.22% increase compared to INVSc-ssxylA (12.70 g / L). Early fermentation (8 hours) analysis showed that the sugar alcohol conversion rate of the co-expressed strain was 35.72%, significantly higher than that of INVSc-ssxylA (28.96%) and INVSc-ssxylA-A30G (32.09%), and 23.35% higher than that of the starting strain INVSc-ssxylA. These results indicate that the engineered strain combining the cold-adapted xylose isomerase mutant (A30G) with the highly efficient xylulose preferential transporter (NcSW2) effectively enhances the simultaneous utilization of xylose, increasing ethanol yield and early conversion efficiency. This allows the strain to function more effectively under industrial-grade high-sugar mixed substrate fermentation conditions.

[0067] All other parts not described in detail are existing technologies. Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A cold-adapted xylose isomerase mutant, characterized in that: The cold-adapted xylose isomerase mutant has a mutation at position 30, where alanine is replaced with glycine, compared to the amino acid sequence of the wild-type xylose isomerase shown in SEQ ID NO:

1.

2. The cold-adapted xylose isomerase mutant according to claim 1, characterized in that: The amino acid sequence of the cold-adapted xylose isomerase mutant is shown in SEQ ID NO:

2.

3. A gene encoding the cold-adapted xylose isomerase mutant of claim 1, characterized in that: The nucleotide sequence of the gene for the cold-adapted xylose isomerase mutant is shown in SEQ ID NO:

7.

4. A method for preparing the cold-adapted xylose isomerase mutant according to claim 1, characterized in that: Includes the following steps: (1) Obtain the gene of the cold-adapted xylose isomerase mutant as shown in SEQ ID NO: 7, and construct the gene of the cold-adapted xylose isomerase mutant into the pET-23a(+) vector to obtain the plasmid pET23a-xylA-A30G; (2) The plasmid pET23a-xylA-A30G was transformed into Escherichia coli BL21 (DE3), and induction expression, lysis and Ni column purification were performed sequentially to obtain the cold-adapted xylose isomerase mutant.

5. An engineered strain of *Saccharomyces cerevisiae*, characterized in that: Including plasmid PUMRI-GRE3-ssxylA-A30G, the host cell of the engineered Saccharomyces cerevisiae strain is Saccharomyces cerevisiae; The plasmid PUMRI-GRE3-ssxylA-A30G uses PUMRI-GRE3-ss as a vector and inserts the cold-adapted xylose isomerase mutant gene shown in SEQ ID NO:

7.

6. The engineered strain of *Saccharomyces cerevisiae* according to claim 5, characterized in that: The nucleotide sequence of the vector PUMRI-GRE3-ss is shown in SEQ ID NO:

5.

7. A co-expression strain, characterized in that: The co-expressing strain includes the plasmid PUMRI-GRE3-ssxylA-A30G-Nc2, and its host cell is Saccharomyces cerevisiae. The plasmid PUMRI-GRE3-ssxylA-A30G-Nc2 uses PUMRI-GRE3-ss as a vector and inserts the cold-adapted xylose isomerase mutant gene shown in SEQ ID NO: 7 and the transporter NcSW2 shown in SEQ ID NO:

4.

8. The co-expression strain according to claim 7, characterized in that: The nucleotide sequence of the vector PUMRI-GRE3-ss is shown in SEQ ID NO:

5.

9. The application of the co-expression strain according to claim 7 in the fermentation of mixed sugars to produce ethanol, characterized in that: The specific steps are as follows: the co-expressed strain is cultured in a mixed sugar environment to generate ethanol.

10. The application according to claim 9, characterized in that: The mixed sugar environment is any one of YPDX medium, high-sugar YPDX simulated medium, and corn straw hydrolysate; The culture time is 72-120 h, the culture temperature is 28-30℃, and the culture rotation speed is 200-220 rpm; The YPDX medium contains 20 g / L tryptone, 10 g / L yeast extract, 8 g / L glucose and 20 g / L xylose; The high-glucose YPDX simulated culture medium contains 20 g / L tryptone, 10 g / L yeast extract, 40 g / L glucose, and 40 g / L xylose. The corn stalk hydrolysate contains 40 g / L glucose and 20 g / L xylose.