DNA polymerase mutants and uses thereof

Abstract

This invention discloses a DNA polymerase mutant and its applications, relating to the field of biotechnology. The DNA polymerase mutant developed by this invention significantly enhances performance in Mg2+ compared to wild-type DNA polymerase. 2+ Under catalysis, it enhances the efficiency and capability of DNA extension amplification on non-natural substrates, especially achieving highly efficient extension amplification of DNA fragments longer than 48.5kb. It effectively fills the gaps in the compatibility of related polymerases with non-natural substrates, efficiency of long fragment extension, and stability in existing technologies, providing a key tool for non-natural substrate-mediated long fragment DNA amplification technology.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to DNA polymerase mutants and their applications. Background Technology

[0002] DNA polymerases are responsible for genome replication and maintenance, and are crucial for the precise transmission of genetic information between generations. Isothermal amplification DNA polymerases, with their strong strand displacement activity, can amplify circular templates and obtain long-fragment amplification products. Phi29 DNA polymerase is the most typical example, and this enzyme utilizes Mg²⁺... + With the aid of metal ions, single-stranded products of approximately 70 kb in length can be amplified in the presence of natural dNTP substrates. Phi29 DNA polymerase belongs to the polymerase B family and is currently a widely used isothermal DNA polymerase. However, wild-type Phi29 DNA polymerase exhibits significant defects in adapting to non-natural substrates, particularly in Mg²⁺. + Under certain conditions, long fragment elongation cannot be effectively achieved using non-natural substrates. Given the rich resources of the polymerase B family, screening and discovering potential applications within this family in Mg²⁺... + A novel isothermal DNA polymerase, which serves as an auxiliary factor and utilizes non-natural substrates for efficient long-fragment DNA amplification, is of great significance for expanding the application scope and prospects of isothermal DNA polymerases under these conditions. Summary of the Invention

[0003] This invention aims to at least solve one of the aforementioned technical problems existing in the prior art. Therefore, the object of this invention is to provide DNA polymerase mutants and their applications. In this invention, the inventors obtained a variety of specific DNA polymerase mutants through targeted screening. These mutants are used in a Mg²⁺… + As a cofactor and in the presence of non-natural substrates in the system, it can significantly enhance isothermal amplification capacity, thus serving as a DNA polymerase capable of long-fragment extension with non-natural substrates.

[0004] To achieve the above objectives, the technical solution adopted by the present invention is as follows: A first aspect of the present invention provides a DNA polymerase mutant, comprising one of the following: (A) A DNA polymerase mutant obtained by substituting at least one amino acid from Y340, V414, S481, T644, K656, T659, N660, A662, K676, I767, D772, D799 and A807 based on the sequence shown in SEQ ID NO:1; (B) A DNA polymerase mutant obtained by substituting at least one amino acid from K656, L660, F662, and G676 based on the sequence shown in SEQ ID NO:4; (C) A DNA polymerase mutant that, based on (A) or (B), has undergone substitution and / or deletion and / or addition of one or more amino acids and has the same function as (A) or (B).

[0005] In some embodiments of the present invention, (A) the DNA polymerase mutant comprises having an amino acid sequence as shown in any of SEQ ID NO. 2-3.

[0006] In some embodiments of the present invention, (B) the DNA polymerase mutant comprises having an amino acid sequence as shown in SEQ ID NO.5.

[0007] In some embodiments of the present invention, the number of amino acid residues replaced, deleted, or added in (C) is 1-5.

[0008] In some embodiments of the present invention, the number of amino acid residues replaced, deleted, or added in (C) is 1, 2, 3, 4, or 5.

[0009] In some embodiments of the present invention, the DNA polymerase mutant has at least 95%, 96%, 97%, 98%, or 99% or about 100% sequence identity compared to the sequence shown in SEQ ID NO:1 or SEQ ID NO:4.

[0010] In this invention, the phrase "having the same function" refers to having DNA polymerase activity capable of long-fragment extension with non-natural substrates. In this invention, the non-natural substrate is a deoxyribonucleotide modified with an oligonucleotide or its analogue. In this invention, "DNA polymerase mutant with the same function" refers to having at least 50%-10000% of the DNA polymerase activity compared to the DNA polymerase mutants in the sequences shown in SEQ ID NO:1 or SEQ ID NO:4, or in (A) or (B).

[0011] In some embodiments of the present invention, the amino acid substitution includes one of the following: (1) Based on the sequence shown in SEQ ID NO:1, the amino acid substitutions include at least one of Y340L, V414R, S481A, T644M, K656R, T659A, N660L, A662F, K676G, I767Q, D772R, D799M and A807Y; (2) Based on the sequence shown in SEQ ID NO:4, the amino acid substitutions include at least one of K656R, L660N, F662A and G676K.

[0012] In some embodiments of the present invention, (1) the amino acid substitutions include Y340L, V414R, S481A, T644M, T659A, N660L, A662F, K676G, I767Q, D772R, D799M, A807Y; or include Y340L, V414R, S481A, T644M, K656R, T659A, I767Q, D772R, D799M, A807Y.

[0013] In some embodiments of the present invention, (2) the amino acid substitutions include K656R, L660N, F662A, and G676K.

[0014] Conserved substitutions, additions or deletions of one or more amino acids, amino-terminal truncation, and carboxyl-terminal truncation of other amino acid sites in the above-mentioned DNA polymerases are also included within the scope of this invention.

[0015] In a second aspect, the present invention provides a nucleic acid molecule encoding a DNA polymerase mutant as described above.

[0016] In some embodiments of the present invention, the nucleic acid molecule may further be linked with modifying sequences and / or functional sequences.

[0017] In some embodiments of the present invention, the modified sequence and / or functional sequence includes at least one of the following: tag coding sequence, protease cleavage site sequence, signal peptide sequence, nuclear localization signal sequence, adapter sequence, fluorescent protein coding sequence, promoter, enhancer, terminator, tool enzyme recognition site, ribozyme coding sequence, self-cleaving intron sequence, miRNA binding site, and ribosome binding site (RBS).

[0018] In some embodiments of the present invention, the tag coding sequence includes at least one of the tag coding sequences that facilitate the dissolution, purification, and detection of DNA polymerase mutants. It is understood that the DNA polymerase mutant of the present invention may contain one or more tag coding sequences; multiple tag coding sequences may include a combination of multiple identical tag coding sequences, or a combination of multiple different tag coding sequences. For example: tag coding sequences that facilitate the dissolution of phiZP2 DNA polymerase mutants include, but are not limited to, nus tag or maltose-binding protein tag coding sequences; tag coding sequences that facilitate the purification of phiZP2 DNA polymerase mutants include, but are not limited to, strep tag coding sequences, His tag coding sequences, GST tag coding sequences, HA tag coding sequences, FLAG tag coding sequences, V5 tag coding sequences, SUMO tag coding sequences, and c-Myc tag coding sequences; tag coding sequences that facilitate the detection of phiZP2 DNA polymerase mutants include, but are not limited to, horseradish peroxidase (HRP), β-galactosidase, luciferase, green fluorescent protein (GFP), HcRed, DsRed, or cyan fluorescent protein (CFP) coding sequences.

[0019] In some embodiments of the present invention, the tag encoding sequence may specifically be a His tag encoding sequence.

[0020] In some embodiments of the present invention, the tool enzyme recognition site includes restriction endonuclease recognition sites, recombinase recognition sites, methylase recognition sites, etc.

[0021] In some embodiments of the present invention, the ribozyme is an RNA sequence with catalytic activity, including hammerhead ribozyme, hairpin ribozyme, HDV ribozyme, etc., which can achieve cis or trans cleavage of RNA.

[0022] In some embodiments of the present invention, the self-splicing introns include type I self-splicing introns, type II self-splicing introns, and other sequences that can self-splice after transcription, for automatically removing spacer sequences without relying on exogenous proteases.

[0023] In some embodiments of the present invention, the modified sequence and / or functional sequence may be attached to the 5′ end, 3′ end and / or interior of the nucleic acid molecule encoding DNA polymerase, as long as the catalytic activity and reading frame of the DNA polymerase are not impaired.

[0024] A third aspect of the present invention provides a biomaterial comprising at least one of the following: (1) An expression vector containing the nucleic acid molecules described above; (2) Transformants containing the nucleic acid molecules described above; (3) Transformants containing the expression vector in (1).

[0025] In some embodiments of the present invention, the expression vector includes a plasmid.

[0026] In this invention, the term "expression vector" refers to a vector or expression system used to integrate or insert a targeted exogenous gene.

[0027] In some embodiments of the present invention, the transformants include bacteria, fungi, viruses, plant cells, or animal cells.

[0028] In this invention, the term "transformant" refers to a recipient cell that acquires a new genetic marker after incorporation or introduction of a foreign gene.

[0029] In some embodiments of the present invention, the transformant does not involve plant or animal reproductive materials.

[0030] In some embodiments of the present invention, the transformants include common cell vectors such as Escherichia coli, Bacillus subtilis, Saccharomyces cerevisiae, and Pichia pastoris.

[0031] In some embodiments of the present invention, the expression vector and transformant can be constructed based on any conventional techniques in the art.

[0032] In this invention, the genetically engineered bacteria expressing DNA polymerase are obtained by inserting the encoding nucleotide sequence of DNA polymerase into a plasmid vector to form a recombinant vector, which is then transformed into host cells. The plasmid vector refers to bacterial plasmids, bacteriophages, yeast plasmids, plant cell viruses, animal cell viruses, retroviruses, or other vectors well-known in the art. In this invention, the vectors that can be used include, but are not limited to, the pET-30a(+) vector expressed in *E. coli*. Any vector can be used to construct a recombinant expression vector, as long as it can stably replicate and exist in the host cell.

[0033] In some embodiments of the present invention, the recombinant vector is obtained by inserting the DNA polymerase DNA fragment into the cloning site of the pET-30a(+) vector to obtain a recombinant plasmid. Optionally, the cloning site is an NdeI or BamHI restriction enzyme site.

[0034] In some embodiments of the present invention, the host cell includes prokaryotic cells, such as archaea cells, bacterial cells, or lower eukaryotic cells, such as yeast cells; or higher eukaryotic cells, such as mammalian cells.

[0035] In some embodiments of the present invention, the genetically engineered bacteria are recombinant engineered bacteria constructed from Escherichia coli.

[0036] A fourth aspect of the present invention provides a composition comprising at least one of the DNA polymerase mutant, nucleic acid molecule, and biological material described in the above aspects.

[0037] In some embodiments of the present invention, the composition comprises an enzyme preparation.

[0038] In some embodiments of the present invention, the enzyme preparation may be used as a polymerase.

[0039] In some embodiments of the present invention, the enzyme preparation may be used as a DNA polymerase.

[0040] In some embodiments of the present invention, the enzyme preparation can be used for extended reactions against non-natural substrates.

[0041] In some embodiments of the present invention, the non-natural substrate refers to a deoxyribonucleotide modified with an oligonucleotide or its analogue.

[0042] In some embodiments of the present invention, the deoxyribonucleotide modified with oligonucleotides or their analogues includes at least one of the natural A, T, C, and G that has been modified with oligonucleotides or their analogues.

[0043] In some embodiments of the present invention, the oligonucleotide or analogue modification includes, but is not limited to, oligomer modification with 10, 20, 30, or 40 deoxyribonucleic acid linkages, polyphosphate modification, base-free oligonucleotide modification, 2' position sugar modification, 5' position pyrimidine modification, 8' position purine modification, exocyclic amine modification, substitution of 4-thiouridine, substitution of 5-bromo or 5-iodouracil, backbone modification, thiophosphate or alkyl phosphate modification, methylation, and uncommon base pairing combinations such as isobasic isocyanidins and isouridines; 3' and 5' modifications such as capping; and phosphate backbone modification, etc. Examples include T40HA, D8G, A30A, N045, N036, N050, and N033.

[0044] In some embodiments of the present invention, the extension reaction includes, but is not limited to, DNA amplification or DNA sequencing.

[0045] In some embodiments of the present invention, the enzyme preparation can be used as a method for utilizing Mg 2+ Catalyzing the synthesis, replication, or amplification of DNA from non-natural substrates or enhancing Mg 2+ Ion pairs are selective DNA polymerases that catalyze the synthesis, replication, or amplification of DNA from non-natural substrates.

[0046] A fifth aspect of the invention provides the use of at least one of the DNA polymerase mutants, nucleic acid molecules, biological materials, and compositions described above in any of the following: A1. Nucleic acid replication and / or nucleic acid amplification; A2. Preparation of nucleic acid replication and / or nucleic acid amplification related products; A3. Sequencing; A4. Prepare sequencing-related products.

[0047] In some embodiments of the present invention, the nucleic acid amplification includes strand displacement reaction, polymerase chain reaction, and isothermal amplification reaction.

[0048] In some embodiments of the present invention, the isothermal amplification reaction includes at least one of loop-mediated amplification (LAMP), rolling circle amplification (RCA), strand substitution amplification (SDA), multiple substitution amplification (MDA), and cross primer amplification (CPA).

[0049] In some embodiments of the present invention, the sequencing includes at least one of DNA sequencing, RNA sequencing, and whole genome sequencing.

[0050] In some embodiments of the present invention, the preparation of sequencing-related products includes the preparation of at least one of products for DNA sequencing, RNA sequencing, and whole genome sequencing.

[0051] In some embodiments of the invention, the product further includes at least one of a non-natural substrate and a reaction buffer.

[0052] A sixth aspect of the present invention provides a method for synthesizing a fragment of DNA, the method comprising the following steps: S1: Configure the reaction system; S2: The DNA fragment is obtained directly by amplification under the reaction system of S1; S3: Verify the DNA fragment by agarose gel electrophoresis.

[0053] In some embodiments of the present invention, the reaction system includes the DNA polymerase mutant described above.

[0054] In some embodiments of the present invention, the reaction system further includes a non-natural substrate.

[0055] In some embodiments of the present invention, the non-natural substrate refers to a deoxyribonucleotide modified with an oligonucleotide or its analogue.

[0056] In some embodiments of the present invention, the reaction system further includes at least one of a reaction buffer, a magnesium ion solution, dithiothreitol (DTT), and a specific primer pair.

[0057] In some embodiments of the present invention, the amplification includes PCR amplification or isothermal amplification.

[0058] In some embodiments of the present invention, the fragment DNA includes at least one of long fragment DNA and short fragment DNA.

[0059] In some embodiments of the present invention, the length of the long DNA fragment is greater than or equal to 48.5 kb.

[0060] In some embodiments of the present invention, the short DNA fragment is less than 48.5 kb in length.

[0061] In some embodiments of the present invention, the short DNA fragment is 63 bp-48.5 kb in length.

[0062] In some embodiments of the present invention, the length of the DNA fragment is greater than or equal to 63 bp.

[0063] In some embodiments of the present invention, the method for synthesizing the long DNA fragment specifically includes the following steps: First, design specific primer pairs according to the sequence of the target long DNA fragment; then, prepare the reaction system by mixing the template-primer complex with purified DNA polymerase at a molar ratio of 10:1 and reacting at 25°C for 10 min to allow the enzyme to fully bind with the template-primer complex; then, add the remaining reaction components to obtain a reaction solution with a total volume of 10 μL, wherein the final concentrations of each component in the reaction system are: 5 mM MgCl2, 20 mM HEPES, 10 nM template + primer, 4 mM DTT, dNTPs at a concentration of 50 μM for each base, and 100 nM DNA polymerase; next, place the prepared reaction solution at 30°C for 40 min and directly obtain the target long DNA fragment by PCR amplification; finally, detect the amplified long DNA fragment by agarose gel electrophoresis.

[0064] In some embodiments of the present invention, the fragmented DNA can be a DNA molecule of any conformation, including but not limited to circular DNA and hairpin DNA.

[0065] A seventh aspect of the present invention provides a kit for use in at least one of nucleic acid replication, nucleic acid amplification, and sequencing, comprising at least one of the DNA polymerase mutant, the nucleic acid molecule, the biological material, and the composition.

[0066] In some embodiments of the present invention, the nucleic acid amplification includes strand displacement reaction, polymerase chain reaction, and isothermal amplification reaction.

[0067] In some embodiments of the present invention, the sequencing includes performing DNA sequencing, RNA sequencing, or whole genome sequencing.

[0068] In some embodiments of the present invention, the kit further includes at least one of reaction buffer, magnesium ion solution, non-natural substrate, and dithiothreitol (DTT).

[0069] In some embodiments of the present invention, the non-natural substrate includes at least one of natural A, T, C, and G modified with an oligonucleotide or analogue.

[0070] The beneficial effects of this invention are: The DNA polymerase mutant in this invention, compared to the wild-type DNA polymerase, exhibits higher performance in the presence of magnesium ions (Mg). 2＋ In the presence of a cofactor, this mutant significantly enhances the efficiency and ability of DNA extension amplification using non-natural substrates, especially achieving highly efficient extension amplification of DNA fragments longer than 48.5 kb. Furthermore, this mutant can serve as a DNA polymerase capable of effectively extending long DNA fragments using non-natural substrates, effectively filling the gaps in existing polymerases regarding non-natural substrate compatibility, long fragment extension efficiency, and stability, providing a key tool for non-natural substrate-mediated long DNA amplification technology. Attached Figure Description

[0071] Figure 1 This is the map of the recombinant plasmid constructed in Example 1 of the present invention.

[0072] Figure 2 The results are SDS-PAGE protein electrophoresis identification results of the purified wild-type DNA polymerase and various DNA polymerase mutants in Example 1 of this invention.

[0073] Figure 3 The results are electrophoresis results of the wild-type DNA polymerase and various DNA polymerase mutants on the extension products of non-natural substrates in Example 2 of this invention.

[0074] Figure 4 This is a diagram showing the hairpin structure and sequence of the template used in Embodiment 3 of the present invention.

[0075] Figure 5 The results are electrophoresis results of the wild-type DNA polymerase and various DNA polymerase mutants on the extended products of non-natural substrates in Example 3 of this invention.

[0076] Figure 6The results are electrophoretics of the wild-type DNA polymerase and the extended products of various DNA polymerase mutants on non-natural substrates in Comparative Example 1 of this invention. Detailed Implementation

[0077] The present invention will be further described in detail below through specific embodiments. Unless otherwise specified, the raw materials, reagents, or apparatus used in the embodiments and comparative examples are all available from conventional commercial sources or can be obtained by existing technical methods. Unless otherwise specified, the test or experimental methods are conventional methods in the art.

[0078] In this invention, the LB liquid culture medium formula is: 10 g / L tryptone, 5 g / L yeast extract, 5 g / L NaCl, with the remainder being water. The LB solid culture medium is based on the LB liquid culture medium formula, with the addition of 15 g / L agar.

[0079] Example 1 In this embodiment, wild-type DNA polymerase and DNA polymerase mutants are provided, as well as methods for their preparation, expression, and purification.

[0080] The specific steps are as follows: (1) Construction of recombinant plasmids encoding each wild-type DNA polymerase and each DNA polymerase mutant The construction of all wild-type DNA polymerases, the nucleotides of each DNA polymerase mutant, and the recombinant plasmids containing the inserted coding nucleotides was performed by GenScript. An example of the constructed recombinant plasmid map is shown below. Figure 1 As shown below, an exemplary nucleotide sequence of the constructed recombinant plasmid is presented, with insertion sites at NdeI and BamHI restriction enzyme sites. Other recombinant plasmids differ in that the inserted target gene has been substituted.

[0081] An exemplary nucleotide sequence of a recombinant plasmid is as follows:

[0082] The amino acid sequences and corresponding coding sequences (nucleotide sequences) of each wild-type DNA polymerase and each DNA polymerase mutant are shown below.

[0083] The amino acid sequence of wild-type phiZP2 DNA polymerase (phiZP2) is as follows: MHHHHHHSGGSVDTLSGLSSEQGQSGDMTIEEDSATHIKFSKRDEDGKELAGATMELRDSSGKTISTWISDGQVKDFYLYPGKYTFVETAAPDGYEVATAITFTVNEQGQVTVNGKATKGDAHISGGSDKHTQYVQEHSFIYSEYEKAQFKEIECLIFDTESCTNYENDNTGARVYGWGLGVTRNKNMIYGQNLNQFWEVCQNIFNDWYHDNKHTIKITKTKKGFPKRKYIKFPIAVHNLGWDVEFLKYSLVENGFNYDKGLLKTVFSKGAPYQTFTDVEEPKTFHIVQNNNIVYGCNVYMDKFFEVENKDGSTTEIGLCLDFFDSYKIITCAESQFHNYVHDVDPMFYKMSEEYDYDTWRSPTHKQTTLELRYQYNDIYMLREVIEQFYIDGLCGGELPLTGMRTASSIAFNVLKKMTFGEEKTEEGYINYFELDKKTKFEFLRKRIEMESYTGGYTHANHKAVGKTINKLGCSLDINSSYPSQMAYKVFPYGKPVRKTWGRKPKTEKNEVYLIEVGFDFVEPKHEEYALDIFKIGAVNSKALSPITGAVSGQEYFCTNIKDGKAIPVFKEIKDTKLTTNYNVVLTSVEYEFWIKHFNFGTFKKDEYDCFEVDNLEFTGLKIGSILYYKAEKGKFKPYVDHFTKMKVENKKLGNKPLTNQAKLFLNGAYGKFGTKQNKEEKDLIMDKNGLLTFTGSVTEYEGKEFYRPYASFVTAYGRLQLWNAIIYAVGVDNFLYCDTDSIYCNREVNSLIDDMNAIGETIDKTILGKWDVEHIFDKFKVLGQKKYMYHDCKENYIDLKCCGLPADARKIIINEGFEEFYLGKNVEGKKQRKKVVGGCLLLDTLFTIKRIMF (SEQ ID NO:1).

[0084] The amino acid sequence of phiZP2 DNA polymerase mutant 1 (phiV1) is as follows: MHHHHHHSGGSVDTLSGLSSEQGQSGDMTIEEDSATHIKFSKRDEDGKELAGATMELRDSSGKTISTWISDGQVKDFYLYPGKYTFVETAAPDGYEVATAITFTVNEQGQVTVNGKATKGDAHISGGSDKHTQYVQEHSFIYSEYEKAQFKEIECLIFDTESCTNYENDNTGARVYGWGLGVTRNKNMIYGQNLNQFWEVCQNIFNDWYHDNKHTIKITKTKKGFPKRKYIKFPIAVHNLGWDVEFLKYSLVENGFNYDKGLLKTVFSKGAPYQTFTDVEEPKTFHIVQNNNIVYGCNVYMDKFFEVENKDGSTTEIGLCLDFFDSYKIITCAESQFHNLVHDVDPMFYKMSEEYDYDTWRSPTHKQTTLELRYQYNDIYMLREVIEQFYIDGLCGGELPLTGMRTASSIAFNRLKKMTFGEEKTEEGYINYFELDKKTKFEFLRKRIEMESYTGGYTHANHKAVGKTINKLGCSLDINSAYPSQMAYKVFPYGKPVRKTWGRKPKTEKNEVYLIEVGFDFVEPKHEEYALDIFKIGAVNSKALSPITGAVSGQEYFCTNIKDGKAIPVFKEIKDTKLTTNYNVVLTSVEYEFWIKHFNFGTFKKDEYDCFEVDNLEFTGLKIGSILYYKAEKGKFKPYVDHFMKMKVENKKLGNKPLALQFKLFLNGAYGKFGTGQNKEEKDLIMDKNGLLTFTGSVTEYEGKEFYRPYASFVTAYGRLQLWNAIIYAVGVDNFLYCDTDSIYCNREVNSLIDDMNAIGETIDKTQLGKWRVEHIFDKFKVLGQKKYMYHDCKENYIMLKCCGLPYDARKIIINEGFEEFYLGKNVEGKKQRKKVVGGCLLLDTLFTIKRIMF (SEQ ID NO:2).

[0085] The amino acid sequence of phiZP2 DNA polymerase mutant 2 (phiV2) is as follows: MHHHHHHSGGSVDTLSGLSSEQGQSGDMTIEEDSATHIKFSKRDEDGKELAGATMELRDSSGKTISTWISDGQVKDFYLYPGKYTFVETAAPDGYEVATAITFTVNEQGQVTVNGKATKGDAHISGGSDKHTQYVQEHSFIYSEYEKAQFKEIECLIFDTESCTNYENDNTGARVYGWGLGVTRNKNMIYGQNLNQFWEVCQNIFNDWYHDNKHTIKITKTKKGFPKRKYIKFPIAVHNLGWDVEFLKYSLVENGFNYDKGLLKTVFSKGAPYQTFTDVEEPKTFHIVQNNNIVYGCNVYMDKFFEVENKDGSTTEIGLCLDFFDSYKIITCAESQFHNLVHDVDPMFYKMSEEYDYDTWRSPTHKQTTLELRYQYNDIYMLREVIEQFYIDGLCGGELPLTGMRTASSIAFNRLKKMTFGEEKTEEGYINYFELDKKTKFEFLRKRIEMESYTGGYTHANHKAVGKTINKLGCSLDINSAYPSQMAYKVFPYGKPVRKTWGRKPKTEKNEVYLIEVGFDFVEPKHEEYALDIFKIGAVNSKALSPITGAVSGQEYFCTNIKDGKAIPVFKEIKDTKLTTNYNVVLTSVEYEFWIKHFNFGTFKKDEYDCFEVDNLEFTGLKIGSILYYKAEKGKFKPYVDHFMKMKVENKKLGNRPLANQAKLFLNGAYGKFGTKQNKEEKDLIMDKNGLLTFTGSVTEYEGKEFYRPYASFVTAYGRLQLWNAIIYAVGVDNFLYCDTDSIYCNREVNSLIDDMNAIGETIDKTQLGKWRVEHIFDKFKVLGQKKYMYHDCKENYIMLKCCGLPYDARKIIINEGFEEFYLGKNVEGKKQRKKVVGGCLLLDTLFTIKRIMF (SEQ ID NO:3).

[0086] The amino acid sequence of wild-type CPV1 DNA polymerase (CPV1) is as follows: MHHHHHHSGGSVDTLSGLSSEQGQSGDMTIEEDSATHIKFSKRDEDGKELAGATMELRDSSGKTISTWISDGQVKDFYLYPGKYTFVETAAPDGYEVATAITFTVNEQGQVTVNGKATKGDAHISGGSDKHTQYVKAHSFIHSEYKKAQFNDIECLIFDTESCTNYENDNTGARVYGWGLGVTRNKNMIYGQNLDQFWDVCINIFNDWYYNNKNTIKITKTKKGYPVRKYIKFPIAVHNLGWDVEFLKYSLVQNGFNYDKGLLKTVFSKGAPYQTVTEIEEPKTFHIVQNNNIVYGCNVYMDVFHEIENKDGSITEIGLCLDFFDSYKIITCAESQFHNLVHDVDPMFYKMNEEYDYDKWRSTEHIQNTLELRYQYNDIYMLREVIEQFYIDGLCGGELPLTGMRTASSIAFNRLKKMTFGEEKTEEEYIKYFELDKKTKFEFLRKRIETESYTGGYTHANHKAVGKTITKLGCSLDINSAYPSQMAYKVFPYGKPIRKTWGRKPKTEKNEVYLIEVGFDFVKPKHEEYALDIFKIGAVNSKALAPITGAVSGQEYFCTNIKDEKAIPVFKELKDTKLTTNYNVVLTSVEYEFWIKHFDFGVFTKDEYECFELDNLNFTGLKIGSILYYKSEKGKFKPYVDHFMKMKVENKKLGNKPLALQFKLFLNGAYGKFGTGQNKEEKDLIMDKNGLLTFTGSVTEYEGKEFYRPYASFVTAYGRLQLWNAIIYAVGVENFLYCDTDSIYCNREVNSLIEDMNAIGETIDKTQLGKWRVEHIFDKFKVLGQKKYMYHDCKENYIMLKCCGLPYDARKIIINEGFEEFYLGKNVEGKKQRKKVVGGCLLLDTLFTIKRIMF (SEQ ID NO:4).

[0087] The amino acid sequence of the CPV1 DNA polymerase mutant (CPV2) is as follows: MHHHHHHSGGSVDTLSGLSSEQGQSGDMTIEEDSATHIKFSKRDEDGKELAGATMELRDSSGKTISTWISDGQVKDFYLYPGKYTFVETAAPDGYEVATAITFTVNEQGQVTVNGKATKGDAHISGGSDKHTQYVKAHSFIHSEYKKAQFNDIECLIFDTESCTNYENDNTGARVYGWGLGVTRNKNMIYGQNLDQFWDVCINIFNDWYYNNKNTIKITKTKKGYPVRKYIKFPIAVHNLGWDVEFLKYSLVQNGFNYDKGLLKTVFSKGAPYQTVTEIEEPKTFHIVQNNNIVYGCNVYMDVFHEIENKDGSITEIGLCLDFFDSYKIITCAESQFHNLVHDVDPMFYKMNEEYDYDKWRSTEHIQNTLELRYQYNDIYMLREVIEQFYIDGLCGGELPLTGMRTASSIAFNRLKKMTFGEEKTEEEYIKYFELDKKTKFEFLRKRIETESYTGGYTHANHKAVGKTITKLGCSLDINSAYPSQMAYKVFPYGKPIRKTWGRKPKTEKNEVYLIEVGFDFVKPKHEEYALDIFKIGAVNSKALAPITGAVSGQEYFCTNIKDEKAIPVFKELKDTKLTTNYNVVLTSVEYEFWIKHFDFGVFTKDEYECFELDNLNFTGLKIGSILYYKSEKGKFKPYVDHFMKMKVENKKLGNRPLANQAKLFLNGAYGKFGTKQNKEEKDLIMDKNGLLTFTGSVTEYEGKEFYRPYASFVTAYGRLQLWNAIIYAVGVENFLYCDTDSIYCNREVNSLIEDMNAIGETIDKTQLGKWRVEHIFDKFKVLGQKKYMYHDCKENYIMLKCCGLPYDARKIIINEGFEEFYLGKNVEGKKQRKKVVGGCLLLDTLFTIKRIMF (SEQ ID NO:5).

[0088] The nucleotide sequence of wild-type phiZP2 DNA polymerase (phiZP2) is as follows:

[0089] The nucleotide sequence of phiZP2 DNA polymerase mutant 1 (phiV1) is as follows:

[0090] The nucleotide sequence of phiZP2 DNA polymerase mutant 2 (phiV2) is as follows:

[0091] The nucleotide sequence of wild-type CPV1 DNA polymerase (CPV1) is as follows:

[0092] The nucleotide sequence of the CPV1 DNA polymerase mutant (CPV2) is as follows:

[0093] (2) Culture and induction expression of recombinant DNA polymerase strains Enzyme protein expression was performed using *E. coli* BL21(DE3). Specifically, the obtained recombinant expression vector was sequentially transformed into *E. coli* ER2566 supercompetent cells (Beyotime Biotechnology, D1039S). First, the obtained DNA polymerase recombinant expression vector was transformed into *E. coli* competent cells, and then plated on LB agar (with 50 mg / L kanamycin) and incubated at 37°C for 12 hours. Then, a single colony was transferred into LB liquid medium (containing 50 mg / L kanamycin) and incubated at 37°C for 12 hours. The bacterial culture was then sequenced for verification. Once confirmed, recombinant *E. coli* expressing DNA polymerase was obtained.

[0094] DNA polymerase was screened. Specifically, following the method described in the above examples, recombinant *E. coli* transformed with the recombinant expression vector of DNA polymerase were prepared. 5 µL of these recombinant *E. coli* were inoculated into 5 mL of LB liquid medium (containing 50 mg / L kanamycin) and cultured overnight at 37°C and 180 rpm. Then, the bacterial culture was inoculated into 200 mL of LB liquid medium (containing 50 mg / L kanamycin) at a 1% (v / v) inoculation rate and cultured in a temperature-controlled shaker at 37°C and 180 rpm for 5 h (equivalent to an OD600 value of 1). The bacterial culture was then removed and cooled at 4°C. Then, an inducer (IPTG) with a final concentration of 0.6 mM was added, and the culture was further induced in a temperature-controlled shaker at 20°C and 180 rpm for 24 h.

[0095] (3) Bacterial cell collection and DNA polymerase purification The cultured bacterial solution was poured into a 500 mL centrifuge cup and centrifuged at 8000 rpm for 10 min at 4°C. The supernatant was discarded, and the bacterial cells were collected and weighed. Wild-type recombinant Escherichia coli with DNA polymerase and recombinant Escherichia coli with DNA polymerase mutant were obtained as wet cells. The polymerase protein was eluted using Ni column affinity chromatography (Ni Sepharose 6FF resin (17531801, Cytiva, Marlborough, MA, USA)) with different concentrations of imidazole. The elution solution consisted of 50 mM Tris, 200 mM KCl, 0.5% Tween-20, 5 mM TCEP (tris(2-chloroethyl) phosphate), and different concentrations of imidazole (100 mM, 150 mM, 200 mM, and 300 mM). The proteins from the elution fractions of 150 mM and 200 mM imidazole were combined and purified to obtain the fusion polymerase. The polymerase was then concentrated using an AMICON ULTRA 15 mL 50 K ultrafiltration column (Millipore, catalog number: UFC905024) and the stock solution was replaced. The replacement solution consisted of 50 mM Tris, 200 mM KCl, 0.5% Tween-20, 5 mM TCEP, and 10% glycerol.

[0096] The purified phiZP2, CPV1, phiV1, phiV2, and CPV2 DNA polymerases (98.3 kD) were analyzed by SDS-PAGE protein electrophoresis to determine the purity of the DNA polymerase proteins. The results are as follows: Figure 2 As shown, this indicates that wild-type DNA polymerases phiZP2 and CPV1, as well as DNA polymerase mutants phiV1, phiV2, and CPV2, were successfully expressed with high purity.

[0097] Example 2 This embodiment tests the ability of each wild-type DNA polymerase and each DNA polymerase mutant to amplify long DNA fragments using modified non-natural substrates. The detection method is as follows: (1) Preparation of circular template-primer complex The primers and circular template were mixed in an annealing buffer (20 mM HEPES, pH = 7.5) at a molar ratio of 2:1 to obtain a circular template-primer mixture (final template concentration approximately 100 nM). The circular template-primer mixture was heated at 95°C for 3 min and then cooled to room temperature to obtain the circular template-primer complex.

[0098] The nucleotide sequence of the single-stranded circular template is 5′-AGGTCGCCAGTTACTTGTTCTCGATGAGTGCCGTACTTGGTTTAATACCCGTTCTTGGAATGATAAGGAAAGACAGCCGATTATTGATTGGTTTCTACATGCTCGTAAATTAGGATGGGATATTATTTTTCTTGTTCAGGACTTATCTATTGTTGATAAACAGGCGCGTTCTGCATTAGCTGAACATGTGTCGCCAGCCC-3′ (SEQ ID NO: 12).

[0099] The nucleotide sequence of the primer is 5′-CTGGCGACCTGGGCTGGCGAC-3′ (SEQ ID NO: 13).

[0100] (2) Natural substrate / non-natural substrate extended reaction 1. Configure the reaction system Table 1. Reaction System

[0101] The non-natural substrates were synthesized by Anxuyuan Biotechnology (Tianjin) Co., Ltd. A, T, C, and G in the non-natural substrates were selected from the study "Real-time single-molecule electronic DNA sequencing by synthesis using polymer-tagged nucleotides on a nanopore array" (Contributed by George M. Church, March 18, 2016 (sent for review February 4, 2016; reviewed by Cynthia J. Burrows, Xiaohua Huang, and Andre Marziali, https: / / doi.org / 10.1073 / pnas.1601782113). Figure 2 The four artificially modified bases (A, T, C, G) in the figure are, in order: dA6P-Cy3-dT4-FldT-dT-FldT-dT 23 -C3、dT6P-Cy3-dT2-dSp8-dT 20 -C3、dC6P-Cy3-dT4-dSp3-dT 23 -C3、dG6P-Cy3-dT 30 -C3. The structural formulas are as follows: .

[0102] The template-primer complex was mixed with the purified DNA polymerase at a molar ratio of 10:1 (5 μL), and reacted at 25 °C for 10 min. Other components were then added (see Table 1) to obtain a total reaction volume of 10 μL. The mixture was then reacted at 30 °C for 40 min to obtain the amplification product.

[0103] The final amplification products were detected by agarose gel electrophoresis, and the results are as follows: Figure 3 As shown. NC is the negative control (a mixture containing only the circular template and primer complex). The results indicate that wild-type phiZP2 polymerase utilizes Mg... 2+ As an auxiliary metal ion, under natural dNTP substrate and circular template conditions, single-stranded amplification products larger than 48.5 kb can be obtained. While DNA polymerase mutants phiV1, phiV2, and CPV2 can amplify under these conditions, their product fragments are relatively diffuse; wild-type CPV1 polymerase produces shorter DNA fragments under the same conditions. However, in Mg... 2+ Under non-natural substrate conditions, DNA polymerase mutants CPV2, phiV1, and phiV2 can obtain single-stranded amplification products larger than 48.5 kb using circular templates, while the product fragments of wild-type DNA polymerase CPV1 are more diffuse, and phiZP2 polymerase cannot amplify DNA fragments under these conditions.

[0104] Example 3 This embodiment tests the ability of each wild-type DNA polymerase and each DNA polymerase mutant to amplify linear DNA templates using modified non-natural substrates. The detection method is as follows: First, the template used has the following hairpin structure and sequence: Figure 4 As shown, the template was heated at 95°C for 5 minutes, then allowed to cool to room temperature. Then, 100 nM template was mixed with 100 nM polymerase and reacted at 30°C for 40 minutes in a reaction solution (0.4 M KAc, 0.05 M Tris-HCl (pH=7.5), 5 mM MgAc2, 0.4 mM EDTA, 4 mM TCEP, 100 μM of the same non-natural substrate as in Example 2). The final amplified product was detected by 10% TBU electrophoresis, and the results are shown below. Figure 5 As shown. NC is the negative control (containing only template and non-natural substrate). The results indicate that wild-type CPV1 and phiZP2 polymerases utilize Mg... 2+As an auxiliary metal ion, it is impossible to amplify 63 bp DNA products under non-natural substrate conditions, but the DNA polymerase mutants CPV2, phiV1, and phiV2 designed in this application can obtain the corresponding amplification products.

[0105] These results further demonstrate that, for linear DNA templates, the DNA polymerase mutants CPV2, phiV1, and phiV2 designed in this application also exhibit good amplification adaptability, successfully achieving efficient amplification of short DNA fragments with a length of 63 bp. The amplification products are highly specific and can meet the routine application requirements of short DNA amplification, further expanding the applicable scenarios of this mutant.

[0106] Comparative Example 1 This comparative example uses the phi29 DNA polymerase mutant Ion_6 disclosed in the prior patent (patent number: CN119736271A, title: A phi29 DNA polymerase mutant and its use) as a control object, with the aim of verifying the difference in technical effect between the DNA polymerase mutants phiV1, phiV2, and CPV2 obtained by screening in this invention and the DNA polymerase mutants disclosed in the prior patent.

[0107] The preparation of the comparative amplification product is exactly the same as the steps in Example 2.

[0108] The final amplification products were detected by agarose gel electrophoresis, and the results are as follows: Figure 6 As shown. NC is the negative control (a mixture containing only the circular template and primer complex). The results indicate that in Mg... 2+ Under non-natural substrate conditions, CPV2, phiV1, and phiV2 polymerases can produce single-stranded amplification products larger than 48.5 kb using a circular template, while the control group Ion_6 polymerase, under Mg... 2+ Furthermore, under non-natural substrate conditions, although single-strand amplification can be performed using a circular template, the amplification product is less than 10 kb. Therefore, compared to the DNA polymerase mutants designed in prior patented technologies, the specific DNA polymerase mutant in Comparative Example 1 can achieve [amplification] with magnesium ions (Mg [amount]). 2+ Under the condition of presence, it significantly improves its efficiency and ability to extend and amplify long DNA fragments using non-natural substrates, especially to extend and amplify DNA fragments larger than 48.5 kb.

[0109] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. A DNA polymerase mutant, characterized in that, The DNA polymerase mutant includes one of the following: (A) A DNA polymerase mutant obtained by substituting at least one amino acid from Y340, V414, S481, T644, K656, T659, N660, A662, K676, I767, D772, D799 and A807 based on the sequence shown in SEQ ID NO:1; (B) A DNA polymerase mutant obtained by substituting at least one amino acid from K656, L660, F662, and G676 based on the sequence shown in SEQ ID NO:4; (C) A DNA polymerase mutant that, based on (A) or (B), has undergone substitution and / or deletion and / or addition of one or more amino acids and has the same function as (A) or (B).

2. The DNA polymerase mutant according to claim 1, characterized in that, The amino acid substitution includes one of the following: (1) Based on the sequence shown in SEQ ID NO:1, the amino acid substitutions include at least one of Y340L, V414R, S481A, T644M, K656R, T659A, N660L, A662F, K676G, I767Q, D772R, D799M, and A807Y; (2) Based on the sequence shown in SEQ ID NO:4, the amino acid substitutions include at least one of K656R, L660N, F662A, and G676K.

3. A nucleic acid molecule encoding the DNA polymerase mutant according to any one of claims 1-2.

4. A biomaterial, characterized in that, The biomaterial includes at least one of the following: (1) An expression vector containing the nucleic acid molecule of claim 3; (2) A transformant containing the nucleic acid molecule of claim 3; (3) Transformants containing the expression vector in (1).

5. A composition, characterized in that, The composition contains at least one of the DNA polymerase mutant of any one of claims 1-2, the nucleic acid molecule of claim 3, and the biomaterial of claim 4.

6. Use of at least one of the following: the DNA polymerase mutant of any one of claims 1-2, the nucleic acid molecule of claim 3, the biomaterial of claim 4, and the composition of claim 5, in any one of the following: A1. Nucleic acid replication and / or nucleic acid amplification; A2. Preparation of nucleic acid replication and / or nucleic acid amplification related products; A3. Sequencing; A4. Prepare sequencing-related products.

7. A method for synthesizing a fragment of DNA, characterized in that, The method includes the following steps: S1: Configure the reaction system; S2: The DNA fragment is obtained directly by amplification under the reaction system of S1; S3: Verify the DNA fragment by agarose gel electrophoresis; The reaction system includes the DNA polymerase mutant according to any one of claims 1-2.

8. The synthesis method according to claim 7, characterized in that, The amplification includes PCR amplification or isothermal amplification.

9. A kit for at least one application in nucleic acid replication, nucleic acid amplification, and sequencing, characterized in that, It comprises at least one of the following: the DNA polymerase mutant of any one of claims 1-2, the nucleic acid molecule of claim 3, the biomaterial of claim 4, and the composition of claim 5.

10. The reagent kit according to claim 9, characterized in that, The kit also includes non-natural substrates.

Images