A method and kit for detecting helicobacter pylori based on mcda-cr ispr / cas12b

Abstract

The application provides a method and a kit for detecting Helicobacter pylori based on MCDA-CRISPR / Cas12b, and in view of the problem that a MCDA multi-primer system is prone to non-specific amplification and interferes with true positive signal recognition, a tube bottom prepositioned MCDA amplification system, a tube cover pre-coated CRISPR / Cas12b detection system, and mineral oil sealing are adopted to realize physical isolation, and step-by-step starting is triggered by centrifugation, so that amplification and cleavage are sequentially performed in the same reaction tube; the MCDA primer group is composed of sequences shown in SEQ ID NO: 1-10, and a matching crRNA sequence is shown in SEQ ID NO: 11; the application forms a double protection mechanism by recognizing target genes through MCDA ten-region recognition amplification and recognizing MCDA specific amplification products through a CRISPR system, the detection limit of DNA containing a target gene plasmid reaches 28 copies / µL, there is no cross reaction with 11 common intestinal pathogens, and the detection limit in a fecal sample is 1.58x10 4 CFU / mL, and the detection is completed within 55 minutes; the application is simple to operate, does not require complex equipment, and is suitable for non-invasive and instant detection of Helicobacter pylori.

Description

Technical Field

[0001] This application relates to the field of biodetection technology, and more specifically, to a method and kit for detecting Helicobacter pylori based on MCDA-CRISPR / Cas12b. Background Technology

[0002] Helicobacter pylori ( Helicobacter pylori Helicobacter pylori (Hp) is a Gram-negative, microaerophilic bacterium that can colonize the human gastric mucosa for a long time, causing chronic active gastritis and is closely related to the development of peptic ulcers, gastric mucosa-associated lymphoid tissue (MALT) lymphoma, and gastric adenocarcinoma. Epidemiological surveys show that about half of the world's population is infected with this pathogen, and a significant proportion of gastric cancer cases can be attributed to Helicobacter pylori infection, posing a major public health risk.

[0003] Currently, non-invasive detection methods for Helicobacter pylori mainly include urea breath test, fecal antigen test, and serological antibody test. However, existing technologies suffer from problems such as susceptibility to drug interference leading to false negatives, insufficient sensitivity at low bacterial loads, and inability to distinguish between current and past infections. While molecular diagnostic technologies based on nucleic acid amplification, such as polymerase chain reaction (PCR), can overcome these limitations, they rely on expensive thermal cycling equipment, making them difficult to promote at the grassroots level.

[0004] Multiple cross-substitution amplification (MCDA), as a novel isothermal amplification technique, can achieve highly efficient exponential amplification of target nucleic acids under isothermal conditions, offering significant advantages in both high sensitivity and rapid reaction. However, the multi-primer system of MCDA is prone to non-specific annealing during amplification, forming byproducts such as primer dimers. If non-specific fluorescent dyes are used for tracking, these byproducts can trigger false fluorescence signals, leading to false positive results. The introduction of the CRISPR / Cas12b system precisely solves this problem. This system possesses precise sequence-specific recognition capabilities, specifically recognizing the true amplification products generated by MCDA under crRNA guidance, thereby activating trans-cleavage activity and cleaving single-stranded probes to generate accurate specific fluorescence signals. Furthermore, the optimal reaction temperature of the CRISPR / Cas12b system is highly compatible with MCDA, laying a solid foundation for the deep integration of the two.

[0005] Most established MCDA-CRISPR / Cas reaction systems currently employ a "separate detection" approach, where MCDA amplification is performed first, followed by opening the cap to transfer the product to the CRISPR / Cas12b reaction system. This process is not only cumbersome, but more critically, the cap-opening step is highly susceptible to aerosol contamination.

[0006] Therefore, there is an urgent need to develop a "one-tube" detection strategy that does not require opening the cap. This strategy would utilize CRISPR / Cas12b to specifically identify and eliminate interference from MCDA primer dimers, while simultaneously eliminating aerosol contamination through a fully enclosed reaction system, thus achieving highly specific and contamination-free accurate detection. Summary of the Invention

[0007] This invention addresses the problem of false positive results caused by non-specific byproducts (primer dimers) in isothermal amplification using MCDA multi-primer systems, and the drawback of traditional "separate tube detection" methods that require opening the tube to transfer amplification products, which can easily lead to aerosol contamination. It provides a method and kit for detecting Helicobacter pylori based on MCDA-CRISPR / Cas12b. This invention utilizes extensive sequence alignment and analysis to detect Helicobacter pylori... ureA Using highly conserved regions of the gene as targets, we designed and screened MCDA-specific primer sets as shown in SEQ ID NO:1~10 for the first time, and designed a corresponding crRNA sequence as shown in SEQ ID NO:11. The crRNA guides Cas12b to specifically recognize the real amplification product of MCDA, fundamentally eliminating the interference of non-specific byproducts such as primer dimers on the detection signal.

[0008] Based on this, the present invention employs a physical isolation scheme of pre-positioning the amplification system at the bottom of the tube, pre-coating the detection system at the tube cap, and setting a mineral oil seal between the two. This allows MCDA amplification and CRISPR / Cas12b cutting to be performed stepwise within the same reaction tube: MCDA amplification is first performed under isothermal conditions to enrich the target nucleic acid; after amplification, centrifugation triggers the mixing of the detection system and amplification products in the tube cap, initiating the CRISPR / Cas12b cutting reaction, and the detection result is output via a fluorescence signal. The entire process is a closed-tube operation, eliminating the need for opening the cap for transfer and completely preventing aerosol contamination.

[0009] This method can complete the detection within 55 minutes, with a detection limit of 28 copies / µL for target DNA plasmids. It shows no cross-reactivity with 11 common intestinal pathogens and maintains excellent detection performance in fecal samples. It achieves synergistic effects of high MCDA amplification efficiency and high CRISPR / Cas12b recognition specificity, effectively eliminating false positive results caused by non-specific byproducts of MCDA multi-primer. This invention requires no complex instruments, is simple to operate, and features closed-tube contamination prevention, making it particularly suitable for non-invasive detection of fecal samples and point-of-care testing at the grassroots level. It provides a reliable technical means for clinical screening and epidemiological surveillance of Helicobacter pylori.

[0010] In a first aspect, the present invention provides a method for detecting Helicobacter pylori based on MCDA-CRISPR / Cas12b, comprising the following steps: S1: Provides MCDA primer set and CRISPR / Cas12b detection system; the MCDA primer set consists of nucleic acid sequences shown in SEQ ID NO: 1~10; S2: Mix the DNA of the sample to be tested with the MCDA primer set and perform a multi-crossover permutation amplification reaction under isothermal conditions to amplify the target DNA; S3: After the amplification reaction is completed, the CRISPR / Cas12b detection system is mixed with the amplification product to perform product-specific recognition and fluorescent probe cleavage reaction; S4: Determine whether Helicobacter pylori is present in the sample by detecting the fluorescence signal.

[0011] This invention addresses the problem of false positive results caused by non-specific byproducts (primer dimers) in isothermal amplification of MCDA multiprimer systems, as well as the defect of traditional detection methods that require opening the tube cap to transfer amplification products, which can easily cause aerosol contamination. It proposes a synergistic detection method with physical isolation and step-by-step initiation: the MCDA primer set is pre-placed at the bottom of the tube, the CRISPR / Cas12b detection system is pre-coated on the tube cap, and the two are physically isolated by a mineral oil seal, creating an interference-free amplification environment for MCDA. During the amplification phase, MCDA independently and efficiently amplifies the target nucleic acid at the bottom of the tube. After amplification, centrifugation triggers mixing, and crRNA guides Cas12b to recognize the actual MCDA amplification product, activating trans-cleavage activity and generating a specific fluorescent signal. The entire detection process is a closed-tube operation, eliminating the need for opening the tube for transfer and completely preventing aerosol contamination.

[0012] In the above design, the MCDA deca-primer can specifically recognize the target DNA and perform efficient amplification. The CRISPR / Cas12b system guides the recognition of the actual MCDA amplification product through crRNA, fundamentally eliminating the interference of non-specific byproducts such as primer dimers on the detection signal. At the same time, the stepwise start-up strategy of physical isolation and centrifugation triggering allows amplification and detection to be completed sequentially in the same closed tube, avoiding cross-contamination caused by opening the cap and transferring, and achieving an effective balance of high sensitivity, high specificity and anti-contamination.

[0013] Preferably, the MCDA primer set and the CRISPR / Cas12b detection system described in S1 are placed in the same reaction tube. The MCDA primer set is pre-placed at the bottom of the reaction tube, and the CRISPR / Cas12b detection system is pre-coated on the inner wall of the reaction tube cap. A mineral oil seal is provided between the MCDA primer set and the CRISPR / Cas12b detection system.

[0014] Preferably, the mixing described in S3 is performed by centrifugation to mix the CRISPR / Cas12b detection system in the tube cap with the MCDA amplification product at the bottom of the tube.

[0015] Preferably, in the MCDA primer set, SEQ ID NO:1 and SEQ ID NO:2 are substitution primers, SEQ ID NO:3 and SEQ ID NO:4 are cross-primers, and SEQ ID NO:5~10 are amplification primers.

[0016] Preferably, the CRISPR / Cas12b detection system contains Cas12b protein and crRNA, the sequence of which is shown in SEQ ID NO:11.

[0017] Preferably, the Cas12b protein is the AapCas12b protein.

[0018] Preferably, the sample to be tested is a fecal sample.

[0019] Preferably, the isothermal conditions described in S2 are 61~64℃ and the reaction time is 30~40 min.

[0020] Secondly, the present invention provides a kit for detecting Helicobacter pylori.

[0021] Thirdly, this invention provides an application of the MCDA-CRISPR / Cas12b-based method for detecting Helicobacter pylori in the preparation of Helicobacter pylori detection products.

[0022] In summary, the present invention has at least one of the following beneficial technical effects: 1. This invention uses multiple sequence alignment to screen for highly conserved sequences within the Helicobacter pylori genus and specific sequences between genus species. ureA Using gene fragments as targets ensures the specificity of the detection target from the source. Furthermore, this invention employs MCDA ten-layer primers to identify 10 regions of the target gene, combined with CRISPR / Cas12b crRNA sequence specificity verification, forming a dual-protection mechanism of multi-region identification at the amplification end and sequence specificity verification at the detection end. Even if a very small number of non-specific byproducts such as primer dimers are generated during MCDA amplification, the CRISPR / Cas12b system will not respond because the byproduct sequences are inconsistent with the target sequence. This fundamentally eliminates the interference of non-specific byproducts on the detection signal, effectively avoids false positive results, and significantly improves detection specificity.

[0023] 2. This invention directly uses fecal samples as the testing target. The sampling process is completely non-invasive, painless, and carries no risk of infection. It requires no complex gastrointestinal preparation or fasting, resulting in high patient acceptance and suitability for large-scale population screening. Furthermore, this invention places no pre-testing requirements on the subject; fasting and discontinuation of antibiotics or proton pump inhibitors are unnecessary. This overcomes the strict limitations imposed by existing methods such as the urea breath test on pre-test medication and diet, greatly expanding its clinical applicability.

[0024] 3. This invention integrates MCDA isothermal amplification and CRISPR / Cas12b cleavage detection into the same reaction tube. Physical isolation and step-by-step start-up are achieved through mineral oil sealing. The entire amplification and detection process is completed sequentially within the same sealed tube without the need for opening the cap and transferring products. This fundamentally avoids aerosol cross-contamination caused by opening the cap and transferring products in traditional "separate tube detection". The entire process from amplification to detection can be completed within 55 minutes under isothermal conditions of 62°C. There is no need for complex equipment such as thermal cyclers. The operation is simple and suitable for point-of-care testing scenarios. Attached Figure Description

[0025] To more clearly illustrate the technical solutions of the embodiments of this application, the drawings used in the description of the embodiments of this application will be briefly introduced below. Obviously, the drawings described below are only some embodiments of this application. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0026] Figure 1 This paper illustrates a schematic diagram of the MCDA-CRISPR / Cas12b single-tube detection process provided in an embodiment of this application. Figure 2 The following graph illustrates the effect of different reaction conditions provided in the embodiments of this application on the fluorescence signal intensity of the detection system; wherein, Figure 2 Figure A shows the optimization results of primer premix volume; Figure 2 Figure B shows the optimized Cas12b / crRNA molar ratio results. Figure 2 Figure C shows the optimized Cas12b protein concentration results. Figure 2 D represents the optimization results of ssDNA reporter probe concentration; Figure 2 E represents the optimized reaction temperature result graph; Figure 3 The figure shown illustrates the results of evaluating detection sensitivity using serially diluted plasmid DNA and pure bacterial suspension, as provided in the embodiments of this application; wherein, Figure 3 A shows the results of plasmid DNA gradient dilution detection. Figure 3 B is a graph showing the results of the serial dilution detection of pure Helicobacter pylori suspension; Figure 4The figure shown is a result graph of the evaluation of detection specificity using 11 common gastrointestinal bacteria provided in the embodiments of this application; Figure 5 The figure shows the results of the evaluation method using spiked simulated fecal samples provided in this application in detecting complex matrices. Figure 6 The figure shows the results of the clinical applicability verification method using 58 clinical stool samples provided in the embodiments of this application. Detailed Implementation

[0027] The technical solutions of the present invention will be clearly and completely described below with reference to the accompanying drawings in the embodiments of the present invention.

[0028] The Bst 2.0 DNA polymerase and dNTPs used in these embodiments were purchased from New England Biolabs; AapCas12b protein was purchased from Shenzhen Yizhi Biotechnology Co., Ltd.; bacterial genomic DNA extraction kits and fecal genomic DNA extraction kits were purchased from Tiangen Biotech (Beijing) Co., Ltd.; MCDA amplification primers and Helicobacter pylori-containing... ureA The plasmid DNA and ssDNA fluorescent reporter probes (5′ labeled with FAM fluorescent group and 3′ labeled with BHQ1 quencher group) of the conserved genes were synthesized by Sangon Biotech (Shanghai) Co., Ltd.; crRNA was synthesized by Chongqing Tuoshengzhonghe Biotechnology Co., Ltd. All other commonly used biochemical reagents were of analytical grade.

[0029] The strains used for specificity verification in this embodiment were all purchased or obtained from commercial depositories and collaborating institutions, specifically as follows: Helicobacter pylori ATCC 43504, Staphylococcus aureus ATCC 6538, Escherichia coli ATCC 8739, Pseudomonas aeruginosa ATCC 27853, Streptococcus pharyngitis ATCC 33397, Streptococcus intermedius ATCC 27335, Streptococcus constellans ATCC 27823, and Listeria monocytogenes ATCC 10403S were all purchased from the American Type Culture Collection (ATCC); Salmonella typhimurium LT2 was deposited by the Experimental Center of West China School of Public Health, Sichuan University; Enterococcus faecalis ATCC 29212, Klebsiella pneumoniae ATCC 13883, and Bacillus cereus ATCC 14579 were all purchased from the American Type Culture Collection (ATCC). All of the above strains are known standard strains that are commercially available to the public and do not require separate depositation.

[0030] Obviously, the described embodiments are only some, not all, of the embodiments of the present invention. The following description of at least one exemplary embodiment is merely illustrative and is in no way intended to limit the invention or its application or use. Based on the embodiments of the present invention, any product identical or similar to the present invention derived by any person under the guidance of the present invention or by combining the features of the present invention with other prior art falls within the protection scope of the present invention. Furthermore, all other embodiments obtained by those skilled in the art without inventive effort are within the protection scope of the present invention.

[0031] Specific experimental steps or conditions are not specified in the embodiments; they can be performed according to the conventional experimental steps or conditions described in the prior art. Reagents and other instruments used, unless otherwise specified, are all commercially available conventional reagent products. Furthermore, the accompanying drawings are merely illustrative diagrams of the embodiments of the present invention and are not necessarily drawn to scale. The same reference numerals in the drawings denote the same or similar parts, and therefore, repeated descriptions of them will be omitted. Some block diagrams shown in the drawings are functional entities and do not necessarily correspond to physically or logically independent entities.

[0032] Techniques, methods, and devices known to those skilled in the art may not be discussed in detail, but where appropriate, such techniques, methods, and devices should be considered part of this specification.

[0033] In the description of this invention, it should be understood that the use of terms such as "first" and "second" to define components is merely for the purpose of distinguishing the corresponding components. Unless otherwise stated, the above terms have no special meaning and therefore should not be construed as limiting the scope of protection of this invention.

[0034] Furthermore, the technical features involved in the different embodiments of the present invention described below can be combined with each other as long as they do not conflict with each other.

[0035] To enable those skilled in the art to better understand this application, the following embodiments are provided to illustrate in detail a method and kit for detecting Helicobacter pylori based on MCDA-CRISPR / Cas12b.

[0036] Example Example 1: Design and Synthesis of Primers and Probes This embodiment provides a method for designing and synthesizing MCDA primer sets, crRNA, and ssDNA reporter probes for Helicobacter pylori detection.

[0037] Using Helicobacter pylori reference strain 83 (GenBank accession number: NC_017375.1) ureA Using gene sequences as reference templates, multiple sequence alignment analysis was conducted to compare ureA homologous sequences of different Helicobacter pylori strains and non-Helicobacter pylori (including common enteropathogenic bacteria) to screen highly conserved sequence regions within the Helicobacter pylori genus and intergeneric specific sequence regions as amplification targets.

[0038] Using PrimerExplorer V5 software, 10 specific primers were designed within the selected target region according to the MCDA primer design principle, including 2 substitution primers (F1, F2), 6 amplification primers (C1, C2, D1, D2, R1, R2), and 2 crossover primers (CP1, CP2). The matrix sequences are shown in Table 1. Each primer was specifically aligned using NCBI BLAST to ensure no homology match with sequences from other microorganisms besides the Helicobacter pylori ureA gene. The hairpin structure and primer dimer formation risk of each primer were assessed using the IDT OligoAnalyzer tool.

[0039] Based on the MCDA amplification of the target sequence region, and following the crRNA design principles of the CRISPR / Cas12b system, a region containing the 5′-TTN-3′ PAM motif was selected in the target sequence to design crRNA. The 5′ end of the crRNA contains a guide sequence complementary to the target sequence, and the 3′ end contains a backbone sequence for Cas12b protein binding. The specific crRNA sequences are shown in Table 1.

[0040] The ssDNA reporter probe is labeled with the FAM fluorescent group at the 5′ end and the BHQ1 quencher group at the 3′ end, and its sequence is shown in Table 1.

[0041] The primers, crRNA, and probes mentioned above were all synthesized by a commercial synthesis company.

[0042] Table 1 Primer, crRNA and probe sequences

[0043] In this sequence, SEQ ID NO:1~2 are substitution primers, SEQ ID NO:3~4 are cross-linking primers, and SEQ ID NO:5~10 are amplification primers. The ssDNA reporter probe is only used as a fluorescent signal reporting tool, and its specific sequence is not limited. Any ssDNA probe that can be cleaved by the trans-cleavage activity of Cas12b can be used as a substitute.

[0044] The primer set designed in this embodiment can specifically recognize Helicobacter pylori. ureA The 10 different regions of the gene, combined with crRNA-mediated CRISPR / Cas12b sequence-specific recognition, provide a molecular basis for high amplification efficiency and high specificity for subsequent one-tube closed-tube detection.

[0045] Example 2: Establishment and Optimization of the MCDA-CRISPR / Cas12b One-Tube Detection System This embodiment provides a one-tube reaction system and detection process for detecting Helicobacter pylori based on MCDA-CRISPR / Cas12b, and optimizes the reaction conditions.

[0046] (1) Construction of the reaction system This embodiment employs a single-tube stepwise reaction system, with the following structural design: the MCDA amplification system is pre-placed at the bottom of the reaction tube, the CRISPR / Cas12b cleavage system is pre-coated on the inner wall of the tube cap, and a mineral oil seal is provided above the liquid surface at the bottom of the tube to achieve physical isolation between the amplification system and the detection system before the reaction starts. The single-tube detection system consists of part A and part B (total 30 μL): Part A (bottom of the tube, MCDA amplification system, 25 μL) consists of: 2.5 μL 10× isothermal amplification buffer, 1.25 μL 100 mmol / L MgSO4, 3.5 μL 10 mmol / L dNTPs, MCDA primer set (0.1 μL each of 100 μmol / L F1 and F2, 0.2 μL each of 100 μmol / L C1, C2, R1, R2, D1 and D2, and 0.4 μL each of 100 μmol / L CP1 and CP2), 1 μL 8U / μL Bst 2.0 DNA polymerase, 1.5 μL 10 μmol / L ssDNA reporter probe, 1 μL template DNA, DEPC-treated water to 25 μL, and finally 10 μL mineral oil for sealing.

[0047] Part B (cap, CRISPR / Cas12b cleavage system, 5 μL) consists of: 0.5 μL 10×Cas12b reaction buffer, 0.25 μL 10 μmol / L AapCas12b protein, 0.25 μL 10 μmol / L crRNA, and DEPC-treated water to a final volume of 5 μL.

[0048] The mineral oil seal is used to physically isolate the MCDA amplification system from the CRISPR / Cas12b detection system before the reaction is initiated, preventing non-specific byproducts generated during MCDA amplification from prematurely contacting and activating Cas12b.

[0049] (2) Testing process like Figure 1As shown, 3 μL of the DNA template from the sample to be tested (obtained through thermal lysis or extraction using a kit) was added to the MCDA amplification system at the bottom of the tube. The reaction tube was placed in an isothermal apparatus and incubated at 62°C in the dark for 40 minutes to perform the MCDA isothermal amplification reaction, amplifying the target nucleic acid. After the amplification reaction was completed, the reaction tube was briefly centrifuged to mix the CRISPR / Cas12b cleavage system on the inner wall of the tube cap with the amplification product at the bottom of the tube, breaking the physical barrier of the mineral oil seal. The reaction was continued at 62°C for 15 minutes to perform the CRISPR / Cas12b cleavage reaction. During the cleavage reaction, the fluorescence signal was collected every 30 seconds using a real-time quantitative PCR instrument.

[0050] Within this closed system, target amplification and CRISPR cleavage occur stepwise, eliminating the need to open the cap or transfer liquids midway, thus enabling real-time fluorescence signal accumulation. During the MCDA amplification stage, the CRISPR / Cas12b detection system does not participate in the reaction due to the physical isolation provided by the mineral oil sealing layer, preventing premature activation of Cas12b by non-specific byproducts of multiple primers. After amplification, mixing is triggered by centrifugation. At this point, the correct target amplicon has been abundantly accumulated, and Cas12b is preferentially activated under the drive of the correct target, cleaving the ssDNA reporter probe to generate a specific fluorescence signal.

[0051] (3) Optimization of reaction conditions To improve detection performance, plasmid DNA containing the ureA target sequence (2.8 × 10⁻⁶) was used. 4 Using copies / μL as a template, the following parameters were optimized using a single-variable method, with each condition repeated 3 times.

[0052] The MCDA primer set was added to the reaction system in a premixed form, and the amplification efficiency was tested at primer premix volumes of 2.1 μL, 2.2 μL, and 2.3 μL. The final concentrations of each primer corresponding to different primer premix volumes are shown in Table 2.

[0053] Table 2 Primer premix volume and corresponding final primer concentration

[0054] Based on the optimal primer concentration (2.3 μL primer premix, corresponding to 0.42 μmol / L each for F1 / F2, 0.84 μmol / L each for C1 / C2 / D1 / D2 / R1 / R2, and 1.67 μmol / L each for CP1 / CP2), the CRISPR / Cas12b cleavage reaction conditions were further optimized. First, the cleavage efficiency was compared when the Cas12b / crRNA molar ratios were 1:1, 1:1.5, and 1:2. The results showed no statistically significant difference in fluorescence signal between the 1:1 and 1:2 ratios. Based on cost-effectiveness considerations, the optimal molar ratio was determined to be 1:1. Next, the Cas12b protein concentration was optimized. Among the three concentrations of 500 nmol / L, 520 nmol / L, and 540 nmol / L, the fluorescence signal was highest at 540 nmol / L. Then, the ssDNA reporter probe concentration was optimized. Among the three concentrations of 500 nmol / L, 600 nmol / L, and 700 nmol / L, the signal intensity was optimal at 700 nmol / L. Finally, the reaction temperature was optimized within the ranges of 61°C, 62°C, 63°C, and 64°C, with the following results: Figure 2 As shown, the fluorescence signal was highest at 62°C. In summary, the optimal cleavage reaction conditions were determined to be: a Cas12b / crRNA molar ratio of 1:1, a Cas12b protein concentration of 540 nmol / L, an ssDNA reporter probe concentration of 700 nmol / L, and a reaction temperature of 62°C.

[0055] Based on the above optimization results, the optimal reaction conditions were determined to be: 2.3 μL primer premix (F1 / F2 0.42 μmol / L, C / R / D 0.84 μmol / L each, CP1 / CP2 1.67 μmol / L each), Cas12b / crRNA molar ratio 1:1, Cas12b protein concentration 540 nmol / L, ssDNA reporter probe concentration 700 nmol / L, and reaction temperature 62°C. Subsequent examples were all performed under these optimal conditions.

[0056] Example 3: Validation of Detection Sensitivity and Specificity This embodiment systematically verifies the sensitivity and specificity of the one-tube detection system established in Example 2.

[0057] (1) Construction of positive control plasmid Helicobacter pylori ureA The target sequence of the gene was the target fragment. The 252 bp DNA fragment shown in SEQ ID NO:12 was cloned into the pUC57 vector to obtain a recombinant plasmid, which served as a positive control template for subsequent sensitivity verification experiments. This plasmid was synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0058] The target insertion fragment sequence of the plasmid is as follows: GATGATGTGATGGATGGCGTGGCAAGCATGATCCATGAAGTGGGTATTGAAGCGATGTTTCCTGATGGGACCAAACTCGTAACCGTGCATACCCCTATTGAGGCTAATGGTAAATTGGTTCCTGGTGAGTTGTTCTTAAAAAATGAAGACATCACTATCAACGAAGGCAAAAAAGCCGTTAGCGTGAAAGTTAAAAATGTGGGCGACAGACCGGTTCAAATCGGCTCACACTTCCATTTCTTTGAAGTGA ATAGATGCTAGACTTTGACAGAGAAAAAACTTTCGGCAAACGCTTAGACATTGCGAGCGGGACAGCAGTAAGGTTTGAGCCTGGCGAAGAAAAATCCGTAGAATTGATTGACATTGGCGGTAACAGAAGAAT CTTTGGATTTAACGCATTGGTTGATAGGCAAGCAGACAACGAAAGCAAAAAAATTGCTTTACACAGAGCTAAAGAGCGTGGTTTTCATGGCGCTAAAAGCGATGACAACTATGTAAAAACAATTAAGGAGTAA.

[0059] (2) To comprehensively evaluate the detection sensitivity of the established one-tube method, detection was performed using plasmid DNA containing the target sequence and pure bacterial culture as templates, respectively.

[0060] The positive control plasmid DNA was serially diluted 10-fold with sterile ultrapure water, and 1 µL of each dilution was taken for detection according to the one-tube method established in Example 2. The results are as follows: Figure 3 As shown, the detection limit of this method for plasmid DNA is 28 copies / µL, and it has high detection sensitivity at both the nucleic acid molecular level and the bacterial cell level, which can meet the detection needs of Helicobacter pylori in clinical samples.

[0061] The pure culture of Helicobacter pylori was centrifuged, precipitated, and resuspended in physiological saline, with the OD600 adjusted to 0.1. After determining the colony count using the standard plate count method, it was serially diluted 10-fold with physiological saline to obtain 10... 1 ~10 6 A concentration gradient of CFU / mL was established. Each dilution was thermally pyrolyzed at 95°C for 10 minutes, and 3 µL of the supernatant was used as a template for detection according to the one-tube method established in Example 2. The results are as follows: Figure 3 As shown, the detection limit of this method for pure bacterial suspensions is 1.58 × 10⁻⁶.4 CFU / mL.

[0062] To evaluate the specificity of this method, 11 common gastrointestinal bacteria were tested under optimal reaction conditions, including Listeria monocytogenes (Listeria monocytogenes). Listeria monocytogenes ), Klebsiella pneumoniae ( Klebsiella pneumoniae Staphylococcus aureus ( Staphylococcus aureus ), Escherichia coli ( Escherichia coli Salmonella typhimurium ( Salmonella typhimurium ), Pseudomonas aeruginosa ( Pseudomonas aeruginosa ), Bacillus cereus ( Bacillus cereus ), pharyngitis streptococcus ( Streptococcus anginosus ), intermediate streptococcus ( Streptococcus intermedius ), Streptococcus constellans ( Streptococcus constellatus ) and Enterococcus faecalis ( Enterococcus faecalis ).

[0063] The OD600 of each strain suspension was adjusted to 0.5-0.6. Genomic DNA was extracted using a bacterial genomic DNA extraction kit. 3 µL was used as a template and the detection was performed using the one-tube method established in Example 2. Helicobacter pylori genomic DNA was used as a positive control and template-free control (NTC) was used as a negative control.

[0064] The results are as follows Figure 4 As shown, only Helicobacter pylori produces a strong fluorescent signal ( P The fluorescence signals of *Listeria monocytogenes*, *Klebsiella pneumoniae*, *Staphylococcus aureus*, *Escherichia coli*, *Salmonella typhimurium*, *Pseudomonas aeruginosa*, *Bacillus cereus*, *Streptococcus pharyngitis*, *Streptococcus intermedius*, *Streptococcus constellans*, and *Enterococcus faecalis* were all significantly different from the template-free control. These results indicate that this method has a highly specific recognition ability for *Helicobacter pylori* and shows no cross-reactivity with common intestinal pathogens.

[0065] Example 4: Detection of Helicobacter pylori in fecal samples This embodiment verifies the detection performance of the one-tube detection system established in Example 2 in the complex clinical matrix of fecal samples.

[0066] (1) Detection of artificially spiked fecal samples To evaluate the detection performance of this method in complex biological matrices, simulated feces without Helicobacter pylori were mixed with Helicobacter pylori suspension to prepare spiked fecal samples with different concentration gradients. Specifically, 0.1 g of simulated feces was mixed with 150 µL of different concentrations (10... 2 ~10 6A suspension of Helicobacter pylori (CFU / mL) was mixed, and DNA was extracted using a commercial fecal genomic DNA extraction kit. 3 µL of the DNA was used as a template and detected using the one-tube method established in Example 2.

[0067] The results are as follows Figure 5 As shown, the detection limit of this method in spiked fecal samples is 1.58 × 10⁻⁶. 4 The CFU / mL result indicates that this method maintains excellent detection performance even in the complex matrix of feces, which contains multiple PCR inhibitors.

[0068] (2) Clinical stool sample testing To verify the clinical applicability of this method, the urea breath test (UBT) was used as the gold standard to analyze clinical stool samples.

[0069] A validation cohort was established at the Digestive Endoscopy Center of West China Fourth Hospital, Sichuan University, from March to May 2026, enrolling 58 patients (aged 19–69 years, 26 males and 32 females). All patients provided stool samples. Exclusion criteria included: use of antibiotics, bismuth preparations, proton pump inhibitors, or H2 receptor antagonists within 4 weeks prior to enrollment; acute diarrhea, severe constipation, or active gastrointestinal bleeding; history of partial gastrectomy; severe heart, liver, or kidney dysfunction; advanced malignancy; pregnancy; or lactation.

[0070] according to 14 C UBT value (cutoff=50) or 13 Patients were divided into UBT-positive and UBT-negative groups based on their UBT value (cutoff=4). The UBT-positive group consisted of 28 patients, including 13 liquid stool samples collected by the endoscopist during the examination and 15 solid stool samples collected by the patients themselves. The UBT-negative control group consisted of 30 patients, including 5 liquid stool samples collected during endoscopy and 25 solid stool samples collected by the patients themselves. Genomic DNA was extracted from all clinical samples using a commercially available stool genomic DNA extraction kit, with 3 µL used as the detection template. This study was approved by the Ethics Committee of West China Fourth Hospital, Sichuan University, and all participants signed informed consent forms.

[0071] Using UBT as the gold standard, 58 clinical stool samples were analyzed, and the results are as follows: Figure 6As shown. In the UBT-positive group, the positive concordance rate of this method was 100% (13 / 13) for 13 liquid stool samples and 40% (6 / 15) for 15 solid stool samples. In the UBT-negative group, the negative concordance rate was 100% (25 / 25) for 25 solid stool samples; 4 out of 5 liquid stool samples were negative (80% concordance rate), and 1 was positive. Retrospective analysis of the positive sample showed that the patient's gastroscopy and histopathological examination confirmed Helicobacter pylori infection, suggesting that this case was a UBT false negative, and this method can detect low-viral-load infections that are missed by UBT.

[0072] In summary, this invention provides a method and kit for detecting Helicobacter pylori based on MCDA-CRISPR / Cas12b. By introducing the CRISPR / Cas12b system, this invention utilizes crRNA to guide Cas12b to specifically recognize the actual MCDA amplification product, fundamentally eliminating the interference of non-specific byproducts generated during isothermal amplification of the MCDA multi-primer system on the detection signal, effectively avoiding false positive results. Simultaneously, this invention employs a synergistic scheme of pre-placed amplification system at the bottom of the tube, pre-coated detection system at the tube cap, physical isolation with mineral oil sealing, and centrifugation-triggered stepwise initiation. This allows MCDA amplification and CRISPR / Cas12b cutting to be completed stepwise within the same sealed tube, without requiring opening the cap for transfer, thus eliminating aerosol contamination caused by opening the cap in traditional "separate tube detection" methods.

[0073] This invention targets the Helicobacter pylori ureA gene and designs MCDA-specific primer sets as shown in SEQ ID NO:1~10 and crRNA as shown in SEQ ID NO:11, forming a dual-protection mechanism of recognition of the amplification end region and specific verification of the crRNA sequence at the detection end. The detection limit for plasmid DNA reaches 28 copies / µL, with no cross-reactivity against 11 common intestinal pathogens, and maintains excellent detection performance in fecal samples. This invention uses feces directly as the test sample, and the sampling is completely non-invasive, requiring no fasting, discontinuation of antibiotics or proton pump inhibitors, and the entire detection process is completed within 55 minutes under isothermal conditions at 62°C. It requires no complex equipment and is suitable for point-of-care testing and large-scale screening scenarios.

[0074] The various embodiments in this specification are described in a progressive manner, with each embodiment focusing on the differences from other embodiments. The same or similar parts between the various embodiments can be referred to each other.

[0075] Although preferred embodiments of the present application have been described, those skilled in the art, upon learning the basic inventive concept, can make other changes and modifications to these embodiments. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments as well as all changes and modifications falling within the scope of the embodiments of the present application.

[0076] Finally, it should be noted that in this document, relational terms such as "first" and "second" are used only to distinguish one entity or operation from another, and do not necessarily require or imply any such actual relationship or order between these entities or operations. Furthermore, the terms "comprising," "including," or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or terminal device that comprises a list of elements includes not only those elements but also other elements not expressly listed, or elements inherent to such a process, method, article, or terminal device. Without further limitations, an element defined by the phrase "comprising one..." does not exclude the presence of other identical elements in the process, method, article, or terminal device that includes said element.

[0077] The above provides a detailed description of the Helicobacter pylori detection method and kit based on MCDA-CRISPR / Cas12b provided in this application. Specific examples have been used to illustrate the principles and implementation methods of this application. The descriptions of the above embodiments are only for the purpose of helping to understand the method and its core ideas. At the same time, for those skilled in the art, there will be changes in the specific implementation methods and application scope based on the ideas of this application. Therefore, the content of this specification should not be construed as a limitation of this application.

Claims

1. A method for detecting Helicobacter pylori based on MCDA-CRISPR / Cas12b, characterized in that, Includes the following steps: S1: Provides MCDA primer set and CRISPR / Cas12b detection system; the MCDA primer set consists of nucleic acid sequences shown in SEQ ID NO: 1~10; S2: Mix the DNA of the sample to be tested with the MCDA primer set and perform a multi-crossover permutation amplification reaction under isothermal conditions to amplify the target DNA; S3: After the amplification reaction is completed, the CRISPR / Cas12b detection system is mixed with the amplification product to perform product-specific recognition and fluorescent probe cleavage reaction; S4: Determine whether Helicobacter pylori is present in the sample by detecting the fluorescence signal.

2. The method for detecting Helicobacter pylori based on MCDA-CRISPR / Cas12b according to claim 1, characterized in that, The MCDA primer set and CRISPR / Cas12b detection system described in S1 are placed in the same reaction tube. The MCDA primer set is pre-placed at the bottom of the reaction tube, and the CRISPR / Cas12b detection system is pre-coated on the inner wall of the reaction tube cap. A mineral oil seal is provided between the MCDA primer set and the CRISPR / Cas12b detection system.

3. The method for detecting Helicobacter pylori based on MCDA-CRISPR / Cas12b according to claim 1, characterized in that, In step S3, centrifugation is used to mix the CRISPR / Cas12b detection system with the MCDA amplification product.

4. The method for detecting Helicobacter pylori based on MCDA-CRISPR / Cas12b according to claim 1, characterized in that, In the MCDA primer set, SEQ ID NO:1 and SEQ ID NO:2 are substitution primers, SEQ ID NO:3 and SEQ ID NO:4 are cross-linking primers, and SEQ ID NO:5~10 are amplification primers.

5. The method for detecting Helicobacter pylori based on MCDA-CRISPR / Cas12b according to claim 1, characterized in that, The CRISPR / Cas12b detection system contains Cas12b protein and crRNA, the sequence of which is shown in SEQ ID NO:

11.

6. The method for detecting Helicobacter pylori based on MCDA-CRISPR / Cas12b according to claim 5, characterized in that, The Cas12b protein is the AapCas12b protein.

7. The method for detecting Helicobacter pylori based on MCDA-CRISPR / Cas12b according to claim 1, characterized in that, The sample to be tested is a fecal sample.

8. The method for detecting Helicobacter pylori based on MCDA-CRISPR / Cas12b according to claim 1, characterized in that, The isothermal conditions described in S2 are 61~64℃ and the reaction time is 30~40 min.

9. A kit for detecting Helicobacter pylori, characterized in that, The kit is used to implement a method for detecting Helicobacter pylori based on MCDA-CRISPR / Cas12b as described in any one of claims 1 to 8.

10. The application of the method for detecting Helicobacter pylori based on MCDA-CRISPR / Cas12b as described in any one of claims 1 to 8 in the preparation of Helicobacter pylori detection products.

Images