Light and simplified detection kit for giant salamander iridovirus

Abstract

The utility model relates to the technical field of aquatic virus detection, and discloses a light and simplified detection kit for giant salamander iridovirus. The kit comprises a kit body and a cover body, and further comprises a dropper, a PCR reaction reagent unit and a colloidal gold test strip detection unit, the giant salamander iridovirus detection kit can rapidly detect the giant salamander iridovirus, and is greatly helpful for effectively controlling the outbreak and propagation of the giant salamander iridovirus disease.

Description

Technical Field

[0001] The utility model relates to the field of biological detection devices, in particular to a simplified detection kit for giant salamander iris virus. Background Art

[0002] Chinese giant salamander iridovirus (GSIV) is a DNA virus of the genus Ranavirus of the family Iridoviridae. The main symptoms of the disease in giant salamanders are skin ulcers, swelling of the limbs and bleeding. Most traditional detection methods for this virus have the disadvantages of poor specificity and sensitivity, cumbersome operation, time-consuming and labor-intensive.

[0003] Recombinase polymerase amplification-lateral flow chromatography strip test method (RPA-LFD) is a new constant temperature in vitro nucleic acid amplification technology that uses recombinase and single-stranded binding protein to achieve specific binding of primers and templates at room temperature to replace the denaturation and renaturation process in traditional PCR thermal cycles. The method combining RPA with lateral flow immunochromatography (LFD) has the advantages of visually readable results, convenient detection, reaction time within 10 minutes, and easy to carry.

[0004] Based on the above-mentioned prior art, the utility model provides a simplified detection kit for giant salamander iris virus, which is easy to carry and can quickly detect giant salamander iris virus without the need for additional instruments. Utility Model Content

[0005] The utility model aims to provide a simplified detection kit for giant salamander iris virus. The kit is easy to carry and can quickly detect giant salamander iris virus without the need for additional instruments.

[0006] In order to achieve the above object, the above object of the utility model is achieved through the following technical solutions:

[0007] A simplified detection kit for giant salamander iris virus, comprising a box body and a cover body, and also comprising: a dropper, a PCR reaction reagent unit and a colloidal gold test strip detection unit;

[0008] The PCR reaction reagent unit comprises: a first primer bottle, a second primer bottle, a first buffer solution bottle, a second buffer solution bottle and a probe bottle;

[0009] The colloidal gold test strip detection unit comprises a colloidal gold test strip and a shell, wherein the colloidal gold test strip is provided with a quality control area, a detection area, and a sample addition area from top to bottom; the shell is provided with an observation frame, a sample addition hole, and a reaction tank with a cover from top to bottom; the shell is sleeved on the colloidal gold test strip, the quality control area and the detection area are exposed through the observation frame, and the sample addition hole and the sample addition area overlap.

[0010] The above-mentioned kit is preferably:

[0011] The first primer bottle is filled with a front primer solution, the second primer bottle is filled with a rear primer solution, the first buffer solution bottle is filled with a first buffer solution, the second buffer solution bottle is filled with a second buffer solution, and the probe bottle is filled with a probe solution.

[0012] The bottom of the reaction tank of the shell is made of heat-conducting material.

[0013] The thermally conductive material is preferably aluminum.

[0014] Compared with the prior art, the utility model has the following beneficial effects:

[0015] (1) Short detection time, fast speed, convenient and quick;

[0016] (2) The instrument is light and easy to carry, suitable for on-site testing;

[0017] (3) The results are easy to interpret and can be directly observed with the naked eye;

[0018] (4) Simple operation and simple steps. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 This is a schematic diagram of the RPA-LFD detection kit of the utility model;

[0020] Among them, 1-dropper; 2-PCR reaction reagent unit; 3-observation hole; 4-sample addition hole; 5-reaction tank. DETAILED DESCRIPTION

[0021] The utility model is further described below in conjunction with the accompanying drawings.

[0022] Embodiment 1:

[0023] A simplified detection kit for giant salamander iris virus, comprising a box body and a cover body, and also comprising: a dropper 1, a PCR reaction reagent unit 2 and a colloidal gold test strip detection unit;

[0024] The PCR reaction reagent unit 2 comprises: a first primer bottle, a second primer bottle, a first buffer solution bottle, a second buffer solution bottle and a probe bottle;

[0025] The colloidal gold test strip detection unit comprises a colloidal gold test strip and a shell, wherein the colloidal gold test strip is provided with a quality control area, a detection area, and a sample addition area from top to bottom; the shell is provided with an observation frame 3, a sample addition hole 4, and a reaction tank 5 with a cover from top to bottom; the shell is sleeved on the colloidal gold test strip, the quality control area and the detection area are exposed through the observation frame, and the sample addition hole and the sample addition area overlap.

[0026] The colloidal gold test strips are HybriDetect colloidal gold test strips, with the product number WLFS8201, purchased from Genenode;

[0027] The first primer bottle is filled with a front primer solution, which contains primers: 5'-3':

[0028] AACCAGCTGGGAGACAACGGCACCATCAGG

[0029] The second primer bottle is filled with a rear primer solution, which contains primers: 5'-3':

[0030] (Biotin)ATTGTAGGGGAGGGAGACGACTGGCAGGGC.

[0031] The first buffer solution bottle is filled with a first buffer solution, which is A buffer in the nfo-DNA constant temperature rapid amplification kit (colloidal gold test strip type), with a product number of nfo, purchased from Genenode;

[0032] The second buffer solution bottle is filled with a second buffer solution, which is the B buffer in the nfo-DNA constant temperature rapid amplification kit (colloidal gold test strip type), with a product number of nfo, purchased from Genenode;

[0033] The probe bottle is filled with probe solution, containing the probe:

[0034] (FAM)AACGTCAACCTCTCATTCAACGACATCAGCGCC(THF)AGTCCTTTTAACACGG(Spa cer)

[0035] The bottom of the reaction tank of the shell is made of aluminum heat-conducting material.

[0036] A method for using a simplified detection kit for giant salamander iris virus is as follows:

[0037] Add the extracted DNA to be tested into the reaction tank, add the solution in the PCR reaction reagent unit at the same time, use a dropper to mix all the solutions, and then cover tightly. Place the bottom of the reaction tank in the palm of your hand and hold it tightly, use the human body temperature of 37 degrees Celsius to react for 10-15 minutes, then use a dropper to draw the solution after the reaction to the sample well, observe the quality control line and the test line to read the results.

[0038] The determination method is as follows:

[0039] When two bands appear on the colloidal gold test strip, one in the quality control area and one in the detection area, the result is positive, indicating that the sample contains giant salamander iris virus; when only one band appears in the quality control area of ​​the test strip and no band appears in the detection area, the result is negative, indicating that the sample does not contain giant salamander iris virus; when no bands appear on both the quality control line and the detection line of the test strip, the test strip is damaged, invalid, or the operation is incorrect.

Claims

1. A simplified detection kit for giant salamander iris virus, comprising a box body and a cover body, characterized in that: Also includes: A dropper, a PCR reaction reagent unit and a colloidal gold test strip detection unit; The PCR reaction reagent unit comprises: a first primer bottle, a second primer bottle, a first buffer solution bottle, a second buffer solution bottle and a probe bottle; The colloidal gold test strip detection unit comprises a colloidal gold test strip and a shell, wherein the colloidal gold test strip is provided with a quality control area, a detection area, and a sample addition area from top to bottom; the shell is provided with an observation frame, a sample addition hole, and a reaction tank with a cover from top to bottom; the shell is sleeved on the colloidal gold test strip, the quality control area and the detection area are exposed through the observation frame, and the sample addition hole and the sample addition area overlap.

2. The detection kit according to claim 1, characterized in that: The first primer bottle is filled with a front primer solution, the second primer bottle is filled with a rear primer solution, the first buffer solution bottle is filled with a first buffer solution, the second buffer solution bottle is filled with a second buffer solution, and the probe bottle is filled with a probe solution.

3. The detection kit according to claim 1, characterized in that: The bottom of the reaction tank of the shell is made of heat-conducting material.

4. The detection kit according to claim 3, characterized in that: The heat conducting material is aluminum.

Images