Primer set for the detection of Candida auris, kit for the detection of Candida auris and method for the detection of Candida auris
Patent Information
- Application Number
- DE602019076938
- Authority / Receiving Office
- DE · DE
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2018-04-27
- Filing Date
- 2019-04-25
- Publication Date
- 2025-10-15
- Estimated Expiration
- 2039-04-25
AI Technical Summary
Existing methods fail to accurately and rapidly detect Candida auris, a pathogenic fungus, due to its similarity with closely related species, posing challenges in diagnosis, treatment, and controlling hospital-associated infections.
A primer set comprising FIP, BIP, F3, and B3 primers, along with optional loop primers, is used in a LAMP method for specific amplification of Candida auris DNA, enabling rapid and accurate detection.
The method allows for rapid and specific detection of Candida auris within 20-60 minutes, distinguishing it from related species with high sensitivity and accuracy, even in contaminated specimens.
Description
Technical Field
[0001] The present invention relates to a primer set for use in the detection of Candida auris, a Candida auris detection kit, and a Candida auris detection method.Background
[0002] Candida auris is a pathogenic species of yeast which was first discovered in Tokyo in 2005 and was reported by the first present inventor as a new species (Non-Patent Literature 1).
[0003] Until August 2017, Candida auris discovered in Japan was found in a culture of a topically infected site (external ear canal) and has relatively low pathogenicity. Candida auris was just a single strain that was not drug-resistant, although Candida auris exerted slightly low resistivity to some of anti-fungal drugs (e.g., fluconazole).
[0004] After that time, however, virulence-increased multidrug-resistant strains of Candida auris which can cause sepsis and the like have been reported with the spreading of Candida auris all over the world including South Korea, India, North Africa, Venezuela, the United Kingdom and the United States. By 2016, Candida auris has been recognized as a world's first fungus that can cause global outbreak (pandemic) (Non-Patent Literature 2). In the latest report published in May 17, 2017, it was reported that 122 persons (7 persons in the last year) were infected with Candida auris in the United States and Candida auris had high mortality. In the United Kingdom, Candida auris has also been spreading, the number of infected persons already reaches around 200 persons, Candida auris is reported as "Japanese Fungus" by the media, and alert has been issued to medical / healthcare institutions.
[0005] Under the current circumstances, the infection by Candida auris is limited to compromised persons, and the outbreak of the infection occurs in the form of hospital-associated infection. From the view of the overseas spreading situations, it is considered that there is a high possibility that the hospital-associated infection is spread through nasal cavities, external ear canals and so on with a normal persons acting as a vector, as in the first case reported firstly by the first present inventor. Actually in the United States which has already been under the spread of the infection by the fungus, it is believed that the infection by the fungus is spread easily thorough skin such as fingers of a healthcare professional (Non-Patent Literature 3). Accordingly, there is a high possibility that a fungus that has acquired increased virulence and drug-resistivity overseas is imported into our country because of flourishing international exchanges and the opening of Tokyo Olympic Games, and it has been urgently demanded to prepare testing systems for preventing the import / export of toxic fungus before it occurs.Background Art
[0006] EP3257951A2 discloses methods and compositions for identifying microbial DNA in the tissues or body fluid samples of patients. More particularly, the invention relates to two-step polymerase chain reaction based methods for identifying microbial DNA in the tissues or body fluid samples of patients, and compositions therefor. Microbial DNA can also be quantified using the methods described therein.
[0007] WO2014133153A1 discloses a method for the quick and simple collective detection of pathogenic fungi. The invention provides a method for the collective detection of pathogenic fungi, characterized by comprising steps (1) through (3): (1) a step for extracting DNA from a sample; (2) a step for LAMP reaction using the DNA extracted in (1) and two or more bacterial strains of a LAMP primer-set for amplifying at least part of the region containing the ITS region or IGS region of one strain of pathogenic fungi; and (3) a step for confirming the presence or absence of the amplification.
[0008] Nakayama et al., 2017 (doi: 10.4265 / bio.22.97) discloses a LAMP primer set for detecting a wide range of fungi developed by aligning the sequences of the large subunit ribosomal RNA gene of Candida albicans (Ascomycota), Cryptococcus neoformans (Basidiomycota), and Mucor racemosus (Mucorales). The correlation between colony forming units (CFU) and LAMP detection rate using the LAMP method for environmental fungi was evaluated.
[0009] Prakash et al., 2016 (doi: 10.1016 / j.cmi.2015.10.022) discloses the study of the population structure and genetic relatedness among 104 global C. auris isolates from India, South Africa and Brazil using multilocus sequence typing (MLST), amplified fragment length polymorphism (AFLP) fingerprinting and matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF MS). MALDI-TOF MS was evaluated as a warranted typing method for this yeast. Antifungal susceptibility testing by the CLSI microbroth dilution method was also performed.
[0010] Theill et al., 2018 (doi: 10.1016 / j.riam.2018.01.003) discloses the development of a classical-PCR method capable of rapidly and accurately identify C. auris and C. haemulonii. A multiplex PCR was carried out in one tube that included an internal control and oligonucleotides that specifically hybridize to the ITS2 region of C. auris and C. haemulonii. The method was verified by testing a collection of 50 strains of 20 different species (previously identified by ITS sequencing). The results obtained were in agreement with those obtained by ITS sequencing.
[0011] Kordalewska et al., 2017 (doi: 10.1128 / JCM.00630-17) discloses PCR and real-time PCR assays to identify C. auris and related species: Candida duobushaemulonii, Candida haemulonii, and Candida lusitaniae. Targeting rDNA region nucleotide sequences, primers specific for C. auris only or C. auris and related species were designed. A panel of 140 clinical fungal isolates was used in both PCR and real-time PCR assays followed by electrophoresis or melting temperature analysis, respectively. The identification results from the assays were concordant with DNA sequencing results.
[0012] Takano et al., "Modern Media", Principle and application of LAMP (Loop-mediated isothermal amplification) method, vol. 60, no.7, 31 July 2017, pages 211-231, XP009503835 discloses principles, features, and characteristics of the LAMP method. Applications of the method in the medical, livestock, fishing, plant, food inspection, and environmental hygiene fields are also discussed.Citation ListNon-Patent Literature
[0013] Non-Patent Literature 1: Satoh K, Makimura K, Hasumi Y, Nishiyama Y, Uchida K, Yamaguchi H. 2009. Candida auris sp. nov., a novel ascomycetous yeast isolated from the external ear canal of an inpatient in a Japanese hospital. Microbiol Immunol 53:41-44. https: / / doi.org / 10.1111 / j.1348-0421.2008.00083.x.
[0014] Non-Patent Literature 2: Website of the US Centers for Disease Control and Prevention (CDC), Tracking Candida auris https: / / www.cdc.gov / fungal / diseases / candidiasis / tracking-c-auris.html (connected on April 22, 2018)
[0015] Non-Patent Literature 3: Shawn R. Lockhart, Elizabeth L. Berkow, Nancy Chow, Rory M. Welsh, Candida auris for the Clinical Microbiology Laboratory: Not Your Grandfather's Candida Species, Clinical Microbiology Newsletter, Volume 39, Issue 13,2017,Pages 99-103,ISSN 0196-4399,https: / / doi.org / 10.1016 / j.clinmicnews.2017.06.003.(http: / / www.sciencedirect.c om / science / article / pii / S0196439917300417)
[0016] Non-Patent Literature 4: Nakayama T, Yamazaki T, Yo A, Tone K, Mahdi AlshahniM, Fujisaki R, Makimura K. 2017. Detection of fungi from an indoor environment using loop-mediated isothermal amplification (LAMP) method. Biocontrol Sci 22:97-104. https: / / doi.org / 10.4265 / bio.22.97.
[0017] Non-Patent Literature 5: Shigekazu Iguchi, Ryo Mizushima, Keisuke Kamada, Yasutomo Itakura, Atsushi Yoshida, Yutaka Uzawa, Yuko Arai, Miyako Takaoka, SumieSato, Aeko Goto, Toshiko Karasawa, Naoki Tsuruoka, Daisuke Totsuka, Erika Ono, Manabu Nonaka, Koichi Makimura, Ken Kikuchi: The Second Candida auris Isolate from Aural Discharge in Japan. Jpn J Infect Dis. 2018 Mar 22;71(2):174-175. doi: 10.7883 / yoken.JJID.2017.466. Epub 2018 Feb 28.Summary of InventionTechnical Problem
[0018] However, Candida auris is a new species of pathogenic fungus (yeast), and cannot be discriminated from closely related species thereof (e.g., Candida haemulonii, Rhodotorula glutinis) by an automated identification system that has been commonly used in a clinical laboratory, such as VITEK2 YST card (bioMerieux, Maracy l'Etoile, France) and API20C AUX (bioMerieux). Accordingly, the type of the species of the fungi cannot be determined accurately. For these reasons, the establishment of a method for detecting (identifying) Candida auris with high sensitivity and in a specific manner is a major problem in diagnosis, treatment, clinical tests, control of hospital-associated infections, and epidemiologic analysis. Moreover, in order to make a treatment for Candida auris infection effective and prevent the spread of the infection, rapid detection ability as well as high detection accuracy are absolutely necessary.
[0019] The present invention has been made under these circumstances, and an object of the present invention is to provide a detection method which can detect Candida auris rapidly and accurately. Another object of the present invention is to provide a primer set and a detection kit which can be used in the detection method.Solution to Problem
[0020] In order to solve the problem, the primer set for use in the detection of Candida auris according to the present invention is a primer set for use in the detection of Candida auris, which includes four types of primers consisting of FIP, BIP, F3 and B3, and is intended to be used in the detection of Candida auris by amplifying a Candida auris target sequence in a specimen by the LAMP method, the primer set being characterized in that: FIP is a polynucleotide comprising SEQ ID NO: 1; BIP is a polynucleotide comprising SEQ ID NO: 2; F3 is a polynucleotide comprising SEQ ID NO: 3; and B3 is a polynucleotide comprising SEQ ID NO: 4.
[0021] In the primer set for use in the detection of Candida auris, it is preferred that polynucleotides respectively including SEQ ID Nos: 5 and 6 are further included as loop primers.
[0022] The Candida auris detection kit according to the present invention includes the primer set for use in the detection of Candida auris.
[0023] The method for detecting Candida auris according to the present invention is a method for detecting Candida auris including subjecting a nucleic acid sample obtained from a specimen to a nucleic acid amplification reaction by the LAMP method and detecting an amplification product, the method being characterized in that: a primer set to be used in the LAMP method includes four types of primers consisting of FIP, BIP, F3 and B3; FIP is a polynucleotide comprising SEQ ID NO: 1; BIP is a polynucleotide comprising SEQ ID NO: 2; F3 is a polynucleotide comprising SEQ ID NO: 3; and B3 is a polynucleotide comprising SEQ ID NO: 4.
[0024] In the method for detecting Candida auris, it is preferred that the primer set further includes polynucleotides respectively including SEQ ID Nos: 5 and 6 as loop primers.Advantageous Effects of Invention
[0025] According to the method for detecting Candida auris of the present invention, it is possible to detect Candida auris rapidly and accurately. The primers and the detection kit can be used in the method for detecting Candida auris of the present invention.Brief Description of Drawings
[0026] Fig. 1 is a diagram showing the results of the detection of amplification products by the detection method of the present invention using the LAMP Auris primer set using pTAC-2 Auris plasmid carrying a DNA fragment specific to Candida auris, in which the results are expressed in terms of the number of copies per detection reaction (copies / reaction). A: negative control (no reaction), B: 2 × 10 0< copies / reaction (34 min), C: 2 × 10 1< copies / reaction (33 min), D: 2 × 10 2< copies / reaction (26 min), E: 2 × 10 3< copies / reaction (24 min), F: 2 × 10 4< copies / reaction (24 min), G: 2 × 10 6< copies / reaction (22 min), H: 2 × 10 8< copies / reaction (17 min). Fig. 2 is a diagram showing the results of the detection of Candida auris (C. auris) in a clinical specimen by the detection method of the present invention. Fig. 3 is a diagram showing the results of the detection of Candida auris (C. auris) in an environmental sample by the detection method of the present invention. Description of Embodiments
[0027] The present inventors have focused attention on the LAMP method as a means for detecting Candida auris rapidly and specifically and with high sensitivity. The present inventors have succeeded in the designing of four types of primers for amplifying target DNA of Candida auris specifically by the LAMP method and two types of loop primers for accelerating gene amplification. As a result, the present invention has been accomplished.
[0028] The LAMP method is known conventionally, and is a method in which amplification is performed by utilizing a strand displacement reaction using four types of primers which are combinations of six regions selected in the sequence for a target gene.
[0029] The designing of the primers in the LAMP method is carried out by utilizing six regions, i.e., F3 region, F2 region, F1 region, B1 region, B2 region and B3 region as observed from the 5'-side, in a region to be amplified (wherein the region is also referred to as "template (nucleotide, DNA)", hereinafter). Regions respectively complementary to these six regions are referred to as "F3c region", "F2c region", "F1c region", "B1c region", "B2c region" and "B3c region". In the LAMP method, four types of primers (two types of Inner primers (FIP and BIP), and two types of Outer primers (F3 primer and B3 primer)) are used. The Inner primers are respectively formed by linking F1c region (i.e., a region complementary to F1 region) to F2 region and linking B1c (i.e., a region complementary to B1 region) to B2 region. In general, the LAMP method has such characteristics that a denaturation reaction from a single strand to a double strand is not needed and the reaction can proceed at a constant temperature ranging from 60 to 65°C when compared with PCR method, and also has such characteristics that an apparatus such as a thermal cycler is not required, the amplification speed is rapid, and the specificity is also high.
[0030] The LAMP method using loop primers is also known conventionally. In general, each of the loop primers is designed as a primer having a sequence complementary to a single strand region (a region between B1 region and B2 region, or a region between F1 region and F2 region) of a 5'-terminal-side loop of a dumb-bell structure in an amplification product of the LAMP method. The loop primers are called as "loop primers B(LB)" and "loop primers F(LF)", respectively. When the loop primers are used, the number of origins of DNA synthesis can be increased and therefore gene amplification can be accelerated.
[0031] In the method for detecting Candida auris of the present invention, as a specimen to be detected, a material such as a clinical specimen collected from a subject (e.g., blood, a tissue, ascitic fluid, a bronchoalveolar lavage fluid, and a skin, mucosal or external ear canal swab) or cultured cells can be used. These specimens may be subjected to the concentration or separation of cells, the isolation or concentration of a nucleic acid from cells, or the like as a pretreatment for an amplification reaction by the LAMP method.
[0032] A sample nucleic acid can be prepared in accordance with a known method from a specimen to be detected. As the method for preparing the sample nucleic acid, a conventional method can be employed, and examples of the method include a chemical lysis (e.g., Proteinase K) treatment, a physical disruption (e.g., bead disruption) treatment, an alkaline lysis method, and a method of purifying a nucleic acid by the extraction with phenol / chloroform or using magnetic beads, a silica membrane or the like (Non-Patent Literature 4). Alternatively, a commercially available nucleic acid extraction kit (e.g., Kaneka Easy DNA Extraction kit version 2 manufactured by Kaneka Corporation) may be used as required.
[0033] The primer set to be used in the detection method of the present invention (i.e., the primer set for use in the detection of Candida auris) includes four types of primers (FIP, BIP, F3, B3), and may also include loop primers (Loop-B, Loop-F) as required.
[0034] The primers (FIP, BIP, F3, B3) and the loop primers (Loop-B, Loop-F) include sequences respectively including the polynucleotides shown below. The primers (FIP, BIP, F3, B3) and the loop primers (Loop-B, Loop-F) are designed from the findings of the present inventors on the basis of a nucleotide sequence (target sequence) specific to Candida auris and suitable for the LAMP method.
[0035] A preferred embodiment of the primer sets of the present invention is shown below.(Primer set for use in the detection of Candida auris)
[0036] FIP:AGGCTACTGAGCTTGCTGGTGTAACCAAACCAACAGGAGAGG (SEQ ID NO: 1) BIP: ACGGTTTCAGGGTTAGCA TGG CTCAACAAAGTC GCTGGTACA (SEQ ID NO: 2) F3: GGGAAAGGAACCCTGACCT (SEQ ID NO: 3) B3: GGACACAGCATTCGAAGTGT (SEQ ID NO: 4) Loop-F: CATCTCGAAGGCCTCGGT (SEQ ID NO: 5) Loop-B:CACATACTCGAACGGAGTC (SEQ ID NO: 6)
[0037] The Loop-F primer and LoopB primer of the present invention may include primers in which a design change, such as the substitution or deletion of a nucleotide in the sequence or the change in the length of the sequence, is made as long as the specific detection of Candida auris by the LAMP method cannot be inhibited. Any primers can act as the Loop-F primer and the Loop-B primer, as long as each of the primers includes a sequence that is complementary to a single-strand domain (located between B1 region and B2 region or between F1 region and F2 region) in a 5'-terminal-side loop of a dumb-bell structure of an amplification product of the LAMP method and is specific to the domain. Therefore, the sequences for the Loop-F primer and the Loop-B primer are not limited to the sequences represented by SEQ ID NO: 5 and SEQ ID NO: 6.
[0038] Namely, in the primer set of the present invention, FIP is required to be a polynucleotide represented by SEQ ID NO: 1, and BIP is required to be a polynucleotide represented by SEQ ID NO: 2.
[0039] In the detection method of the present invention, the nucleic acid sample in the specimen is subjected to a nucleic acid amplification reaction by the LAMP method using the primers (FIP, BIP, F3, B3) and optionally using the loop primers (Loop-B, Loop-F), and an amplification product is then detected.
[0040] The conditions for the amplification of the target sequence in the nucleic acid sample by the LAMP method are not particularly limited, and may be adjusted appropriately. A specific example of the temperature to be employed for the nucleic acid amplification reaction by the LAMP method is a temperature falling within the range from about 50°C to about 65°C, and a specific example of the reaction time to be employed is a time period falling within the range from 20 minutes to 60 minutes.
[0041] In addition to the above-mentioned primer set, the Candida auris detection kit to be used for the detection method of the present invention can also include a polymerase, a buffer, dNTPs, MgSO 4 and the like as reagents for use in the amplification of the sample nucleic acid. The concentrations of the reagents to be used in the detection method of the present invention and the like can be adjusted appropriately depending on the volumes of the reagents, the reaction time and the like. As the polymerase to be used in the amplification of the sample nucleic acid, a known polymerase can be used appropriately. For example, Bst DNA Polymerase (manufactured by Eiken Chemical Co., Ltd.), Csa DNA Polymerase (manufactured by Nippon Gene Co., Ltd.) and the like can be used.
[0042] In the detection kit, the primer set and other regents may be included separately, or some of them may be prepared in the form of a mixture. The primer set consists of four types of primers and loop primers, and these primers may be included separately or some of them may be prepared in the form of a mixture.
[0043] Furthermore, in the detection method of the present invention, a known method may be employed appropriately for the detection of an amplification product by the LAMP method. For example, for the detection of the amplification product, a method in which the occurrence of white turbidity of a reaction is observed with naked eyes, a method in which the white turbidity of a reaction solution is measured using a spectrophotometer, and a method in which a fluorescence is detected visually, a method in which a labeled oligonucleotide or a fluorescent intercalator capable of recognizing an amplified nucleotide sequence specifically is used can be exemplified. Alternatively, it is also possible that a reaction solution obtained after the completion of the reaction is subjected to agarose gel electrophoresis without any modification, then the gel is stained with ethidium bromide and then a ladder-like electrophoresis image specific to an amplification product is confirmed by the irradiation with ultraviolet ray.
[0044] In the detection method of the present invention, the detection of an amplification product obtained by the LAMP method may include the detection of the presence or absence of the amplification product as well as the measurement of the quantity of the amplification product.
[0045] In the detection method of the present invention, the nucleic acid sample in the specimen is subjected to a nucleic acid amplification reaction by the LAMP method using the detection kit including the primer set, and an amplification product is then detected. The primer set is designed employing a nucleotide sequence specific to Candida auris as a target.
[0046] In the detection method of the present invention, Candida auris can be detected specifically with high sensitivity without detecting a closely related species thereof. Therefore, Candida auris can be detected accurately even when a specimen contaminated with various microorganisms (e.g., a contaminated clinical specimen, an environmental specimen) is used. Furthermore, in the detection method of the present invention, the time required for the detection is short (about 20 minutes to 60 minutes) and therefore the detection can be achieved rapidly.Examples
[0047] Hereinbelow, the present invention will be described specifically by way of examples.<Example 1> Designing of LAMP Auris primer set
[0048] In order to design a primer set to be used in the LAMP method, the genome sequences for four types of Candida species, i.e., C. auris (PRJNA342691), C. tropicalis (GCF_000006335.2), C. albicans (GCA_000182965.3) and C. lusitaniae (LYUB00000000.2), were aligned and were compared with one another using Mauve (version 20150226), and a sequence having low homology with other Candida species was searched for. As a result, about several hundreds nucleotide sequences were obtained.
[0049] Most of the several hundreds nucleotide sequences were not suitable for the designing of primers. On the basis of the technical knowledge based on the experience of the present inventors, four types of nucleotide sequences (candidate sequences) that were assumed to be used for the designing of the LAMP primer set were selected (SEQ ID NOs: 7 to 10). (SEQ ID NO: 7) (SEQ ID NO: 8) (SEQ ID NO: 9) (SEQ ID NO: 10)
[0050] Among from the sequences represented by SEQ ID NOs: 7 to 10, the nucleotide sequence represented by SEQ ID NO: 7 was selected as a sequence having a length of about 1 kbp and most suitable for a LAMP reaction on the basis of the experience of the present inventors. As the result of the BLAST search in the National Center of Biotechnology Information of the United States, it was confirmed that the nucleotide sequence represented by SEQ ID NO: 7 was the genome of Candida auris (C. auris) containing a pyruvate : ferredoxin oxidoreductase domain (accession number of the genome: XM_018317007).
[0051] The DNA fragment represented by SEQ ID NO: 7 was amplified with EcoRIdAmp (registered tradename) PCR Master Mix (manufactured by Takara Bio Inc.) using C. auris JCM15448 T< that served as a template and a pair of primers consisting of Auris F (SEQ ID NO: 11: GCTATGCCGCTAGCAACG) and Auris R (SEQ ID NO: 12: CACTACAGCAGGATCAACGG).
[0052] In order to produce a pTAC-2Auris plasmid that was specific to the DNA of the fungus, an amplicon was purified with QIAquick (registered tradename) PCR purification kit (Qiagen, Venlo, The Netherlands) and was then cloned into a pTAC-2 vector using DynaExpress TA PCR cloning kit (BioDynamics Laboratory Inc., Tokyo, Japan). The cloned nucleotide sequence was confirmed using ABI PRISM (registered tradename) 3130x1 Genetic Analyzer (Applied Biosystems, Foster City, CA, USA).
[0053] A candidate LAMP primer set was designed using a 192-bp fragment (gene locus XM_018317007: located from 774b to 965b) as a target and using PrimerExplorer V5 software (https: / / primerexplorer.jp / lampv5 / index.html). The decided LAMP Auris primer set (also sometimes referred to as "LAMP Auris primer set", hereinafter) is shown in Table 1. [Table 1]Primer Sequence (5'→3') FIPAGGCTACTGAGCTTGCTGGTGTAACCAAACCAACAGGAGAGG (SEQ ID NO: 1)BIPACGGTTTCAGGGTTAGCATGGCTCAACAAAGTCGCTGGTACA (SEQ ID NO: 2)F3GGGAAAGGAACCCTGACCT (SEQ ID NO: 3)B3GGACACAGCATTCGAAGTGT (SEQ ID NO: 4)Loop-FCATCTCGAAGGCCTCGGT (SEQ ID NO: 5)Loop-BCACATACTCGAACGGAGTC (SEQ ID NO: 6)
[0054] It should be noted that the designing of the LAMP primers is not always easy even when a specialized software is used. For example, in addition to the basic LAMP primer set represented by SEQ ID Nos: 1 to 4 shown in Table 1, a primer set including the polynucleotides represented by SEQ ID NOs: 13 to 16 can be mentioned as another example of the basic LAMP primer set which can be designed on the basis of SEQ ID NO: 7. The primer set was confirmed to cause no Candida auris gene amplification reaction by the LAMP method. (SEQ ID NO: 15) AGAAACGGAACCGAAACGG(F3) (SEQ ID NO: 16) CCTCTCCTGTTGGTTTGGTT(B3) <Example 2> Amplification reaction by the LAMP method
[0055] With respect to a cultured Candida auris specimen, an amplification reaction by the LAMP method was run using Loopamp Turbidimeter RT-160C (manufactured by Eiken Chemical Co., Ltd.) at 56°C for 90 minutes. The reaction was terminated by deactivating the DNA polymerase at 80°C for 5 minutes. Each of the reaction solutions was prepared by mixing 12.5 µL of 2 × Reaction Mix (manufactured by Eiken Chemical Co., Ltd.), the primers of LAMP Auris primer set (40 µM of FIP, 40 µM of BIP, 20 µM of Loop-F, 20 µM of Loop-B, 5 µM of F3, 5 µM of B3), 1 µL of BstDNA polymerase, 2 µL of a sample DNA solution and distilled water together, and the total volume of the reaction solution was adjusted to 25 µL.
[0056] In order to determine the detection limit of the LAMP Auris primer set, pTAC-2Auris was serially diluted (1×10 0< to 10 10< copies / µL) and was used as a template in triplicate reactions. The detection of an amplification product was carried out with Loopamp Turbidimeter RT-160C.
[0057] The results are shown in Fig. 1.
[0058] As shown in Fig. 1, according to the LAMP method using LAMP Auris primer set, it was confirmed that pTAC-2Auris was detected and the sensitivity was high even when the concentration was 2×10 1< copies or less per one reaction. With respect to the extraction of DNA from the fungal cells, it was also confirmed that the DNA was extracted with high efficiency even when the fungal cells were treated with a DNA extraction reagent directly (i.e., without being disrupted).<Example 3> Evaluation of specificity of LAMP Auris primer set
[0059] In order to evaluate the specificity of the LAMP Auris primer set to Candida auris (C. auris), 57 strains in total of 38 species (20 kinds of filamentous fungi and 18 kinds of yeast strains) were tested (Table 2).
[0060] The full-length DNA of a template strain was extracted and purified in accordance with the method disclosed in Non-Patent Literature 4. With respect to the yeast strains, an aliquot of a colony proliferated on Sabouraud dextrose agar (SDA) was suspended in 25 µL of distilled water, and the resultant suspension was heated at 100°C for 15 minutes and was then centrifuged for a short time. In each of the reactions using the LAMP Auris primer set, 2 µL of a supernatant or purified DNA was used as a template.
[0061] The results are shown in Table 2. [Table 2]SpeciesStrain No.LAMP Auris reaction resultAcremonium curvulumNBRC32242-Aspergillus fumigatusTIMM0108-Aspergillus nigerTIMM0115-Candida albicansLSEM11-828-Candida aurisCBS12323, CBS12372, CBS12766, CBS12767, CBS12768, CBS12769, CBS12770, CBS12771, CBS12772, CBS12773, CBS12774, CBS12775, JCM12373, JCM15448 T< , LSEM52-3435, LSEM52-3449+Candida duobushaemulonii*CBS7799-Candida farnata*NBRC0083, NBRC0623-Candida glabrataCBS138, NBRC0005-Candida guilliermondii*TIMM0257-Candida haemulonii*JCM3762-Candida kruseiTIMM3378-Candida lusitaniae*NBRC1019, NBRC10059-Candida parapsilosis*ATCC22019-Candida pseudohaemuloniiJCM12453-Candida sake*NBRC0435-Candida tropicalisATCC750, TIMM0313-Chaetomium globosumTSY-0369-Cladosporium carrioniiTIMM3048-Cunninghamella bertholletiaeTIMM3392-Exophiala jeanselmeiTSY-0396-Fusarium oxysporumTSY-0351-Fusarium solaniTSY-0403-Malassezia furfurCBS1878 T< -Malassezia restrictaCBS7877-Microsporum gypseumNBRC5948-Mucor circinelloidesTIMM3177-Paecilomyces variotiiNBRC4855-Pseudallescheria boydiiTIMM0886-Rhodotorula glutinis*LSEM 20-1447-Rhodotorola minulaTIMM6222-Saccharomyces cervisiaeLSEM 14-1013-Scopulariopsis brevicaulisNBRC4843-Scopulariopsis brumptiiNBRC6441-Scytalidium lignicolaNBRC104988-Trichophyton benhamiaeSM103-Trichophyton mentagrophytesTIMM2789-Trichophyton rubrumTIMM2659-Trichophyton tonsuransNBRC5928-+: positive, -: negative, *: a species which Candida auris (C. auris) has been misidentified as in common tests.
[0062] By the LAMP method using the LAMP Auris primer set, the occurrence of amplification was confirmed with respect to all of 16 kinds of C. auris strains. In contrast, with respect to all of the remaining filamentous fungi and yeast strains including fungi which C. auris has been commonly misidentified as (i.e., fungi that have not been identified as Candida auris (C. auris) in the conventional test methods: marked with asterisks in Table 2), the occurrence of amplification was not confirmed.
[0063] In order to verify the quality of the DNA templates used in the reaction with the LAMP Auris primer set, the DNA templates were separately subjected to the LAMP reaction using panfungal LAMP primer set (Non-Patent Literature 4). As a result, the occurrence of amplification was detected with respect to the templates from all of the test species.<Example 4> Detection of Candida auris (C. auris) in clinical specimen by LAMP method
[0064] The LAMP method using the LAMP Auris primer set was applied to a clinical specimen. The test was carried out on an ear swab specimen obtained from otitis induced by C. auris LC318417 (Non-Patent Literature 5).
[0065] An ear swab specimen was placed on the surface of SDA agar and was then cultured at 37°C. A small cream-like colony (cells) thus obtained was identified as Candida auris (C. auris) by the LAMP method of the present invention, MALDI-TOF MS (Bruker DaltonicsK. K., Kanagawa, Japan) and rDNA sequencing.
[0066] At the same time, it was attempted to detect Candida auris (C. auris) DNA directly from a clinical specimen without carrying out culturing in the following manner. A cotton swab was placed in a 2-mL-microtube, was then washed with 1 mL of physiological saline supplemented with 0.05% Tween 80, and was then shaken for 10 minutes. A suspension thus obtained was centrifuged at 20,000 g for 10 minutes to produce pellets, the pellets were washed with 100 µL of physiological saline, and the full-length DNA was extracted using Kaneka Easy DNA Extraction kit version 2 (manufactured by Kaneka Corporation) in accordance with the instructions by the supplier. A nucleic acid amplification reaction by the LAMP method was carried out using the extracted DNA (2 µl) as a sample nucleic acid for an LAMP reaction solution and using the LAMP Auris primer set. The reaction conditions and the method for the detection of an amplification product were the same as those employed in Example 2.
[0067] The results are shown in FIG. 2.
[0068] As shown in Fig. 2, the amplification product produced by the LAMP method from the clinical specimen was detected in 27 minutes. It was confirmed that the LAMP method using the LAMP Auris primer set was applicable to a clinical specimen directly. The whole identification process including the direct extraction of DNA (i.e., extraction without disruption) was completed within about 1 hour, and it was confirmed that rapid detection could be achieved.<Example 5> Detection of Candida auris (C. auris) in environmental sample by LAMP method
[0069] The applicability of the LAMP method using the LAMP primer set to an environmental research was also evaluated. About 25 µL of physiological saline containing 1 × 10 6< cells of Candida auris (C. auris) was dried in a clean petri dish, and the cells were collected by a wiping method that had been optimized for environmental sampling use (samples A to D).
[0070] The cell amounts and the collection rates of samples A to D are shown in Table 3. [Table 3]SampleAmount of collected cells (cells / µL)Collection rate (%)A5 × 10 2< 51B5.6 × 10 2< 57C6.25 × 10 2< 63D3.75 × 10 2< 38
[0071] The handling of swabs and the extraction of DNA, excluding the shaking, were carried out in the same manner as in Examples 2 and 4. With respect to samples A and B, a vibration shaker was not use. With respect to samples C and D, the vibration shaker was used for 10 minutes. The reaction conditions for the nucleic acid amplification reaction by the LAMP method and the detection of an amplification product were the same as those employed in Examples 2 and 4.
[0072] The LAMP reaction times and the detection results for the samples are shown in Table 4 and Fig. 3. [Table 4]Specimen No.SpecimenTime required until LAMP auris-positive reaction occurs (min)1Distilled water (negative control)Positive reaction does not occur2Sample A213Sample B164Sample C225Sample D236Candida auris DNA (positive control)20
[0073] As shown in Table 4 and Fig. 3, with respect to each of the samples (A to D, positive control), an amplification product was detected (LAMP-positive) 20 minutes after the start of the nucleic acid amplification reaction by the LAMP method, and it was confirmed that Candida auris (C. auris) DNA was detected. It was suggested that the LAMP method using the LAMP Auris primer set was applicable to environmental researches and enabled rapid and accurate detection.
[0074] From the results of Examples mentioned above, it was confirmed that, according to the LAMP method using the LAMP Auris primer set, all of C. auris strains were able to be identified with 100% of specificity and were able to be detected distinctively from closely related species thereof with high reliability. Furthermore, the target DNA was detected at a concentration of 2 × 10 1< copies per reaction, and therefore there was no technical problem about the use of an amplification device and the results were obtained within a short time. Furthermore, it was also confirmed that the detection from a clinical specimen was possible and therefore the time necessary for culturing or extraction of DNA was shortened, and early diagnosis became possible. In recent years, a portable LAMP amplification device and the like are commercially available. Therefore, according to the LAMP method using the LAMP Auris primer set of the present invention, the rapid and accurate detection of Candida auris (C. auris) becomes possible in, for example, environmental researches in medical facilities where the environmental control is critical.
Claims
1. A primer set for use in the detection of Candida auris, which comprises four types of primers consisting of FIP, BIP, F3 and B3, and is intended to be used in the detection of Candida auris by amplifying a Candida auris target sequence in a specimen by the LAMP method, wherein: FIP is a polynucleotide comprising SEQ ID NO: 1; BIP is a polynucleotide comprising SEQ ID NO: 2; F3 is a polynucleotide comprising SEQ ID NO: 3; and B3 is a polynucleotide comprising SEQ ID NO: 4.
2. The primer set for use in the detection of Candida auris according to claim 1, wherein polynucleotides respectively comprising SEQ ID Nos: 5 and 6 are further included as loop primers.
3. A Candida auris detection kit including a primer set for use in the detection of Candida auris as recited in claim 1 or 2.
4. A method for detecting Candida auris, comprising subjecting a nucleic acid sample obtained from a specimen to a nucleic acid amplification reaction by the LAMP method and detecting an amplification product, wherein: a primer set to be used in the LAMP method comprises four types of primers consisting of FIP, BIP, F3 and B3; FIP is a polynucleotide comprising SEQ ID NO: 1; BIP is a polynucleotide comprising SEQ ID NO: 2; F3 is a polynucleotide comprising SEQ ID NO: 3; and B3 is a polynucleotide comprising SEQ ID NO: 4.
5. The method for detecting Candida auris according to claim 4, wherein the primer set further includes polynucleotides respectively comprising SEQ ID Nos: 5 and 6 as loop primers.