process

Abstract

The present disclosure relates to the biotransformation of crude poppy extract or purified or semi-purified sources of opiates or opioid alkaloids to produce one or more opiates or opioid alkaloids, vectors comprising nucleic acid molecules encoding enzymes, and microbial cells expressing the nucleic acids encoding the enzymes and comprising modified enzymes with enhanced activity.

Description

[Technical field]

[0001] The present disclosure relates to a process for producing one or more opiates or opioid alkaloids, the process comprising forming a reaction mixture comprising a host cell transformed with one or more nucleic acid molecules encoding an enzyme that catalyzes at least one reaction in the conversion of an opiate alkaloid, including a semi-synthetic opioid alkaloid, reacting the mixture to convert the opiate alkaloid or semi-synthetic opioid alkaloid to an additional opiate or opioid alkaloid, and optionally extracting the product of the reaction mixture; vectors comprising the nucleic acid molecules; and host cells expressing nucleic acids encoding polypeptides and modified polypeptides having altered or enhanced activity. [Background technology]

[0002] Opiates, such as codeine and morphine, are powerful analgesics that are frequently used to treat moderate to severe pain. Semi-synthetic opioids, such as oxycodone, oxymorphone, nalbuphine, naloxone, naltrexone, buprenorphine, or etorphine, often have a lower side effect profile compared to codeine and morphine and therefore provide a valuable pain management alternative.

[0003] The biosynthetic pathway of morphinan alkaloids is well established and involves a series of enzymatic steps starting from dopamine and 4-hydroxyphenylacetaldehyde leading to the synthesis of R-reticuline, which is then converted to thebaine. Thebaine is then converted to oripavine by codeine 3-O-demethylase (CODM) or in several steps with the activity of thebaine-6-O-demethylase (T6ODM). Codeine is then converted to morphine by demethylation by CODM.

[0004] Thebaine is the starting material for the synthesis of some semi-synthetic opioids. Opiate alkaloids can be extracted from latex, harvested from the green seed pods of the opium poppy, or from the dried mature plant, poppy seed pod, but the demand for opium alkaloids generally exceeds the available natural supplies, necessitating expensive chemical synthesis. Thebaine, the chemical precursor of codeine, morphine, and semi-synthetic opioids, is readily converted within the plant, so levels of thebaine in wild-type poppy plants are low.

[0005] WO2017 / 122011, incorporated by reference in its entirety, discloses the characterization of a genomic locus encoding the CODM genes in Papaver somniferum. The locus contains three closely related CODM genes that are about 99% identical at the genomic sequence level. Mutations in the CODM genes that affect enzyme activity are associated with elevated codeine, and in plants in which each of the CODM genes is deleted, the plants have very high levels of codeine. EP3398430, incorporated by reference in its entirety, discloses the characterization of a genomic locus encoding the T6ODM genes. The locus contains five T6ODM genes. In P.somniferum plants carrying mutations in both of the CODM three gene clusters combined with a mutation in the T6ODM gene, the resulting double mutants show high levels of thebaine. When expression or activity of CODM and T6ODM is undetectable, the resulting plants have very high levels of thebaine.

[0006] For example, disclosed are processes for the conversion of one or more opiates or opioid alkaloids to one or more opiates or opioid intermediates, comprising forming a preparation comprising a host cell, such as a bacterial, fungal, or plant cell, transformed with one or more nucleic acids encoding an enzyme involved in opiate biotransformation or an enzyme involved in the synthesis of a semisynthetic opioid, e.g., oxycodone, oxymorphone, nalbuphine, naloxone, naltrexone, buprenorphine, or etorphine.

[0007] Also disclosed is the use of crude poppy extracts obtained from opium poppy, e.g., P. sominferum, incubating the preparation to obtain biotransformation, and optionally extracting one or more opiate or opioid alkaloids from the transformed preparation. The disclosure provides for scale conversion of opiate alkaloids as an alternative to in planta extraction of opiate alkaloids from Papaver species. Also disclosed are CODM polypeptides bearing amino acid modifications that result in altered or enhanced CODM activity. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0008] According to one aspect of the invention there is provided a method for the biotransformation of one or more opiate alkaloids or synthetic opioid alkaloids comprising the steps of: forming a preparation comprising a host cell transformed with one or more nucleic acid molecules encoding one or more polypeptides that catalyze at least one reaction in the conversion of one or more opiate alkaloids or synthetic opioid alkaloids to one or more different opiate alkaloids or semi-synthetic opioid alkaloids; incubating the reaction to allow for conversion of one or more opiate alkaloids or semi-synthetic opioid alkaloids; and optionally and extracting the one or more converted different opiate alkaloids or semi-synthetic opioid alkaloids from the preparation.

[0009] In a preferred method of the invention, the preparation comprises naturally occurring opiate alkaloids.

[0010] In another preferred method of the invention, the preparation comprises a semi-synthetic opioid alkaloid.

[0011] In a preferred method of the invention, the preparation comprises a crude poppy extract that contains natural opiate alkaloids, such as codeine, thebaine, codeinone, and morphinone.

[0012] In a preferred method, the preparation comprises an opiate alkaloid selected from the group consisting of thebaine, oripavine, codeine, morphinone, neomorphinone, neopinone, and codeinone, preferably thebaine and codeine.

[0013] In a preferred method, the preparation contains codeine or thebaine.

[0014] In a preferred method, the one or more converted opiate alkaloids are selected from the group consisting of oripavine, codeine, morphinone, neomorphinone, neopinone, and codeinone, preferably thebaine and codeine.

[0015] In a preferred method, the one or more converted different opiate alkaloids are oripavine and morphine.

[0016] In another method of the invention, the opioid alkaloid is oxycodone, oxymorphone, hydrocodone, hydromorphone, dihydrocodeine, dihydromorphine: 14-hydroxycodeine, 14-hydroxymorphine, noroxycodone, noroxymorphone, noroxycodeinone, noroxymorphinone, 14-hydroxynorcodeinone, 14-hydroxynormorphinone, 14-hydroxycodeinone, 14-hydroxymorphinone, buprenorphine intermediates, e.g., N-cyclopropylmethyl-7α-(2-hydroxypropyl)-1,4-dihydro ... and 7-acetyl-6,14-endoetheno-6,7,8,14-tetrahydronorthebaine or 7-acetyl-6,14-endoetheno-6,7,8,14-tetrahydrothebaine, buprenorphine ((2S)-2-[17-(cyclopropylmethyl)-4,5α-epoxy-3-hydroxy-6-methoxy-6α,14-ethano-14α-morphinan-7α-γl]-3,3-dimethylbutan-2-ol), and an etorphine intermediate.

[0017] Further examples of semi-synthetic opioid alkaloids are disclosed in US2019 / 0144900, which is incorporated by reference in its entirety.

[0018] In a preferred method of the invention, the nucleic acid molecule comprises i) a nucleotide sequence as set forth in SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15; ii) a nucleotide sequence, which is degenerate as a result of the genetic code for the nucleotide sequence defined in (i); iii) a nucleic acid molecule comprising a nucleotide sequence of a complementary strand that hybridizes under stringent hybridization conditions to the sequence of SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15, wherein the nucleic acid molecule encodes codeine 3-O-demethylase; iv) a nucleotide sequence encoding a polypeptide comprising the amino acid sequence represented by SEQ ID NO: 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or 31; v) a nucleotide sequence encoding a polypeptide comprising an amino acid sequence modified by addition, deletion or substitution of at least one amino acid residue as depicted in iv) above, and having codeine 3-O-demethylase activity.

[0019] In a preferred embodiment of the invention, the nucleotide sequence encoding the codeine 3-O-demethylase polypeptide comprises a nucleotide sequence set forth in SEQ ID NO:3 or which is at least 90% identical to SEQ ID NO:3.

[0020] Sequence homology is 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity or similarity to the full length nucleotide or amino acid sequences disclosed herein.

[0021] In a preferred embodiment of the invention, the nucleotide sequence encoding the codeine 3-O-demethylase polypeptide comprises a nucleotide sequence set forth in SEQ ID NO:8 or which is at least 90% identical to SEQ ID NO:8.

[0022] In a preferred embodiment of the invention, the nucleotide sequence encoding a codeine 3-O-demethylase polypeptide is selected from the group consisting of SEQ ID NOs: 1, 2, 4, 5, 6, 7, 9, 10, 11, 12, 13, 14, and 15, or comprises a nucleotide sequence that is at least 90% identical to SEQ ID NOs: 1, 2, 4, 5, 6, 7, 9, 10, 11, 12, 13, 14, and 15.

[0023] In a preferred embodiment of the invention, the codeine 3-O-demethylase polypeptide comprises a polypeptide comprising an amino acid sequence set forth in SEQ ID NO:19, or an amino acid sequence that is at least 90% identical to SEQ ID NO:19.

[0024] In a preferred embodiment of the invention, the codeine 3-O-demethylase polypeptide comprises a polypeptide comprising the amino acid sequence set forth in SEQ ID NO:20, or an amino acid sequence that is at least 90% identical to SEQ ID NO:20 and includes the amino acid substitution E259K.

[0025] In a preferred embodiment of the invention, the codeine 3-O-demethylase polypeptide comprises a polypeptide comprising the amino acid sequence set forth in SEQ ID NO:21, or an amino acid sequence that is at least 90% identical to SEQ ID NO:21 and includes the amino acid substitution E259D.

[0026] In a preferred embodiment of the invention, the codeine 3-O-demethylase polypeptide comprises a polypeptide comprising the amino acid sequence set forth in SEQ ID NO:22, or an amino acid sequence that is at least 90% identical to SEQ ID NO:22 and includes the amino acid substitution E259H.

[0027] In a preferred embodiment of the invention, the codeine 3-O-demethylase polypeptide comprises a polypeptide comprising the amino acid sequence set forth in SEQ ID NO:23, or an amino acid sequence that is at least 90% identical to SEQ ID NO:23 and includes the amino acid substitution E259Q.

[0028] In a preferred embodiment of the invention, the codeine 3-O-demethylase polypeptide comprises a polypeptide comprising the amino acid sequence set forth in SEQ ID NO:24, or an amino acid sequence that is at least 90% identical to SEQ ID NO:24 and includes the amino acid substitution E259A.

[0029] In a preferred embodiment of the invention, the codeine 3-O-demethylase polypeptide comprises a polypeptide comprising the amino acid sequence set forth in SEQ ID NO:25, or an amino acid sequence that is at least 90% identical to SEQ ID NO:25 and includes the amino acid substitution E259S.

[0030] In a preferred embodiment of the invention, the codeine 3-O-demethylase polypeptide comprises a codeine 3-O-demethylase polypeptide comprising the amino acid sequence set forth in SEQ ID NO:26, or an amino acid sequence that is at least 90% identical to SEQ ID NO:26 and includes the amino acid substitution E259G.

[0031] In a preferred embodiment of the invention, the codeine 3-O-demethylase polypeptide comprises a polypeptide comprising the amino acid sequence set forth in SEQ ID NO:27, or an amino acid sequence that is at least 90% identical to SEQ ID NO:27 and comprises the amino acid substitution R260T.

[0032] In a preferred embodiment of the invention, the codeine 3-O-demethylase polypeptide comprises a polypeptide comprising the amino acid sequence set forth in SEQ ID NO:28, or an amino acid sequence that is at least 90% identical to SEQ ID NO:28 and comprises the amino acid substitutions E259G and R260T.

[0033] In a preferred embodiment of the invention, the codeine 3-O-demethylase polypeptide comprises a polypeptide comprising the amino acid sequence set forth in SEQ ID NO:29, or an amino acid sequence that is at least 90% identical to SEQ ID NO:29 and comprises the amino acid substitution R260K.

[0034] In a preferred embodiment of the invention, the codeine 3-O-demethylase polypeptide comprises a polypeptide comprising the amino acid sequence set forth in SEQ ID NO:30, or an amino acid sequence that is at least 90% identical to SEQ ID NO:30 and comprises the amino acid substitutions E259D and R260K.

[0035] In a preferred embodiment of the invention, the codeine 3-O-demethylase polypeptide comprises a polypeptide comprising the amino acid sequence set forth in SEQ ID NO:31, or an amino acid sequence that is at least 90% identical to SEQ ID NO:31 and comprises the amino acid substitutions E259G and R260K.

[0036] In a preferred method of the invention, the nucleic acid molecule comprises i) the nucleotide sequence set forth in SEQ ID NO: 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, or 52; ii) a nucleotide sequence, which is degenerate as a result of the genetic code for the nucleotide sequence defined in (i); iii) a nucleic acid molecule comprising a nucleotide sequence of a complementary strand that hybridizes under stringent hybridization conditions to the sequence of SEQ ID NO: 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, or 52, wherein the nucleic acid molecule encodes codeine 3-O-demethylase; iv) a nucleotide sequence encoding a polypeptide comprising an amino acid sequence represented by SEQ ID NO: 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, or 68; v) a nucleotide sequence encoding a polypeptide comprising an amino acid sequence modified by addition, deletion or substitution of at least one amino acid residue as depicted in iv) above, and having codeine 3-O-demethylase activity.

[0037] In a preferred embodiment of the invention, the nucleotide sequence encoding a codeine 3-O-demethylase polypeptide is selected from the group consisting of SEQ ID NOs: 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, and 52, or comprises a nucleotide sequence that is at least 90% identical to a sequence selected from the group consisting of SEQ ID NOs: 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, and 52.

[0038] In a preferred embodiment of the invention, the nucleotide sequence encoding the codeine 3-O-demethylase polypeptide comprises a nucleotide sequence set forth in SEQ ID NO:47 or which is at least 90% identical to SEQ ID NO:47.

[0039] In a preferred embodiment of the invention, the nucleotide sequence encoding the codeine 3-O-demethylase polypeptide comprises a nucleotide sequence set forth in SEQ ID NO:43 or which is at least 90% identical to SEQ ID NO:43.

[0040] In a preferred embodiment of the invention, the nucleotide sequence encoding the codeine 3-O-demethylase polypeptide comprises a nucleotide sequence set forth in SEQ ID NO:52 or which is at least 90% identical to SEQ ID NO:52.

[0041] In a preferred embodiment of the invention, the nucleotide sequence encoding the codeine 3-O-demethylase polypeptide comprises a nucleotide sequence set forth in SEQ ID NO:51 or which is at least 90% identical to SEQ ID NO:51.

[0042] In a preferred embodiment of the invention, the nucleotide sequence encoding the codeine 3-O-demethylase polypeptide comprises a nucleotide sequence set forth in SEQ ID NO:50 or which is at least 90% identical to SEQ ID NO:50.

[0043] In a preferred embodiment of the invention, the codeine 3-O-demethylase polypeptide comprises a polypeptide comprising an amino acid sequence set forth in SEQ ID NO:53, or an amino acid sequence which is at least 90% identical to SEQ ID NO:53.

[0044] In a preferred embodiment of the invention, the codeine 3-O-demethylase polypeptide comprises a polypeptide comprising an amino acid sequence set forth in SEQ ID NO:54, or an amino acid sequence that is at least 90% identical to SEQ ID NO:54 and comprises the amino acid substitutions T3K, P4A, I5K, and I7M.

[0045] In a preferred embodiment of the invention, the codeine 3-O-demethylase polypeptide comprises a polypeptide comprising the amino acid sequence set forth in SEQ ID NO:55, or an amino acid sequence that is at least 90% identical to SEQ ID NO:55 and comprises the amino acid substitutions Y357S and M360I.

[0046] In a preferred embodiment of the invention, the codeine 3-O-demethylase polypeptide comprises a polypeptide comprising an amino acid sequence set forth in SEQ ID NO:56, or an amino acid sequence that is at least 90% identical to SEQ ID NO:56 and comprises the amino acid substitutions T3K, P4A, I5K, I7M, Y357S, and M360I.

[0047] In a preferred embodiment of the invention, the codeine 3-O-demethylase polypeptide comprises a polypeptide comprising the amino acid sequence set forth in SEQ ID NO:57, or an amino acid sequence that is at least 90% identical to SEQ ID NO:57 and comprises the amino acid substitution T3K.

[0048] In a preferred embodiment of the invention, the codeine 3-O-demethylase polypeptide comprises a polypeptide comprising the amino acid sequence set forth in SEQ ID NO:58, or an amino acid sequence that is at least 90% identical to SEQ ID NO:58 and includes the amino acid substitution P4A.

[0049] In a preferred embodiment of the invention, the codeine 3-O-demethylase polypeptide comprises a polypeptide comprising the amino acid sequence set forth in SEQ ID NO:59, or an amino acid sequence that is at least 90% identical to SEQ ID NO:59 and comprises the amino acid substitution I5K.

[0050] In a preferred embodiment of the invention, the codeine 3-O-demethylase polypeptide comprises a codeine 3-O-demethylase polypeptide comprising the amino acid sequence set forth in SEQ ID NO:60, or an amino acid sequence that is at least 90% identical to SEQ ID NO:60 and comprises the amino acid substitution I7M.

[0051] In a preferred embodiment of the invention, the codeine 3-O-demethylase polypeptide comprises a polypeptide comprising the amino acid sequence set forth in SEQ ID NO:61, or an amino acid sequence that is at least 90% identical to SEQ ID NO:61 and includes the amino acid substitution Y357S.

[0052] In a preferred embodiment of the invention, the codeine 3-O-demethylase polypeptide comprises a polypeptide comprising the amino acid sequence set forth in SEQ ID NO:62, or an amino acid sequence that is at least 90% identical to SEQ ID NO:62 and comprises the amino acid substitution M360I.

[0053] In a preferred embodiment of the invention, the codeine 3-O-demethylase polypeptide comprises a polypeptide comprising the amino acid sequence set forth in SEQ ID NO:63, or an amino acid sequence that is at least 90% identical to SEQ ID NO:63 and comprises the amino acid substitutions I5K and M360I.

[0054] In a preferred embodiment of the invention, the codeine 3-O-demethylase polypeptide comprises a polypeptide comprising the amino acid sequence set forth in SEQ ID NO:64, or an amino acid sequence that is at least 90% identical to SEQ ID NO:64 and comprises the amino acid substitutions I5K and E259G.

[0055] In a preferred embodiment of the invention, the codeine 3-O-demethylase polypeptide comprises a polypeptide comprising the amino acid sequence set forth in SEQ ID NO:65, or an amino acid sequence that is at least 90% identical to SEQ ID NO:65 and comprises the amino acid substitutions E259G and M360I.

[0056] In a preferred embodiment of the invention, the codeine 3-O-demethylase polypeptide comprises a polypeptide comprising the amino acid sequence set forth in SEQ ID NO:66, or an amino acid sequence that is at least 90% identical to SEQ ID NO:66 and comprises the amino acid substitutions I5K, E259G, and M360I.

[0057] In a preferred embodiment of the invention, the codeine 3-O-demethylase polypeptide comprises a polypeptide comprising an amino acid sequence set forth in SEQ ID NO:67, or an amino acid sequence that is at least 90% identical to SEQ ID NO:67 and comprises the amino acid substitutions P4A, E259G, and M360I.

[0058] In a preferred embodiment of the invention, the codeine 3-O-demethylase polypeptide comprises a polypeptide comprising an amino acid sequence set forth in SEQ ID NO:68, or an amino acid sequence that is at least 90% identical to SEQ ID NO:68 and comprises the amino acid substitutions P4A, I5K, E259G, and M360I.

[0059] In a preferred method of the invention, the nucleic acid molecule comprises i) the nucleotide sequence set forth in SEQ ID NO: 16; ii) a nucleotide sequence, which is degenerate as a result of the genetic code for the nucleotide sequence defined in i); iii) a nucleic acid molecule comprising a nucleotide sequence of a complementary strand that hybridizes under stringent hybridization conditions to the sequence of SEQ ID NO: 16, wherein the nucleic acid molecule encodes thebaine 6-O-demethylase; iv) a nucleotide sequence encoding a polypeptide comprising the amino acid sequence represented by SEQ ID NO: 32; v) a nucleotide sequence encoding a polypeptide comprising an amino acid sequence modified by addition, deletion, or substitution of at least one amino acid residue as depicted in iv) above, and having thebaine 6-O-demethylase activity.

[0060] In a preferred method of the invention, the nucleic acid molecule comprises i) the nucleotide sequence set forth in SEQ ID NO: 18; ii) a nucleotide sequence, which is degenerate as a result of the genetic code for the nucleotide sequence defined in i); iii) a nucleic acid molecule comprising a nucleotide sequence of a complementary strand that hybridizes under stringent hybridization conditions to the sequence of SEQ ID NO: 18, said nucleic acid molecule encoding codeinone reductase; iv) a nucleotide sequence encoding a polypeptide comprising the amino acid sequence represented by SEQ ID NO: 34; v) a nucleotide sequence encoding a polypeptide comprising an amino acid sequence modified by addition, deletion or substitution of at least one amino acid residue as depicted in iv) above, and having codeinone reductase activity.

[0061] In a preferred method of the invention, the nucleic acid molecule comprises i) the nucleotide sequence set forth in SEQ ID NO: 17; ii) a nucleotide sequence, which is degenerate as a result of the genetic code for the nucleotide sequence defined in i); iii) a nucleic acid molecule comprising a nucleotide sequence of a complementary strand that hybridizes under stringent hybridization conditions to the sequence of SEQ ID NO: 17, said nucleic acid molecule encoding neopinone isomerase; iv) a nucleotide sequence encoding a polypeptide comprising the amino acid sequence represented by SEQ ID NO: 33; v) a nucleotide sequence encoding a polypeptide comprising an amino acid sequence modified by addition, deletion or substitution of at least one amino acid residue as depicted in iv) above, and having neopinone isomerase activity.

[0062] Hybridization of nucleic acid molecules occurs when two complementary nucleic acid molecules undergo a degree of hydrogen bonding with each other. The stringency of hybridization can vary depending on the environmental conditions surrounding the nucleic acid, the nature of the hybridization method, and the composition and length of the nucleic acid molecule used. Calculations regarding the hybridization conditions required to achieve a certain degree of stringency are described in Sambrook et al., Molecular Cloning: A Laboratory Manual (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 2001), and Tijssen, Laboratory Techniques in Biochemistry and Molecular Biology-Hybridization with Nucleic Acid Probes Part I, Chapter 2 (Elsevier, New York, 1993). m is the temperature at which 50% of a given strand of a nucleic acid molecule hybridizes to its complementary strand. The following are an exemplary, non-limiting set of hybridization conditions. Very high stringency (allowing sequences sharing at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to hybridize) Hybridization: 5xSSC, 65℃, 16 hours 2 washes: 2xSSC, room temperature (RT), 15 min each Wash twice: 0.5xSSC, 65℃, 20 min each High stringency (allowing sequences sharing at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, or 89% identity to hybridize) Hybridization: 5x-6x SSC, 65℃-70℃, 16-20 hours Wash twice: 2xSSC, room temperature, 5-20 minutes each Wash twice: 1xSSC, 55℃~70℃, 30 minutes each Low stringency (allowing sequences sharing at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, or 79% identity to hybridize) Hybridization: 6xSSC, room temperature to 55℃, 16 to 20 hours Wash at least two times: 2x–3x SSC, room temperature–55 °C, 20–30 min each.

[0063] In a preferred method of the invention, the host cell is a eukaryotic cell.

[0064] In a preferred method of the invention, the eukaryotic cell is a plant cell, such as a Papaver species plant cell, such as a P. somniferum cell.

[0065] In a preferred method of the invention, the eukaryotic cell is a microbial cell, such as a Saccharomyces cerevisiae cell or a Pichia pastoris cell.

[0066] In another preferred method of the invention, the host cell is a prokaryotic cell.

[0067] In yet another preferred embodiment of the invention, the prokaryotic cell is a bacterial cell, for example an Escherichia coli (E. coli) cell.

[0068] When microorganisms are used as organisms in the process according to the invention, they are grown or cultured in a manner familiar to the skilled artisan, depending on the host organism. The microorganisms are grown in a liquid medium containing a carbon source, usually in the form of sugars, a nitrogen source, usually in the form of an organic nitrogen source such as yeast extract, or trace elements such as salts such as ammonium sulfate, iron, manganese and magnesium salts, and, if necessary, vitamins, at temperatures between 0°C and 100°C, preferably between 10°C and 60°C, in oxygen with supplemental gassing.

[0069] The pH of the liquid medium may be kept constant, regulated or not during the cultivation period. The cultures may be grown batchwise, semi-batchwise or continuously. Nutrients may be provided at the beginning of the fermentation or fed semi-continuously or continuously. These products may be isolated from the organisms as described above by processes known to the skilled artisan, for example selective extraction from the aqueous phase into and out of the immiscible organic solvent by manipulation of the solubility of the products by pH adjustment with acids or bases. Purification using adsorbents and or formation of crystals by changing the solubility of the target compounds using the temperature of the solution, polarity, pH of the solution, formation of salts of the target compounds allows the isolation of the desired products. For this purpose the organisms may advantageously be pre-destructed. In this process the pH value is advantageously maintained at 4 to 12, preferably at pH 6 to 9, particularly preferably at pH 7 to 8.

[0070] An overview of known cultivation methods can be found in the textbooks by Chmiel (BioprozeBtechnik 1. Einführung in die Bioverfahrenstechnik [Bioprocess technology 1. Introduction to Bioprocess technology] (Gustav Fischer Verlag, Stuttgart, 1991)) or by Storhas (Bioreaktoren und periphere Einrichtungen [Bioreactors and peripheral equipment] (Vieweg Verlag, Brunswick / Wiesbaden, 1994)).

[0071] The medium used should meet the requirements of the strain in question. Descriptions of culture media for various microorganisms can be found in the American Society of Bacteriology textbook "Manual of Methods for General Bacteriology" (Washington DC, USA, 1981).

[0072] As mentioned above, these media that can be used according to the invention usually contain one or more carbon sources, nitrogen sources, inorganic salts, vitamins and / or trace elements.

[0073] Preferred carbon sources are sugars, such as monosaccharides, disaccharides, or polysaccharides. Examples of carbon sources are glucose, fructose, mannose, galactose, ribose, sorbose, ribulose, lactose, maltose, sucrose, raffinose, starch, or cellulose. Sugars can be added to the medium via complex mixtures, such as molasses or other by-products from refined sugar. Addition of a mixture of various carbon sources can also be advantageous. Other possible carbon sources are fats and oils, such as soybean oil, sunflower oil, peanut oil, and / or coconut fat, fatty acids, such as palmitic acid, stearic acid, and / or linoleic acid, alcohols and / or polyhydric alcohols, such as glycerol, methanol, and / or ethanol, and / or organic acids, such as acetic acid and / or lactic acid.

[0074] Nitrogen sources are usually organic or inorganic nitrogen compounds or materials containing these compounds. Examples of nitrogen sources include ammonia in liquid or gas form, or ammonium salts such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate, or ammonium nitrate, nitrates, urea, amino acids, or complex nitrogen sources such as corn steep liquor, soybean meal, soybean protein, yeast extract, meat extract, etc. The nitrogen sources can be used individually or as a mixture.

[0075] Inorganic salt compounds that may be present in the medium include chlorides, phosphorus, and sulfates of calcium, magnesium, sodium, cobalt, molybdenum, potassium, manganese, zinc, copper, and iron.

[0076] Inorganic sulfur-containing compounds, such as sulfates, sulfites, dithionites, tetrathionates, thiosulfatos, sulfides, etc., or organic sulfur compounds, such as mercaptans and thiols, can be used as sulfur sources for the production of sulfur-containing fine chemicals, especially methionine.

[0077] Phosphoric acid, potassium dihydrogen phosphate, or dipotassium hydrogen phosphate, or the corresponding sodium-containing salts, can be used as the phosphorus source.

[0078] Chelating agents may be added to the medium to keep metal ions in solution. Particularly suitable chelating agents include dihydroxyphenols such as catechol or protocatechol, and organic acids such as citric acid.

[0079] The fermentation media used according to the invention to cultivate microorganisms usually also contain other growth factors such as vitamins or growth promoters, including, for example, biotin, riboflavin, thiamine, folic acid, nicotinic acid, pantothenate, and pyridoxine. Growth factors and salts are often derived from complex medium components such as yeast extract, molasses, corn steep liquor, etc. Furthermore, suitable precursors can be added to the culture medium. The exact composition of the medium compounds is highly dependent on the specific experiment and is determined individually for each specific case. Information on media optimization can be found in the textbook "Applied Microbiol. Physiology, A Practical Approach" (Editors PMRhodes, PF Stanbury, IRL Press (1997) pp. 53-73, ISBN 0 19 963577 3). Growth media can also be obtained from commercial suppliers, such as, for example, Standard 1 (Merck) or BHI (Brain Heart Infusion, DIFCO).

[0080] All medium components are sterilized either by heat (20 min at 1.5 bar and 121° C.) or by filter sterilization. Components may be sterilized together or separately as needed. All medium components may be present at the start of the culture or may be added continuously or batchwise as needed.

[0081] The culture temperature is usually 15°C to 45°C, preferably 25°C to 40°C, and may be kept constant or may be changed during the experiment. The pH of the medium should be in the range of 5.0 to 8.5, preferably 7.0. The pH for the culture can be controlled by adding basic compounds such as sodium hydroxide, potassium hydroxide, ammonia, and aqueous ammonia, or acidic compounds such as phosphoric acid, acetic acid, or sulfuric acid during the culture. Foaming can be controlled, for example, by using antifoaming agents such as fatty acid polyglycol esters. To maintain the stability of the plasmid, it is possible to add suitable substances having a selective effect, for example antibiotics, to the medium. Aerobic conditions are maintained by introducing oxygen or an oxygen-containing gas mixture, for example ambient air, into the culture. The culture temperature is usually 20°C to 45°C, preferably 25°C to 40°C. The culture is continued until the formation of the desired product is maximized. This goal is usually achieved within 10 to 160 hours.

[0082] The fermentation broth containing polyunsaturated fatty acids thus obtained usually contains 7.5% to 25% by weight of the dry mass.

[0083] The fermentation broth can then be further processed. The biomass may be completely or partially removed from the fermentation broth, if desired, by a separation method such as, for example, centrifugation, filtration, decanting, or a combination of these methods, or may be left entirely in the broth. It may be advantageous to process the biomass after its separation.

[0084] However, the fermentation broth can be concentrated or concentrated without separating the cells using known methods, such as, for example, rotary evaporators, thin film evaporators, falling film evaporators, reverse osmosis or nanofiltration, etc. Finally, the concentrated fermentation broth can be treated to obtain the opiate alkaloids present therein.

[0085] In a preferred method of the present invention, the crude poppy extract is obtained from Papaver somniferum or Papaver bracteatum plants.

[0086] Information on the optimization of extraction methods can be found in the textbook "Natural Product Extraction, Principles and Applications" (edited by M Rostagno and J Prado, RSC Publishing (2013), ISBN 978 1 84973 606 0).

[0087] Preferably, the Papaver species naturally contains high levels of one or more opiate alkaloids.

[0088] In another preferred method of the invention, the Papaver species is modified, wherein the modification is a genomic modification, and wherein the genomic modification is associated with an increased opiate alkaloid content.

[0089] In a preferred method of the invention, the Papaver species is P. somniferum and the modification is a mutation in one or more codeine 3-O-demethylases.

[0090] In a preferred method of the invention, the P. somniferum plant is modified to be deleted or mutated with respect to one, two, or three linked codeine 3-O-demethylase genes encoded by a nucleic acid molecule comprising a nucleotide sequence set forth in SEQ ID NO:1, or a nucleic acid molecule comprising a nucleotide sequence that is 95-99% identical to the nucleotide sequence set forth in SEQ ID NO:1.

[0091] In a preferred method of the invention, the P. somniferum plant is modified to be deleted or mutated in respect of one, two or three linked codeine 3-O-demethylase genes encoded by a nucleic acid molecule comprising a nucleotide sequence set forth in SEQ ID NO:37, or a nucleic acid molecule comprising a nucleotide sequence that is 95-99% identical to the nucleotide sequence set forth in SEQ ID NO:37.

[0092] In a preferred method of the invention, the P. somniferum plant is modified by deleting all or part of a nucleic acid molecule comprising or consisting of the nucleotide sequence set forth in SEQ ID NO: 35, and one, two or three linked codeine 3-O-demethylase genes are deleted or mutated.

[0093] In a preferred method of the invention, the P. somniferum plant is deleted for each codeine 3-O-demethylase gene and codeine 3-O-demethylase activity is undetectable.

[0094] The term "gene" is not limited to open reading frames, but can also extend to promoter regions and other regulatory sequences. For example, the activity of an enzyme can be undetectable due to a deleted or mutated regulatory region, resulting in the lack of gene expression and subsequent enzyme activity.

[0095] In a preferred method of the invention, the P. somniferum plant comprises a modification, which is a deletion or mutation in one or more thebaine 6-O-demethylases.

[0096] In a preferred method of the invention, the P. somniferum plant is modified to be deleted or mutated with respect to one, two, three, four, or five linked thebaine 6-O-demethylase genes encoded by a nucleic acid molecule comprising a nucleotide sequence set forth in SEQ ID NO:16, or a nucleic acid molecule comprising a nucleotide sequence that is 95-99% identical to the nucleotide sequence set forth in SEQ ID NO:16.

[0097] In a preferred method of the invention, the P. somniferum plant is modified by deleting all or part of a nucleic acid molecule comprising or consisting of the nucleotide sequence set forth in SEQ ID NO:36, and one, two, three, four, or five linked thebaine 6-O-demethylase genes are deleted or mutated.

[0098] In a preferred method of the invention, the P. somniferum plant is deleted for each thebaine 6-O-demethylase gene and 6-O-demethylase activity is undetectable.

[0099] In a preferred method of the invention, the P. somniferum plant is modified genomic modifications to one, two, or three genes encoding codeine 3-O-demethylase; comprising genomic modifications to one, two, three, four, or five genes encoding thebaine 6-O-demethylase; The expression of codeine 3-O-demethylase or the activity of codeine 3-O-demethylase is reduced or undetectable, and further, the expression of thebaine 6-O-demethylase or the activity of thebaine 6-O-demethylase is reduced or undetectable, and the modified plant has elevated levels of thebaine when compared to a wild-type P. somniferum plant and comprises a functional gene encoding codeine 3-O-demethylase and a functional gene encoding thebaine 6-O-demethylase.

[0100] According to a further aspect of the invention there is provided a modified codeine 3-O-demethylase polypeptide, the activity of which is altered.

[0101] In a preferred embodiment of the invention, the modification is to the amino acid sequence set forth in SEQ ID NO: 19, and the polypeptide is modified by the addition, deletion or substitution of at least one amino acid residue.

[0102] In a preferred embodiment of the invention, the modified codeine 3-O-demethylase polypeptide is modified at amino acid position 259.

[0103] In another embodiment of the invention, the modified codeine 3-O-demethylase polypeptide is modified at amino acid position 260.

[0104] In yet another preferred embodiment of the invention, the modified codeine 3-O-demethylase polypeptide is modified at amino acid positions 259 and 260.

[0105] In a preferred embodiment of the invention, the modified codeine 3-O-demethylase polypeptide is selected from the group consisting of SEQ ID NOs: 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or 31.

[0106] In a preferred embodiment of the invention, the modification is to the amino acid sequence set forth in SEQ ID NO: 53, and the polypeptide is modified by the addition, deletion or substitution of at least one amino acid residue.

[0107] In yet another preferred embodiment of the invention, the modified codeine 3-O-demethylase polypeptide is modified at the amino acid 3 position.

[0108] In yet another preferred embodiment of the invention, the modified codeine 3-O-demethylase polypeptide is modified at the amino acid 4 position.

[0109] In yet another preferred embodiment of the invention, the modified codeine 3-O-demethylase polypeptide is modified at the amino acid 5 position.

[0110] In yet another preferred embodiment of the invention, the modified codeine 3-O-demethylase polypeptide is modified at the amino acid 7 position.

[0111] In yet another preferred embodiment of the invention, the modified codeine 3-O-demethylase polypeptide is modified at amino acid position 259.

[0112] In yet another preferred embodiment of the invention, the modified codeine 3-O-demethylase polypeptide is modified at amino acid position 357.

[0113] In yet another preferred embodiment of the invention, the modified codeine 3-O-demethylase polypeptide is modified at amino acid position 360.

[0114] In yet another preferred embodiment of the invention, the modified codeine 3-O-demethylase polypeptide is modified at amino acid positions 3, 4, 5, 7, 259, 357, and / or 360, or a combination thereof, optionally at positions selected from the group consisting of i) 357 and 360, ii) 5 and 360, iii) 5 and 259, iv) 259 and 360, v) 5, 259, and 360, vi) 4, 259, and 360, vii) 4, 5, 259, and 360, viii) 3, 4, 5, and 7, and ix) 3, 4, 5, 7, 357, and 360.

[0115] Preferably, the modified codeine 3-O-demethylase polypeptide is modified at amino acid positions 3, 4, 5, 7, 259, 260, 357, and / or 360, or a combination thereof.

[0116] In another preferred embodiment of the invention, the modified codeine 3-O-demethylase polypeptide is selected from the group consisting of SEQ ID NOs:54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, or 68.

[0117] In a preferred embodiment of the invention, the modified codeine 3-O-demethylase polypeptide has enhanced activity when compared to the wild-type codeine 3-O-demethylase polypeptide represented by the amino acid sequence set forth in SEQ ID NO:19.

[0118] In a preferred embodiment of the invention, the enhanced codeine 3-O-demethylase activity is at least 10% higher when compared to the wild-type codeine 3-O-demethylase represented by the amino acid sequence set forth in SEQ ID NO:19.

[0119] In preferred embodiments of the invention, the enhanced codeine 3-O-demethylase activity is at least 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 60%, 70%, 80%, 90%, or 100% greater when compared to a wild-type codeine 3-O-demethylase polypeptide represented by the amino acid sequence set forth in SEQ ID NO:19.

[0120] In a preferred embodiment of the invention, the modified codeine 3-O-demethylase polypeptide is represented by the amino acid sequence set forth in SEQ ID NO:21.

[0121] In a preferred embodiment of the invention, the modified codeine 3-O-demethylase polypeptide is represented by the amino acid sequence set forth in SEQ ID NO:26.

[0122] In a preferred embodiment of the invention, the modified codeine 3-O-demethylase polypeptide is represented by an amino acid sequence selected from the group consisting of the sequences set forth in SEQ ID NOs:22, 23, 24, 25, 27, 28, 29, 30, and 31.

[0123] In a preferred embodiment of the invention, the modified codeine 3-O-demethylase polypeptide has enhanced activity when compared to the wild-type codeine 3-O-demethylase polypeptide represented by the amino acid sequence set forth in SEQ ID NO:53.

[0124] In a preferred embodiment of the invention, the enhanced codeine 3-O-demethylase activity is at least 10% higher when compared to the wild-type codeine 3-O-demethylase represented by the amino acid sequence set forth in SEQ ID NO:53.

[0125] In preferred embodiments of the invention, the enhanced codeine 3-O-demethylase activity is at least 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 60%, 70%, 80%, 90%, or 100% greater when compared to a wild-type codeine 3-O-demethylase polypeptide represented by the amino acid sequence set forth in SEQ ID NO:53.

[0126] Codeine and thebaine are substrates for the codeine 3-O-demethylase polypeptide. It is disclosed that the substrate specificity of the codeine 3-O-demethylase polypeptide for codeine and thebaine can be altered depending on the specific mutation. This can be measured by the reduction in oripavine yield compared to the yield obtained when using the wild type enzyme and compared to the morphine yield. See, for example, FIG. 5. After 4 hours, the I7M strain had an average yield of thebaine to oripavine of only 6%, compared to 47% for the WT CODM expressing strain. Meanwhile, the average yield of codeine to morphine was 32% and 47% for the I7M and WT CODM expressing strains, respectively.

[0127] In a preferred embodiment of the invention, the modified codeine 3-O-demethylase polypeptide has altered substrate specificity when compared to a wild-type codeine 3-O-demethylase polypeptide represented by the amino acid sequence set forth in SEQ ID NO:53 or 19.

[0128] In a preferred embodiment of the invention, the altered substrate specificity is manifested by an increase or decrease in the yield of oripavine compared to the wild-type yield.

[0129] In a preferred embodiment of the invention, the altered substrate specificity is manifested by an increase or decrease in the yield of morphine compared to the wild-type yield.

[0130] In preferred embodiments of the invention, SEQ ID NOs: 54, 55, 56, 60, and 61 exhibit higher substrate specificity for thebaine compared to codeine and compared to the wild type.

[0131] In preferred embodiments of the invention, SEQ ID NOs: 57, 58, 59, 62, 63, 64, 65, 66, 67, and 68 exhibit higher substrate specificity for codeine when compared to thebaine and when compared to the wild type.

[0132] In a preferred embodiment of the invention, the modified codeine 3-O-demethylase polypeptide is represented by an amino acid sequence selected from the group consisting of SEQ ID NOs:54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 67, and 68.

[0133] In a preferred embodiment of the invention, the modified codeine 3-O-demethylase polypeptide is represented by the amino acid sequence set forth in SEQ ID NO:49.

[0134] In a preferred embodiment of the invention, the modified codeine 3-O-demethylase polypeptide is represented by the amino acid sequence set forth in SEQ ID NO:55.

[0135] In a preferred embodiment of the invention, the modified codeine 3-O-demethylase polypeptide is represented by the amino acid sequence set forth in SEQ ID NO:56.

[0136] In a preferred embodiment of the invention, the modified codeine 3-O-demethylase polypeptide is represented by the amino acid sequence set forth in SEQ ID NO:57.

[0137] In a preferred embodiment of the invention, the modified codeine 3-O-demethylase polypeptide is represented by the amino acid sequence set forth in SEQ ID NO:58.

[0138] In a preferred embodiment of the invention, the modified codeine 3-O-demethylase polypeptide is represented by the amino acid sequence set forth in SEQ ID NO:59.

[0139] In a preferred embodiment of the invention, the modified codeine 3-O-demethylase polypeptide is represented by the amino acid sequence set forth in SEQ ID NO:60.

[0140] In a preferred embodiment of the invention, the modified codeine 3-O-demethylase polypeptide is represented by the amino acid sequence set forth in SEQ ID NO:61.

[0141] In a preferred embodiment of the invention, the modified codeine 3-O-demethylase polypeptide is represented by the amino acid sequence set forth in SEQ ID NO:62.

[0142] In a preferred embodiment of the invention, the modified codeine 3-O-demethylase polypeptide is represented by the amino acid sequence set forth in SEQ ID NO:65.

[0143] In a preferred embodiment of the invention, the modified codeine 3-O-demethylase polypeptide is represented by the amino acid sequence set forth in SEQ ID NO:64.

[0144] In a preferred embodiment of the invention, the modified codeine 3-O-demethylase polypeptide is represented by the amino acid sequence set forth in SEQ ID NO:68.

[0145] In a preferred embodiment of the invention, the modified codeine 3-O-demethylase polypeptide is represented by the amino acid sequence set forth in SEQ ID NO:67.

[0146] In a preferred embodiment of the invention, the modified codeine 3-O-demethylase polypeptide is represented by the amino acid sequence set forth in SEQ ID NO:66.

[0147] In a preferred embodiment of the invention, the modified codeine 3-O-demethylase polypeptide is represented by the amino acid sequence set forth in SEQ ID NO:63.

[0148] According to a further aspect of the present invention there is provided an isolated nucleic acid molecule comprising a nucleotide sequence encoding a modified codeine 3-O-demethylase polypeptide according to the present invention.

[0149] In a preferred embodiment of the invention, the nucleic acid molecule comprises a nucleotide sequence set forth in SEQ ID NO: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15, or a nucleotide sequence that is at least 90% identical to SEQ ID NO: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 and comprises a sequence that encodes a polypeptide having modified codeine 3-O-demethylase activity.

[0150] In a preferred embodiment of the invention, the nucleic acid molecule comprises a nucleotide sequence set forth in SEQ ID NO: 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, or 52, or a nucleotide sequence that is at least 90% identical to SEQ ID NO: 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, or 52 and encodes a polypeptide having modified codeine 3-O-demethylase activity.

[0151] In a preferred embodiment of the invention, the nucleic acid molecule comprises the nucleotide sequence set forth in SEQ ID NO:1, wherein the sequence is modified, said modification being to the codons for amino acid residues 259 and / or 260.

[0152] In a preferred embodiment of the invention, the nucleic acid molecule comprises the nucleotide sequence set forth in SEQ ID NO: 37, wherein the sequence is modified, and the modifications are to the codons for amino acid residues 3, 4, 5, 7, 259, 357, and / or 360.

[0153] In a preferred embodiment of the invention, the nucleic acid molecule comprises a nucleotide sequence encoding a modified codeine 3-O-demethylase as set forth in SEQ ID NO:3 or comprises a nucleotide sequence that is at least 90% identical to SEQ ID NO:3 and includes a modification to codon 260 and amino acid residue 259.

[0154] In a preferred embodiment of the invention, the nucleotide sequence comprises a nucleotide sequence encoding a modified codeine 3-O-demethylase as set forth in SEQ ID NO:8 or which is at least 90% identical to SEQ ID NO:8 and which comprises a modification to codon 260 and, optionally, amino acid residue 259.

[0155] In a preferred embodiment of the invention, the nucleic acid molecule comprises a nucleotide sequence encoding a modified codeine 3-O-demethylase selected from the group consisting of SEQ ID NOs: 2, 4, 5, 6, 7, 10, 12, 13, 14, and 15, or comprises a nucleotide sequence that is at least 90% identical to a sequence selected from the group consisting of SEQ ID NOs: 2, 4, 5, 6, 7, 10, 12, 13, 14, and 15 and includes a modification to codon 260 and amino acid residue 259.

[0156] In a preferred embodiment of the invention, the nucleic acid molecule comprises a nucleotide sequence encoding a modified codeine 3-O-demethylase selected from the group consisting of SEQ ID NOs:9 and 11, or comprises a nucleotide sequence that is at least 90% identical to a sequence selected from the group consisting of SEQ ID NOs:9 and 11 and that includes a modification to codon 259 and, optionally, amino acid residue 260.

[0157] In a preferred embodiment of the invention, the nucleotide sequence encoding a modified codeine 3-O-demethylase is selected from the group consisting of SEQ ID NOs: 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, and 52, or is at least 90% identical to a sequence selected from the group consisting of SEQ ID NOs: 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, and 52, and is ... and 360, and optionally modifications to combinations thereof selected from the group consisting of: i) 357 and 360, ii) 5 and 360, iii) 5 and 259, iv) 259 and 360, v) 5, 259, and 360, vi) 4, 259, and 360, vii) 4, 5, 259, and 360, viii) 3, 4, 5, and 7, and ix) 3, 4, 5, and 7, 357, and 360.

[0158] In a preferred embodiment of the invention, the nucleotide sequence encodes a modified codeine 3-O-demethylase polypeptide comprising the amino acid sequence set forth in SEQ ID NO:20, or a polypeptide comprising an amino acid sequence that is at least 90% identical to SEQ ID NO:20 and includes the amino acid substitution E259K.

[0159] In a preferred embodiment of the invention, the nucleotide sequence encodes a modified codeine 3-O-demethylase polypeptide comprising the amino acid sequence set forth in SEQ ID NO:21, or a polypeptide comprising an amino acid sequence that is at least 90% identical to SEQ ID NO:21 and includes the amino acid substitution E259D.

[0160] In a preferred embodiment of the invention, the nucleotide sequence encodes a modified codeine 3-O-demethylase polypeptide comprising the amino acid sequence set forth in SEQ ID NO:22, or a polypeptide comprising an amino acid sequence that is at least 90% identical to SEQ ID NO:22 and includes the amino acid substitution E259H.

[0161] In a preferred embodiment of the invention, the nucleotide sequence encodes a modified codeine 3-O-demethylase polypeptide comprising the amino acid sequence set forth in SEQ ID NO:23, or a polypeptide comprising an amino acid sequence that is at least 90% identical to SEQ ID NO:23 and includes the amino acid substitution E259Q.

[0162] In a preferred embodiment of the invention, the nucleotide sequence encodes a modified codeine 3-O-demethylase polypeptide comprising the amino acid sequence set forth in SEQ ID NO:24, or a polypeptide comprising an amino acid sequence that is at least 90% identical to SEQ ID NO:24 and includes the amino acid substitution E259A.

[0163] In a preferred embodiment of the invention, the nucleotide sequence encodes a modified codeine 3-O-demethylase polypeptide comprising the amino acid sequence set forth in SEQ ID NO:25, or a polypeptide comprising an amino acid sequence that is at least 90% identical to SEQ ID NO:25 and includes the amino acid substitution E259S.

[0164] In a preferred embodiment of the invention, the nucleotide sequence encodes a modified codeine 3-O-demethylase polypeptide comprising the amino acid sequence set forth in SEQ ID NO:26, or a polypeptide comprising an amino acid sequence that is at least 90% identical to SEQ ID NO:26 and includes the amino acid substitution E259G.

[0165] In a preferred embodiment of the invention, the nucleotide sequence encodes a modified codeine 3-O-demethylase polypeptide comprising the amino acid sequence set forth in SEQ ID NO:27, or a polypeptide comprising an amino acid sequence that is at least 90% identical to SEQ ID NO:27 and includes the amino acid substitution R260T.

[0166] In a preferred embodiment of the invention, the nucleotide sequence encodes a modified codeine 3-O-demethylase polypeptide comprising the amino acid sequence set forth in SEQ ID NO:28, or a polypeptide comprising an amino acid sequence that is at least 90% identical to SEQ ID NO:28 and includes the amino acid substitutions E259G and R260T.

[0167] In a preferred embodiment of the invention, the nucleotide sequence encodes a modified codeine 3-O-demethylase polypeptide comprising the amino acid sequence set forth in SEQ ID NO:29, or a polypeptide comprising an amino acid sequence that is at least 90% identical to SEQ ID NO:29 and includes the amino acid substitution R260K.

[0168] In a preferred embodiment of the invention, the nucleotide sequence encodes a modified codeine 3-O-demethylase polypeptide comprising the amino acid sequence set forth in SEQ ID NO:30, or a polypeptide comprising an amino acid sequence that is at least 90% identical to SEQ ID NO:30 and includes the amino acid substitutions E259D and R260K.

[0169] In a preferred embodiment of the invention, the nucleotide sequence encodes a modified codeine 3-O-demethylase polypeptide comprising the amino acid sequence set forth in SEQ ID NO:31, or a polypeptide comprising an amino acid sequence that is at least 90% identical to SEQ ID NO:31 and includes the amino acid substitutions E259G and R260K.

[0170] In a preferred embodiment of the invention, the nucleotide sequence encodes a modified codeine 3-O-demethylase polypeptide comprising the amino acid sequence set forth in SEQ ID NO:54, or a polypeptide comprising an amino acid sequence that is at least 90% identical to SEQ ID NO:54 and includes the amino acid substitutions T3K, P4A, I5K, and I7M.

[0171] In a preferred embodiment of the invention, the nucleotide sequence encodes a modified codeine 3-O-demethylase polypeptide comprising the amino acid sequence set forth in SEQ ID NO:55, or a polypeptide comprising an amino acid sequence that is at least 90% identical to SEQ ID NO:55 and includes the amino acid substitutions Y357S and M360I.

[0172] In a preferred embodiment of the invention, the nucleotide sequence encodes a modified codeine 3-O-demethylase polypeptide comprising the amino acid sequence set forth in SEQ ID NO:56, or a polypeptide comprising an amino acid sequence that is at least 90% identical to SEQ ID NO:56 and includes the amino acid substitutions T3K, P4A, I5K, I7M, Y357S, and M360I.

[0173] In a preferred embodiment of the invention, the nucleotide sequence encodes a modified codeine 3-O-demethylase polypeptide comprising the amino acid sequence set forth in SEQ ID NO:57, or a polypeptide comprising an amino acid sequence that is at least 90% identical to SEQ ID NO:57 and includes the amino acid substitution T3K.

[0174] In a preferred embodiment of the invention, the nucleotide sequence encodes a modified codeine 3-O-demethylase polypeptide comprising the amino acid sequence set forth in SEQ ID NO:58, or a polypeptide comprising an amino acid sequence that is at least 90% identical to SEQ ID NO:58 and includes the amino acid substitution P4A.

[0175] In a preferred embodiment of the invention, the nucleotide sequence encodes a modified codeine 3-O-demethylase polypeptide comprising the amino acid sequence set forth in SEQ ID NO:59, or a polypeptide comprising an amino acid sequence that is at least 90% identical to SEQ ID NO:59 and comprises the amino acid substitution I5K.

[0176] In a preferred embodiment of the invention, the nucleotide sequence encodes a modified codeine 3-O-demethylase polypeptide comprising the amino acid sequence set forth in SEQ ID NO:60, or a polypeptide comprising an amino acid sequence that is at least 90% identical to SEQ ID NO:60 and includes the amino acid substitution I7M.

[0177] In a preferred embodiment of the invention, the nucleotide sequence encodes a modified codeine 3-O-demethylase polypeptide comprising the amino acid sequence set forth in SEQ ID NO:61, or a polypeptide comprising an amino acid sequence that is at least 90% identical to SEQ ID NO:61 and includes the amino acid substitution Y357S.

[0178] In a preferred embodiment of the invention, the nucleotide sequence encodes a modified codeine 3-O-demethylase polypeptide comprising the amino acid sequence set forth in SEQ ID NO:62, or a polypeptide comprising an amino acid sequence that is at least 90% identical to SEQ ID NO:62 and includes the amino acid substitution M360I.

[0179] In a preferred embodiment of the invention, the nucleotide sequence encodes a modified codeine 3-O-demethylase polypeptide comprising the amino acid sequence set forth in SEQ ID NO:63, or a polypeptide comprising an amino acid sequence that is at least 90% identical to SEQ ID NO:63 and comprises the amino acid substitutions I5K and M360I.

[0180] In a preferred embodiment of the invention, the nucleotide sequence encodes a modified codeine 3-O-demethylase polypeptide comprising the amino acid sequence set forth in SEQ ID NO:64, or a polypeptide comprising an amino acid sequence that is at least 90% identical to SEQ ID NO:64 and comprises the amino acid substitutions I5K and E259G.

[0181] In a preferred embodiment of the invention, the nucleotide sequence encodes a modified codeine 3-O-demethylase polypeptide comprising the amino acid sequence set forth in SEQ ID NO:65, or a polypeptide comprising an amino acid sequence that is at least 90% identical to SEQ ID NO:65 and includes the amino acid substitutions E259G and M360I.

[0182] In a preferred embodiment of the invention, the nucleotide sequence encodes a modified codeine 3-O-demethylase polypeptide comprising the amino acid sequence set forth in SEQ ID NO:66, or a polypeptide comprising an amino acid sequence that is at least 90% identical to SEQ ID NO:66 and includes the amino acid substitutions I5K, E259G, and M360I.

[0183] In a preferred embodiment of the invention, the nucleotide sequence encodes a modified codeine 3-O-demethylase polypeptide comprising the amino acid sequence set forth in SEQ ID NO:67, or a polypeptide comprising an amino acid sequence that is at least 90% identical to SEQ ID NO:67 and includes the amino acid substitutions P4A, E259G, and M360I.

[0184] In a preferred embodiment of the invention, the nucleotide sequence encodes a modified codeine 3-O-demethylase polypeptide comprising the amino acid sequence set forth in SEQ ID NO:68, or a polypeptide comprising an amino acid sequence that is at least 90% identical to SEQ ID NO:68 and includes the amino acid substitutions P4A, I5K, E259G, and M360I.

[0185] In a preferred embodiment of the invention, the nucleic acid molecule comprises a nucleotide sequence, which is degenerate due to the genetic code and which encodes a modified codeine 3-O-demethylase polypeptide according to the invention.

[0186] According to a further aspect of the invention there is provided an expression vector comprising a nucleic acid molecule according to the invention.

[0187] In a preferred embodiment of the invention, the expression vector comprises a promoter operably linked to the nucleic acid molecule.

[0188] In a preferred embodiment of the invention, the promoter is a constitutive promoter.

[0189] In an alternative preferred embodiment of the invention, the promoter is regulatable.

[0190] Preferably, the promoter is inducible to provide for inducible expression of an operably linked nucleic acid.

[0191] Preferably, the expression vector is adapted for expression in a microbial host cell.

[0192] According to an aspect of the invention there is provided a cell transformed with a nucleic acid molecule or vector according to the invention.

[0193] In a preferred embodiment of the invention, the host cell is a eukaryotic cell.

[0194] In a preferred embodiment of the invention, the eukaryotic cell is a plant cell, such as a Papaver species plant cell, such as P. somniferum.

[0195] In a preferred embodiment of the invention, the eukaryotic cell is a microbial cell, such as a Saccharomyces cerevisiae cell or a Pichia pastoris cell.

[0196] In another preferred embodiment of the invention, the host cell is a prokaryotic cell.

[0197] In yet another preferred embodiment of the invention, the prokaryotic cell is a bacterial cell, for example an Escherichia coli cell.

[0198] According to a further aspect of the invention there is provided a cell culture comprising a cell according to the invention.

[0199] According to a further aspect of the invention there is provided a fermenter comprising a cell culture according to the invention.

[0200] According to a further aspect of the invention there is provided a process for the biotransformation of a first opiate or opioid alkaloid to a second opiate or opioid alkaloid comprising: forming a preparation comprising a modified codeine 3-O-demethylase polypeptide according to the invention and a crude poppy extract or a purified or semi-purified source of a selected opiate or opioid alkaloid; incubating the preparation to allow for conversion of one or more opiates or opioid alkaloids; and, optionally, and extracting the one or more converted opiates or opioid alkaloids from the preparation.

[0201] In a preferred method of the invention, the modified codeine 3-O-demethylase polypeptide is expressed by a cell according to the invention.

[0202] In a preferred method of the invention, the first opiate alkaloid is a naturally occurring opiate alkaloid.

[0203] In another method of the invention, the first opiate alkaloid is a semi-synthetic opioid alkaloid.

[0204] In a preferred method of the invention, the first opiate alkaloid is thebaine and the second opiate alkaloid is oripavine.

[0205] In another preferred method of the invention, the first opiate alkaloid is codeine and the second opiate alkaloid is morphine.

[0206] In yet another method of the invention, the first opiate alkaloid is codeinone and the second opiate alkaloid is morphinone.

[0207] In yet another method of the invention, the first semi-synthetic opioid alkaloid is oxycodone and the second semi-synthetic opioid alkaloid is oxymorphone.

[0208] In yet another method of the invention, the first semi-synthetic opioid alkaloid is hydrocodone and the second semi-synthetic opioid alkaloid is hydromorphone.

[0209] In yet another method of the invention, the first semi-synthetic opioid alkaloid is dihydrocodeine and the second semi-synthetic opioid alkaloid is dihydromorphine.

[0210] In yet another method of the present invention, the first semi-synthetic opioid alkaloid is 14-hydroxycodeine and the second semi-synthetic opioid alkaloid is 14-hydroxymorphine.

[0211] In yet another method of the invention, the first semi-synthetic opioid alkaloid is noroxycodone and the second semi-synthetic opioid alkaloid is noroxymorphone.

[0212] In yet another method of the invention, the first semi-synthetic opioid alkaloid is noroxycodeinone and the second semi-synthetic opioid alkaloid is noroxymorphinone.

[0213] In yet another method of the present invention, the first semi-synthetic opioid alkaloid is 14-hydroxynorcodeinone and the second semi-synthetic opioid alkaloid is 14-hydroxynormorphinone.

[0214] In yet another method of the present invention, the first semi-synthetic opioid alkaloid is 14-hydroxycodeinone and the second semi-synthetic opioid alkaloid is 14-hydroxymorphinone.

[0215] In yet another method of the present invention, the first semi-synthetic opioid alkaloid is a buprenorphine intermediate (N-cyclopropylmethyl-7α-(2-hydroxy-3,3-dimethyl-2-butyl)-6,14-endoethano-6,7,8,14-tetrahydronorthebaine) and the second semi-synthetic opioid alkaloid is buprenorphine ((2S)-2-[17-(cyclopropylmethyl)-4,5α-epoxy-3-hydroxy-6-methoxy-6α,14-ethano-14α-morphinan-7α-γl]-3,3-dimethylbutan-2-ol).

[0216] In yet another method of the present invention, the first semi-synthetic opioid alkaloid is a buprenorphine intermediate (7-acetyl-6,14-endoetheno-6,7,8,14-tetrahydrothebaine) and the second semi-synthetic opioid alkaloid is an etorphine intermediate.

[0217] Further examples of semi-synthetic opiate alkaloids are disclosed in US2019 / 0144900, which is incorporated by reference in its entirety.

[0218] Throughout the description and claims of this specification, "comprise" and "contain" and variations of these words, such as "comprising" and "comprises," mean "includes," "including but not limited to," and are not intended to (and do not) exclude other moieties, additives, components, integers, or steps. "Consisting essentially of" means having the requisite integer, but including integers that do not materially affect the function of the requisite integer.

[0219] Throughout the description and claims of this specification, the singular encompasses the plural unless the context requires otherwise. In particular, where the indefinite article is used, the specification should be understood as contemplating plural singularity unless the context requires otherwise.

[0220] It is to be understood that any feature, integer, characteristic, compound, chemical moiety, or group described in conjunction with a particular aspect, embodiment, or example of the invention applies to any other aspect, embodiment, or example described herein, unless inconsistent.

[0221] Embodiments of the invention will now be described, by way of example only, with reference to the following figures and tables: [Brief description of the drawings]

[0222] [Figure 1]Thebaine to morphine conversion pathway in Papaver somniferum; [Diagram 2] A) Yields of oripavine and morphine produced by CODM mutant expression compared to the yields obtained with wild-type (WT) CODM. Biotransformation was carried out for 4 h for oripavine and 30 min for morphine using strains expressing CODM mutants with different amino acids at position 259 or WT CODM. Data are the mean ± standard deviation of three independent replicates. B) Representative SDS-PAGE images of WT CODM and CODM mutant expression. Values ​​indicate relative expression to WT CODM as determined by densiometric analysis, data are the mean ± standard deviation of three independent replicates; [Diagram 3] A) Yields of oripavine and morphine produced by CODM mutant expression compared to the yields obtained with wild-type (WT) CODM. Biotransformation was carried out for 4 h for oripavine and 30 min for morphine using strains expressing CODM mutants with different amino acids at positions 259, 260, or both 259 and 260, or WT CODM. Data are the mean ± standard deviation of three independent replicates. B) Representative SDS-PAGE images of WT CODM and CODM mutant expression. Values ​​indicate relative expression to WT CODM as determined by densiometric analysis, data are the mean ± standard deviation of three independent replicates; [Figure 4] Production of oripavine as a function of biotransformation proceeds using pure thebaine or thebaine crude extract as substrate and cells expressing wild-type CODM. Data are the mean ± standard deviation of two independent replicates. [Diagram 5]A) Yields of oripavine and morphine produced by CODM mutant expression compared to yields obtained with wild-type (WT) CODM. Biotransformation was performed using strains expressing CODM mutants with single amino acid residue changes (T3K, P4A, I5K, I7M, Y357S, or M360I), or mutations at multiple sites; 1) T3K+P4A+I5K+I7M, 2) Y357S+M360I, and 3) T3K+P4A+I5K+I7M+Y357S+M360I, or WT CODM. Yields of oripavine were assayed 4 h and morphine 30 min later. Data are the mean ± standard deviation of three independent replicates. B) Representative SDS-PAGE images of WT CODM and CODM mutant protein expression. Values ​​indicate relative expression to WT CODM as determined by densiometric analysis, data are the mean ± standard deviation of three independent replicates. [Figure 6] A) Yields of oripavine and morphine produced by CODM mutant expression compared to yields obtained with wild-type (WT) CODM. Biotransformation was performed using strains expressing CODM mutants with combinations of P4A, I5K, E259G, and M360I mutations, or I5K single mutations, or WT CODM. Oripavine yields were assayed 4 h and morphine 30 min later. Data are the mean ± standard deviation of three independent replicates. B) Representative SDS-PAGE images of WT CODM and CODM mutant protein expression. Values ​​indicate relative expression to WT CODM as determined by densiometric analysis, data are the mean ± standard deviation of three independent replicates. [Figure 7]A) Yield of oripavine produced as a function of time during biotransformation by cells expressing CODM with either a single I5K mutation, a single M360I mutation, double I5K+M360I mutations, or wild-type (WT) CODM. Oripavine was assayed every hour for 9 hours and then every 3 hours until 24 hours had elapsed. B) Yield of morphine produced as a function of time during biotransformation by cells expressing CODM with either a single I5K mutation, a single M360I mutation, double I5K+M360I mutation, or wild-type (WT) CODM. Morphine was assayed every 15 minutes until 2 hours had elapsed. Data are the mean ± standard deviation of three independent replicates.

[0223] Materials and Methods Chemicals and Reagents Antibiotics, analytical grade glycerol, isopropyl β-D-1-thiogalactopyranoside (IPTG), sodium chloride, sodium ascorbate, glucose, ferrous sulfate heptahydrate, HPLC grade acetonitrile, methanol, trifluoroacetic acid (TFA), dichloromethane (DCM), and acetic acid were purchased from Merck (USA). Restriction enzymes, Phusion High Fidelity DNA Polymerase, NEBuilder HiFi DNA Assembly, E. coli 5-alpha competent cells, and E. coli BL21(DE3) competent cells (E. coli B strain derivative) were purchased from New England BioLabs Inc., USA. Yeast extract and tryptone for medium preparation were purchased from Oxiod, Thermo Scientific, UK. Water used in all experiments was purified to a resistivity of 18.2 MΩ.cm or higher. Thebaine, oripavine, codeine, and morphine were obtained from Sun Pharmaceutical Industries Australia Pty Ltd.

[0224] Plasmids and staining The plasmids used in this study are listed in Table 1, and the primers and synthetic sequences are listed in Tables 2 and 3. The synthetic gBlock sequences were codon-optimized for expression in E. coli B strain and ordered from Integrated DNA Technologies (IDT, USA). Sufficient vector homology (approximately 20 bp) was engineered into the gBlocks for assembly by NEBuilder HiFi DNA Assembly to speed up the generation of the constructs. The T7 polymerase expression vector pET24b-6H-MBP (Merck, USA) was used to control the expression of the genes of interest. Each open reading frame (ORF) was fused at the N-terminus to a six histidine tag (6H) and maltose binding protein (MBP). In addition, the ORFs were under the transcriptional control of the T7 promoter and T7 terminator. E. coli 5-alpha competent cells were used for cloning and maintenance of plasmids, and E. coli BL21(DE3) competent cells were used for biotransformation and protein expression. The constructed constructs were verified by sequencing (Australian Genome Research Facility, Australia) using primers UM13 / UM03 (see Table 2).

[0225] The E. coli codon usage-adapted CODM (UniProtKB:D4N502) (herein referred to as WT CODM for ease of comparison) expression plasmid pGWKS100 was generated by incorporating the 1.1 kb CODM gBlock (UMg4) into a pET24b-6H-MBP backbone linearized with BamHI and XhoI using NEBuilder.

[0226] Several expression vectors (pGWKS101, 119-126, see Table 1) were generated using the same procedure, where the wild type residues were replaced with the appropriate residues by PCR amplification (see Table 2) and then cloned into the linearized pET24b-6H-MBP expression vector using NEBuilder. For example, to construct the expression vector pGWKS101 for the endogenous CODM E259K variant (NCBI reference sequence: XP_026416234.1), the glutamic acid (E) residue present in the CODM WT isoform was replaced with a lysine (K) residue by PCR amplification (UM15 / UM05 and UM06 / UM18) and the two fragments were incorporated into the linearized pET24b-6H-MBP via NEBuilder.

[0227] The remaining expression vectors (pGWSK127–129, 131–146) (see Table 1 ) were generated by incorporating the respective 1.1 kb ORF gBlock(UMg8-26) (see Table 3 ) into the linearized pET24b-6H-MBP backbone using NEBuilder.

[0228] Cell culture and protein expression Cells were grown overnight at 37 °C in lysogeny culture medium (0.5% yeast extract, 1% tryptone, and 1% NaCl) supplemented with kanamycin (50 μg / mL). 1 mL of overnight cell culture was inoculated into an Erlenmeyer flask containing 50 mL of 2-YT medium (1% yeast extract, 1.6% tryptone, and 0.5% NaCl) supplemented with kanamycin (50 μg / mL) and 1 mL of glycerol. Protein expression was induced by IPTG addition (0.1 mM) when the OD600 (optical density measured at 600 nm) reached 0.4-0.8 and continued for 22 h at 18 °C. After protein expression, cell pellets were collected by centrifugation at 3,000 g for 15 min and resuspended in 15% glycerol until the OD600 reached 100 for biotransformation.

[0229] Whole cell biotransformation Biotransformations were performed in 20 mL volumes and consisted of the indicated alkaloids (1 mM thebaine, 1 mM codeine, or crude poppy extract of thebaine), 100 mM phosphate buffer (pH 6.0), 0.5% w / w glucose, 10 μM iron(II) sulfate (FeSO4), and 10 mM sodium ascorbate, and 10 OD600 of E. coli cells. Reactions were performed at 24°C with shaking at 220 rpm. Samples were taken periodically at different time intervals. The collected samples were centrifuged at 16,000 g for 7 min, and the supernatants were analyzed by liquid chromatography-mass spectrometry for alkaloid quantification. Three independent replicates were performed for CODM mutant biotransformation and two for thebaine crude extract biotransformation.

[0230] Protein expression analysis The soluble protein produced by protein expression was determined by SDS-PAGE analysis using the BugBuster™ protocol provided by the manufacturer. Briefly, the soluble protein fraction was released from frozen cell pellets with an OD600 of 1 by resuspension in BugBuster™ Protein Extraction Reagent containing Benzonase (25 units / mL BugBuster™ Reagent) (Merck, Germany). Insoluble cell debris and soluble protein-containing supernatant were then separated by centrifugation at 16,000g for 20 minutes and 4°C. The soluble protein fraction was run on precast Bolt 8% Bis-Tris Plus Gels (ThermoFisher Scientific, USA) in MOPS running buffer at 120V for 60 minutes. Protein size was estimated using Precision Plus protein™ Kaleidoscope™ Prestained Protein Standard (Bio-Rad Laboratories, USA). Band intensities (with low background intensity and normalized to the 75 kDa molecular weight band) were calculated using Image Lab software (Bio-Rad Laboratories, USA).Soluble protein expression was determined for each independent replicate of the CODM mutation assay.

[0231] Preparation of crude poppy extract Optimization of extraction methods can be found in the textbook "Natural Product Extraction, Principles and Applications" edited by M Rostagno and J Prado, RSC Publishing (2013), ISBN 978 1 84973 606 0. Extracts are prepared by those knowledgeable in the technical field of natural product extraction, and may include aqueous and / or hydrocarbon-based liquid systems at temperatures between 0°C and 100°C, with the pH adjusted (pH 2 to pH 14) using appropriate acidic or alkaline reagents.

[0232] LC-MS analysis of alkaloids Quantification of alkaloids was performed using a Shimadzu LCMS-2020 liquid chromatograph mass spectrometer. Analysis was performed on an Onyx Monolithic C18 column (100 × 4.6 mm, Phenomenex Australia Pty Ltd) with a linear gradient of 0–20% buffer B, increasing from 1 mL / min to 2.5 mL / min over 10 min at 28 °C in a flow rate of 1 mL / min [Buffer A: 0.1% TFA in water, Buffer B: 0.1% TFA in acetonitrile]. The detector wavelength was set at 285 nm and the reference wavelength was set at 360 nm. Alkaloid compounds in the biotransformation samples were identified by comparison to alkaloid standards, with reference to both retention time [morphine 4.3 min, codeine 6.9 min, oripavine 7.5 min, and thebaine 10.1 min] and mass-to-charge ratio (m / z) [morphine 286, codeine 300, oripavine 298, and thebaine 312]. The concentration of alkaloids in each sample was quantified by integrating the peak area of ​​each compound with reference to the peak area of ​​an alkaloid standard series with concentrations ranging from 25 μg / mL to 500 μg / mL, using Shimadzu LabSolutions software. For analysis, samples were injected into the LC-MS with an injection volume of 5 μL.

[0233] Example 1 The suitability of thebaine crude poppy extract as a biotransformation substrate compared to pure thebaine was evaluated over a 24-h period. Two concentrations of thebaine crude extract were assayed, corresponding to 0.2 g / L thebaine and 0.5 g / L thebaine. The crude extract was added to the reaction mixture in place of pure thebaine, while all other components were kept constant. As can be seen in Figure 4, thebaine crude extract is able to replace pure thebaine with minimal changes in the progress of the reaction. Furthermore, several concentrations of thebaine crude extract can be used as a biotransformation substrate to produce higher concentrations of oripavine.

[0234] Example 2 Seven strains were generated that contained mutations at the 259th amino acid residue of CODM (E259K, -D, -H, -Q, -A, -S, and -G), and two strains were generated that contained mutations at the 260th residue of CODM (R260T and -K). Three double mutant strains were generated that contained mutations at both the 259th and 260th residues of CODM (E259G+R260T, E259D+R260K, and E259G+R260K). The performance of the CODM mutant strains was assessed via biotransformation, as shown in Figures 2-3, with morphine yields assayed after 30 min and oripavine yields assayed after 4 h. Expression of soluble protein under these conditions was assayed by SDS-PAGE analysis, as shown in Figures 2-3.

[0235] Of the seven 259 residue mutants investigated, only the E259D and E259G mutants showed improved product yields, with morphine and oripavine yields improved by about 30% and 24%, respectively, and about 38% and 27%, respectively, compared to wild-type (WT) CODM. Furthermore, these mutations appeared to improve soluble protein expression, with about 2.1-fold more soluble E259D and about 1.5-fold more soluble E259G produced compared to WT CODM. In comparison, biotransformation with the E259K, -H, -Q, -A, and -S CODM mutants results in at least a 20% reduction in product yield compared to WT CODM, consistent with reduced expression of soluble protein expression, as shown in Figures 2-3.

[0236] The R260T expressing strain produced approximately 28% less morphine, approximately 29% less oripavine, and approximately 63% less soluble protein than the WT CODM, see Figure 3. In comparison, the R260K expressing strain produced similar levels of both products as the WT CODM strain, and produced similar amounts of soluble protein as the WT CODM strain, see Figure 3.

[0237] Incorporation of the E259G mutation restored the performance of the R260T mutation in the E259G+R260T double mutant strain and produced similar levels of conversion to the WT CODM strain (Figure 3). In comparison, the performance of the E259D+R260K and E259G+R260K double mutant strains was improved compared to the WT CODM staining, with comparable performance and protein expression levels to the E259D and E259G single mutant strains (Figure 3).

[0238] Example 3 Six strains were generated containing single amino acid mutations at either the 3rd, 4th, 5th, 7th, 357th, or 360th residues of WT CODM: T3K, P4A, I5K, I7M, Y357S, or M360I. Three additional strains were generated using the following combinations of mutations: 1) T3K+P4A+I5K+I7M, 2) Y357S+M360I, and 3) T3K+P4A+I5K+I7M+Y357S+M360I. The performance of the CODM mutant strains was assessed via biotransformation, as shown in Figure 5A, with morphine yields assayed after 30 min and oripavine yields assayed after 4 h. Expression of soluble protein under these conditions was assayed by SDS-PAGE analysis, as shown in Figure 5B.

[0239] Of the six single mutant strains investigated, both the I5K and M360I strains showed improved product yields, with morphine yields improved by 58% and 29%, respectively, and oripavine yields improved by 79% and 33%, respectively, compared to the WT CODM strain (Figure 5A). The I5K mutation appeared to improve soluble protein expression by 2.9-fold over WT CODM, while only minor changes in protein expression were observed in the M360I strain compared to WT CODM (Figure 5B).

[0240] Four other single mutants (T3K, P4A, I7M, or Y357S) resulted in either a slight improvement in product yield (e.g., T3K or P4A) or a reduction in product yield of at least about 22% (e.g., I7M or Y357S) compared to the WT CODM strain, consistent with slight changes in the levels of protein expression (e.g., T3K, P4A, Y357S, or I7M) (Figure 5B).

[0241] All three strains containing mutant combinations had lower biotransformation yields for at least one of the two desired products compared to the WT CODM strain, consistent with increased protein expression levels in all three strains, most notably in the T3K+P4A+I5K+I7K (~3.2-fold) and T3K+P4A+I5K+I7M+Y357S+M360I (~4-fold) strains.

[0242] Example 4 Six additional strains containing various combinations of the P4A, I5K, E259G, and M360 mutations were generated to assess the effect of these beneficial mutations on the yield and level of soluble protein expression of the modified CODM enzyme. In this case, morphine production was measured after 15 minutes (compared to 30 minutes in Example 3) and oripavine was measured after 2 hours (compared to 4 hours in Example 3), as shown in Figure 6A. This was due to an accelerated reaction rate for these mutants.

[0243] All six strains demonstrated improved yields relative to the production of both morphine and oripavine by biotransformation, as well as the levels of soluble protein expression detected compared to WT CODM (Figures 6A and B). The strain containing both I5K+M360I mutations produced the highest yields of all mutant strains, with a 2.3-fold increase in morphine yield and a 2.76-fold increase in oripavine yield compared to the WT CODM strain (Figure 6A), and a ∼5.5-fold increase in soluble protein compared to WT CODM (Figure 6B).

[0244] Example 5 The performance of strains containing the single mutations I5K or M360I, or the double mutation I5K+M360I, was compared to WT CODM over the entire time course of thebaine or codeine demethylation. Oripavine was assayed every hour for the first 9 hours, then every 3 hours until 24 hours had elapsed. The faster codeine demethylation was assessed by measuring morphine every 15 minutes for 2 hours.

[0245] The strain containing the I5K+M360I double mutation carried out the fastest biotransformation with thebaine as substrate, reaching approximately 95% yield of thebaine relative to oripavine after approximately 5 h (Figure 7A). Strains with single mutations also performed faster than the strain with WT CODM. Biotransformation reactions approached complete conversion for all three mutant strains at least 12 h before the WT CODM strain.

[0246] Two strains showed similar fast biotransformation rates with codeine as substrate, including the single mutant I5K or the double mutant I5K+M360I, achieving about 94% yield of morphine after 1 h, faster than the WT CODM control (Figure 7B). The single mutant M360I was faster than the WT CODM control, but not as fast as the other two mutant strains. All three mutants achieved nearly complete conversion at 2 h.

[0247] All strains were generated with pET24b-6H-MBP. [Table 1]

[0248] pGWKS134 encodes a protein identical to the WT CODM enzyme in the pGWKS100 plasmid, differing only in codon usage at codons 2 (GAG→GAA), 6 (TTG→CTG), and 118 (CGC→CGT). pGWKS127-129 and pGWKS135-145 contain equivalent codon usage as pGWKS134, and the pGWKS134 strain was used as the control WT CODM in these assays. This control was used for the experiments described in Examples 4-6, but not Examples 1-3, which used the pGWKS100 strain as the control WT CODM. [Table 2]

[0249] The "Δ" primers are universal, so the upper primer (UM15) and the lower primer (UM18) were used for all amplifications of fragments 1 and 2, respectively.

[0250] The R260K, E259D+R260K, and E259G+R260K expression plasmids were generated using synthetic sequences rather than via PCR mutagenesis, see Materials and Methods section.

[0251] The synthetic sequence used for cloning is designated UMgX, was ordered from IDT, and is codon-optimized for expression in E. coli B strain. homology region CCTGAAAGACGGCGCAGACTGGATCC and CTCGAGCACCACCACCACCACCACTGAGATCCGGCTGCTA

[0252] and other similar sequences are included upstream and downstream, respectively, of each synthetic sequence to facilitate NEBuilder assembly and are optional with respect to the nucleic acid molecule encoding a protein according to the invention. [Table 3] TIFF2024507282000005.tif235154TIFF2024507282000006.tif235155TIFF2024507282000007.tif236155TIFF2024507282000008.tif235157TIFF2024507282000009.tif235155TIFF2024507282000010.tif236155TIFF2024507282000011.tif235154TIFF2024507282000012.tif236153TIFF2024507282000013.tif235155TIFF2024507282000014.tif236154TIFF2024507282000015.tif235153TIFF2024507282000016.tif235155TIFF2024507282000017.tif233156TIFF2024507282000018.tif235154TIFF2024507282000019.tif235154TIFF2024507282000020.tif235153TIFF2024507282000021.tif230153TIFF2024507282000022.tif231154TIFF2024507282000023.tif132154

Claims

1. 1. A method for the biotransformation of one or more opiate alkaloids or synthetic opioid alkaloids or derivatives thereof, comprising: forming a preparation comprising a host cell transformed with one or more nucleic acid molecules encoding one or more polypeptides capable of catalyzing at least one reaction in the conversion of one or more opiate alkaloids or synthetic opioid alkaloids or derivatives thereof to one or more different opiate alkaloids or semi-synthetic opioid alkaloids or derivatives thereof; incubating the reaction to allow for conversion of one or more opiate alkaloids or semi-synthetic opioid alkaloids or derivatives thereof; and optionally and extracting said one or more converted different opiate alkaloids or semi-synthetic opioid alkaloids or derivatives thereof from said preparation.

2. The nucleic acid molecule i) a nucleotide sequence as set forth in SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15; ii) a nucleotide sequence, said sequence being degenerate as a result of the genetic code for said nucleotide sequence defined in (i); iii) a nucleic acid molecule comprising a nucleotide sequence of a complementary strand that hybridizes under stringent hybridization conditions to the sequence set forth in SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15, wherein the nucleic acid molecule encodes codeine 3-O-demethylase; iv) a nucleotide sequence encoding a polypeptide comprising the amino acid sequence represented by SEQ ID NO: 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or 31; v) a nucleotide sequence encoding a polypeptide comprising an amino acid sequence modified by addition, deletion or substitution of at least one amino acid residue as depicted in iv) above, and having codeine 3-O-demethylase activity.

3. 3. The method of claim 1 or 2, wherein the nucleotide sequence encoding the codeine 3-O-demethylase polypeptide comprises a nucleotide sequence set forth in SEQ ID NO:3 or which is at least 90% identical to SEQ ID NO:3, or wherein the nucleotide sequence encoding the codeine 3-O-demethylase polypeptide comprises a nucleotide sequence set forth in SEQ ID NO:8 or which is at least 90% identical to SEQ ID NO:

8.

4. 4. The method of any one of claims 1 to 3, wherein the polypeptide comprises a polypeptide comprising the amino acid sequence set forth in SEQ ID NO:21, or an amino acid sequence that is at least 90% identical to SEQ ID NO:21 and comprises the amino acid substitution E259D, or wherein the polypeptide comprises a polypeptide comprising the amino acid sequence set forth in SEQ ID NO:26, or an amino acid sequence that is at least 90% identical to SEQ ID NO:26 and comprises the amino acid substitution E259G.

5. The nucleic acid molecule i) a nucleotide sequence as set forth in SEQ ID NO: 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, or 52; ii) a nucleotide sequence, said sequence being degenerate as a result of the genetic code for said nucleotide sequence defined in (i); iii) a nucleic acid molecule comprising a nucleotide sequence of a complementary strand that hybridizes under stringent hybridization conditions to the sequence of SEQ ID NO: 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, or 52, wherein the nucleic acid molecule encodes codeine 3-O-demethylase; iv) a nucleotide sequence encoding a polypeptide comprising an amino acid sequence represented by SEQ ID NO: 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, or 68; v) a nucleotide sequence encoding a polypeptide comprising an amino acid sequence, said amino acid sequence being modified by addition, deletion or substitution of at least one amino acid residue as depicted in iv) above, and having codeine 3-O-demethylase activity. and / or the nucleotide sequence encoding a codeine 3-O-demethylase polypeptide is a) a sequence comprising SEQ ID NO:63, or an amino acid sequence which is at least 90% identical to SEQ ID NO:63; b) a sequence comprising SEQ ID NO:59, or an amino acid sequence which is at least 90% identical to SEQ ID NO:59; c) a sequence comprising SEQ ID NO:68, or an amino acid sequence which is at least 90% identical to SEQ ID NO:68; d) a sequence comprising SEQ ID NO:67, or an amino acid sequence that is at least 90% identical to SEQ ID NO:67; and e) SEQ ID NO: 66, or a sequence comprising an amino acid sequence that is at least 90% identical to SEQ ID NO: 66 and / or The polypeptide, a) a polypeptide comprising the amino acid sequence set forth in SEQ ID NO:63, or an amino acid sequence which is at least 90% identical to SEQ ID NO:63 and which comprises the amino acid substitutions I5K and M360I; b) a polypeptide comprising the amino acid sequence set forth in SEQ ID NO:59, or an amino acid sequence that is at least 90% identical to SEQ ID NO:59 and comprises the amino acid substitution I5K; c) a polypeptide comprising an amino acid sequence as set forth in SEQ ID NO:68, or an amino acid sequence that is at least 90% identical to SEQ ID NO:68 and comprises the amino acid substitutions P4A, I5K, E259G, and M360I; d) a polypeptide comprising the amino acid sequence set forth in SEQ ID NO:67, or an amino acid sequence that is at least 90% identical to SEQ ID NO:67 and comprises the amino acid substitutions P4A, E259G, and M360I; and e) a polypeptide comprising the amino acid sequence set forth in SEQ ID NO:66, or an amino acid sequence that is at least 90% identical to SEQ ID NO:66 and comprises the amino acid substitutions I5K, E259G, and M360I. The amino acid sequence is selected from the group consisting of The method according to any one of claims 1 to 4.

6. The nucleic acid molecule a) i) the nucleotide sequence set forth in SEQ ID NO: 16; ii) a nucleotide sequence, said sequence being degenerate as a result of the genetic code for said nucleotide sequence defined in (i); iii) a nucleic acid molecule comprising a nucleotide sequence of a complementary strand that hybridizes under stringent hybridization conditions to the sequence of SEQ ID NO: 16, said nucleic acid molecule encoding thebaine 6-O-demethylase; iv) a nucleotide sequence encoding a polypeptide comprising the amino acid sequence represented by SEQ ID NO:32; v) a nucleotide sequence encoding a polypeptide comprising an amino acid sequence, said amino acid sequence being modified by addition, deletion or substitution of at least one amino acid residue as represented in iv) above, and having thebaine 6-O-demethylase activity; b) i) the nucleotide sequence set forth in SEQ ID NO: 18; ii) a nucleotide sequence, said sequence being degenerate as a result of the genetic code for said nucleotide sequence defined in (i); iii) a nucleic acid molecule comprising a nucleotide sequence of a complementary strand that hybridizes under stringent hybridization conditions to the sequence of SEQ ID NO: 18, said nucleic acid molecule encoding codeinone reductase; iv) a nucleotide sequence encoding a polypeptide comprising the amino acid sequence represented by SEQ ID NO:34; v) a nucleotide sequence encoding a polypeptide comprising an amino acid sequence, said amino acid sequence being modified by addition, deletion or substitution of at least one amino acid residue as represented in iv) above, and having codeinone reductase activity; and c) i) the nucleotide sequence set forth in SEQ ID NO: 17; ii) a nucleotide sequence, said sequence being degenerate as a result of the genetic code for said nucleotide sequence defined in (i); iii) a nucleic acid molecule comprising a nucleotide sequence of a complementary strand that hybridizes under stringent hybridization conditions to the sequence of SEQ ID NO: 17, said nucleic acid molecule encoding neopinone isomerase; iv) a nucleotide sequence encoding a polypeptide comprising the amino acid sequence represented by SEQ ID NO:33; v) a nucleotide sequence encoding a polypeptide comprising an amino acid sequence, said amino acid sequence being modified by addition, deletion or substitution of at least one amino acid residue as represented in iv) above, and having neopinone isomerase activity. The method of any one of claims 1 to 5, comprising a nucleotide sequence selected from the group consisting of:

7. 7. The method according to any one of claims 1 to 6, wherein the opiate alkaloids are obtained from a crude poppy extract, obtained from the Papaver plant.

8. The Papaver plant has been modified such that the plant is deleted or mutated in respect of one, two or three linked codeine 3-O-demethylase genes encoded by a nucleic acid molecule comprising a nucleotide sequence as set forth in SEQ ID NO: 1 or 37, or a nucleic acid molecule comprising a nucleotide sequence that is 95-99% identical to the nucleotide sequence as set forth in SEQ ID NO: 1 or 37; and / or The Papaver plant is deleted for each codeine 3-O-demethylase gene, such that codeine 3-O-demethylase activity is undetectable, and optionally The Papaver plant is deleted or mutated for one, two, three, four, or five linked thebaine 6-O-demethylase genes encoded by a nucleic acid molecule comprising a nucleotide sequence set forth in SEQ ID NO:16, or a nucleic acid molecule comprising a nucleotide sequence that is 95-99% identical to the nucleotide sequence set forth in SEQ ID NO:16, and optionally 8. The method of claim 7, wherein the Papaver plant is deleted for each thebaine 6-O-demethylase gene and thebaine 6-O-demethylase activity is undetectable.

9. The Papaver plant has been modified, genomic modifications to one, two, or three genes encoding codeine 3-O-demethylase; comprising genomic modifications to one, two, three, four, or five genes encoding thebaine 6-O-demethylase; 9. The method of claim 8, wherein expression of codeine 3-O-demethylase or activity of codeine 3-O-demethylase is reduced or undetectable, and further wherein expression of thebaine 6-O-demethylase or activity of thebaine 6-O-demethylase is reduced or undetectable, and wherein the modified plant has elevated levels of thebaine when compared to a wild-type Papaver somniferum plant, and comprises a functional gene encoding codeine 3-O-demethylase and a functional gene encoding thebaine 6-O-demethylase.

10. A modified codeine 3-O-demethylase polypeptide, wherein the activity of the modified codeine 3-O-demethylase polypeptide is altered when compared to an unmodified codeine 3-O-demethylase, and optionally A modified codeine 3-O-demethylase polypeptide, wherein the modification is to the amino acid sequence set forth in SEQ ID NO:19, and the polypeptide is modified by the addition, deletion, or substitution of at least one amino acid residue, and the codeine 3-O-demethylase has altered activity.

11. the modified codeine 3-O-demethylase polypeptide is modified at amino acid position 259 and / or amino acid position 260, or comprises an amino acid sequence that is at least 90% identical to SEQ ID NO:19 and includes a modification to amino acid residue 259 and / or amino acid residue 260; or the modification is to the amino acid sequence set forth in SEQ ID NO:53, and the polypeptide is modified by the addition, deletion, or substitution of at least one amino acid residue, and the codeine 3-O-demethylase has an altered activity; or 11. The modified codeine 3-O-demethylase polypeptide of claim 10, wherein the modified codeine 3-O-demethylase polypeptide is modified at one or more amino acid positions selected from 3, 4, 5, 7, 259, 357, and / or 360, or a combination thereof, or comprises an amino acid sequence that is at least 90% identical to SEQ ID NO:53 and includes a modification to a codon at one or more amino acid residue positions selected from 3, 4, 5, 7, 259, 357, and / or 360, or a combination thereof.

12. 11. The modified codeine 3-O-demethylase polypeptide of claim 10, wherein the modified codeine 3-O-demethylase polypeptide is selected from SEQ ID NOs: 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or 31.

13. 12. The modified codeine 3-O-demethylase polypeptide of claim 10 or 11, wherein the modified codeine 3-O-demethylase polypeptide is selected from SEQ ID NOs: 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, or 68.

14. the modified codeine 3-O-demethylase polypeptide has enhanced activity when compared to a wild-type codeine 3-O-demethylase polypeptide represented by the amino acid sequence set forth in SEQ ID NO: 19 or 53; and / or the modified codeine 3-O-demethylase polypeptide is i) a modified codeine 3-O-demethylase polypeptide having the amino acid sequence set forth in SEQ ID NO:21; ii) a modified codeine 3-O-demethylase polypeptide having the amino acid sequence set forth in SEQ ID NO:26; iii) a modified codeine 3-O-demethylase polypeptide having the amino acid sequence set forth in SEQ ID NO:63; iv) a modified codeine 3-O-demethylase polypeptide having the amino acid sequence set forth in SEQ ID NO:59; v) a modified codeine 3-O-demethylase polypeptide having the amino acid sequence set forth in SEQ ID NO:68; vi) a modified codeine 3-O-demethylase polypeptide having the amino acid sequence set forth in SEQ ID NO:67; and vii) a modified codeine 3-O-demethylase polypeptide having the amino acid sequence set forth in SEQ ID NO:66; The codeine 3-O-demethylase polypeptide of any one of claims 10 to 13, selected from the group consisting of:

15. 15. An isolated nucleic acid molecule comprising a nucleotide sequence encoding a modified codeine 3-O-demethylase polypeptide according to any one of claims 11 to 14, optionally comprising: the nucleic acid molecule comprises a nucleotide sequence set forth in SEQ ID NO: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15, or a nucleotide sequence that is at least 90% identical to SEQ ID NO: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 and has modified codeine 3-O-demethylase activity, and optionally The nucleotide sequence encoding the modified codeine 3-O-demethylase polypeptide comprises a nucleotide sequence set forth in SEQ ID NO:8 or at least 90% identical to SEQ ID NO:8, and including modifications to the codons for amino acid residue 259 and, optionally, amino acid residue 260, and optionally the nucleotide sequence encodes a modified codeine 3-O-demethylase polypeptide comprising the amino acid sequence set forth in SEQ ID NO:21, or an amino acid sequence that is at least 90% identical to SEQ ID NO:21 and comprises the amino acid substitution E259D, and optionally 20. An isolated nucleic acid molecule, wherein the nucleotide sequence encodes a modified codeine 3-O-demethylase polypeptide comprising the amino acid sequence set forth in SEQ ID NO:26, or a polypeptide comprising an amino acid sequence that is at least 90% identical to SEQ ID NO:26 and includes the amino acid substitution E259G.

16. 16. The isolated nucleic acid molecule of claim 15, wherein the nucleic acid molecule comprises a nucleotide sequence set forth in SEQ ID NO: 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, or 52, or a nucleotide sequence that is at least 90% identical to SEQ ID NO: 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, or 52, and has modified codeine 3-O-demethylase activity, optionally comprising: the nucleotide sequence encoding the modified codeine 3-O-demethylase polypeptide comprises a nucleotide sequence set forth in SEQ ID NO:43 or which is at least 90% identical to SEQ ID NO:43 and which includes one or more modifications to the codons at amino acid residue 5 and, optionally, amino acid residues 360, 259, 3, 7, 357, and / or 4; or The nucleotide sequence encoding the modified codeine 3-O-demethylase polypeptide comprises a nucleotide sequence set forth in SEQ ID NO:51 or at least 90% identical to SEQ ID NO:51, and comprising one or more modifications to the codons at amino acid residues 4, 360, 259, and optionally amino acid residues 3, 7, 357, and / or 5, and optionally The nucleotide sequence is i) a polypeptide comprising an amino acid sequence of SEQ ID NO:59, or an amino acid sequence at least 90% identical to SEQ ID NO:59 and comprising the amino acid substitution I5K; ii) a polypeptide comprising an amino acid sequence of SEQ ID NO:63, or an amino acid sequence at least 90% identical to SEQ ID NO:63 and comprising the amino acid substitutions I5K and M360I; iii) a polypeptide comprising an amino acid sequence of SEQ ID NO:66, or an amino acid sequence at least 90% identical to SEQ ID NO:66 and comprising the amino acid substitutions I5K, E259G, and M360I; iv) a polypeptide comprising an amino acid sequence of SEQ ID NO:67, or an amino acid sequence at least 90% identical to SEQ ID NO:67 and comprising the amino acid substitutions P4A, E259G, and M360I; and v) A polypeptide comprising an amino acid sequence of SEQ ID NO:68, or an amino acid sequence at least 90% identical to SEQ ID NO:68 and comprising the amino acid substitutions P4A, I5K, E259G, and M360I. An isolated nucleic acid molecule encoding a modified codeine 3-O-demethylase polypeptide comprising an amino acid sequence selected from the group consisting of:

17. 17. The isolated nucleic acid molecule of any one of claims 15 to 16, wherein the nucleic acid molecule comprises a nucleotide sequence, the nucleotide sequence being degenerate due to the genetic code and encoding a modified codeine 3-O-demethylase polypeptide of any one of claims 10 to 14.

18. An expression vector comprising the nucleic acid molecule according to any one of claims 15 to 17.

19. A cell transformed with a nucleic acid molecule or vector according to any one of claims 15 to 18.

20. 1. A process for the biotransformation of a first opiate or opioid alkaloid to a second opiate or opioid alkaloid, comprising: forming a preparation comprising a modified codeine 3-O-demethylase polypeptide according to any one of claims 10 to 14 and a crude poppy extract or a purified or semi-purified source of a selected opiate or opioid alkaloid; incubating the preparation to allow for conversion of one or more opiates or opioid alkaloids; and optionally and extracting the one or more converted opiates or opioid alkaloids from the preparation, optionally comprising: The modified codeine 3-O-demethylase polypeptide is expressed by a cell according to claim 19; and / or i) the first opiate alkaloid is thebaine and the second opiate alkaloid is oripavine; ii) the first opiate alkaloid is codeine and the second opiate alkaloid is morphine; iii) the first opiate alkaloid is codeinone and the second opiate alkaloid is morphinone; iv) the first semi-synthetic opioid alkaloid is oxycodone and the second semi-synthetic opioid alkaloid is oxymorphone; v) the first semi-synthetic opioid alkaloid is hydrocodone and the second semi-synthetic opioid alkaloid is hydromorphone; vi) the first semi-synthetic opioid alkaloid is dihydrocodeine and the second semi-synthetic opioid alkaloid is dihydromorphine; vii) the first semi-synthetic opioid alkaloid is 14-hydroxycodeine and the second semi-synthetic opioid alkaloid is 14-hydroxymorphine; viii) the first semi-synthetic opioid alkaloid is noroxycodone and the second semi-synthetic opioid alkaloid is noroxymorphone; ix) the first semi-synthetic opioid alkaloid is noroxycodeinone and the second semi-synthetic opioid alkaloid is noroxymorphinone; x) the first semi-synthetic opioid alkaloid is 14-hydroxynorcodeinone and the second semi-synthetic opioid alkaloid is 14-hydroxynormorphinone; xi) the first semi-synthetic opioid alkaloid is 14-hydroxycodeinone and the second semi-synthetic opioid alkaloid is 14-hydroxymorphinone; xii) the first semi-synthetic opioid alkaloid is a buprenorphine intermediate (N-cyclopropylmethyl-7α-(2-hydroxy-3,3-dimethyl-2-butyl)-6,14-endoethano-6,7,8,14-tetrahydronorthebaine) and the second semi-synthetic opioid alkaloid is buprenorphine ((2S)-2-[17-(cyclopropylmethyl)-4,5α-epoxy-3-hydroxy-6-methoxy-6α,14-ethano-14α-morphinan-7α-γl]-3,3-dimethylbutan-2-ol); xiii) the process wherein the first semi-synthetic opioid alkaloid is a buprenorphine intermediate (7-acetyl-6,14-endoetheno-6,7,8,14-tetrahydrothebaine) and the second semi-synthetic opioid alkaloid is an etorphine intermediate.

Images