Combination cancer therapy with epithelial cell adhesion molecule (EPCAM) inhibitors and hepatocyte growth factor receptor (HGFR) inhibitors

Abstract

The present invention relates to a combination therapy of cancer using an epithelial cell adhesion molecule (EpCAM) inhibitor and a hepatocyte growth factor receptor (HGFR) inhibitor. Specifically, the EpCAM inhibitor is an antibody against the extracellular domain of EpCAM (EpEX). This combination therapy is effective in inducing apoptosis of cancer cells, inhibiting migration / invasion of cancer cells, reducing tumor size, and / or prolonging the survival of cancer patients.

Description

[Technical field]

[0001] Related Applications This application claims the benefit of priority under 35 U.S.C. § 119 to U.S. Provisional Application No. 63 / 215,016, filed June 25, 2021, the entire contents of which are incorporated herein by reference.

[0002] Technical Field The present invention relates to a combination therapy of cancer using an epithelial cell adhesion molecule (EpCAM) inhibitor and a hepatocyte growth factor receptor (HGFR) inhibitor. Specifically, the EpCAM inhibitor is an antibody against the extracellular domain of EpCAM (EpEX). This combination therapy is effective in inducing apoptosis of cancer cells, inhibiting migration / invasion of cancer cells, reducing tumor size, and / or prolonging the survival of cancer patients. [Background technology]

[0003] 2. Background of the Invention EpCAM is a type I transmembrane protein with 314 amino acids, containing an extracellular domain (EpEX, 265 amino acids), a single transmembrane domain, and a short intracellular domain (EpICD, 26 amino acids). As a well-known tumor-associated antigen, EpCAM is abundant in various carcinomas and is also known to be involved in homotypic cell-cell adhesion in normal epithelia (Dolle et al., 2015). EpCAM is absent or weakly expressed in squamous cells of the majority of healthy epithelia, but is strongly expressed in squamous cell carcinomas (Balzar et al., 1999). Furthermore, expression of EpCAM in squamous cell carcinomas correlates with increased cell proliferation and reduced differentiation (Litvinov et al., 1996). Our group previously developed a neutralizing antibody against EpCAM, EpAb2.6, which could potentially be used to treat colorectal cancer (CRC) (Chen et al., 2020; Liang et al., 2018; Liao et al., 2015). Despite its potential as a therapeutic target for CRC, the mechanisms by which EpCAM contributes to tumorigenesis and metastasis remain incompletely understood.

[0004] HGFR (c-MET) is a high-affinity receptor tyrosine kinase (RTK) that is activated by hepatocyte growth factor (HGF, also known as Scatter Factor) and is encoded by the MET gene (Lai et al., 2009; Peschard & Park, 2007). The tyrosine kinase domain of HGFR contains two tyrosine residues at positions 1234 and 1235, and phosphorylation of these two sites is essential for activation of the HGFR receptor (Koch et al., 2020; Ponzetto et al., 1994). Many reports have demonstrated the important role of HGFR in tumorigenesis, cell proliferation, survival and metastasis (Cao et al., 2019; Li et al., 2018; Mazzone & Comoglio, 2006). In normal tissues, HGFR is expressed in epithelial cells and is activated by HGF derived from surrounding mesenchymal cells or in the circulation (Birchmeier et al., 2003). Activation of HGFR by HGF initiates a morphogenetic program that promotes cell migration and invasion. Based on its known functions, HGFR is usually considered to be a proto-oncogene involved in embryonic development, adult tissue homeostasis, and regeneration. Of note, early studies on HGFR showed that it has homology to both growth factor receptor and RTK families (Dean et al., 1985). It was subsequently demonstrated that HGFR is the cognate RTK of HGF and is identical to the HGFR ligand called hepatocyte growth factor (scatter factor) (Koch et al., 2020; Naldini et al., 1991).

[0005] Epithelial-mesenchymal transition (EMT) is associated with cancer progression and metastasis (Iwatsuki et al., 2010). The process of EMT involves a series of complex, reversible events that lead to the loss of epithelial cell adhesion and the induction of a mesenchymal phenotype of cells. Cancer cells that have undergone EMT also exhibit enhanced cell motility and invasion through the induction of mesenchymal properties and the loss of epithelial cell adhesion. Indicators of EMT include the decreased expression of epithelial markers such as E-cadherin along with the increased expression of mesenchymal markers such as Vimentin, Snail, and Slug (Singh & Settleman, 2010). Many reports have shown that HGFR signaling promotes the EMT program, thereby enhancing the invasiveness and metastatic potential of cancer cells (Gumustekin et al., 2012; Jiao et al., 2016).

[0006] EpEX contains two epidermal growth factor (EGF)-like domains and may function as a soluble growth factor in the local tumor microenvironment. Previous reports have shown that activation of the EGF receptor (EGFR) triggers regulated intramembrane proteolysis (RIP) of EpCAM, inducing EMT (Hsu et al., 2016). Notably, EGFR is a highly relevant RTK in many types of cancers, as it is overexpressed in various tumors (Normanno et al., 2006). Similar to the action of EGFR, excessive activation of HGFR acts through many downstream effectors, such as AKT, extracellular signal-related kinase (ERK), phosphoinositide 3-kinase, RAS and SRC (Comoglio et al., 2008; Ortiz-Zapater et al., 2017), promoting cancer cell proliferation, survival and migration (Kim et al., 2014; Simiczyjew et al., 2018). Interestingly, HGFR expression positively correlates with EGFR expression in basal-type breast cancer (Mueller et al, 2010), and HGFR and EGF family receptors are frequently co-expressed in cancer cells (Shattuck et al, 2008). Furthermore, it has been reported that stimulation of epidermal cancer cells with EGFR ligands results in EGFR-dependent phosphorylation and activation of HGFR (Jo et al, 2000). Such cross-activation of HGFR in cells with elevated EGFR signaling has also been observed in several types of tumours (Tang et al, 2008). Importantly, however, the mechanism underlying this cross-activation effect has not been identified until now. Summary of the Invention

[0007] Summary of the Invention Described herein is a method for the treatment of cancer using a combination of an epithelial cell adhesion molecule (EpCAM) inhibitor and an HGFR inhibitor. Specifically, the EpCAM inhibitor is an antibody against the extracellular domain of EpCAM (EpEX). The combination therapy is effective in inducing apoptosis of cancer cells, inhibiting migration / invasion of cancer cells, reducing tumor size, and / or prolonging the survival of cancer patients.

[0008] In one aspect, the present invention provides a method for treating cancer, comprising administering to a subject in need thereof: (i) an effective amount of a first inhibitor that inhibits activation of EpCAM signaling; and (ii) an effective amount of a second inhibitor that inhibits activation of HGFR signaling; The method includes administering

[0009] In certain embodiments, the first inhibitor reduces the production (or release) of EpEX, inhibits the binding of EpEX to HGFR, and / or inhibits EpEX-induced HGFR phosphorylation.

[0010] In certain embodiments, the second inhibitor inhibits binding of HGF to HGFR.

[0011] In certain embodiments, the first inhibitor is an antibody or antigen-binding fragment thereof against EpEX.

[0012] In some embodiments, the anti-EpEX antibodies described herein specifically bind to epidermal growth factor (EGF)-like domains I and II. In a particular example, the anti-EpEX antibodies described herein have specific binding affinity to an epitope within the sequence CVCENYKLAVN (aa 27-37) (SEQ ID NO: 20) located in EGF-like domain I, and KPEGALQNNDGLYDPDCD (aa 83-100) (SEQ ID NO: 19) located in EGF-like domain II.

[0013] In some embodiments, the antibody or antigen-binding fragment comprises: (a) a heavy chain variable region (VH) comprising a heavy chain complementarity determining region 1 (HC CDR1) comprising the amino acid sequence of SEQ ID NO:2, a heavy chain complementarity determining region 2 (HC CDR2) comprising the amino acid sequence of SEQ ID NO:4, and a heavy chain complementarity determining region 3 (HC CDR3) comprising the amino acid sequence of SEQ ID NO:6; and (b) a light chain variable region (VL) comprising a light chain complementarity determining region 1 (LC CDR1) comprising the amino acid sequence of SEQ ID NO:9, a light chain complementarity determining region (LC CDR2) comprising the amino acid sequence of SEQ ID NO:11, and a light chain complementarity determining region 3 (LC CDR3) comprising the amino acid sequence of SEQ ID NO:13; Includes.

[0014] In some embodiments, the VH comprises the amino acid sequence of SEQ ID NO:15 and / or the VL comprises the amino acid sequence of SEQ ID NO:16.

[0015] In some embodiments, the first inhibitor is effective to inhibit phosphorylation of TACE and PS2 signals.

[0016] In some embodiments, the second inhibitor is selected from the group consisting of foretinib, crizotinib, and cabozantinib.

[0017] In some embodiments, the methods of the present invention are effective in inducing apoptosis in cancer cells.

[0018] In some embodiments, the methods of the invention are effective in inhibiting cancer cell migration / invasion and / or reducing tumor size.

[0019] In some embodiments, the methods of the invention are effective in extending the survival time of a subject.

[0020] In some embodiments, the cancer is selected from the group consisting of lung cancer, brain cancer, breast cancer, cervical cancer, colon cancer, gastric cancer, head and neck cancer, kidney cancer, leukemia, liver cancer, ovarian cancer, pancreatic cancer, prostate cancer, skin cancer and testicular cancer.

[0021] In another aspect, the present invention provides a method for producing a pharmaceutical composition comprising: (i) an effective amount of a first inhibitor that inhibits activation of EpCAM signaling; and (ii) an effective amount of a second inhibitor that inhibits activation of HGFR signaling; The present invention provides a kit of pharmaceutical compositions comprising:

[0022] The present invention also provides the use of a combination of (i) a first inhibitor that inhibits activation of EpCAM signaling; and (ii) a second inhibitor that inhibits activation of HGFR signaling, for the manufacture of a pharmaceutical or kit for treating cancer.

[0023] The details of one or more aspects of the invention are set forth in the following description. Other features or advantages of the invention may become apparent from the following detailed description of several aspects, and from the appended claims. [Brief description of the drawings]

[0024] BRIEF DESCRIPTION OF THE DRAWINGS The summary above, as well as the following detailed description of the invention, may be better understood when read in conjunction with the accompanying drawings. For the purposes of illustrating the invention, there are shown in the drawings embodiments which are presently preferred. It should be understood, however, that the invention is not limited to the precise arrangement and functionality shown.

[0025] [Figure 1]Figures 1A to 1J. EpEX interacts with HGFR and induces phosphorylation of HGFR. (Figure 1A) Immunoprecipitation (IP) of endogenous EpCAM bound to HGFR in HCT116 and HT29 cells. (Figure 1B) HEK293 T cells were transfected with HGFRECD-c-Myc and EpCAM-V5. IP was performed with control IgG, anti-V5 or anti-c-Myc antibodies, followed by Western blotting. (Figure 1C) The interaction of EpEX-Fc and HGFR-His recombinant proteins (2.5 μg / ml) was examined by IP with Dynabeads Protein G and Western blotting with anti-6X His tag antibody. (Figure 1D) Starved HCT116 and HT29 cells were treated with different doses of EpEX-His for 15 min, and starved HCT116 and HT29 cells were treated with 50 nM EpEX-His for the indicated times. Phosphorylation of HGFR was examined by Western blotting. (Fig. 1E) Wild-type (WT) or EpCAM knockout (KO) HCT116 and H29 cells were starved for 16 h and then treated with EpEX-His (50 nM) for 15 min. The level of phosphorylated HGFR was assayed using an ELISA kit (ab126451). (Fig. 1F) HEK293 T cells were transfected with HGFRECD-c-Myc and full-length or EGF-like domain deletion mutant EpCAM-V5. Protein interactions were probed by IP with anti-V5 or anti-c-Myc antibodies, as well as by Western blotting with anti-V5 or anti-c-Myc antibodies. (Fig. 1G) HEK293 T cells were transfected with c-Myc or HGFRECD-c-Myc and full-length or EGF-like domain deletion mutant EpEX-His. Protein interactions were probed by IP with anti-c-Myc antibody and Western blotting with anti-c-Myc and anti-His antibodies (Figure 1H). HGFR-His recombinant protein (2 μg / ml) was added to EGF-like domain deletion mutant-Fc coated (1 μg / ml) ELISA plates and detected by TMB colorimetric peroxidase assay.HCT116 cells were starved and treated with wild-type or EGF domain deletion mutant EpEX, and phosphorylated HGFR was analyzed by (Figure 1I) Western blotting and (Figure 1J) ELISA kit (ab126451). All data are shown as mean ± SEM. *, p<0.05. [Diagram 2]Figures 2A to 2K. EpEX promotes tumor progression through HGFR signaling. (Figure 2A) WT or EpCAM knockout (KO) HCT116 and HT29 cells treated with HGF (0.5 nM) for 15 min. Phosphorylation of HGFR, AKT, and ERK was examined by Western blotting. (Figure 2B) WT or KO HCT116 and HT29 cells were treated with HGF (0.5 nM) containing 2% FBS for the indicated times. Cell proliferation was examined by WST-1 assay. (Figure 2C) Starved HCT116 cells were treated with the HGFR inhibitor SU11274 (SU, 10 μM) for 1 h, followed by treatment with 50 nM EpEX-His for 15 min. The levels of phosphorylated HGFR, EGFR, AKT, and ERK were examined by Western blotting. HCT116 and HT29 cells were treated with 50 nM EpEX and SU (10 μM). (Figure 2D) Cell proliferation was examined after treatment for the indicated times by WST-1 assay. (Figure 2E) HCT116 cells were treated with shLuc or HGFR shRNA, followed by treatment with 50 nM EpEX-His for 15 min. The levels of phosphorylated HGFR, EGFR, ERK, and AKT were examined by Western blotting in HGFR knockdown HCT116 cells. (Figure 2F) The levels of phosphorylated ADAM17 and presenilin 2 were examined by Western blotting. (Figure 2G) Nuclear translocation of active β-catenin was assayed using Western blotting. (Figure 2H) HCT116 cells were treated with shLuc or HGFR shRNA, followed by treatment with 50 nM EpEX-His for the indicated times. Cell proliferation was examined by WST-1 assay. (Figure 2I) HCT116 cells after shLuc and shHGFR treatment were treated with 50 nM EpEX-His containing 2% FBS for 7 days. Colony formation was examined by crystal violet staining. Quantification of nuclear β-catenin in the lower panel. (Fig. 2J) HCT116 cells were treated with HGF (0.5 nM) for the indicated times, and EpEX protein levels in the culture medium were examined by immunoprecipitation and Western blotting. (Fig. 2K) HCT116 cells were treated with HGF (0.5 nM) for 15 min.The levels of phosphorylated HGFR, presenilin 2, and ADAM17 proteins in cell lysates were analyzed by Western blotting, and EpEX protein levels in culture media were examined by immunoprecipitation and Western blotting. All data are presented as mean ± SEM. *, p<0.05; **, p<0.01. [Diagram 3]Figures 3A to 3H. EpEX induces activation of ERK and FAK-ACT signaling pathways. Wild-type (WT) or EpCAM knockout (KO) HCT116 cells after EpEX-His treatment. (Figure 3A) The levels of phosphorylated HGFR, AKT, FAK, GSK3β, ERK, ADAM17 and presenilin 2 were measured by Western blotting. (Figure 3B) Colony formation was examined by crystal violet staining. (Figure 3C) HCT116 cells were treated with TAPI (ADAM17 inhibitor) or DAPT (γ-secretase inhibitor) for 24 hours, HGFR, AKT and ERK phosphorylation was analyzed by Western blotting, and EpEX protein levels in the culture medium were examined by immunoprecipitation and Western blotting. (Figure 3D) HCT116 and HT29 cells were starved for 16 hours and then treated with EpEX-His (50 nM) and HGF (0.5 nM) for 15 minutes. The levels of phosphorylated HGFR, AKT and ERK were examined by Western blotting. (Figure 3E) HCT116 cells were starved for 16 h and then treated with 50 nM EpEX-His for 15 min. HGFR inhibitor SU11274 (SU, 10 μM), AKT inhibitor LY294002 (LY, 25 μM), ERK inhibitor U0126 (U0, 20 μM), or FAK inhibitor PF-562271 (PF, 10 μM) were applied 1 h before EpEX treatment. Phosphorylation of AKT, ERK and FAK was examined by Western blotting. (Figure 3F) HCT116 cells were starved for 16 h and then treated with 50 nM EpEX and SU (10 μM), LY (25 μM), U0 (20 μM) or PF (10 μM). Colony formation was examined by crystal violet staining after 7 days of treatment. Relative colony density is shown. Migration ability (Fig. 3G) was examined at the indicated times by wound-healing assay. (Fig. 3H) After 24 h of treatment, the number of migrated cells was assessed by transwell. *, p<0.05.

[0026] [Figure 4]Figures 4A to 4L. EpEX stabilizes β-catenin and Snail by reducing GSK3β activity, inducing EMT and invasion. (Figure 4A) Protein expression of EMT markers and regulators was detected by Western blotting in wild-type (WT) or EpCAM knockout (KO) HCT116 cells after EpEX treatment. (Figure 4B) Cell invasion was examined by transwell chamber assay using Matrigel. (Figure 4C) WT or KO HCT116 cells and HT29 cells were starved for 16 h and then treated with 0.5 nM HGF containing 2% FBS for 24 h. EMT-related protein expression (E-cadherin, vimentin and Snail) was examined by Western blotting. (Figure 4D) WT or KO HCT116 cells and HT29 cells were treated with HGF (0.5 nM) for 24 h. Invasion by HCT116 and HT29 cells was examined by transwell chamber assay using Matrigel. (Figure 4E) HCT116 and HT29 cells were starved for 16 h and then treated with 0.5 nM HGF plus 2% FBS for 24 h, and the expression of EMT-related proteins (E-cadherin, vimentin, and snail) was examined by Western blotting. (Figure 4F) HCT116 and HT29 cells were starved for 16 h and then treated with 0.5 nM HGF plus 2% FBS for 24 h, and cell invasion was evaluated by transwell assay using Matrigel. (Figure 4G) HCT116 cells after shLuc and shHGFR treatment were treated with 50 nM EpEX-His. HCT116 cells after shLuc and shHGFR treatment were treated with 50 nM EpEX-His supplemented with 2% FBS for 24 h, and the expression of EMT-related proteins (E-cadherin, vimentin, and Snail) was examined by Western blotting. (Figure 4H) Cell invasion was examined by transwell chamber assay using Matrigel. (Figure 4I) Starved HCT116 cells were treated with SU (10 μM) for 1 h, followed by EpEX-His (50 nM) for 24 h. Phosphorylated GSK3β, active β-catenin, and Snail were detected by Western blotting.(Fig. 4J) HCT116 cells were starved for 16 h and then treated with 50 nM EpEX-His for 24 min. AKT inhibitor LY294002 (25 μM), ERK inhibitor U0126 (20 μM), or PF-562271 (10 μM) were applied 1 h before EpEX treatment. Protein expression of phosphorylated GSK3β and Snail was examined by Western blotting. (Fig. 4K) HCT116 cells were starved for 16 h and then treated with 50 nM EpEX, and SU (10 μM), LY (25 μM), U0 (20 μM), or PF (10 μM). Cell invasion was examined by transwell chamber assay with Matrigel. (Fig. 4L) EpEX-His (50 nM)-treated HCT116 cells were treated with 2 μM GSK3β inhibitor (BIO) for 24 h, and then protein expression was analyzed by Western blot. All data are shown as mean ± SEM. *, p<0.05; **, p<0.01.

[0027] [Diagram 5]Figure 5A to Figure 5I. EpEX promotes Snail protein stability by inhibiting ubiquitination-mediated proteasomal degradation. (Figure 5A) Gene expression of EMT markers and regulators in wild type (WT) or EpCAM knockout (KO) HCT116 and HT29 cells was detected by qRT-PCR. (Figure 5B) Stability of Snail protein in WT or KO HCT116 cells. Cells were treated with cyclohexamide (CHX) 100 μg / ml for the indicated time intervals and Western blotting was performed. (Figure 5C) Snail protein expression was analyzed by Western blotting in WT or KO HCT116 cells treated or not with 10 mM MG132 (proteasome inhibitor) for 6 h. (Figure 5D) WT or KO HCT116 cells were treated with 10 μM MG132 for 6 h before cell harvesting. Cell lysates were immunoprecipitated with anti-Snail antibody and Input. Western blotting was performed with the indicated antibodies to detect ubiquitinated Snail protein. (Fig. 5E) Stability of Snail protein in HCT116 cells after treatment with EpEX (50 nM) for 24 h. Cells were treated with cyclohexamide (CHX; 100 μg / ml) for the indicated time intervals, followed by Western blotting. (Fig. 5F) Expression of the gene encoding SNAIL was detected by qRT-PCR in HCT116 cells after treatment with EpEX (50 nM) for 24 h. (Fig. 5G) Snail protein expression in HCT116 cells was analyzed by Western blotting after treatment with EpEX (50 nM) for 24 h, and with or without treatment with 10 μM MG132 (proteasome inhibitor) for 6 h. (Fig. 5H) The location of the mutants within the Snail phosphorylation motif is shown diagrammatically. (Fig. 5I) HCT116 cells were transfected with Snail-WT, 2SA, 4SA, and 6SA for 24 h and then treated with EpEX (50 nM) for 24 h. All data are shown as mean ± SEM. *, p<0.05; **, p<0.01. [Figure 6]Figure 6A to Figure 6J. EpAb2-6 inhibits EpCAM and HGFR signaling and promotes the degradation of active β-catenin and Snail proteins via activation of GSK3β. (Figure 6A) HCT116 cells were treated with 10 μg / ml of control IgG (normal mouse IgG, NMIgG) or mouse EpAb2-6 (EpAb2-6) for 16 h, followed by treatment with EpEX-His (50 nM) for 15 min. The levels of phosphorylated HGFR, AKT, FAK, GSK3β, ERK, ADAM17 and presenilin 2 were examined by Western blotting. (Figure 6B) HCT116 cells were treated with 10 μg / ml of control IgG or mouse EpAb2-6 for 16 h, followed by treatment with or without HGF (0.5 nM) for 15 min. The levels of phosphorylated HGFR, AKT and ERK were examined by Western blotting. HCT116 cells were treated with mouse EpAb2-6 (10 μg / ml) and HGF (0.5 nM). (Figure 6C) Cell migration was examined by wound healing assay at the indicated times. (Figure 6E) HCT116 cells were treated with NMIgG or EpAb2-6 for 6 h, then immunoprecipitated with anti-EpCAM (IP:EpCAM) or anti-HGFR (IP:HGFR) antibodies and Western blotting was performed. (Figure 6F) EpEX-His (2 μg / ml) co-treated with 1 μg of IgG or EpAb2-6 was added to HGFR-Fc-coated (1 μg / ml) ELISA plates and detected by TMB colorimetric peroxidase assay. (Figure 6G) EMT-related protein levels were detected by Western blotting in HCT116 cells treated with NMIgG or EpAb2-6 for 24 h. (Fig. 6H) Protein expression was detected by Western blotting in HCT116 cells treated with EpAb2-6 and 2 μM GSK3β inhibitor (BIO) for 24 hours. (Fig. 6I) HCT116 cells were treated with 10 μM MG132 and EpAb2-6 for 6 hours, and then the cells were harvested and subjected to Western blotting. (Fig. 6J) Stability of Snail protein in HCT116 cells treated with NMIgG or EpAb2-6.Cells were treated with cyclohexamide (CHX) at 100 μg / ml for the indicated time intervals and subjected to Western blotting. The graph below shows the quantification of Snail half-life in the indicated groups. All data are presented as mean ± SEM. *, p < 0.05; **, p < 0.01. [Figure 7]Figures 7A to 7G. EpAb2-6 binds EpEX and induces apoptosis through F(ab')2, inhibiting activation of regulated intramembrane proteolysis (RIP) and HGFR signaling. (Figure 7A) The binding affinity of IgG EpAb2-6 (mouse) and F(ab')2 to overnight coated EpEX-His (1 μg / ml) was examined by ELISA (OD450). (Figure 7B) HCT116 cells were treated with 100 μg / ml of control IgG, Fc or F(ab')2 of EpAb2-6 for 24 h, and apoptotic and necrotic cells were quantified by fluorescein-annexin V-FITC / PI double labeling. (Fig. 7C) HCT116 and HT29 cells were treated with 10 μg / ml of control IgG, MT201, humanized EpAb2-6 (hEpAb2-6) or mouse hybridoma EbAb2-6 (mEpAb2-6) for 24 h. Apoptotic and necrotic cells were quantified by fluorescein-annexin V-FITC / PI double labeling. (Fig. 7D) HCT116 cells were treated with 10 μg / ml of control IgG, MT201, hEpAb2-6 or mEpAb2-6 for 16 h and then with EpEX-His (50 nM) for 15 min. The levels of phosphorylated HGFR, AKT and ERK, as well as (Fig. 7E) the RIP proteins ADAM17 and presenilin 2, were examined by Western blotting. Anti-EpCAM antibody and crizotinib cooperatively induce apoptosis in colon cancer cells. (Fig. 7F) HCT116 and HT29 cells were treated with 10 μg / ml NMIgG or EpAb2-6 and 4 μM HGFR inhibitor crizotinib for 24 h. Apoptotic and necrotic cells were quantified by fluorescein-annexin V-FITC / PI double labeling. (Fig. 7G) HCT116 and HT29 cells were treated with 10 μg / ml NMIgG or EpAb2-6 and 10 μM HGFR inhibitor crizotinib. All data are shown as mean ± SEM. *, p<0.05.

[0028] [Figure 8]Figures 8A to 8G. EpAb2-6 binds to both EGF-like domains I and II of EpCAM. HEK293T cells were transfected with full-length or EGF-like domain deletion mutant EpCAM-V5. Antibody binding was assessed by (Figure 8A) Western blotting, (Figure 8B) flow cytometry, and (Figure 8C) immunofluorescence. (Figure 8D) EpCAM mutants with amino acid substitutions in the EGF-I (Y32A) and EGF-II (L94A, Y95A, or D96A) domains were constructed. EpCAM wild-type and mutant proteins were expressed in HEK293T cells. Binding of MT201, EpAb2-6, and EpAb23-1 to EpCAM wild-type and mutants was assessed by (Figure 8E) immunofluorescence, (Figure 8F) flow cytometry, and (Figure 8G) cell ELISA. All data are shown as mean ± SEM. *, p<0.05; **, p<0.01. [Figure 9]Figures 9A to 9K. EpAb2-6 and crizotinib cooperatively suppress tumor progression and metastasis. (Figure 9A) Timeline of the study evaluating the effect of EpAb2-6 and / or crizotinib in metastasis model animals. (Figure 9B) NOD / SCID mice were intravenously injected with 5x106 HCT116 cells and then treated with control IgG, EpAb2-6 and / or crizotinib (n=5). Survival curves, median survival days, and representative H&E staining of lung tissue in metastasis model animals. (Figure 9C) Timeline of the experiment evaluating EpAb2-6 and / or crizotinib in an orthotopic animal model. (Fig. 9D) NOD / SCID mice were orthotopically implanted with HCT116-Luc cells and treated with control IgG (normal mouse IgG, NMIgG), crizotinib, EpAb2-6, or a combination of crizotinib and EpAb2-6 starting 3 days after tumor inoculation (n=5). Tumor growth was measured by bioluminescence using an IVIS 200 imaging system. (Fig. 9E) HCT116-Luc tumor cells measured by bioluminescence quantification. (Fig. 9F) Body weight of each treatment group in the HCT116 orthotopic animal model. (Fig. 9G) Survival curves and median survival times of each treatment group in the HCT116 orthotopic animal model. (Fig. 9H) NOD / SCID mice were stereotactically implanted with HT29-Luc cells and treated with control IgG, crizotinib, EpAb2-6, or a combination of crizotinib and EpAb2-6 starting 3 days after tumor inoculation (n=5). Tumor growth was measured by bioluminescence with an IVIS 200 imaging system. (Figure 9I) HT29-Luc tumor cells measured by bioluminescence quantification. (Figure 9J) Mouse weights after indicated treatments for each treatment group in the HT29 orthotopic animal model. (Figure 9K) Survival curves and median survival times for each treatment group in the HT29 orthotopic animal model. All data are presented as mean ± SEM. *, p<0.05; **, p<0.01. [Figure 10]10A to 10B. Sequence features and domains of human EpCAM. (FIG. 10A) Full length of human EpCAM containing 314 amino acid residues (SEQ ID NO: 17). (FIG. 10B) Identification of the domains of EpCAM including an EGF I domain (aa 27-59) in which the EpEX domain contains VGAQNTVIC (aa 51 to 59, SEQ ID NO: 18) and an EGF II domain (aa 66-135) containing KPEGALQNNDGLYDPDCDE (aa 83 to 100, SEQ ID NO: 19) which contains a LYD motif (aa 94-96). [Figure 11] Figure 11. Amino acid sequence of EpAb2-6. VH (SEQ ID NO: 15) comprises HC CDR1 of SEQ ID NO: 2, HC CDR2 of SEQ ID NO: 4, and HC CDR3 of SEQ ID NO: 6; and VL (SEQ ID NO: 16) comprises LC CDR1 of SEQ ID NO: 9, LC CDR2 of SEQ ID NO: 11, and LC CDR3 of SEQ ID NO: 13. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0029] Detailed Description of the Invention The following description is merely intended to illustrate various aspects of the present invention. As such, the specific aspects or modifications described herein should not be construed as limiting the scope of the present invention. Those skilled in the art will recognize that various modifications or equivalents may be implemented without departing from the scope of the present invention.

[0030] In order to provide a clear and easy understanding of the present invention, certain terms are first defined. Additional definitions are provided in the detailed description. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0031] As used herein, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a component" includes a plurality of such components and equivalents thereof known to those skilled in the art.

[0032] The terms "comprise" or "comprising" are generally used in the sense of include / including, meaning permitting the presence of one or more features, components or ingredients. The terms "comprise" or "comprising" encompass the terms "consist" or "consisting of".

[0033] As used herein, the term "polypeptide" refers to a polymer of amino acid residues linked through peptide bonds. The term "protein" generally refers to a relatively large polypeptide. The term "peptide" generally refers to a relatively short polypeptide (e.g., containing up to 100, 90, 70, 50, 30, 20, or 10 amino acid residues).

[0034] The term "approximately" or "about" as used herein means an acceptable degree of deviation that would be understood by one of ordinary skill in the art, and may vary to some extent depending on the context in which it is used. Specifically, "about" may mean a numerical value having a range of ±10%, ±5%, or ±3% of the indicated numerical value.

[0035] As used herein, the term "substantially identical" refers to two sequences that have a homology of 80% or more, preferably 85% or more, more preferably 90% or more, and even more preferably 95% or more.

[0036] As used herein, the term "antibody" (the plural forms are used interchangeably) refers to an immunoglobulin molecule capable of specifically binding to a particular target antigenic molecule. As used herein, the term "antibody" includes intact (i.e., full-length) antibody molecules as well as antigen-binding fragments thereof that retain antigen-binding ability, such as Fab, Fab', F(ab')2, and Fv. Such fragments are also well known in the art and are routinely used in vitro and in vivo. The term "antibody" also includes chimeric antibodies, humanized antibodies, human antibodies, diabodies, linear antibodies, single-chain antibodies, multispecific antibodies (e.g., bispecific antibodies), and other modified configurations of immunoglobulin molecules that contain an antigen recognition site of the required specificity, including amino acid sequence variants of antibodies, glycosylation variants of antibodies, and covalently modified antibodies.

[0037] An intact or whole antibody contains two heavy chains and two light chains. Each heavy chain contains a variable region (V H ) and the first, second and third constant regions (C H 1. C H 2 and C H 3), each light chain contains a variable region (V L ) and the constant region (C L). Antibodies are "Y" shaped, with the stem of the Y consisting of the second and third constant regions of two heavy chains linked via disulfide bonds. Each arm of the Y contains the variable and first constant regions of one heavy chain bound to the variable and constant region of one light chain. The light and heavy chain variable regions are responsible for antigen binding. The variable regions of both chains are generally responsible for antigen binding and each contain three highly variable regions: the heavy (H) chain CDRs, including HC CDR1, HC CDR2, and HC CDR3, and the light (L) chain CDRs, including LC CDR1, LC CDR2, and LC CDR3. The three CDRs are flanked by framework regions (FR1, FR2, FR3, and FR4), which are more highly conserved than the CDRs and form a scaffold supporting the hypervariable regions. The constant regions of the heavy and light chains are not involved in antigen binding but are involved in various effector functions. Depending on the antibody amino acid sequence of the constant domain of the heavy chain, immunoglobulins are classified into different classes. There are five major classes of immunoglobulins: IgA, IgD, IgE, IgG, and IgM. The heavy chain constant domains corresponding to the different classes of immunoglobulins are called alpha, delta, epsilon, gamma, and mu, respectively.

[0038] As used herein, the term "antigen-binding fragment" or "antigen-binding domain" refers to a portion or region of an intact antibody molecule that is responsible for antigen binding. An antigen-binding fragment can bind to the same antigen as the parent antibody binds. Examples of antigen-binding fragments include: (i) V H -C H 1 chain and V L -C L (ii) a F(ab')2 fragment, which may be a bivalent fragment consisting of two Fab fragments linked by a disulfide bridge at the hinge region; (iii) a V chain of an antibody molecule. H Domains and V L (iv) a Fv fragment in which the domains are non-covalently linked; (iv) a V H Domains and V L(v) single-chain Fv (scFv), which can be a single polypeptide chain composed of two V domains linked by a peptide linker; H domain and two V via disulfide bridges H Two Vs bound to the domain L The scFv domain may include, but is not limited to, (scFv)2.

[0039] As used herein, the term "chimeric antibody" refers to an antibody that comprises polypeptides from different sources, e.g., different species. In some embodiments, in a chimeric antibody, the variable regions of both the light and heavy chains may mimic the variable regions of an antibody from a certain mammal (e.g., a non-human mammal such as mouse, rabbit, and rat), while the constant regions may be homologous to sequences of an antibody from another mammal, such as a human.

[0040] As used herein, the term "humanized antibody" refers to an antibody containing a framework region derived from a human antibody and one or more CDRs derived from a non-human (usually mouse or rat) immunoglobulin.

[0041] As used herein, the term "human antibody" refers to an antibody in which essentially the entire light and heavy chain sequences, including the complementarity determining regions (CDRs), are derived from human genes. In some cases, a human antibody may contain one or more amino acid residues not encoded by human germline immunoglobulin sequences, e.g., by mutating one or more CDRs or one or more FRs to reduce potential immunogenicity, increase affinity, or remove cysteines that may cause undesirable folding.

[0042] As used herein, the term "specific binds" refers to a non-random binding reaction between two molecules, such as the binding of an antibody to an epitope of a target antigen. An antibody that "specifically binds" to a target antigen or epitope is a term well understood in the art, and methods for determining such specific binding are also well known in the art. An antibody "specifically binds" to a target antigen when it binds with higher affinity / avidity, more readily, and / or for longer than it binds to other substances. In other words, by reading this definition, it is understood that, for example, an antibody that specifically binds to a first target antigen may or may not specifically or preferentially bind to a second target antigen. Thus, "specific binding" or "preferential binding" does not necessarily require (although it can include) exclusive binding. In general, the affinity of binding is measured by the dissociation constant (K D Generally, when used with respect to antibodies, specifically binding can be defined as binding to an antibody with a specific binding capacity of about 10 7 Less than M, about 10 8 Less than M, about 10 9 Less than M, about 10 10 Less than M, about 10 11 Less than M, about 10 12 Specifically binds (recognizes) its target with a KD value, such as less than M or less, and has an affinity for binding to a non-specific antigen (such as BSA or casein) that is at least 100-fold lower, e.g., at least 1,000-fold lower, or at least 10,000-fold lower. D It may refer to an antibody that binds to a specific target with an affinity corresponding to

[0043] As used herein, the term "nucleic acid" or "polynucleotide" may refer to a polymer of nucleotide units. Polynucleotides include naturally occurring nucleic acids, such as deoxyribonucleic acid ("DNA") and ribonucleic acid ("RNA"), as well as nucleic acid analogs having non-naturally occurring nucleotides. Polynucleotides may be synthesized, for example, using an automated DNA synthesizer. When a nucleotide sequence is represented as a DNA sequence (i.e., A, T, G, C), it will be understood to also include RNA sequences in which "U" is substituted for "T" (i.e., A, U, G, C). The term "cDNA" refers to DNA that is complementary or identical to mRNA, in single- or double-stranded form.

[0044] As used herein, the term "complementary" refers to the topological compatibility or correspondence of interacting surfaces of two polynucleotides. A first polynucleotide is complementary to a second polynucleotide when its nucleotide sequence is identical to the nucleotide sequence of the polynucleotide binding partner of the second polynucleotide. Thus, a polynucleotide whose sequence is 5'-ATATC-3' is complementary to a polynucleotide whose sequence is 5'-GATAT-3'.

[0045] As used herein, the term "encoding" refers to the natural property, and biological properties resulting therefrom, that a particular sequence of nucleotides in a polynucleotide (e.g., gene, cDNA, or mRNA) serves as a template for the synthesis of other polymers and macromolecules in biological processes having either a predetermined sequence of RNA transcripts (i.e., rRNA, tRNA, and mRNA) or a predetermined sequence of amino acids. Thus, a gene encodes a protein when the protein is produced in a cell or other biological system by transcription and translation of the mRNA produced by that gene. It will be understood by those of skill in the art that, as a result of the degeneracy of the genetic code, many different polynucleotides and nucleic acids can encode the same polypeptide. It will also be understood by those of skill in the art that, using routine techniques, nucleotide substitutions that do not affect the polypeptide sequence encoded by the polynucleotides described therein may be made to reflect the codon usage of the particular host organism in which the polypeptide is expressed. Thus, unless otherwise specified, a "nucleotide sequence encoding an amino acid sequence" includes all nucleotide sequences that are degenerate versions of each other and that encode the same amino acid sequence.

[0046] The term "recombinant nucleic acid" as used herein refers to a polynucleotide or nucleic acid having sequences that are not naturally linked together. A recombinant nucleic acid may be in the form of a vector. A "vector" may comprise a nucleotide sequence of interest and a regulatory sequence. A vector can be used to express a given nucleotide sequence (expression vector) or to maintain a given nucleotide sequence in order to replicate, manipulate or transfer it between different locations (e.g., between different organisms). A vector can be introduced into a suitable host cell for the above purposes. "Recombinant cell" refers to a host cell into which a recombinant nucleic acid has been introduced. "Transformed cell" refers to a cell into which a DNA molecule encoding a protein of interest has been introduced by recombinant DNA techniques.

[0047] Vectors may be of various types, including plasmids, cosmids, episomes, fosmids, artificial chromosomes, phages, viral vectors, and the like. Generally, in a vector, a given nucleotide sequence is operably linked to a regulatory sequence such that when the vector is introduced into a host cell, the given nucleotide sequence can be expressed in the host cell under the control of the regulatory sequence. Regulatory sequences may include, for example, but are not limited to, promoter sequences (e.g., cytomegalovirus (CMV) promoter, simian virus 40 (SV40) early promoter, T7 promoter, and alcohol oxidase gene (AOX1) promoter), initiation codons, origins of replication, enhancers, secretion signal sequences (e.g., α-mating factor signal), stop codons, and other control sequences (e.g., Shine-Dalgarno sequence, termination sequence). Preferably, the vector may further include a marker sequence (e.g., antibiotic resistance marker sequence) for subsequent screening / selection procedures. For the purpose of protein production, in the vector, the desired nucleotide sequence of interest can be linked to other nucleotide sequences than the above mentioned regulatory sequences, so that a fusion polypeptide is produced, which is beneficial for the subsequent purification procedure, said fusion polypeptide containing a tag for purification purposes, for example a His tag.

[0048] As used herein, the term "treatment" refers to the application or administration of one or more active agents to a subject suffering from a disorder, having a symptom or condition of a disorder, a disorder induced by a disorder, or the progression of a disorder, for the purpose of caring for, curing, alleviating, ameliorating, altering, relieving, ameliorating, or affecting said disorder, a symptom or condition of a disorder, or the progression of a disorder.

[0049] The present invention is based, at least in part, on the development of a combination cancer therapy using an epithelial cell adhesion molecule (EpCAM) inhibitor and an HGFR inhibitor.

[0050] The extracellular domain of EpCAM, EpEX, contains two epidermal growth factor (EGF)-like domains and can function as a soluble growth factor in the tumor local microenvironment. Activation of the EGF receptor (EGFR) can trigger regulated intramembrane proteolysis (RIP) of EpCAM and induce epithelial-mesenchymal transition (EMT) (Hsu et al., 2016). EGFR is a RTK that is overexpressed in various tumors and is therefore deeply involved in many types of cancer (Normanno et al., 2006). Excessive activation of HGFR promotes cancer cell proliferation, survival and migration through many downstream effectors, such as AKT, extracellular signal-related kinase (ERK), phosphoinositide 3-kinase, RAS and SRC (Normanno et al., 2006) (Comoglio et al., 2008; Ortiz-Zapater et al., 2017). HGFR expression positively correlates with EGFR expression in basal-type breast cancer (Comoglio et al., 2008; Ortiz-Zapater et al., 2017), and HGFR and EGF family receptors are often coexpressed in cancer cells (Comoglio et al., 2008; Ortiz-Zapater et al., 2017). Furthermore, stimulation of epidermal cancer cells with EGFR ligands results in EGFR-dependent phosphorylation and activation of HGFR (Comoglio et al., 2008; Ortiz-Zapater et al., 2017). Such cross-activation of HGFR in cells with elevated EGFR signaling has also been observed in several tumor types (Tang et al., 2008).

[0051] In the present invention, it is surprisingly found that EpEX binds to HGFR and activates its downstream signal transduction to promote cell proliferation, migration and invasion.It is also found that EpCAM neutralizing antibody EpAb2-6 suppresses HGFR phosphorylation and inhibits cancer cell metastasis.Therefore, the results of the present invention provide a mechanistic basis for simultaneously targeting EpCAM and HGFR signal transduction to combat cancer metastasis.

[0052] As used herein, "combination therapy" refers to a treatment in which two or more therapeutic agents or approaches are combined. "Combination" refers to the administration of two or more therapeutic agents or therapeutic approaches to the same subject, either simultaneously or sequentially. Preferably, the combination therapy produces a synergistic effect.

[0053] As used herein, the term "synergy" refers to and includes the combined action of two or more active agents in a combination such that the combined activity of the two or more active agents exceeds the sum of the activities of each active agent alone. The term "synergy" can also mean that two or more active agents, when used together, provide a combined activity such that a lower dose of each agent can be used to achieve equivalent or enhanced activity compared to using a single agent.

[0054] Thus, the present invention provides a combination therapy for treating cancer, comprising administering to a subject in need thereof a combination comprising: (i) an effective amount of a first inhibitor (EpCAM inhibitor) that inhibits activation of EpCAM signaling; and (ii) an effective amount of a second inhibitor (HGFR inhibitor) that inhibits activation of HGFR signaling.

[0055] In some embodiments, the anti-EpEX antibody used herein specifically binds to the EGF-like domain I (aa 27-59 of EpCAM) and the EGF-like domain II (aa 66-135 of EpCAM) of EpCAM. Specifically, the anti-EpEX antibody used herein has specific binding affinity to an epitope within the sequence CVCENYKLAVN (aa 27-37) (SEQ ID NO: 20) located in the EGF-like domain I, and KPEGALQNNDGLYDPDCD (aa 83-100) (SEQ ID NO: 19) located in the EGF-like domain II. More specifically, the anti-EpEX antibody used herein recognizes the NYK motif (aa 31-33) in domain I of EpCAM and the LYD motif (aa 94-96) in domain II. In contrast, many other antibodies (e.g., MT201, M97, 323 / A3 and edrecolomab) target only the well-known EGF I domain of EpCAM. The features of the anti-EpEX antibody of the present invention that distinguish it from other antibodies are described below. TIFF2024524251000002.tif33155

[0056] One of the anti-EpEX antibodies used herein is EpAb2-6, which is shown in the Examples below. H ) and the light chain variable region (V L ), and the amino acid sequences of their complementarity determining regions (HC CDR1, HC CDR2 and HC CDR3) (LC CDR1, LC CDR2 and LC CDR3) are shown in Table 1 below. The anti-EpEX antibodies of the present invention include EpAb2-6 and functional variants thereof.

[0057] [Table 1]

[0058] In some embodiments, the anti-EpEX antibody of the invention comprises (a) a V CDR1 comprising an HC CDR1 of SEQ ID NO:2, an HC CDR2 of SEQ ID NO:4, and an HC CDR3 of SEQ ID NO:6. Hand (b) a V comprising an LC CDR1 of SEQ ID NO:9, an LC CDR2 of SEQ ID NO:11, and an LC CDR3 of SEQ ID NO:13. L A functional variant of EpAb2-6, or an antigen-binding fragment thereof, characterized in that it comprises:

[0059] In some embodiments, (a) a V CDR1 comprising an HC CDR1 of SEQ ID NO:2, an HC CDR2 of SEQ ID NO:4, and an HC CDR3 of SEQ ID NO:6. H and (b) a V comprising an LC CDR1 of SEQ ID NO:9, an LC CDR2 of SEQ ID NO:11, and an LC CDR3 of SEQ ID NO:13. L The anti-EpEX antibody of the present invention has a V sequence comprising SEQ ID NO: 15 or an amino acid sequence substantially identical thereto. H and V comprising an amino acid sequence of SEQ ID NO: 16 or substantially identical thereto. L Specifically, the anti-EpEX antibody of the present invention may comprise a V that comprises an amino acid sequence having at least 80% (e.g., 82%, 84%, 85%, 86%, 88%, 90%, 92%, 94%, 95%, 96%, 98% or 99%) identity to SEQ ID NO: 15. H and V comprising an amino acid sequence having at least 80% (e.g., 82%, 84%, 85%, 86%, 88%, 90%, 92%, 94%, 95%, 96%, 98% or 99%) identity to SEQ ID NO: 16. L The anti-EpEX antibodies of the invention include those having the relevant V H or V L Engineered antibodies that are encoded by a polynucleotide sequence that codes for an amino acid sequence are also included.

[0060] The term "substantially identical" refers to the relative amino acid sequence (e.g., FR, CDR, V H , or V LIn some instances, the amino acid residue change is a conservative amino acid substitution, which means that the amino acid residue of the polypeptide has a similar chemical structure to another amino acid residue, and the other biological effects on the function, activity or properties of the polypeptide are small or do not substantially affect the polypeptide. In contrast to the CDR region, the FR region can usually be made with a relatively large number of substitutions, as long as it does not adversely affect the binding function and biological activity of the antibody (e.g., reducing the binding affinity by 50% or more compared to the original antibody). In some embodiments, sequence identity can be about 80%, 82%, 84%, 85%, 86%, 88%, 90%, 92%, 94%, 95%, 96%, 98%, or 99% or more between the reference antibody and the variant. Variants can be prepared according to methods for modifying polypeptide sequences known to those skilled in the art, for example, as described in references that summarize such methods, for example, Molecular Cloning: A Laboratory Manual, J. Sambrook, et al., eds., Second Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 1989. For example, conservative substitutions of amino acids include substitutions made between amino acids in the following groups: (i) A, G; (ii) S, T; (iii) Q, N; (iv) E, D; (v) M, I, L, V; (vi) F, Y, W; and (vii) K, R, H.

[0061] The antibodies described herein may be animal antibodies (e.g., mouse-derived antibodies), chimeric antibodies (e.g., mouse-human chimeric antibodies), humanized antibodies, or human antibodies. The antibodies described herein may also include antigen-binding fragments, such as Fab fragments, F(ab')2 fragments, Fv fragments, single chain Fv (scFv), (scFv)2. Antibodies or antigen-binding fragments thereof can be prepared by methods known in the art.

[0062] Details of the anti-EpEX antibodies used herein are as described in U.S. Pat. No. 9,187,558, the relevant disclosures of which are incorporated herein by reference for any purpose or subject matter referred to herein.

[0063] Numerous methods are available for obtaining antibodies or antigen-binding fragments thereof, which are conventional in the art.

[0064] In some embodiments, the antibodies provided herein can be produced by conventional hybridoma technology. In general, a target antigen, such as a tumor antigen, can be optionally conjugated to a carrier protein, such as keyhole limpet hemocyanin (KLH), and / or mixed with an adjuvant, such as complete Freund's adjuvant, and used to immunize a host animal to produce an antibody that binds to the antigen. Lymphocytes secreting monoclonal antibodies are harvested and fused with myeloma cells to produce hybridomas. The hybridoma clones thus formed are screened to identify and select those secreting the desired monoclonal antibody.

[0065] In certain embodiments, the antibodies provided herein can be prepared by recombinant techniques. In related aspects, isolated nucleic acids encoding the disclosed amino acid sequences are also provided, along with vectors containing such nucleic acids and host cells transformed or transfected with the nucleic acids.

[0066] For example, nucleic acids comprising nucleotide sequences encoding heavy and light chain variable regions of such antibodies can be cloned into expression vectors (e.g., bacterial vectors such as E. coli vectors, yeast vectors, viral vectors, or mammalian vectors) by conventional techniques, and either vector can be introduced into appropriate cells (e.g., bacterial cells, yeast cells, plant cells, mammalian cells) for expression of the antibody. Examples of nucleotide sequences encoding the heavy and light chain variable regions of the antibodies described herein are shown in Table 1. Examples of mammalian host cell lines include human embryonic kidney lines (293 cells), baby hamster kidney cells (BHK cells), Chinese hamster ovary cells (CHO cells), African green monkey kidney cells (VERO cells), and human liver cells (Hep G2 cells). Recombinant vectors for expressing the antibodies described herein usually contain a nucleic acid encoding the antibody amino acid sequence operably linked to either a constitutive or inducible promoter. Common vectors contain transcription and translation terminators, initiation sequences, and promoters useful for controlling expression of the nucleic acid encoding the antibody. The vectors may contain both prokaryotic and eukaryotic selectable markers, if desired. In some instances, coding sequences for both the heavy and light chains are contained in the same expression vector. In other instances, each of the heavy and light chains of an antibody may be cloned into a separate vector, produced separately, and then incubated under conditions suitable for antibody assembly.

[0067] Recombinant vectors for expressing the antibodies described herein typically contain a nucleic acid encoding an antibody amino acid sequence operably linked to either a constitutive or inducible promoter. Recombinant antibodies can be produced in prokaryotic or eukaryotic expression systems, such as bacteria, yeast, insect, or mammalian cells. Typical vectors contain transcription and translation terminators, initiation sequences, and promoters useful for controlling expression of the nucleic acid encoding the antibody. Vectors can contain selectable markers for both prokaryotic and eukaryotic systems, if desired. The produced antibody protein can be further isolated or purified to obtain a substantially homogenous preparation for further assays and applications. Suitable purification procedures include, for example, immunoaffinity or ion exchange column fractionation, ethanol precipitation, sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE), high performance liquid chromatography (HPLC), ammonium sulfate precipitation, and gel filtration.

[0068] When full-length antibodies are desired, the V H Chain and V L The coding sequence for either chain can be linked to the coding sequence for the Fc region of an immunoglobulin, and the resulting genes encoding full-length antibody heavy and light chains can be expressed and assembled in a suitable host cell, such as a plant cell, a mammalian cell, a yeast cell, or an insect cell.

[0069] Antigen-binding fragments can be prepared by conventional methods. For example, F(ab')2 fragments can be generated by pepsin digestion of full-length antibody molecules, and Fab fragments can be generated by reducing the disulfide bonds of F(ab')2 fragments. Alternatively, such fragments can be prepared recombinantly by expressing heavy and light chain fragments in a suitable host cell and assembling them to form the desired antigen-binding fragment either in vivo or in vitro. Single-chain antibodies can be prepared recombinantly by linking a nucleotide sequence encoding a heavy chain variable region and a nucleotide sequence encoding a light chain variable region. Preferably, a flexible linker is incorporated between the two variable regions.

[0070] An antibody can be further modified to conjugate one or more additional elements, such as another protein and / or a drug or carrier, to the N-terminus and / or C-terminus of the antibody. Preferably, the antibody with the additional elements attached retains the desired binding specificity and therapeutic effect while providing additional properties due to the additional elements that aid in, for example, solubility, storage or other handling properties, cell permeability, half-life, reduction of hypersensitivity, delivery and / or distribution control. Other embodiments include conjugation of labels, such as dyes or fluorescent dyes, for assay, detection, tracking, etc. In some embodiments, the antibody can be conjugated to additional elements, such as peptides, dyes, fluorophores, carbohydrates, anticancer drugs, lipids, etc. Additionally, the antibody can be directly conjugated to the surface of a liposome via the Fc region, for example, to form an immunoliposome.

[0071] In certain embodiments, the second inhibitor (the HGFR inhibitor) inhibits binding of HGF to HGFR.

[0072] In some embodiments, the second inhibitor (HGFR inhibitor) is a small molecule tyrosine kinase receptor inhibitor compound of HGFR. Table 2 provides some examples of small molecule HGFR inhibitor compounds.

[0073] [Table 2-1] [Table 2-2]

[0074] Further examples of HGFR inhibitor compounds useful in the present invention include, but are not limited to, AMEP (Bioalliance), EMD-1204831 (Merck KgaA / EMD Serono), INCB-028060 (Incyte / Novartis), ARQ197 (ArQule), AMG102 (Amgen) and RG-3638 (Roche / Genentech).Details are described, for example, in WO2012042421A1, the entire contents of which are incorporated herein by reference.

[0075] As used herein, the term "small molecule HGFR inhibitor compound" or "small molecule HGFR inhibitor" includes small molecule compounds that inhibit or bind to HGFR. Unless otherwise specified, references herein to small molecule HGFR inhibitors include references to pharmaceutically acceptable salts, solvates, hydrates and complexes thereof, and solvates, hydrates and complexes of pharmaceutically acceptable salts thereof, including polymorphs, stereoisomers and isotopically labeled forms thereof.

[0076] As used herein, the term "pharmaceutically acceptable salts" includes acid addition salts. "Pharmaceutically acceptable acid addition salts" refers to salts that retain the biological effectiveness and properties of the free bases formed with inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, and organic acids such as acetic acid, propionic acid, pyruvic acid, maleic acid, malonic acid, succinic acid, fumaric acid, tartaric acid, citric acid, benzoic acid, mandelic acid, methanesulfonic acid, ethanesulfonic acid, p-toluenesulfonic acid, salicylic acid, trifluoroacetic acid, and the like. The term "pharmaceutically acceptable salts" also includes base salts. Suitable base salts are formed from bases that form non-toxic salts. For example, aluminum salts, arginine salts, benzathine salts, calcium salts, choline salts, diethylamine salts, diolamine salts, glycine salts, lysine salts, magnesium salts, meglumine salts, olamine salts, potassium salts, sodium salts, tromethamine salts, zinc salts, and the like.

[0077] The term "effective amount" as used herein means the amount of an active ingredient to give a desired biological effect to a treated subject or cell. The effective amount may vary for various reasons, such as the route of administration and frequency of administration, the weight and type of the individual to whom the drug is administered, and the purpose of administration. Those skilled in the art can determine the dosage for each case based on the description herein, established methods, and their own experience.

[0078] The subject to be treated by the treatment methods described herein may be a mammal, more preferably a human. Mammals include, but are not limited to, farm animals, sport animals, pets, primates, horses, dogs, cats, mice, rats, etc.

[0079] As used herein, "a pharma- ceutically acceptable carrier" means that the carrier is compatible with the active ingredient in the composition, preferably capable of stabilizing the active ingredient, and is safe for the recipient individual. The carrier may be a diluent, vehicle, excipient, or matrix for the active ingredient. In general, the composition containing the active ingredient, such as an EpCAM inhibitor, an HGFR inhibitor, or a combination thereof, may be formulated in the form of a solution, such as an aqueous solution, e.g., saline, or may be provided in the form of a powder. Suitable excipients include lactose, sucrose, dextrose, sorbose, mannose, starch, gum arabic, calcium phosphate, alginate, gum tragacanth, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, sterile water, syrup, and methylcellulose. The composition may further include pharma-ceutically acceptable auxiliary substances necessary to approximate physiological conditions, such as pH adjusting agents and buffers, such as sodium acetate, sodium chloride, potassium chloride, calcium chloride, sodium lactate, etc. The composition may be in the form of tablets, pills, powders, lozenges, sachets, troches, elixirs, suspensions, lotions, solutions, syrups, soft and hard gelatin capsules, suppositories, sterile injections, and packaged powders.The composition of the present invention can be delivered by any physiologically acceptable route, including oral, enteral (intramuscular, intravenous, subcutaneous and intraperitoneal, etc.), transdermal, suppository, and nasal.In certain embodiments, the composition of the present invention is administered as a liquid injection dosage form that can be provided as a ready-to-use dosage form or as a stable powder that can be reconstituted.

[0080] In some embodiments, the two active components of the present invention, EpCAM inhibitor and HGFR inhibitor, can be formulated in the form of a kit, either as a mixture or separately, for simultaneous administration, separate administration or sequential administration to subject.Each component can be formulated with suitable pharma- ceutically acceptable carrier for suitable administration route.In some embodiments, EpCAM inhibitor and HGFR inhibitor can be provided in suitable packaging unit, where EpCAM inhibitor or the composition comprising it and HGFR inhibitor or the composition comprising it are in separate packaging unit.

[0081] According to the present invention, the combination of EpCAM inhibitor and HGFR inhibitor provides synergistic effects in the treatment of cancer, particularly in inhibiting migration / invasion of cancer cells, reducing tumor size, reducing or suppressing tumor progression, metastasis, and / or prolonging the survival time of cancer patients, compared with EpCAM inhibitor or HGFR inhibitor alone. In particular, in metastatic and orthotopic animal models shown in the examples (e.g., Example 2.8), all animals in the control IgG and HGFR inhibitor (crizotinib) groups show significant tumor growth and poor survival time, while the group administered with EpCAM neutralizing antibody (EpAb2-6) as an EpCAM inhibitor shows slow tumor progression and high median survival time, and surprisingly, the combination therapy using EpCAM neutralizing antibody (EpAb2-6) as an EpCAM inhibitor and HGFR inhibitor (crizotinib) has been shown to provide a significant synergistic effect in suppressing tumor progression.

[0082] In some embodiments, the EpCAM inhibitor and the HGFR inhibitor are administered simultaneously, separately or sequentially to provide a synergistic anti-cancer or anti-metastatic effect, particularly where the cancer is susceptible to a synergistic combination.

[0083] In some embodiments, the cancer is selected from the group consisting of lung cancer, brain cancer, breast cancer, cervical cancer, colon cancer, gastric cancer, head and neck cancer, kidney cancer, leukemia, liver cancer, ovarian cancer, pancreatic cancer, prostate cancer, skin cancer and testicular cancer.

[0084] The present invention is further illustrated by the following examples, which are provided for purposes of illustration and not limitation. Those skilled in the art should, in light of the description herein, appreciate that many changes can be made to the specific embodiments described and still obtain like or similar results without departing from the spirit and scope of the invention. EXAMPLES

[0085] EpCAM signaling is known to promote colon cancer progression and metastasis. Although metastasis is one of the main causes of cancer treatment failure, the involvement of EpCAM signaling in the metastatic process is unclear. The present invention shows that the soluble extracellular domain of EpCAM (EpEX) binds to HGFR and induces downstream signaling in colon cancer cells. We also show that HGF treatment increases EpEX production, and that EpEX and HGF coordinately control HGFR signaling. Furthermore, EpEX enhances the metastatic potential of colon cancer cells by activating ERK and FAK-ACT signaling pathways, and further stabilizes activated β-catenin and Snail proteins by reducing GSK3β activity. Finally, we show that combination therapy of anti-EpCAM neutralizing antibody (EpAb2-6) and HGFR inhibitor (crizotinib) significantly suppresses tumor progression and extends survival in metastatic and orthotopic animal models of colon cancer. These findings reveal the molecular mechanism by which EpCAM signaling promotes colon cancer metastasis and further suggest that the combination of EpAb2-6 and crizotinib may be an effective strategy for the treatment of colon cancer.

[0086] 1. Materials and Methods 1.1 Compounds and antibodies Anti-α-tubulin and GAPDH antibodies were obtained from Sigma-Aldrich. Antibodies against human EpCAM, total ERK and Thr202 / Tyr204-phosphorylated ERK, total AKT, Ser473-phosphorylated AKT, total HGFR, Tyr1234 / 1235-phosphorylated HGFR, non-phosphorylated (active) β-catenin (Ser45), β-catenin, E-cadherin, vimentin, Snail, Slug, and Twist were obtained from Cell Signaling Technology. LY294002 (AKT inhibitor) was also obtained from Cell Signaling Technology. Foretinib (HGFR inhibitor), SU11274 (HGFR inhibitor), U0126 (MEK inhibitor), PF-562271 (FAK inhibitor), and BIO (GSK3β inhibitor) were obtained from Selleck Chemicals. Crizotinib (HGFR inhibitor) was obtained from Med Chem Express. Antibodies against total GSK3β, phosphorylated GSK3β (phospho-S9), phosphorylated ADAM17 (phospho-T735), total ADAM17, phosphorylated presenilin2 / AD5 (phospho-S327), total presenilin2 / AD5, V5 tag, 6x His tag, c-Myc tag, and Met(pY1234 / pY1235)+total Met ELISA kit (ab126451) were obtained from Abcam. Human HGFR (c-MET) and HGF recombinant proteins were obtained from Sino Biological Company.

[0087] 1.2 Cell lines and culture The following human cell lines were used: HEK293T, colon cancer cell line HCT116 (ATCC: CCL-247), and HT29. Cells were cultured in Dulbecco's modified Eagle's medium (DMEM; Gibco) supplemented with 10% fetal bovine serum (FBS; Gibco) and 100 μg / ml penicillin / streptomycin (P / S; Gibco) at 37 °C in a humidified incubator with 5% CO2.

[0088] 1.3 Mammalian lentiviral shRNA For knockdown experiments, human EpCAM shRNA in pLKO vector was obtained from the RNAi core facility at Academia Sinica. Lentivirus was produced according to standard protocols with minor modifications. Briefly, 293T cells were seeded at 70% density in 100 mm dishes and transfected with packaging vectors (i.e., pCMV-ΔR8.91 (containing gag, pol and rev genes)), envelope vectors (i.e., pMD2.G; VSV-G expression plasmid), and individual shRNA vectors. shRNA plasmids were transfected into 293T cells using Polyjet transfection reagent (SignaGen Laboratories). After overnight culture, the medium was changed to BSA-containing medium. HCT116 cells were infected with viral supernatant containing polybrene (8 μg / ml) for 24 h, and after repeating the infection procedure, cells were incubated in puromycin (2 μg / ml) for 7 days to select cells with stable shRNA expression.

[0089] 1.4 EpCAM gene knockout For EpCAM knockout, CRISPR / cas9 gRNA constructs were purchased from Genescript. To produce lentivirus, 293T cells were transiently transfected with CRISPR / cas9 gRNA plasmid, EpCAM gRNA (target sequence: GTGCACCAACTGAAGTACAC, SEQ ID NO: 21), packaging plasmid (pCMV-ΔR8.91) and envelope expression plasmid (pMD.G). HCT116 or HT29 cells were cultured in lentivirus-containing medium and selected with 2 μg / ml puromycin. Single cell clones were isolated from the selected pool and examined for EpCAM expression by Western blotting.

[0090] 1.5 Production and purification of EpEX-His recombinant protein Recombinant proteins were expressed and purified using the Expi293 expression system. Cells were cultured in Expi293 expression medium, and protein expression was induced by the addition of enhancer reagent. The supernatant was collected by centrifugation and centrifuged at 8000g for 20 min at 4°C. The supernatant was then incubated with nickel chelate affinity resin (Ni-NTA, Qiagen) for 2 h at 4°C. The resin was washed with a wash buffer containing 50 mM Tris-HCl (pH 8.0), 500 mM NaCl, and 20 mM imidazole, and the protein was eluted with an elution buffer containing 50 mM Tris-HCl (pH 8.0), 500 mM NaCl, and 250 mM imidazole.

[0091] 1.6 Construction of EpCAM EGF-like domain deletion mutants The extracellular domain of EpCAM contains two EGF-like domains, amino acids 27-59 (first EGF-like domain) and amino acids 66-135 (second EGF-like domain), as well as a cysteine-free motif (Schnell et al., 2013). EpCAM EGF-like domain deletion mutants were generated using standard QuikChange PCR with a first forward mutagenesis deletion primer (5'-GCAGCTCAGGAAGAATCAAAGCTGGCTGCC-3', SEQ ID NO:22), a first reverse mutagenesis deletion primer (5'-GGCAGCCAGCTTTGATTCTTCCTGAGCTGC-3', SEQ ID NO:23), a second forward primer (5'-AAGCTGGCTGCCAAATCTGAGCGAGTGAGA-3', SEQ ID NO:24) and a second reverse primer (5'-TCTCACTCGCTCAGATTTGGCAGCCAGCTT-3', SEQ ID NO:25). (商標) The deletion mutation system was used to generate the PCR amplification, which was performed using KAPA HiFi Hot Start DNA polymerase (Kapa Biosystems), and the products were treated with the restriction enzyme DpnI (Thermo Scientific) to digest the methylated parental DNA.

[0092] 1.7 Immunoprecipitation assay Cells were lysed in lysis buffer (50 mM Tris-HCl, pH 7.4, 150 mM NaCl and 1% NP-40) supplemented with protease inhibitors (Roche). For immunoprecipitation, cell lysates were incubated with antibodies for 6 h at 4 °C. Then, 20 μL of Dynabeads Protein G was added and incubated for 2 h at 4 °C to pull down antibody-bound proteins. Immunoprecipitated samples were washed three times with PBS, denatured in sample buffer, and analyzed by Western blotting.

[0093] 1.8 Production of monoclonal antibodies and purification of IgG The generation of EpAb2-6 and control IgG was performed as previously described ( Liao et al., 2015 ). The experimental protocol was approved by the Academia Sinica Animal Experiment Ethics Committee (AS IACUC: 11-04-166).

[0094] 1.9 Protein extraction and immunoblotting Whole cell extracts were prepared in RIPA buffer (50 mM Tris-HCl pH 7.4, 1% NP-40, 0.5% sodium deoxycholate, 0.1% SDS, 150 mM NaCl, 2 mM EDTA, 50 mM NaF). Protein concentrations of cell lysates were measured by Bradford assay. Lysates were separated on 10% polyacrylamide gels and transferred to PVDF membranes. Membranes were blocked with 3% BSA in PBST for 1 h. Then, membranes were incubated overnight with primary antibodies. Appropriate horseradish peroxidase-associated secondary antibodies (Millipore) were applied and membranes were incubated for 1 h at room temperature (RT). Protein bands were then visualized with chemiluminescence reagents (Millipore) and detected with a BioSpectrum 600 Imaging system (UVP). Protein levels were quantified from band intensity using Gel-Pro analyzer 3.1 (Media Cybernetics).

[0095] 1.10 Cell viability assay Cell viability was assayed by measuring mitochondrial dehydrogenase activity with the WST-1 (4-[3-(4-iodophenyl)-2-(4-nitrophenyl)-2H-5-tetrazolio]-1,3-benzidinedisulfonic acid) assay. Cells were plated in 96-well plates at 10 4 Cells were seeded at a density of 100 cells / well and cultured for 24 hours. Fresh medium supplemented with EGF, EpEX or deglycan-EpEX at the indicated concentrations was added to the cells. After the treatment period, 10 μl of WST-1 proliferation reagent (5 μg / ml) was added to each well and incubated at 37°C for 1 hour. After incubation, the absorbance of each well was detected at 450 nm using a spectrophotometer microplate reader.

[0096] 1.11 Colony formation assay Cells were seeded in 24-well plates (1 × 10 4 The plates were cultured at 100 x 100 nm (cells / well) for 7 days. The cells were then fixed with 4% formaldehyde and stained with crystal violet solution. After the plates were photographed, 0.5% SDS solution was added to each well and the plates were incubated at room temperature for 2 hours. The absorbance at 570 nm was then measured using a microplate reader to determine the relative density of the cells. The experiment was performed in triplicate.

[0097] 1.12 Transwell migration and invasion assays Cell migration and invasion were assayed using 8 μm pore size transwell migration chambers (Millicell) without or with 10% Matrigel. Cells (1 × 10 5) was added to the upper chamber in 500 μl of serum-free DMEM. Then, 700 μl of DMEM containing 10% FBS was added to the lower chamber as a chemoattractant. Migration and invasion were allowed to proceed for 16 h at 37 °C in a standard cell culture incubator. Afterwards, cells were removed from the upper surface of the membrane with a cotton swab, and cells that had migrated to the lower surface were stained with 0.05% (w / v) crystal violet in 4% paraformaldehyde (in 1x PBS) for 15 min and washed with water. After drying the membrane for 15-20 min, at least four random fields on the membrane observed at high magnification were counted for each experimental condition.

[0098] 1.13 Apoptosis assay Cells were seeded and treated with 10 μg / ml mAb or inhibitor for 6 h. An irrelevant mouse myeloma immunoglobulin at appropriate dilutions was used as an isotype control for IgG2a (Invitrogen #02-6200). Apoptotic cells were detected using Annexin V-FITC and PI and analyzed using a flow cytometer (BD Immunocytometry Systems). Early apoptosis was measured using Annexin V-FITC Apoptosis Detection Kit II (BD Pharmingen). Late apoptotic nuclei were detected by propidium iodide (PI) staining.

[0099] 1.14 RNA extraction, cDNA synthesis, and quantitative reverse transcription polymerase chain reaction (qRT-PCR) Total RNA extraction, first-strand cDNA synthesis, and SYBR-green-based real-time PCR were performed as described in the manufacturer's instructions. To extract total RNA, cells were lysed using TRIzol reagent (Invitrogen), and chloroform was used to remove proteins and phenol from TRIzol. After centrifugation, the upper colorless layer was collected and mixed with isopropanol to precipitate the RNA pellet. The RNA pellet was then washed with 70% ethanol, air-dried at room temperature, and then dissolved in RNase-free water. For first-strand cDNA synthesis, 5 μg of total RNA was used and reverse-transcribed for 60 min at 50 °C using oligo(dT) primers and SuperScriptIII reverse transcriptase (Invitrogen). Target gene levels were assessed by quantitative PCR (qPCR) using LightCycler 480 SYBR Green I Master Mix (Roche) and the LightCycler480 System (Roche). GAPDH mRNA expression was measured as an endogenous housekeeping control to normalize all q-PCR reactions. The qPCR reaction was performed at 95°C for 5 min, followed by 40 cycles of denaturation at 95°C for 10 s, annealing at 60°C for 10 s, and extension at 72°C for 30 s. The primer sequences used to detect the mRNA expression of the target genes are shown in Table 3.

[0100] [Table 3]

[0101] 1.15 Colon cancer metastasis animal model Colon cancer HCT116 or HT29 (5 × 10 6EpAb2-6 (15 mg / kg) or a combination of EpAb2-6 (15 mg / kg) and crizotinib (20 mg / kg) were administered orally to tumor-bearing mice. The mice were then randomly assigned to different treatment groups according to their body weight. Three days later, the antibodies were administered via tail vein injection twice a week for 4 consecutive weeks. Crizotinib was administered orally daily for 5 days a week (treatment period 4 weeks). In the treatment study, tumor-bearing mice were administered isotype control IgG1 (15 mg / kg), crizotinib (20 mg / kg), EpAb2-6 (15 mg / kg), or a combination of crizotinib (20 mg / kg) and EpAb2-6 (15 mg / kg). The survival rate of the mice was measured. Animal care was performed in accordance with the guidelines of Academia Sinica, Taiwan. The protocol was approved by the Academia Sinica Animal Experiment Ethics Committee (AS IACUC: 20-05-1468).

[0102] 1.16 Orthotopic Implantation and Therapeutic Trials Orthotopic tumor models were created as previously reported (Chen et al., 2020). Briefly, NSCID mice were orthotopically implanted with HCT116 cells previously infected with Lenti-luc virus (lentivirus containing luciferase gene). Mice were anesthetized with intraperitoneal (i.p.) injection of Avertin, 2,2,2-tribromo-ethanol (Sigma-Aldrich) at a dose of 250 mg / kg. Tumor growth was measured by bioluminescence imaging. For therapeutic studies, tumor-bearing mice were administered isotype control IgG1 (15 mg / kg), crizotinib (20 mg / kg), EpAb2-6 (15 mg / kg), or a combination of crizotinib (20 mg / kg) and EpAb2-6 (15 mg / kg). Tumor progression was measured by quantification of bioluminescence. Mouse survival rates were also measured. Animal care was performed in accordance with Academia Sinica guidelines. The protocol was approved by the Academia Sinica Animal Experiment Ethics Committee (AS IACUC: 20-05-1468).

[0103] 1.17 Statistical analysis All data are presented as the mean ± SEM of the indicated number of experiments. Analysis of percentage expression in experimental vs. control cultures was performed using unpaired Student's t-test. A p value of <0.05 was considered statistically significant.

[0104] 2.Results 2.1 EpEX induces phosphorylation of HGFR through its interaction with HGFR In our previous study, we performed a Human Phospho-RTK Array Kit (R&D Systems) assay and found that EpEX induced phosphorylation of both EGFR and HGFR in HCT116 cells (Liang et al., 2018). To examine whether endogenous EpCAM directly interacts with HGFR in HCT116 and HT29 colon cancer cell lines, we stabilized the putative EpCAM-HGFR complex using a crosslinker, DTSSP. As expected, the interaction between EpCAM and HGFR was confirmed by immunoprecipitation (IP) and Western blotting (Figure 1A). Furthermore, we found that membrane-bound EpCAM binds to the extracellular domain of HGFR (HGFR ECD ) to investigate whether they could bind to EpCAM-V5 and HGFR ECD We performed co-IP experiments using HEK293T cells overexpressing both EpEX-Fc and c-Myc-tag. The results confirmed the interaction between exogenous EpCAM and HGFR (Figure 1B). Next, we used recombinant EpEX-Fc and HGFR ECD- IP was performed to examine the direct interaction with the His recombinant protein (Figure 1C). To examine the effect of EpEX on the phosphorylation of HGFR in colon cancer cells, the levels of phosphorylated HGFR in HCT116 and HT29 cells were analyzed. Western blotting and ELISA results showed that both EpCAM and EpEX induced phosphorylation of HGFR in both cell types. Indeed, only EpEX was able to induce phosphorylation of HGFR in the absence of EpCAM (Figure 1D, E).

[0105] Because EpEX is composed of two EGF-like domains (Schnell et al., 2013), we attempted to determine which domain interacts with HGFR by analyzing various EGF-like domain deletion mutants (EpCAM ΔEGFI+II , EpCAM ΔEGFI , EpCAM ΔEGFII Surprisingly, a mutant with only one deletion of the EGF-like domain (EpCAM ΔEGFI and EpCAM ΔEGFII ) was able to interact with HGFR, whereas a mutant lacking both domains (EpCAM ΔEGFI+II ) did not show such results (Figure 1F). Similar results were observed in HGFR ECD This was also observed when binding of EpCAM to soluble EpEX wild-type or mutant proteins was assessed (Figure 1G). Overall, these findings indicate that both membrane-bound EpCAM and secreted EpEX can bind to HGFR via either EGF domain I or II of EpCAM / EpEX.

[0106] Next, we performed ELISA to examine the potential interactions of several EGF-like domain deletion mutants of EpEX-Fc with the HGFR-His protein. ΔEGFI+II HGFR binding to the mutant proteins was completely abolished, confirming that EpEX binds to HGFR through both of its domains (Fig. 1H). Similar to the phosphorylation results for wild-type EpEX (Fig. 1D and E), EpEX ΔEGFI and EpEX ΔEGFII Both induced phosphorylation of HGFR and EpEX ΔEGFI+II From these results, we concluded that EpEX binds to HGFR and thus induces its phosphorylation.

[0107] 2.2 EpEX promotes tumor progression via HGFR signaling EpCAM induces phosphorylation of HGFR, suggesting that this pathway may be partially involved in tumorigenesis of colon cancer cells. To investigate whether activation of EpCAM and HGFR cooperate to control cancer progression and metastasis, we examined the levels of phosphorylated ERK and AKT in EpCAM knockout cells with or without HGF treatment. Western blotting results showed that phosphorylation of HGFR, AKT and ERK was not affected by HGF treatment in EpCAM knockout HCT116 and HT29 cells (Figure 2A). Furthermore, cell proliferation assays showed that EpCAM knockout cells proliferated slower than wild-type HCT116 and HT29 cells, but the trajectory of cell proliferation could be restored by treating EpCAM knockout HCT116 and HT29 cells with HGF (Figure 2B).

[0108] To investigate whether EpEX can induce cancer progression and invasion through HGFR signaling, we analyzed the phosphorylation of EGFR, ERK, and AKT in colon cancer cells after combined treatment with EpEX-His and SU11274, a tyrosine kinase inhibitor of HGFR. The results showed that SU11274 could suppress EpEX-mediated phosphorylation of ERK and AKT in HCT116 and HT29 cells (Figure 2C). To further understand the effect of such inhibition on cell proliferation, we found that EpEX treatment alone promoted the proliferation of HCT116 and HT29 cells, while SU11274 abolished the EpEX-induced increase in cell viability and proliferation in colon cancer cells (Figure 2D).

[0109] Furthermore, HGFR knockdown decreased the phosphorylation levels of HGFR, EGFR, AKT, and ERK. Interestingly, HGFR knockdown also decreased EGFR phosphorylation levels (Figure 2E). Furthermore, HGFR knockdown reduced EpEX-induced RIP (phosphorylated ADAM17 and presenilin 2) (Figure 2F) and nuclear translation of active β-catenin (Figure 2G). In addition, in HCT116 cells, HGFR knockdown significantly reduced both EpEX-induced cell proliferation and colony formation (Figure 2H and Figure 2I). Indeed, using IP assays, we found that EpEX production was elevated after HGF treatment of HCT116 cells (Figure 2J). We also found that HGF treatment increased ADAM17 phosphorylation, presenilin 2 phosphorylation, and EpEX production in HCT116 cells (Figure 2K).

[0110] 2.3 EpEX activates ERK and FAK-ACT signaling EpCAM is known to affect cancer cell proliferation, survival and metastasis through its downstream effectors. In the process of its signaling, proteolysis of EpCAM produces EpEX, which further stimulates RIP to release EpICD, which is thought to transduce the EpCAM signal (Lin et al., 2012). In addition, it has been previously shown that EpEX treatment of HCT116 cells can increase RIP through phosphorylation of TACE and presenilin 2, the catalytic subunit of γ-secretase (Liang et al., 2018). Therefore, we treated EpCAM knockout HCT116 cells with EpEX, which partially restored HGFR downstream signaling, such as phosphorylation of AKT, FAK and ERK, as well as phosphorylation of RIP proteins (ADAM17 and presenilin 2) (Figure 3A). Previous studies have shown that GSK3β antagonists stimulate EMT through AKT (An et al., 2020). In line with this mechanism, we found that EpEX rescued inhibitory phosphorylation of GSK3β (S9, inactive GSK3β) and simultaneously reduced activating phosphorylation of GSK3β (Y216, active GSK3β) in EpCAM knockout cells (Fig. 3A). We also found that EpEX increased colony formation in EpCAM knockout HCT116 cells (Fig. 3B). Furthermore, inhibition of shedding of endogenous EpEX, but not EpICD, reduced phosphorylation of HGFR, AKT, and ERK, suggesting that endogenous EpEX is important for HGFR signaling activation (Fig. 3C).

[0111] Next, we tested whether EpEX enhances HGF-induced HGFR signaling. Incubation of HCT116 and HT29 cells with soluble EpEX and HGF increased the phosphorylation of HGFR and subsequent downstream phosphorylation, including AKT and ERK, compared with EpEX or HGF treatment alone (Figure 3D). Because EpEX induces HGFR activation, we further investigated the effect of EpEX on mediators of HGFR signaling. Herein, AKT signaling and ERK signaling are two of the most important cancer-related signaling pathways, as they play various physiological roles in controlling EMT, cell cycle, survival and cancer progression (Chang et al., 2013; Sun et al., 2015). Therefore, we tested whether HGFR inhibitor (SU11274), AKT inhibitor (LY294002), ERK inhibitor (U0126) and FAK inhibitor (PF-562271) affected EpEX-induced signal transduction in HCT116 cells. EpEX increased the phosphorylation levels of AKT, ERK and FAK (Figure 3E), colony formation ability (Figure 3F), wound healing ability (Figure 3G) and migration ability (Figure 3H). These results indicated that EpEX increased the ERK and FAK-ACT signal transduction pathway by inducing the activation of HGFR in colon cancer cells.

[0112] 2.4 EpEX induces the expression of active β-catenin and Snail through downregulation of GSK3β activity, promoting EMT and invasion We found that knockout of EpCAM enhanced the expression of E-cadherin in HCT116 cells, while suppressing the expression of mesenchymal marker Vimentin and the level of Snail protein, an EMT regulator (Figure 4A).EpEX also induced cell invasion in EpCAM knockout HCT116 cells (Figure 4B).

[0113] To investigate whether EpCAM and HGFR activation cooperate to control cancer cell invasion, EpCAM knockout cells were tested with or without HGF treatment. We found that the expression of EMT-related proteins and cell invasive properties were significantly reduced in EpCAM knockout HCT116 and HT29 cells compared to wild-type cells. HGF-induced EMT and invasive activity was also reduced in EpCAM knockout cells (Figure 4C and Figure 4D). Incubation of HCT116 and HT29 cells with a combination of EpEX and HGF increased the levels of EMT and cell invasion compared to EpEX or HGF treatment alone (Figure 4E and Figure 4F). Furthermore, knockdown of HGFR prevented EpEX-induced EMT-related protein expression and cell invasion (Figure 4G and Figure 4H). These results suggest that EpEX promotes HGFR activation and induces EMT and metastasis of colon cancer cells.

[0114] Previous reports have shown that GSK3β antagonists stimulate EMT by AKT signaling, which in turn affects the turnover of SNAIL protein through phosphorylation and ubiquitin-mediated protein degradation (An et al., 2020). In relation to this mechanism, we found that EpEX induced inhibitory phosphorylation of GSK3β (S9, inactive GSK3β), while decreasing activating phosphorylation of the protein (Y216, active GSK3β). These changes were consistent with increased expression of SNAIL protein in HCT116 cells. However, SU11274 was able to attenuate EpEX-mediated GSK3β activity and abolish EpEX-induced expression of active β-catenin and SNAIL protein in HCT116 cells (Figure 4I). We also found that inhibitors of HGFR downstream mediators (i.e., LY294002, U0126 and PF-562271) attenuated EpEX-mediated GSK3β activity and SNAIL protein expression (Figure 4J). EpEX-induced invasion was also suppressed by LY294002, U0126 and PF-562271 (Figure 4K). Of note, the expression of active β-catenin and SNAIL protein was elevated in both control and EpEX-treated cells after treatment with BIO, a GSK3β inhibitor (Figure 4L). These results suggest that EpEX promotes EMT and invasion by inducing the expression of active β-catenin and SNAIL protein via downregulation of GSK3β activity.

[0115] 2.5 EpEX promotes the stability of SNAIL proteins by inhibiting their ubiquitination-mediated proteasomal degradation We analyzed the effect of EpCAM on EMT-related gene expression by transfecting colon cancer cells with lentivirus expressing Cas9 and sgRNA targeting EpCAM. As a result, EpCAM knockout increased the gene expression of E-cadherin and decreased the gene expression of VIM. However, EpCAM knockout did not affect the SNAIL gene expression level (Figure 5A). In fact, we found that cyclohexamide treatment shortened the half-life of Snail protein in EpCAM knockout cells (Figure 5B). Meanwhile, treatment with MG132 (an inhibitor of the 26S proteasome) increased the steady-state protein level of Snail, indicating that the protein level is largely controlled by proteasomal degradation (Figure 5C). EpCAM knockout also increased the level of ubiquitinated Snail compared to control cells (Figure 5D). Furthermore, cyclohexamide treatment further confirmed that EpEX extended the half-life of Snail protein (Figure 5E). EpEX did not affect the expression levels of the Snail gene ( Fig. 5F ), but MG132 increased the Snail steady-state protein levels in HCT116 cells with or without EpEX treatment ( Fig. 5G ).

[0116] In this regard, two consensus motifs in the serine-rich region of SNAIL (motif 1: S97, S101; motif 2: S108, S112, S116, S120) are crucial for post-transcriptional regulation and ubiquitination-mediated proteasomal degradation (Zhou et al., 2004). HCT116 cells were transfected with wild-type (Snail-WT) and three mutant (Snail-2SA, -4SA, and -6SA) SNAIL constructs (Figure 5H). Treatment of transfected cells with EpEX significantly increased the expression of Snail-WT and -2SA, but had no such effect on the expression of Snail-4SA and -6SA mutants (Figure 5I). These data suggest that EpEX regulates SNAIL protein stability through the serine-rich SNAIL consensus motif 2 in cancer cells. These results indicate that EpEX plays an important role in regulating EMT by promoting the stability of SNAIL protein in colon cancer cells.

[0117] 2.6 EpAb2-6 inhibits EpCAM and HGFR signaling and promotes the degradation of active β-catenin and Snail protein via activation of GSK3β

[0118] Previously, we developed a neutralizing antibody, EpAb2-6, that targets EpEX and induces apoptosis in cancer cells (Liang et al., 2018; Liao et al., 2015). Therefore, we used EpAb2-6 to block the function of EpEX in colon cancer cells and analyzed the phosphorylation levels of HGFR, AKT, FAK, GSK3β, ERK, ADAM17 and presenilin 2 in HCT116 cells. EpAb2-6 treatment reduced the phosphorylation of HGFR, AKT, ERK and FAK compared with control IgG treatment (Figure 6A). HGF treatment increased the phosphorylation levels of HGFR, AKT and ERK in HCT116 cells. Meanwhile, the levels of these phosphorylated proteins were significantly decreased in cells treated with EpAb2-6. Furthermore, the invasion and migration activity of HCT116 cells was also significantly reduced by EpAb2-6 treatment (Figure 6B). When HCT116 cells were treated with EpAb2-6 followed by HGF, the effect of EpAb2-6 on invasion and migration was partially blunted (FIGS. 6C and 6D).

[0119] Interestingly, EpAb2-6 reduced the binding of EpCAM to HGFR, as detected by IP of endogenous proteins in HCT116 cells (Figure 6E). To evaluate whether recombinant EpEX directly binds to HGFR, we performed ELISA to examine the interaction between purified EpEX-His and HGFR-Fc proteins. The binding activity of EpEX to HGFR was further confirmed by ELISA, and we also showed that the anti-EpCAM monoclonal antibody EpAb2-6 inhibited the binding of EpEX to HGFR (Figure 6F).

[0120] Following these tests, we analyzed the expression levels of EMT proteins in HCT116 cells treated with control IgG or EpAb2-6. The results showed that EpAb2-6 increased the levels of E-cadherin and decreased SNAIL and active β-catenin (Figure 6G). Furthermore, EpAb2-6 decreased the inhibitory phosphorylation of GSK3β at S9 (inactive GSK3β) and simultaneously increased the activating phosphorylation at Y216 (active GSK3β). These changes were expected to increase GSK3β activity and were consistent with the observed decrease in active β-catenin and SNAIL protein. Correspondingly, active β-catenin and SNAIL protein were increased upon treatment with BIO, a GSK3β inhibitor (Figure 6H). The steady-state protein levels of active β-catenin and SNAIL were decreased by treatment with EpAb2-6, whereas treatment with a proteasome inhibitor (MG132) increased the steady-state protein levels of active β-catenin and SNAIL (Figure 6I). Furthermore, EpAb2-6 reduced the half-life of SNAIL protein, as shown by cyclohexamide treatment assay (Figure 6J). These results suggest that EpAb2-6 inhibits the metastatic process by downregulating HGFR signaling, allowing the degradation of active β-catenin and SNAIL protein via increasing GSK3β activity.

[0121] We further tested whether the bivalent antibody fragment F(ab')2 of EpAb2-6 could bind to EpEX and induce apoptosis. The results showed that F(ab')2 of EpAb2-6 indeed bound to EpEX (Figure 7A) and induced apoptosis in colon cancer cells (Figure 7B). We also used an apoptosis assay to evaluate whether humanized EpAb2-6 (hEpAb2-6) and the human anti-EpCAM antibody adecatumumab (MT201) had similar activity. EpAb2-6 and hEpAb2-6 showed similar functional properties in terms of inducing apoptosis, whereas MT201 did not show such an effect in HCT116 or HT29 cancer cells (Figure 7C). We also found that both EpAb2-6 and hEpAb2-6 inhibited the phosphorylation of HGFR, AKT and ERK, whereas MT201 did not (Figure 7D). The levels of phosphorylated ADAM17 and presenilin 2 were also decreased after EpAb2-6 or hEpAb2-6 treatment, but MT201 antibody had no such effect (Figure 7E). Our data suggested that EpEX and HGFR cooperate to stimulate downstream HGFR signaling to promote tumor progression and cell invasion. We therefore wanted to further test the antitumor effect by simultaneously blocking both EpCAM signaling and HGFR signaling. Furthermore, we also found that the HGFR inhibitor crizotinib enhanced the apoptotic effect of EpAb2-6 on HCT116 and HT29 cancer cells (Figure 7F). In cell invasion assays, crizotinib enhanced the inhibitory effect of EpAb2-6 on the invasion of HCT116 and HT29 cells compared with control IgG (Figure 7G).

[0122] 2.7 EpAb2-6 binds to the EGF-like domains I and II of EpCAM Previous studies have identified the binding epitope of the EpAb2-6 antibody to be the LYD motif of EpCAM, which corresponds to amino acid residues 94-96. In particular, residue 95 (Y95) plays a major role in the binding of EpAb2-6 (Liao et al., 2015). Here, we found that EpEX binds to HGFR via EGF-like domains I and II (Figure 1F and Figure 1G), and EpAb2-6 can inhibit the binding of EpEX to HGFR (Figure 6E and Figure 6F). Therefore, we wanted to examine whether this antibody binds to EpCAM through both EGF-like domains of EpEX (Figures 8A, 8B, and 8C). To confirm that EpAb2-6 recognizes the LYD motif of EpCAM, we constructed cDNA sequences encoding the first EGF-like repeat (aa 27-59; EGF-I domain) and the second EGF-like repeat (aa 66-135; EGF-II / TY domain) of EpCAM. Then, mutations were introduced into each domain using PCR-based site-directed mutagenesis (Figure 8D). The reactivity of EpAb2-6 antibody against these EpCAM mutants was evaluated by immunofluorescence (Figure 8E), flow cytometry (Figure 8F), and cell ELISA (Figure 8G). Amino acid mutations at positions Y32 (EGF-I domain) or Y95 (EGF-II domain) of EpCAM caused a marked decrease in EpAb2-6 binding but did not affect MT201 binding. Thus, we conclude that EpAb2-6 binds to the EGF-I and EGF-II domains of EpEX, targeting amino acid residues Y32 and Y95, respectively.

[0123] 2.8 EpAb2-6 improves the efficacy of crizotinib treatment in an animal model of colon cancer In the animal model, treatment was started 72 hours after transplantation (Figure 9A). First, we investigated the effects of crizotinib and EpAb2-6 on the metastasis of colon cancer cells HCT116. NOD / SCID mice were intravenously injected with HCT116 cells, and 3 days after cell injection, crizotinib and EpAb2-6 were co-administered or the same amount of control IgG was administered. The median and overall survival of mice transplanted with HCT116 cells receiving the combination of EpAb2-6 and crizotinib was extended compared to the control IgG group (Figure 9B), supporting the idea that EpAb2-6 can improve the anti-metastatic effect of crizotinib in vivo.

[0124] Next, we tested the combined effect of EpAb2-6 and crizotinib as a therapeutic strategy in an orthotopic mouse model of colon cancer. As shown in Figure 9C, tumor growth was evaluated by in vivo monitoring of HT29-Luc and HCT116-Luc cells stably expressing firefly luciferase. Before the start of treatment (3 days after tumor cell implantation), tumor growth was observed in all mice. After treatment, the bioluminescence intensity of mice treated with EpAb2-6 or EpAb2-6 in combination with crizotinib was significantly reduced compared to the control IgG or crizotinib alone groups. Similar effects were also observed in orthotopic models implanted with HCT116 cells (Figure 9D and Figure 9E) or HT29 cells (Figure 9H and Figure 9I). Furthermore, in the orthotopic implantation models of HCT116 cells (Figure 9F) or HT29 cells (Figure 9J), body weight was not significantly different between treatment groups. The median and overall survival of mice implanted with HCT116 (Figure 9G) or HT29 (Figure 9K) cells treated with the combination of EpAb2-6 and crizotinib was significantly extended compared to the control IgG group. Overall, in the metastatic and orthotopic animal models, all animals in the control IgG and crizotinib groups developed significant tumors and had poor survival rates. On the other hand, the EpAb2-6 treatment group showed significantly slower tumor progression and a higher median survival than the control IgG or crizotinib treatment groups. Importantly, the inhibition of tumor progression was most pronounced in the combination treatment group.

[0125] 3. Discussion Because EpCAM expression correlates with tumorigenesis and metastasis in many cancers, we sought to elucidate the underlying mechanisms in this study.Here, we further show that EpEX-induced tumor progression and metastasis are mediated by HGFR signaling.

[0126] Many studies have revealed an association between high expression or activation of HGFR and poor prognosis of cancer patients (Birchmeier et al., 2003). High expression of HGFR indicates poor prognosis in thyroid cancer and non-small cell lung cancer (NSCLC), and is a predictor of tumor invasion and lymph node metastasis in colon cancer (Al-Saad et al., 2017; Takeuchi et al., 2003). Previous reports have also shown that blocking HGFR signaling can suppress tumor cell proliferation and metastasis in vitro and in vivo in models of gastric cancer and CRC (Smolen et al., 2006; Toiyama et al., 2012; Zou et al., 2007).

[0127] HGF is a cytokine that regulates epithelial cell proliferation and is expressed and secreted primarily by mesenchymal cells (Lassus et al, 2006; Taher et al, 2002). The main coordinator of HGF signaling is HGFR, and the complex program induced by this signaling pathway promotes proliferation, survival, matrix degradation, and migration. Together, HGFR and HGF form the basis of the critical epithelial and mesenchymal interactions required for wound closure and angiogenesis (Comoglio & Trusolino, 2002). Our results show that EpCAM knockout suppressed phosphorylation of HGFR in colon cancer cells, and the cell proliferation and migration capacity of EpCAM knockout HCT116 cells was significantly reduced compared to wild-type cells. When HGF treatment was restored to EpCAM knockout HCT16 cells, the effects of EpCAM on cell proliferation and migration were partially reversed. The ability of EpCAM to regulate the phosphorylation of HGFR strongly suggests that this pathway may play an important role in colon cancer cells.

[0128] Tyrosine kinase inhibitors (TKIs) are small molecule drugs that can target activated RTKs regardless of the presence of ligand by preventing ATP from reaching the ATP-binding pocket of the kinase domain (Pasquini & Giaccone, 2018). Drug resistance usually occurs through the acquisition of mutations in RTKs that abolish the effect of TKIs, or through the amplification of another RTK that stimulates similar signaling, such as HGFR (Sacher et al., 2014). Previously, our group used a human phospho-RTK array kit to screen the phosphorylation of RTKs in EpEX-Fc-treated and Fc-treated HCT116 colon cancer cells. The results showed that HGFR (MET)-tyrosine phosphorylation was stimulated by EpEX treatment (Liang et al., 2018). In this study, we found that HGFR phosphorylation was induced by incubating HCT116 colon cancer cells with soluble EpEX-His protein. Interestingly, an HGFR tyrosine kinase inhibitor (SU11274) suppressed EpEX-mediated phosphorylation of ERK and AKT. Furthermore, we confirmed that depletion of HGFR could suppress EpEX-induced cell proliferation and invasion, consistent with the effect of the HGFR inhibitor.

[0129] Many studies have shown that EMT is associated with cancer progression and metastasis (Iwatsuki et al., 2010). The process of EMT involves a complex series of reversible events in which epithelial cell adhesion is lost and cells are induced to adopt a mesenchymal phenotype. EMT endows tumors with stem cell-like plasticity required to acquire mesenchymal characteristics, allowing tumor cell dissemination and invasion (Sacchetti et al., 2021; Thiery & Sleeman, 2006). Cancer cells that have undergone EMT lose adhesion to epithelial cells, are induced to adopt mesenchymal properties, and have enhanced cell motility and invasiveness. Indicators of EMT include increased expression of mesenchymal markers such as vimentin, snail, and slug, and decreased expression of epithelial markers such as E-cadherin, which disrupts cell-cell junctions (Meng et al., 2012). Furthermore, cells that have undergone EMT are resistant to apoptosis. Many reports have shown that EMT in various cancer types can promote resistance to various types of therapeutic drugs (Singh & Settleman, 2010). Inhibiting EMT for therapeutic purposes can be achieved by targeting components of the tumor microenvironment that contribute to the activation of the EMT program in tumor cells (Shibue & Weinberg, 2017). For example, HGF induces the EMT program through HGFR signaling, thereby enhancing the invasive and metastatic potential of cancer cells and allowing the cells to survive in the bloodstream in an unanchored state. Previous reports have shown that the FAK-PI3K / AKT and MAPK signaling pathways promote migration and metastasis in colon cancer and glioblastoma (Golubovskaya, 2014; Song et al., 2016). Our data showed that inhibitors of these molecules (i.e., SU11274, LY294002, U0126 and PF-562271) could attenuate EpEX-induced migration and invasion in HCT116 cells.

[0130] Inhibition of GSK3β by EpEX signaling stabilizes both β-catenin and SNAIL, cooperatively inducing EMT-associated cell migration and invasion. Of note, although EMT correlates with high expression of non-phosphorylated (activated) β-catenin and nuclear translocation of β-catenin, overexpression of β-catenin alone does not necessarily promote EMT-associated processes (Kim et al., 2000; Zhou et al., 2004). Furthermore, SNAIL is a zinc-finger transcription factor that induces EMT by suppressing E-cadherin expression. Many oncogenic signals, such as PI3K / AKT, MAPK and Wnt, have been shown to inhibit GSK3β, leading to SNAIL stabilization and subsequent EMT (Zhou et al., 2004). Our data showed that EpEX induces EMT and invasion by stabilizing active β-catenin and SNAIL via decreasing GSK3β activity. Furthermore, our anti-EpCAM antibody inhibits EMT and invasion by increasing GSK3β activity, leading to the degradation of active β-catenin and Snail.

[0131] HGFR signaling is an important target for anticancer drug therapy, and great efforts have been made to develop antagonists of this pathway. Currently, many small molecule inhibitors against the HGFR tyrosine kinase domain are being evaluated in clinical trials. Overexpression of HGFR is known to promote drug resistance in many cancer cells, resulting in poor therapeutic efficacy and shorter patient survival (Yang et al., 2021; Zhao et al., 2020). For example, there is strong preclinical and clinical evidence showing that the HGFR signaling pathway is a major driver of multidrug resistance in multiple myeloma patients (Moschetta et al., 2013). As the primary mechanism of HGFR activation is ligand-independent HGFR overexpression, many of the HGFR inhibitors directly target its RTK activity rather than HGF ligands (Koch et al., 2020; Liang et al., 2020). Currently, two nonselective HGFR TKIs are approved: crizotinib for ALK- and ROS1-positive NSCLC (first approved in 2011) and cabozantinib for thyroid and kidney cancer (first approved in 2016) (Kobayashi et al., 2016; Shaw et al., 2014). The relevance of HGFR inhibition is being actively evaluated, with several ongoing clinical trials of crizotinib. Results from one crizotinib trial suggested some promise for the treatment of NSCLC with HGFR exon 14 skipping mutations (Paik et al., 2015). The phase I MErCuRIC1 trial is evaluating the combination of crizotinib with a MEK inhibitor in a cohort of CRC patients with amplified HGFR and wild-type or mutated RAS (NCT02510001) (Van Schaeybroeck et al., 2015). A previous report demonstrated that crizotinib could inhibit the HGF / STAT3 / SOX13 / HGFR feedback loop and suppress SOX13-mediated migration, invasion, and metastasis of CRC (Du et al., 2020).

[0132] Our group generated an EpEX neutralizing antibody, EpAb2-6, which can be used to inhibit the function of EpEX. EpAb2-6 treatment is known to disrupt EpEX / EGFR / ADAM17-based signaling, which involves a positive feedback loop that promotes EpCAM cleavage and then increases EpEX and EpICD production (Liang et al., 2018; Liao et al., 2015). Of note, a decrease in phosphorylated HGFR levels was observed after EpAb2-6 treatment. Furthermore, EpAb2-6 attenuated the invasive and migratory abilities of HCT116 cells, which were partially restored after HGF treatment. Previous reports have shown that EpAb2-6 can induce apoptosis, and we confirmed that HCT116 cells were sensitized to humanized-EpAb2-6 and EpAb2-6-induced apoptosis after crizotinib treatment. Results from an orthotopic colon cancer animal model also demonstrated that combined administration of EpAb2-6 and crizotinib significantly inhibited tumor growth.

[0133] Among potential treatments for NSCLC, crizotinib and other HGFR-targeted therapies are among the most beneficial. This fact highlights the importance of a deep understanding of the mechanisms that can be used to inhibit HGFR activation. We found that EpCAM or EpEX induces the HGFR-ERK-ACT signal axis. According to these findings, EpCAM may be an excellent target for combination therapy with crizotinib. Indeed, in our study, EpAb2-6 reduced the level of phosphorylated HGFR and improved the therapeutic effect of crizotinib in an animal model. Thus, our findings reveal a novel action of EpCAM in controlling HGFR signaling and suggest a new strategy for EpCAM / HGFR-targeted combination therapy.

[0134] In this invention, we found that EpCAM / EpEX induces tumor progression and metastasis through ERK and FAK-ACT by inducing HGFR activation, GSK3β-Snail and β-catenin signaling in colon cancer cells. We further showed that inhibition or depletion of EpCAM signaling leads to a decrease in HGFR activation and its downstream signaling. Treatment with anti-EpCAM mAb EpAb2-6 suppressed colon cancer progression and metastasis, and importantly, improved the survival rate of orthotopic tumor and metastasis model mice. Thus, our data suggest that the combination of therapeutic antibodies targeting EpCAM and HGFR inhibitors has great potential for colon cancer treatment. The insights gained from these findings may be useful in aiding in the development of novel anticancer drugs that suppress metastasis and improve patient prognosis.

[0135] literature Al-Saad S, Richardsen E, Kilvaer TK, Donnem T, Andersen S, Khanehkenari M, Bremnes RM, Busund L-TJPo (2017) The impact of MET, IGF-1, IGF1R expression and EGFR mutations on survival of patients with non-small-cell lung cancer. 12: e0181527 An P, Chen F, Li Z, Ling Y, Peng Y, Zhang H, Li J, Chen Z, Wang HJO (2020) HDAC8 promotes the dissemination of breast cancer cells via AKT / GSK-3β / Snail signals. 39: 4956-4969 Balzar M, Winter MJ, de Boer CJ, Litvinov SVJJomm (1999) The biology of the 17-1A antigen (Ep-CAM). 77: 699-712 Birchmeier C, Birchmeier W, Gherardi E, Woude GFVJNrMcb (2003) Met, metastasis, motility and more. 4: 915-925 Cao L, Wang F, Li S, Wang X, Huang D, Jiang RJCL (2019) PIM1 kinase promotes cell proliferation, metastasis and tumor growth of lung adenocarcinoma by potentiating the c-MET signaling pathway. 444: 116-126 Chang L, Graham P, Hao J, Ni J, Bucci J, Cozzi P, Kearsley J, Li YJCd, disease (2013) Acquisition of epithelial-mesenchymal transition and cancer stem cell phenotypes is associated with activation of the PI3K / Akt / mTOR pathway in prostate cancer radioresistance. 4: e875-e875 Chen H-N, Liang K-H, Lai J-K, Lan C-H, Liao M-Y, Hung S-H, Chuang Y-T, Chen K-C, Tsuei WW-F, Wu H-CJCR (2020) EpCAM signaling promotes tumor progression and protein stability of PD-L1 through the EGFR pathway. 80: 5035-5050 Comoglio PM, Giordano S, Trusolino LJNrDd (2008) Drug development of MET inhibitors: targeting oncogene addiction and expedience. 7: 504-516 Comoglio PM, Trusolino LJTJoci (2002) Series Introduction: Invasive growth: from development to metastasis. 109: 857-862 Dean M, Park M, Le Beau MM, Robins TS, Diaz MO, Rowley JD, Blair DG, Woude GFVJN (1985) The human met oncogene is related to the tyrosine kinase oncogenes. 318: 385-388 Dolle L, Theise ND, Schmelzer E, Boulter L, Gires O, van Grunsven LA (2015) EpCAM and the biology of hepatic stem / progenitor cells. Am J Physiol-Gastr L 308: G233-G250 Du F, Li X, Feng W, Qiao C, Chen J, Jiang M, Qiu Z, Qian M, Tian D, Nie YJO (2020) SOX13 promotes colorectal cancer metastasis by transactivating SNAI2 and c-MET. 39: 3522-3540 Golubovskaya VMJFib (2014) Targeting FAK in human cancer: from finding to first clinical trials. 19: 687 Gumustekin M, Kargi A, Bulut G, Gozukizil A, Ulukus C, Oztop I, Atabey NJP, Research O (2012) HGF / c-Met overexpressions, but not met mutation, correlates with progression of non-small cell lung cancer. 18: 209-218 Hsu Y-T, Osmulski P, Wang Y, Huang Y-W, Liu L, Ruan J, Jin VX, Kirma NB, Gaczynska ME, Huang TH-MJCr (2016) EpCAM-regulated transcription exerts influences on nanomechanical properties of endometrial cancer cells that promote epithelial-to-mesenchymal transition. 76: 6171-6182 Iwatsuki M, Mimori K, Yokobori T, Ishi H, Beppu T, Nakamori S, Baba H, Mori MJCs (2010) Epithelial-mesenchymal transition in cancer development and its clinical significance. 101: 293-299 Jiao D, Wang J, Lu W, Tang X, Chen J, Mou H, Chen Q-yJMT-O (2016) Curcumin inhibited HGF-induced EMT and angiogenesis through regulating c-Met dependent PI3K / Akt / mTOR signaling pathways in lung cancer. 3: 16018 Jo M, Stolz DB, Esplen JE, Dorko K, Michalopoulos GK, Strom SCJJoBC (2000) Cross-talk between epidermal growth factor receptor and c-Met signal pathways in transformed cells. 275: 8806-8811 Kim K, Pang KM, Evans M, Hay EDJMbotc (2000) Overexpression of β-catenin induces apoptosis independent of its transactivation function with LEF-1 or the involvement of major G1 cell cycle regulators. 11: 3509-3523 Kim YJ, Choi JS, Seo J, Song JY, Eun Lee S, Kwon MJ, Kwon MJ, Kundu J, Jung K, Oh EJIjoc (2014) MET is a potential target for use in combination therapy with EGFR inhibition in triple‐negative / basal‐like breast cancer. 134: 2424-2436 Kobayashi T, Fujimoto H, Gabazza ECJJotd (2016) Efficacy of crizotinib in ALK fusion variants. 8: E1381 Koch JP, Aebersold DM, Zimmer Y, Medova MJO (2020) MET targeting: time for a rematch. 1-18 Lai AZ, Abella JV, Park MJTicb (2009) Crosstalk in Met receptor oncogenesis. 19: 542-551 Lassus P, Janer J, Haglund C, Karikoski R, Andersson LC, Andersson SJN (2006) Consistent expression of HGF and c-met in the perinatal lung. 90: 28-33 Li Z, Yanfang W, Li J, Jiang P, Peng T, Chen K, Zhao X, Zhang Y, Zhen P, Zhu JJCl (2018) Tumor-released exosomal circular RNA PDE8A promotes invasive growth via the miR-338 / MACC1 / MET pathway in pancreatic cancer. 432: 237-250 Liang H, Wang MJO, therapy (2020) MET oncogene in non-small cell lung cancer: mechanism of MET dysregulation and agents targeting the HGF / c-Met axis. 13: 2491 Liang K-H, Tso H-C, Hung S-H, Kuan I-I, Lai J-K, Ke F-Y, Chuang Y-T, Liu I-J, Wang Y-P, Chen R-HJCl (2018) Extracellular domain of EpCAM enhances tumor progression through EGFR signaling in colon cancer cells. 433: 165-175 Liao M-Y, Lai J-K, Kuo MY-P, Lu R-M, Lin C-W, Cheng P-C, Liang K-H, Wu H-CJO (2015) An anti-EpCAM antibody EpAb2-6 for the treatment of colon cancer. 6: 24947 Lin C-W, Liao M-Y, Lin W-W, Wang Y-P, Lu T-Y, Wu H-CJJoBC (2012) Epithelial cell adhesion molecule regulates tumor initiation and tumorigenesis via activating reprogramming factors and epithelial-mesenchymal transition gene expression in colon cancer. 287: 39449-39459 Litvinov SV, van Driel W, van Rhijn CM, Bakker H, van Krieken H, Fleuren GJ, Warnaar SOJTAjop (1996) Expression of Ep-CAM in cervical squamous epithelia correlates with an increased proliferation and the disappearance of markers for terminal differentiation. 148: 865 Mazzone M, Comoglio PMJTFJ (2006) The Met pathway: master switch and drug target in cancer progression. 20: 1611-1621 Meng F, Wu GJC, Reviews M (2012) The rejuvenated scenario of epithelial-mesenchymal transition (EMT) and cancer metastasis. 31: 455-467 Moschetta M, Basile A, Ferrucci A, Frassanito MA, Rao L, Ria R, Solimando AG, Giuliani N, Boccarelli A, Fumarola FJCcr (2013) Novel targeting of phospho-cMET overcomes drug resistance and induces antitumor activity in multiple myeloma. 19: 4371-4382 Mueller KL, Yang ZQ, Haddad R, Ethier SP, Boerner JLJJoms (2010) EGFR / Met association regulates EGFR TKI resistance in breast cancer. 5:8 Naldini L, Weidner KM, Vigna E, Gaudino G, Bardelli A, Ponzetto C, Narsimhan RP, Hartmann G, Zarnegar R, Michalopoulos GKJTEj (1991) Scatter factor and hepatocyte growth factor are indistinguishable ligands for the MET receptor. 10: 2867-2878 Normanno N, De Luca A, Bianco C, Strizzi L, Mancino M, Maiello MR, Carotenuto A, De Feo G, Caponigro F, Salomon DSJG (2006) Epidermal growth factor receptor (EGFR) signaling in cancer. 366: 2-16 Ortiz-Zapater E, Lee RW, Owen W, Weitsman G, Fruhwirth G, Dunn RG, Neat MJ, McCaughan F, Parker P, Ng TJPO (2017) MET-EGFR dimerization in lung adenocarcinoma is dependent on EGFR mtations and altered by MET kinase inhibition. 12: e0170798 Paik PK, Drilon A, Fan P-D, Yu H, Rekhtman N, Ginsberg MS, Borsu L, Schultz N, Berger MF, Rudin CMJCd (2015) Response to MET inhibitors in patients with stage IV lung adenocarcinomas harboring MET mutations causing exon 14 skipping. 5: 842-849 Pasquini G, Giaccone GJEOoID (2018) C-MET inhibitors for advanced non-small cell lung cancer. 27: 363-375 Peschard P, Park MJO (2007) From Tpr-Met to Met, tumorigenesis and tubes. 26: 1276-1285 Ponzetto C, Bardelli A, Zhen Z, Maina F, dalla Zonca P, Giordano S, Graziani A, Panayotou G, Comoglio PMJC (1994) A multifunctional docking site mediates signaling and transformation by the hepatocyte growth factor / scatter factor receptor family. 77: 261-271 Sacchetti A, Teeuwssen M, Verhagen M, Joosten R, Xu T, Stabile R, van der Steen B, Watson MM, Gusinac A, Kim WKJE (2021) Phenotypic plasticity underlies local invasion and distant metastasis in colon cancer. 10: e61461 Sacher AG, Jaenne PA, Oxnard GRJC (2014) Management of acquired resistance to epidermal growth factor receptor kinase inhibitors in patients with advanced non‐small cell lung cancer. 120: 2289-2298 Schnell U, Kuipers J, Giepmans BNJBr (2013) EpCAM proteolysis: new fragments with distinct functions? 33 Shattuck DL, Miller JK, Carraway KL, Sweeney CJCr (2008) Met receptor contributes to trastuzumab resistance of Her2-overexpressing breast cancer cells. 68: 1471-1477 Shaw AT, Ou S-HI, Bang Y-J, Camidge DR, Solomon BJ, Salgia R, Riely GJ, Varella-Garcia M, Shapiro GI, Costa DBJNEJoM (2014) Crizotinib in ROS1-rearranged non-small-cell lung cancer. 371: 1963-1971 Shibue T, Weinberg RAJNrCo (2017) EMT, CSCs, and drug resistance: the mechanistic link and clinical implications. 14: 611 Simiczyjew A, Dratkiewicz E, Van Troys M, Ampe C, Styczen I, Nowak DJC (2018) Combination of EGFR inhibitor lapatinib and MET inhibitor foretinib inhibits migration of triple negative breast cancer cell lines. 10: 335 Singh A, Settleman JJO (2010) EMT, cancer stem cells and drug resistance: an emerging axis of evil in the war on cancer. 29: 4741-4751 Smolen GA, Sordella R, Muir B, Mohapatra G, Barmettler A, Archibald H, Kim WJ, Okimoto RA, Bell DW, Sgroi DCJPotNAoS (2006) Amplification of MET may identify a subset of cancers with extreme sensitivity to the selective tyrosine kinase inhibitor PHA-665752. 103: 2316-2321 Song G, Xu S, Zhang H, Wang Y, Xiao C, Jiang T, Wu L, Zhang T, Sun X, Zhong LJJoE et al (2016) TIMP1 is a prognostic marker for the progression and metastasis of colon cancer through FAK-PI3K / AKT and MAPK pathway. 35: 1-12 Sun Y, Liu W-Z, Liu T, Feng X, Yang N, Zhou H-FJJoR, Transduction S (2015) Signaling pathway of MAPK / ERK in cell proliferation, differentiation, migration, senescence and apoptosis. 35: 600-604 Taher TE, Tjin EP, Beuling EA, Borst J, Spaargaren M, Pals STJTJoI (2002) c-Cbl is involved in Met signaling in B cells and mediates hepatocyte growth factor-induced receptor ubiquitination. 169: 3793-3800 Takeuchi H, Bilchik A, Saha S, Turner R, Wiese D, Tanaka M, Kuo C, Wang H-J, Hoon DSJCCR (2003) c-MET expression level in primary colon cancer: a predictor of tumor invasion and lymph node metastases. 9: 1480-1488 Tang Z, Du R, Jiang S, Wu C, Barkauskas D, Richey J, Molter J, Lam M, Flask C, Gerson SJBjoc (2008) Dual MET-EGFR combinatorial inhibition against T790M-EGFR-mediated erlotinib-resistant lung cancer. 99: 911-922 Thiery JP, Sleeman JPJNrMcb (2006) Complex networks orchestrate epithelial-mesenchymal transitions. 7: 131-142 Toiyama Y, Yasuda H, Saigusa S, Matushita K, Fujikawa H, Tanaka K, Mohri Y, Inoue Y, Goel A, Kusunoki MJIjoc (2012) Co‐expression of hepatocyte growth factor and c‐Met predicts peritoneal dissemination established by autocrine hepatocyte growth factor / c‐Met signaling in gastric cancer. 130: 2912-2921 Van Schaeybroeck S, Rolfo CD, Elez E, Kelly S, Houlden J, Collins L, Love S, Andre T, Lawler M, Di Nicolantonio F, 2015. MErCuRIC1: A Phase I study of MEK1 / 2 inhibitor PD-0325901 with cMET inhibitor crizotinib in RAS MT and RAS WT (with aberrant c-MET) metastatic colorectal cancer (mCRC) patients. American Society of Clinical Oncology. Yang Yn, Wang C, Dai C, Liu X, Li W, Huang M, Zhao X, Ji D, Li J, Guo WJABeBS (2021) Amplification and expression of c-MET correlate with poor prognosis of patients with gastric cancer and upregulate the expression of PDL1. 53: 547-557 Zhao C, Guo R, Guan F, Ma S, Li M, Wu J, Liu X, Li H, Yang BJSr (2020) MicroRNA-128-3p Enhances the Chemosensitivity of Temozolomide in Glioblastoma by Targeting c-Met and EMT. 10: 1-12 Zhou BP, Deng J, Xia W, Xu J, Li YM, Gunduz M, Hung M-CJNcb (2004) Dual regulation of Snail by GSK-3β-mediated phosphorylation in control of epithelial-mesenchymal transition. 6: 931-940 Zou HY, Li Q, Lee JH, Arango ME, McDonnell SR, Yamazaki S, Koudriakova TB, Alton G, Cui JJ, Kung P-PJCr (2007) An orally available small-molecule inhibitor of c-Met, PF-2341066, exhibits cytoreductive antitumor efficacy through antiproliferative and antiangiogenic mechanisms. 67: 4408-4417

Claims

1. For treating cancer, (i) a first inhibitor in an effective amount that inhibits the activation of epithelial cell adhesion molecule (EpCAM) signaling; and (ii) a second inhibitor in an effective amount that inhibits the activation of HGFR signaling or contains a first inhibitor in an effective amount that inhibits the activation of EpCAM signaling, and is administered in combination with a second inhibitor in an effective amount that inhibits the activation of HGFR signaling, or contains a second inhibitor in an effective amount that inhibits the activation of HGFR signaling, and is administered in combination with a first inhibitor in an effective amount that inhibits the activation of EpCAM signaling, a pharmaceutical composition.

2. The pharmaceutical composition according to claim 1, wherein the first inhibitor reduces the production (or release) of the extracellular domain (EpEX) of EpCAM, blocks the binding of EpEX to HGFR, and / or inhibits EpEX-induced HGFR phosphorylation.

3. The pharmaceutical composition according to claim 1, wherein the second inhibitor blocks the binding of HGF to HGFR.

4. The pharmaceutical composition according to claim 1, wherein the first inhibitor is an antibody against EpEX or an antigen-binding fragment thereof.

5. The pharmaceutical composition according to claim 4, wherein the antibody specifically binds to epidermal growth factor (EGF)-like domains I and II.

6. The pharmaceutical composition according to claim 5, having a specific binding affinity for epitopes within the sequences CVCE NYKLAVN (aa 27-37) (SEQ ID NO: 20) located in EGF-like domain I and KPEGALQNNDGLYDPDCD (aa 83-100) (SEQ ID NO: 19) located in EGF-like domain II.

7. The antibody or antigen-binding fragment is (a) A heavy chain variable region (VH) comprising a heavy chain complementarity determining region 1 (HC CDR1) containing the amino acid sequence of SEQ ID NO: 2, a heavy chain complementarity determining region 2 (HC CDR2) containing the amino acid sequence of SEQ ID NO: 4, and a heavy chain complementarity determining region 3 (HC CDR3) containing the amino acid sequence of SEQ ID NO: 6; and (b) A light chain variable region (VL) comprising a light chain complementarity determining region 1 (LC CDR1) containing the amino acid sequence of SEQ ID NO: 9, a light chain complementarity determining region 2 (LC CDR2) containing the amino acid sequence of SEQ ID NO: 11, and a light chain complementarity determining region 3 (LC CDR3) containing the amino acid sequence of SEQ ID NO: 13, The pharmaceutical composition according to claim 4, comprising

8. The pharmaceutical composition according to claim 1, wherein the first inhibitor is effective for inhibiting the signal transduction of the phosphorylation of TACE and PS2.

9. The pharmaceutical composition according to claim 1, wherein the second inhibitor is selected from the group consisting of foretinib, crizotinib, and cabozantinib.

10. The pharmaceutical composition according to claim 1, which is effective for inducing apoptosis of cancer cells.

11. The pharmaceutical composition according to claim 1, which is effective for inhibiting the migration / invasion of cancer cells and / or reducing the tumor size.

12. The pharmaceutical composition according to claim 1, which is effective for prolonging the survival of a subject.

13. The pharmaceutical composition according to any one of claims 1 to 12, wherein the cancer is selected from the group consisting of lung cancer, brain tumor, breast cancer, cervical cancer, colon cancer, gastric cancer, head and neck cancer, kidney cancer, leukemia, liver cancer, ovarian cancer, pancreatic cancer, prostate cancer, skin cancer, and testicular cancer.

14. (i) A first inhibitor that inhibits the activation of EpCAM signal transduction; and (ii) A second inhibitor that inhibits the activation of HGFR signal transduction A kit comprising the same as a mixture or separately.

15. The kit according to claim 14, wherein the first inhibitor is as described in any one of claims 1, 2 and 4 to 8, and / or the second inhibitor is as described in claim 3 or 9.

16. Use of a combination of (i) a first inhibitor that inhibits the activation of EpCAM signaling and (ii) a second inhibitor that inhibits the activation of HGFR signaling for the manufacture of a medicament or kit for treating cancer.

17. The use according to claim 16, wherein the first inhibitor is as described in any one of claims 1, 2 and 4 to 8, and / or the second inhibitor is as described in claim 3 or 9.

18. The use according to claim 16, wherein the medicament or kit is effective in inducing apoptosis of cancer cells.

19. The use according to claim 16, wherein the medicament or kit is effective in inhibiting migration / invasion of cancer cells and / or reducing tumor size.

20. The use according to claim 16, wherein the medicament or kit is effective in prolonging the survival of a subject.

21. The use according to claim 16, wherein the cancer is selected from the group consisting of lung cancer, brain tumor, breast cancer, cervical cancer, colon cancer, gastric cancer, head and neck cancer, kidney cancer, leukemia, liver cancer, ovarian cancer, pancreatic cancer, prostate cancer, skin cancer, and testicular cancer.

22. The pharmaceutical composition for treating cancer according to claim 1, wherein the first inhibitor and the second inhibitor are administered simultaneously, individually or sequentially.

Images