Modified cereal grains

Abstract

The present invention relates to cereal grains and husks, such as rice kernels and husks, having high oleic acid content and improved oil stability.

Description

[Technical field]

[0001] The present invention relates to cereal grains and husks, such as rice grains and brans, having high oleic acid content and improved oil stability. [Background technology]

[0002] Rice (Oryza sativa L.) is one of the most important staple foods for over half the world's population, specifically in Asia, which produces about 90% of the world's total. Worldwide, the majority of rice is eaten as "white rice", which is essentially the endosperm of the rice kernel, and is produced by milling the harvested kernel to remove the outer cortex layer and germ (embryo and scutellum). The removal is done primarily because "brown rice" does not maintain well in storage, especially under hot tropical conditions. The nutritional quality and potential health benefits of brown rice are attracting increasing interest from nutritionists, growers, and plant biotechnologists.

[0003] Rice husk Rice husk is the outer brown layer of the rice kernel and includes the germ, pericarp, aleurone, and subaleurone. Rice husk is known to be rich in minerals, protein, oil, and crude fiber. Rice husk is obtained mainly as a by-product of milling rice. Currently, the world production is approximately 66-75 million tons. Generally, rice husk is composed of 14-16% protein, 12-23% lipid, and 8-10% crude fiber (Juliano, 1985).

[0004] Rice husk oil Rice husk is the source of rice husk oil (RBO). Interest in RBO as an edible oil for cooking, for example, is increasing due to its demonstrated health benefits in humans. Studies have shown that RBO intake significantly reduces low-density lipoprotein cholesterol (LDL-C) and increases antioxidant capacity in hyperlipidemic subjects (Bumrungpert et al. 2019; Berger et al., 2005). The health profile of RBO is associated with significant unsaponifiable trace components such as tocopherols, phytosterols, terpenes, and mixed isoprenoids, which are 3-4.5% higher compared to the roughly 1% oil content of other vegetable oils. RBO generally contains 1.8% phytosterols, 1.2-1.7% gamma-oryzanol, up to 0.17% tocotrienol, and 0.08% tocopherol (Pal and Pratap, 2017). These minor components have attracted increasing interest because some have been shown to have beneficial effects on skin health, aging, vision, and blood cholesterol, or to prevent breast cancer or cardiovascular disease (Theriault et al., 1999; Moghadasian and Frohlich, 1999). These bioactive components have also been shown to improve lipid profiles in rats fed a high-cholesterol diet (Ha et al., 2005). Another important component found primarily in the husk is vitamin A precursor. However, these nutrients and health benefits are lost through rice polishing and consumption of white rice.

[0005] Modification of fatty acid biosynthetic enzymes in cereals In contrast to the considerable research that has been carried out on fatty acid biosynthesis and modification in oil seeds, oil modification in cereals has been relatively unexplored, possibly due to the much lower levels of oil in cereal grains (approximately 1.5-6% by weight) and, as a result, the perceived importance of oil from cereals in the human diet. [Table 1]

[0006] The nutrient-rich outer rice husk layer, obtained through grinding the outer layer of the rice kernel, is an excellent dietary source containing antioxidant compounds such as tocotrienols and gamma-oryzanol, which is also a phytoestrogen (Rukmini and Raghuram, 1991). Bioactive compounds present in rice husk oil have been found to lower cholesterol in humans (Most et al., 2005).

[0007] There is a need to improve the cereal grain lipid profile in the husk layer to improve the usefulness and shelf life of whole grains and prevent rancidity of the husk and RBO without the need for further processing. There is also a need for cereal varieties such as rice to produce grains with improved oil composition for health benefits, while at the same time being more stable on storage, allowing for greater use of, for example, brown rice, rice husks, and RBO in the human diet. Summary of the Invention

[0008] The present inventors have produced cereal kernels and husks with improved oil characteristics.

[0009] Thus, in a first aspect, the present invention provides a fertile cereal grain comprising a genetically modified FAD2-1 gene and a genetically modified LOX3 gene, the grain comprising: i) at least some FAD2-1 protein activity, which FAD2-1 activity is reduced when compared to wild type grain; ii) reduced LOX3 protein activity when compared to wild-type grain.

[0010] In one embodiment, the cereal grain is rice, sorghum, wheat, oats, rye, barley, or corn kernel. In one embodiment, the grain is sorghum kernel. In one embodiment, the grain is rice kernel.

[0011] In one embodiment, the oil extracted from the grain is more stable than the oil extracted from wild type grains.

[0012] In one embodiment, the grain has a total fatty acid content of at least 50%, at least 60%, at least 70%, at least 75%, between 50% and 80%, between 55% and 75%, between 55% and 70% oleic acid (w / w dry weight). In one embodiment, the grain has a total fatty acid content of between 55% and 75% oleic acid (w / w dry weight). In one embodiment, the grain has a total fatty acid content of between 55% and 65% oleic acid (w / w dry weight).

[0013] In one embodiment, the grain has a total fatty acid content of less than 22%, less than 21%, less than 20%, less than 18%, less than 15%, between 15% and 22%, or between 15% and 21% palmitic acid (w / w dry weight). In one embodiment, the grain has a total fatty acid content of between 10% and 15% palmitic acid (w / w dry weight). In one embodiment, the grain has a total fatty acid content of between 10% and 13% palmitic acid (w / w dry weight).

[0014] In one embodiment, the grain has a total fatty acid content of less than 20%, less than 15%, less than 10%, less than 5%, between 2% and 20%, or between 5% and 15% linoleic acid (w / w dry weight).In one embodiment, the grain has a total fatty acid content of between 15% and 25% linoleic acid (w / w dry weight).

[0015] In one embodiment, the grain has a total fatty acid content comprising 55% to 65% oleic acid, 10% to 15% palmitic acid, and 15% to 25% linoleic acid.

[0016] In one embodiment, the grain produces a reduced amount of FAD2-1 protein and / or is homozygous for a FAD2-1 allele encoding a FAD2-1 protein, a LOX3 knockout, a FATB2 knockout, a FATB3 knockout, and a FATB4 knockout, which produce a reduced amount of FAD2-1 protein and / or have reduced FAD2-1 protein activity.

[0017] In one embodiment, the grain is homozygous for a FAD2-1 allele that produces a reduced amount of FAD2-1 protein and / or encodes a FAD2-1 protein with reduced FAD2-1 protein activity, a LOX3 knockout, a FATB1 knockout, and a FATB4 knockout.

[0018] In one embodiment, the grain is homozygous for a FAD2-1 allele that produces a reduced amount of FAD2-1 protein and / or encodes a FAD2-1 protein having reduced FAD2-1 protein activity, a LOX3 knockout, a FATB1 knockout, a FATB2 knockout, a FATB3 knockout, and a FATB4 knockout.

[0019] In one embodiment, the grain does not have LOX3 protein activity. For example, the genetic modification is a premature stop codon in the LOX3 gene.

[0020] In one embodiment, the grain is homozygous for the genetic modification in the LOX3 gene. In one embodiment, the genetic modification in the LOX3 gene is a premature stop codon in the LOX3 gene.

[0021] In one embodiment, the grain is homozygous for the genetic modification in the FAD2-1 gene.

[0022] In one embodiment, the grain is heterozygous for the genetic modification in the FAD2-1 gene.

[0023] In one embodiment, the grain comprises a wild-type FAD2-1 allele and a knockout FAD2-1 allele.

[0024] In one embodiment, the grain comprises a wild-type FAD2-1 allele and a FAD2-1 allele that produces a reduced amount of FAD2-1 protein and / or encodes a FAD2-1 protein having reduced FAD2-1 protein activity.

[0025] In one embodiment, the grain comprises a FAD2-1 allele that produces a reduced amount of FAD2-1 protein and / or encodes a FAD2-1 protein having reduced FAD2-1 protein activity, as well as a knockout FAD2-1 allele.

[0026] In one embodiment, the genetically modified FAD2-1 gene encodes a mutant FAD2-1 protein. In one embodiment, the mutant FAD2-1 has a Δ12 desaturase activity that is 5% to 95% lower, 20% to 80% lower, 40% to 70% lower, or 50% to 60% lower than a wild-type FAD2-1 protein. In one embodiment, the grain mutant FAD2-1 has a Δ12 desaturase activity that is 5% to 95% lower, 20% to 80% lower, 40% to 70% lower, or 50% to 60% lower than a wild-type FAD2-1 protein, such as a FAD2-1 protein consisting of an amino acid sequence set forth in any one of SEQ ID NOs: 1 to 9.

[0027] In one embodiment, the FAD2-1 protein having reduced FAD2-1 protein activity comprises or consists of the amino acid sequence set forth in SEQ ID NO: 10 or SEQ ID NO: 11. In one embodiment, the FAD2-1 protein having reduced FAD2-1 protein activity has an altered translation initiation site.

[0028] In one embodiment, the grain has wild-type activity of other FAD2 genes in the genome of the grain, for example, the rice grain of the present invention has wild-type FAD2-2, FAD2-3, and FAD2-4 activity.

[0029] In one embodiment, one or both of the genetic modifications were introduced by gene editing of an ancestral cereal plant.

[0030] In one embodiment, the grain has reduced FATB activity when compared to wild type grain. In one embodiment, the FATB is FATB1.

[0031] In one embodiment, the grain is free of exogenous dsRNA.

[0032] In a further aspect, the present invention provides a cereal husk comprising genetically modified cells, comprising: i) at least some FAD2-1 protein activity, which FAD2-1 activity is reduced when compared to wild-type cereal husks; ii) providing a cereal husk that comprises reduced LOX3 protein activity when compared to wild-type cereal husks.

[0033] The hull may have any of the relevant characteristics defined above for the cereal grain of the invention, such as fatty acid profile, etc. For example, in one embodiment the hull is rice hull.

[0034] In one aspect the invention provides an extracted cereal grain oil or cereal husk oil having a total fatty acid content comprising 50% to 80%, or 55% to 80% oleic acid (w / w dry weight) and having an induction time of at least 25 hours as measured by a Rancimat test performed at 110°C and an air flow rate of 20 L / h.

[0035] In another aspect, the present invention provides an extracted cereal grain oil or cereal hull oil which is more stable than cereal oil extracted from cereal grains or hulls lacking i) and ii) of the present invention. In one embodiment, the extracted cereal grain oil or hull oil of this aspect has a total fatty acid content comprising 50% to 80%, or 55% to 80% oleic acid (w / w dry weight).

[0036] In one embodiment, the cereal oil is rice, sorghum, wheat, oat, rye, barley, or corn oil. In one embodiment, the husk oil is rice, sorghum, wheat, oat, rye, barley, or corn husk oil. In one embodiment, the oil is sorghum kernel oil or husk oil. In one embodiment, the oil is rice kernel oil or husk oil.

[0037] In one embodiment the extracted cereal grain or hull oil of the invention has a total fatty acid content of 55% to 75%, or 55% to 70% oleic acid (w / w dry weight).In one embodiment the extracted cereal grain or hull oil of the invention has a total fatty acid content of 55% to 65% oleic acid (w / w dry weight).

[0038] In one embodiment, the extracted cereal grain oil or hull oil of the invention has a total fatty acid content of less than 22%, less than 21%, less than 20%, less than 18%, less than 15%, between 15% and 22%, or between 15% and 21% palmitic acid (w / w dry weight). In one embodiment, the extracted cereal grain oil or hull oil of the invention has a total fatty acid content of 10-15% palmitic acid (w / w dry weight). In one embodiment, the extracted cereal grain oil or hull oil of the invention has a total fatty acid content of 10-13% palmitic acid (w / w dry weight).

[0039] In one embodiment, the extracted cereal grain or hull oil of the invention has a total fatty acid content of less than 20%, less than 15%, less than 10%, less than 5%, 2%-20%, or 5%-15% linoleic acid (w / w dry weight).In one embodiment, the extracted cereal grain or hull oil of the invention has a total fatty acid content of 15%-25% linoleic acid (w / w dry weight).

[0040] In one embodiment, the extracted cereal grain or hull oil of the present invention has a total fatty acid content comprising 55% to 65% oleic acid, 10% to 15% palmitic acid, and 15% to 25% linoleic acid.

[0041] In a further aspect, the present invention provides substantially purified and / or recombinant mutant FAD2-1 proteins having Δ12 desaturase activity that is 5% to 95% lower, 20% to 80% lower, 40% to 70% lower, or 50% to 60% lower than the corresponding wild-type FAD2-1 protein, or than a FAD2-1 protein consisting of the amino acid sequence set forth in SEQ ID NO:1.

[0042] Therefore, this embodiment excludes wild-type FAD2-1 proteins, such as those consisting of the amino acid sequence set forth in any one of SEQ ID NOs: 1-9.

[0043] In one embodiment, the mutant FAD2-1 comprises an amino acid sequence set forth in SEQ ID NOs: 1 to 9, and which is at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 95.5% identical to one or more of the amino acid sequences set forth therein.

[0044] In one embodiment, the variant FAD2-1 comprises an amino acid sequence that is at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 95.5% identical to the amino acid sequence set forth in SEQ ID NO:1.

[0045] In one embodiment, the variant FAD2-1 comprises an amino acid sequence that is at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 95.5% identical to the amino acid sequence set forth in SEQ ID NO:6.

[0046] In one embodiment, the protein comprises the sequence of amino acids set forth in SEQ ID NO:10 or SEQ ID NO:11.

[0047] In one embodiment, the mutant is an N-terminal truncation of wild-type protein. In one embodiment, the mutant lacks one or more or all of the first six amino acids of wild-type FAD2-1 protein. In one embodiment, the mutant is encoded by a FAD2-1 gene with a genetically modified translation initiation site.

[0048] In another aspect, the present invention provides isolated and / or exogenous polynucleotides encoding the proteins of the present invention.

[0049] In another aspect, the present invention provides a vector comprising a polynucleotide of the present invention.

[0050] In one embodiment, the polynucleotide is operably linked to a promoter.

[0051] Also provided is a cell, preferably a rice cell, comprising a genetic modification as defined herein, a polynucleotide of the invention, or a vector of the invention.

[0052] In one embodiment, the cell is a cereal plant cell. Examples of cereal plant cells of the present invention include, but are not limited to, wheat, oat, rye, barley, rice, corn, sorghum, or maize cells. In one embodiment, the cell is a sorghum cell. In one embodiment, the cell is a rice cell.

[0053] In a preferred embodiment, the cell is a rice kernel cell, such as a rice husk cell.

[0054] In one embodiment, the polynucleotide is integrated into the genome of the cell.

[0055] In a further aspect, the present invention provides a cereal plant comprising one or more or all of the cereal grain of the invention, the cereal husk of the invention, the protein of the invention, the polynucleotide of the invention, the vector of the invention, or the cell of the invention. In one embodiment, the plant is a sorghum plant.

[0056] Also provided is a population of at least 100 plants of the invention, such as rice plants, growing in a field.

[0057] In yet another aspect, the present invention provides a method of producing a cell of the present invention, the method comprising the step of introducing into the cell a genetic modification as defined herein, a polynucleotide of the present invention, or a vector of the present invention.

[0058] In another aspect, the present invention provides a method for identifying a FAD2-1 protein having reduced FAD2-1 protein activity, comprising the steps of: i) obtaining a polypeptide having an amino acid sequence that is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% identical, but not identical, to any one or more of the amino acid sequences set forth in SEQ ID NOs: 1 to 9; ii) assessing the FAD2-1 protein activity of the polypeptide by determining the ability of the polypeptide to introduce a double bond into oleic acid at the Δ12 position; and iii) selecting a polypeptide having a certain degree of FAD2-1 protein activity, but having lower FAD2-1 protein activity than a protein consisting of an amino acid sequence set forth in any one of SEQ ID NOs: 1 to 9.

[0059] In one embodiment, the polypeptide of part i) is evaluated relative to the corresponding wild-type FAD2-1. For example, in one embodiment, the method comprises: i) obtaining a polypeptide having an amino acid sequence that is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% identical, but not identical, to the amino acid sequence set forth in SEQ ID NO:1; ii) assessing the FAD2-1 protein activity of the polypeptide by determining the ability of the polypeptide to introduce a double bond into oleic acid at the Δ12 position; iii) selecting a polypeptide having a certain degree of FAD2-1 protein activity, but having a lower FAD2-1 protein activity than a protein consisting of the amino acid sequence set forth in SEQ ID NO:1.

[0060] In one embodiment, the polypeptide in i) is an N-terminal and / or C-terminal truncation of a wild-type FAD2-1 polypeptide.

[0061] In another aspect, the present invention provides a method for producing a genetically modified cereal plant, comprising the steps of: i) introducing a genetic modification into a cereal cell so as to encode a protein of the invention; ii) producing a plant from the cell.

[0062] In one embodiment, the method further comprises analyzing the plants for fertility and selecting those plants that are fertile.

[0063] In one embodiment, the method further comprises analyzing the fatty acid composition of the grain and / or husk of the plant or its progeny, and selecting a plant producing grain and / or husk having a total fatty acid content as defined herein.

[0064] In one embodiment, the cell does not encode a functional LOX3 protein.

[0065] In one embodiment, the method further comprises introducing a genetic modification such that the plant, or its progeny, does not encode a functional LOX3 protein in its grain and / or husk.

[0066] In one embodiment, the method further comprises harvesting grain from the plant of step ii), wherein the grain comprises the genetic modification.

[0067] In one embodiment, the method further comprises producing one or more generations of genetically modified progeny plants from the genetically modified kernel, wherein the progeny plants have the genetic modification.

[0068] In another aspect, the present invention provides a method of producing a grain plant of the present invention, the method comprising crossing a first genetically modified parent plant having grains that contain at least some FAD2-1 protein activity, where the FAD2-1 protein activity is reduced when compared to wild-type grain, with a second genetically modified parent plant having grains that contain reduced LOX3 protein activity when compared to wild-type grain.

[0069] In another aspect, the present invention provides a method for selecting a cereal plant or grain from a plant of the present invention, comprising the steps of: i) screening a population of cereal plants, kernels or husks, each resulting from a mutagenesis treatment of a precursor cereal cell, kernel or plant, for the production of a kernel or husk as defined herein or for the presence of a genetic modification; ii) selecting from the population of step (i) a cereal plant or grain producing a grain as defined herein, Thereby, a method for selecting a cereal plant or grain is provided.

[0070] In one embodiment, step ii) comprises i) analyzing a sample containing DNA from the progeny plant or kernel from the progeny plant for the genetic modification; and / or ii) Analysing the fatty acid content of the kernel or the husk from the kernel.

[0071] In another aspect, the present invention provides a method for identifying a cereal plant of the present invention, comprising the steps of: i) obtaining a nucleic acid sample from a cereal plant; ii) screening the sample for the presence or absence of a first genetic modification that reduces, but does not neutralize, FAD2-1 protein activity in the grain of the plant compared to wild-type grain, and a second genetic modification that reduces LOX3 protein activity in the grain of the plant compared to wild-type grain.

[0072] In another aspect, the present invention provides a process for producing extracted cereal grain oil and / or cereal husk oil, comprising: i) obtaining grains and / or husks from a cereal plant of the present invention; ii) extracting oil from the grains and / or cereal husks.

[0073] In one embodiment, the extracted oil is as defined herein.

[0074] In another aspect, the present invention provides a method for producing a part of a cereal plant, comprising the steps of: a) growing in a field a cereal plant of the invention or at least 100 such plants; b) harvesting a portion of the cereal plant from the cereal plant or plants.

[0075] In one embodiment, the portion is a grain.

[0076] In another aspect, the present invention provides a method for producing cereal flour, hulls, wholemeal flour, germinated material, starch, or oil from cereal grains, comprising the steps of: a) obtaining grain of a plant of the invention, or grain and / or husk of the invention; b) processing the grain to produce flour, hulls, whole grain flour, germinated starch, or oil.

[0077] In one embodiment, the oil is a cereal husk oil, such as rice husk oil.

[0078] In another aspect, the present invention provides a lipid or oil obtained or obtainable by the process of the present invention.

[0079] In another aspect, the present invention provides a product made from the plant of the present invention, or the grain and / or husk of the present invention.

[0080] In one embodiment, the product comprises a genetic modification.

[0081] In one embodiment, the product is a food ingredient, a beverage ingredient, a food product, or a beverage product.

[0082] In one embodiment, the food or beverage ingredient is selected from the group consisting of whole grains, flours, hulls, starches, sprouts, and oils.

[0083] In one embodiment, the food product is selected from the group consisting of animal feed, breakfast cereals, and snack foods.

[0084] In one embodiment, the beverage product is a packaged beverage or a beverage that includes ethanol.

[0085] In another aspect, the present invention provides a method of preparing a food or beverage ingredient of the present invention, comprising processing grain of a cereal plant of the present invention, grain and / or husks of the present invention, or husks, flour, wholemeal, germinated material, starch, or oil from the grains to produce the food or beverage ingredient.

[0086] In a further aspect, the present invention provides a method of preparing a food product or beverage product of the invention comprising processing grain of a cereal plant of the invention, grain and / or husks of the invention, or husks, flour, wholemeal, germinated material, starch or oil from the grains to produce a food or beverage.

[0087] In another aspect, the present invention provides a method of preparing a food product comprising cooking an edible substance in a cereal oil, such as the rice oil of the present invention.

[0088] Also provided is the use of a cereal plant or part thereof, or the grain and / or husk of the invention, as an animal feed or food, or for producing a feed for animal consumption or a food for human consumption.

[0089] In another aspect, the invention provides a composition comprising one or more of a polypeptide of the invention, a polynucleotide of the invention, a vector of the invention, a cell of the invention, or an oil of the invention, and one or more acceptable carriers.

[0090] Any embodiment herein is to be construed as applying mutatis mutandis to any other embodiment unless specifically stated otherwise.

[0091] The scope of the present invention is not limited by the specific embodiments described herein, which are intended for purposes of example only. Functionally equivalent products, compositions, and methods are clearly within the scope of the invention described herein.

[0092] Throughout this specification, unless specifically stated otherwise or required otherwise by context, references to a single step, composition of matter, group of steps, or group of compositions of matter are to be interpreted as encompassing one and more (i.e., one or more) of that step, composition of matter, group of steps, or group of compositions of matter.

[0093] The invention will now be described by way of the following non-limiting examples and with reference to the accompanying figures. [Brief description of the drawings]

[0094] [Figure 1] cDNA sequence alignment of OsFAD2 from rice. The guide RNA target sequences of gRNA1 and gRNA2 in the FAD2 gene are indicated by the target 1 and target 3 bars. [Diagram 2] CRISPR gene editing vector V1 in pYLCRISPR_Cas9Pubi-H. [Diagram 3] Translated protein sequence alignment of OsFATB gene with Arabidopsis FATB1. The asterisk * indicates the site of the catalytic triad (aspartic acid N-227, histidine H-229, and cysteine ​​C-264) in the aligned sequences. [Figure 4] Vector 2 FATB gRNA ligation product (Golden Gate, BsaI): pYLCRISPR_Cas9Pubi-H-V2. [Diagram 5] Half-seed fatty acid composition. A, T3 seeds of V1-13 and Neg; B, T2 seeds from a single ear of V1-13. [Figure 6]A) Strain genotype key is as follows: KD refers to fad2-1 KD / KD+lox3KO genotype, LOX refers to FAD2WT+lox3-KO genotype, and Neg is the negative control. B) FAD2-KO is a homozygous fad2-1 KO / KO strain, Neg refers to the negative control, FAD2-KD refers to fad2-1 KD / KD+lox3KO genotype, FAD2-KD / KO refers to fad2-1 KD / KO+lox3-KO, and LOX3 refers to FAD2-1WT+lox3 KO genotype. [Figure 7] Half-seed fatty acid composition of V2 mutant T3 seeds as described in Tables 5 and 7. *For ease of reference, b1, b2, b3, and b4 refer to the presence of one or more mutant forms of FATB1, FATB2, FATB3, and FATB4, respectively. NEG is the negative control, and Nip refers to the wild-type Nipponnbare. [Figure 8] Total fatty acid composition of high oleic and low palmitic genotypes. There are five major fatty acids in brown rice (16:0, 18:0, 18:1, 18:2, 18:3) and some minor fatty acids such as myristic acid (14:0) and 20:0. [Figure 9] Oxidative stability of rice husk oil extract by Rancimat test. A, Total fatty acid composition of rice husk oil extract from genetically modified mutants and FAD2-RNAi line. B, KD refers to fad2-1 KD / KD+lox3KO genotype, LOX is FAD2WT+lox3-KO genotype, Neg is negative control. C, FAD2 is FAD2-RNAi silent line, NEG is negative control. [Figure 10]Production of hexanal compounds from rice husk samples of gene-edited mutants and FAD2 RNAi silent lines in a 3-day storage stimulation assay. DO (day 0) and D3 (day 3) indicate the time points when samples were taken before and after storage stimulation. A, KD refers to the fad2-1 KD / KD+lox3KO genotype, KK refers to the fad2-1 KD / KO+lox3KO genotype, LOX is the FAD2WT+lox3-KO genotype, and Neg is the negative control. B, FAD2 refers to the FAD2-RNAi silent line, and NC is the corresponding negative control. [Figure 11] Alignment of wild-type cereal FAD2-1 proteins. [Figure 12-1] Alignment of wild-type cereal LOX3 proteins. [Figure 12-2] Alignment of wild-type cereal LOX3 proteins.

[0095] Key to sequence table SEQ ID NO:1-Rice FAD2-1 SEQ ID NO:2-Barley FAD2-1 SEQ ID NO:3- Maize FAD2-1 SEQ ID NO:4 - Brachypodium distachyon FAD2-1 SEQ ID NO:5-Brassica napus FAD2-1 SEQ ID NO:6 - Glycine max FAD2-1 SEQ ID NO:7 - Carthamus tinctorius FAD2-1 SEQ ID NO:8 - Olea europaea FAD2-1 SEQ ID NO:9 - Setaria italica FAD2-1 SEQ ID NO:10 - Mutant FAD2-1A SEQ ID NO:11 - Mutant FAD2-1B SEQ ID NO:12-Rice FAD2-2 SEQ ID NO:13-Rice FAD2-3 SEQ ID NO:14-Rice FAD2-4 SEQ ID NO:15 - Polynucleotide sequence encoding rice FAD2-1 SEQ ID NO:16 - Polynucleotide sequence encoding rice FAD2-2 SEQ ID NO:17 - Polynucleotide sequence encoding rice FAD2-3 SEQ ID NO:18 - Polynucleotide sequence encoding rice FAD2-4 SEQ ID NO:19-Rice FATB-1 SEQ ID NO:20-Rice FATB-2 SEQ ID NO:21-Rice FATB-3 SEQ ID NO:22-Rice FATB-4 SEQ ID NO:23 - Rice LOX3 SEQ ID NO:24 - Oryza brachyantha LOX3 SEQ ID NO:25 - Glycine max LOX3 SEQ ID NO:26 - Maize LOX3 SEQ ID NO:27 - Avena sativa LOX3 SEQ ID NO:28-Barley LOX3 SEQ ID NO:29 - Triticum aestivum LOX3 SEQ ID NO:30-37 - RNA guide SEQ ID NO:38 - FATB motif SEQ ID NO:39 - Arabidopsis FATB1 SEQ ID NO:40 - Cereal LOX3 consensus sequence SEQ ID NO: 41-56 - Amino acid motif DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0096] General Techniques and Definitions Unless specifically defined otherwise, all technical and scientific terms used herein are intended to have the same meaning as commonly understood by one of ordinary skill in the art (e.g., in cell culture, molecular genetics, genetic modification including gene editing, protein chemistry, food preparation, and biochemistry).

[0097] Unless otherwise indicated, the recombinant protein, cell culture, and immunological techniques utilized in the present invention are standard procedures, well known to those skilled in the art. Such techniques are described in J. Perbal, A Practical Guide to Molecular Cloning, John Wiley and Sons (1984), J. Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press (1989), TA Brown (editor), Essential Molecular Biology: A Practical Approach, Volumes 1 and 2, IRL Press (1991), D M Glover and B D Hames (editors), DNA Cloning: A Practical Approach, Volumes 1-4, IRL Press (1995 and 1996), and FM Ausubel et al. (editors), Current Protocols in Molecular Biology, Greene Pub. Associates and Wiley-Interscience (1988, including all updates to date), Ed Harlow and David Lane (editors), Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, (1988), and J E Coligan et al. al. (editors) Current Protocols in Immunology, John Wiley & Sons (including all updates to date), and other sources.

[0098] The term "and / or," e.g., "X and / or Y," is understood to mean either "X and Y" or "X or Y," and is deemed to provide explicit support for both meanings or either meaning.

[0099] As used herein, unless stated to the contrary, the term about refers to + / - 10%, more preferably + / - 5%, more preferably + / - 1% of the specified value.

[0100] Throughout this specification the word "comprise" or variations such as "comprises" or "comprising" are understood to imply the inclusion of a stated element, integer or step, or group of elements, integers or steps, but not the exclusion of any other element, integer or step, or group of elements, integers or steps.

[0101] The terms "genetically modified," "genetically modified," or variants thereof, refer to any genetic manipulation by man, including the introduction of a gene into a cell by transformation or transduction, gene editing, mutating a gene in a cell, and altering or modulating the regulation of a gene, such as in a cell or organism or progeny thereof.

[0102] As used herein, "oil" refers to a composition that is primarily comprised of lipids and is liquid at room temperature. For example, the oil of the present invention preferably comprises at least 75% by weight, at least 80% by weight, at least 85% by weight, or at least 90% by weight of lipids. Typically, refined oil comprises at least 90% by weight of triacylglycerol (TAG) of the lipids in the oil. Minor components of oil such as diacylglycerol (DAG), free fatty acid (FFA), phospholipids, and sterols may be present as described herein. In one embodiment, the oil of the present invention is a grain oil and / or hull oil.

[0103] As used herein, the term "rice oil" refers to a composition obtained from the kernel / seed of rice plant containing at least 60% (w / w) lipid, or a portion thereof, such as the hull layer. Rice oil is typically liquid at room temperature. The lipids include fatty acids that are at least 6 carbons in length. The fatty acids are typically in esterified form, for example, triacylglycerols, phospholipids, and the like. The rice oil of the present invention includes oleic acid. The rice oil of the present invention may also include at least some other fatty acids, such as palmitic acid, linoleic acid, myristic acid, stearic acid, and / or linolenic acid. The fatty acids may be free fatty acids and / or may be found as triacylglycerols (TAGs). In one embodiment, at least 50%, more preferably at least 70%, more preferably at least 80% of the fatty acids in the rice oil of the present invention are found as TAGs. The rice oil of the present invention may form part of the rice kernel / seed, or a portion thereof, such as the aleurone layer or embryo / scutellum, which together are referred to as the "rice hull." Alternatively, the rice oil of the present invention is extracted from rice kernels / seeds or rice husks. An example of such an extraction procedure is provided in Example 1. Thus, in one embodiment, the "rice oil" of the present invention is "substantially purified" or "purified" rice oil, which is separated from one or more other lipids, nucleic acids, polypeptides, or other contaminating molecules with which it is naturally associated. Substantially purified rice oil is preferably at least 60%, more preferably at least 75%, more preferably at least 90% free of other components with which it is naturally associated. In a preferred embodiment, the ratios of oleic acid to linoleic acid, palmitic acid to oleic acid, and / or palmitic acid to linoleic acid are not significantly altered (e.g., 5% or less change) upon extraction when compared to the ratios in intact seeds / grains or husks. In a further embodiment, the rice oil has not been exposed to procedures such as hydrogenation that may alter the ratios of oleic acid to linoleic acid, palmitic acid to oleic acid, and / or palmitic acid to linoleic acid when compared to the ratios in the intact seed / kernel or husk. The rice oil of the present invention may further comprise non-fatty acid molecules such as, but not limited to, gamma-oryzanol and sterols.

[0104] Rice oil can be extracted from rice kernels or husks by any method known in the art. This typically involves extraction with non-polar solvents such as diethyl ether, petroleum ether, chloroform / methanol, or butanol mixtures. Lipids associated with the starch in the kernel can be extracted with water-saturated butanol. Rice oil can be "degummed" by methods known in the art to remove polysaccharides, or treated in other ways to remove contaminants or improve purity, stability, or color. Triacylglycerols and other esters in the oil can be hydrolyzed to release free fatty acids, or hydrogenated or chemically or enzymatically treated oils as known in the art.

[0105] Rice oil after extraction from rice seeds or husks typically contains a group of lipids called gamma-oryzanol. As used herein, "containing gamma-oryzanol" refers to the presence of at least 0.1% (w / w) gamma-oryzanol compounds in the oil. The level of gamma-oryzanol in rice oil after extraction and before removal from TAG is typically 1.5-3.5% (w / w). The compounds are typically a mixture of steryl and other triterpenyl esters of ferulic acid (4-hydroxy-3-methoxycinnamic acid). Cycloartenyl ferulate, 24-methylenecycloartanyl ferulate, and campesteryl ferulate are the predominant ferulates in oryzanol, with lower levels of β-sitosteryl ferulate and stigmasteryl ferulate. The presence of gamma-oryzanol is believed to help protect rice oil consumers against chronic diseases such as heart disease and cancer, and therefore the presence of gamma-oryzanol is advantageous.

[0106] As used herein, the "Rancimat" method is a well-known test based on accelerated aging. It is carried out by passing air through the sample in a reaction vessel with constantly increasing temperature. The fatty acids are oxidized during this process. At the end of the test, which is carried out by flowing an air stream into a measurement vessel where it is absorbed by the measurement solution (distilled water), volatile secondary reaction products are formed. The electrical conductivity, which is continuously recorded, increases as a result of the absorption of the ionic reaction products. The time until the secondary reaction products appear is called the induction time. This characterizes the oxidative stability of the oils and fats.

[0107] As used herein, the term "rice hull" refers to the layer between the inner white rice kernel and the outer shell of the rice seed / kernel (aleurone layer) as well as the embryo / scutellum of the kernel. Rice hull is the primary by-product of polishing brown rice to produce white rice.

[0108] As used herein, the term "Fad2 protein" refers to a protein that carries out a desaturase reaction that converts oleic acid to linoleic acid. Thus, the term "Fad2 protein activity" refers to the conversion of oleic acid to linoleic acid. As used herein, the term "Fad2-1 protein" refers to an evolutionarily conserved subclass of FAD2-1 proteins that are typically expressed in seeds. Exemplary FAD2-1 proteins have the amino acid sequence set forth in any one of SEQ ID NOs: 1-9. In rice, four Fad2 polypeptides exist (Zaplin et al., 2013; WO2008 / 006171), designated OsFAD2-1 (LOC_Os02g48560) (SEQ ID NO: 1), OsFAD2-2 (LOC_Os07g23430) (SEQ ID NO: 12), OsFAD2-3 (LOC_Os07g23410) (SEQ ID NO: 1:3), and OsFAD2-4 (LOC_Os07g23390) (SEQ ID NO: 14) (Figure 1). Naturally occurring FAD2 enzymes typically contain three histidine-rich motifs that are involved in the formation of a diiron-oxygen complex used in biochemical catalysis (Shanklin et al., 1998). In one embodiment, the rice FAD2-1 protein has an amino acid sequence that is at least 95%, at least 97%, at least 99%, or at least 99.5% identical, or identical, when compared to the sequence of amino acids set forth in SEQ ID NO:1.

[0109] As used herein, the term "LOX" or variations thereof refers to lipoxygenases (LOX; EC 1.13.12), which catalyze lipid peroxidation. Lipoxygenases have an amino-terminal β-barrel, now known as a PLAT (polycystin-1, lipoxygenase, alpha-toxin) domain, and a much larger α-helical domain that accommodates the catalytic iron (Newcomer and Brash, 2015). LOXs are classified into three types (Mizuno et al., 2003). Type I lipoxygenases are localized in chloroplasts and are stress inducible, type II lipoxygenases are localized in the cytoplasm, originate from dicots and are not stress inducible, and type III lipoxygenases are localized in the cytoplasm, originate from monocots and are associated with seed germination. Type I LOXs have a transit peptide, which is absent in type II and III LOXs. LOXs are also classified as either 9-LOXs or 13-LOXs, according to the enzyme's preference for carbon 9 or carbon 13 in the substrate hydrocarbon backbone, producing 9(S)-hydroperoxy- and 9(S)-hydroperoxy derivatives (Feussner and Wasternack, 2002). Based on bioinformatics analysis, the rice genome (rice.plantbiology.msu.edu) is claimed to have 14 LOX protein genes. Three isozymes of type III LOX (LOX1, LOX2, and LOX3) have been identified in developing rice seeds (Ohta et al., 1986). Among them, LOX3 is the most abundant enzyme. Exemplary LOX3 proteins have an amino acid sequence set forth in any one of SEQ ID NOs: 23-29. In one embodiment, the rice LOX3 protein has an amino acid sequence that is at least 95%, at least 97%, at least 99%, or at least 99.5% identical or identical when compared to the sequence of amino acids set forth in SEQ ID NO: 23.As used herein, the term "LOX3 protein activity" refers to the peroxidation of fatty acids in cereal grains, such as rice grains.

[0110] As used herein, the term "FatB polypeptide" refers to a protein that hydrolyzes palmitoyl-ACP to produce free palmitic acid. Thus, the term "FatB activity" refers to the hydrolysis of palmitoyl-ACP to produce free palmitic acid. As used herein, the term "FatB-1 protein" refers to an evolutionarily conserved subclass of FATB proteins that are typically expressed in seeds. There are four rice OsFATB genes, named FATB1 (LOC_Os06g05130) (SEQ ID NO: 19), FATB2 (LOC_Os11g43820) (SEQ ID NO: 20), FATB3 (LOC_Os02g43090) (SEQ ID NO: 21), and FATB4 (LOC_Os06g39520) (SEQ ID NO: 22) (WO2008 / 006171). In one embodiment, the rice FATB-1 protein has an amino acid sequence that is at least 95%, at least 97%, at least 99%, or at least 99.5% identical, or identical, when compared to the sequence of amino acids set forth in SEQ ID NO:21.

[0111] As used herein, the phrase "more stable" is a relative term. Stability refers to the oxidative stability of oil. In particular, a "more stable" oil (such as the rice oil of the present invention) is oxidized to a lower extent than oil from a wild-type plant (lacking the genetic modification of the present invention) when stored under the same conditions for the same length of time. As described herein, one measure for improving stability is hexanal production (see Example 9).

[0112] The terms "seed" and "grain" are used interchangeably herein. "Grain" generally refers to mature, harvested grain, but may also refer to grain after imbibition or germination, depending on the context. Mature grain generally has a moisture content of less than about 18-20%.

[0113] As used herein, a "fertile" grain is capable of being germinated to produce a fertile plant, while a fertile plant is capable of producing fertile grain. In one embodiment, a plant of the present invention is at least capable of producing 50% or more, or 75% or more of the amount of fertile grain when compared to a corresponding wild-type plant lacking the genetic modification.

[0114] As used herein, "wild type" refers to a cell, tissue, or plant that has not been modified according to the present invention. A wild type cell, tissue, or plant may be used as a control to compare the level of expression of an exogenous nucleic acid, or the degree and nature of trait modification by a cell, tissue, or plant modified as described herein. A wild type rice variety that is suitable as a reference standard includes Nipponbare.

[0115] Polypeptides The terms "polypeptide" and "protein" are generally used interchangeably.

[0116] "Substantially purified polypeptide" or "purified polypeptide" generally refers to a polypeptide that has been separated from lipids, nucleic acids, other peptides, and other contaminating molecules with which the polypeptide is naturally associated. Preferably, a substantially purified polypeptide is at least 90% free from other components with which the polypeptide is naturally associated. In one embodiment, the polypeptides of the invention have an amino acid sequence that differs from a naturally occurring FAD2-1 and / or LOX3 polypeptide, i.e., are amino acid sequence variants.

[0117] Genetically modified organisms, such as plants, and host cells of the present invention may contain an exogenous polynucleotide encoding a polypeptide of the present invention. In these cases, the plants and cells produce recombinant polypeptides. In the context of a polypeptide, the term "recombinant" refers to a polypeptide that, when produced by a cell, is encoded by an exogenous polynucleotide, which has been introduced into the cell or progenitor cell by recombinant DNA or RNA techniques, such as transformation. Typically, the cell contains a non-endogenous gene that causes the production of an altered amount of the polypeptide. In one embodiment, a "recombinant polypeptide" is a polypeptide made by expression of an exogenous (recombinant) polynucleotide in a plant cell.

[0118] The percent identity of polypeptides is determined by GAP (Needleman and Wunsch, 1970) analysis (GCG program) with a gap creation penalty of 5 and a gap extension penalty of 0.3. The query sequence is at least 300 amino acids in length and the GAP analysis aligns the two sequences over a region of at least 300 amino acids. More preferably, the query sequence is at least 325 amino acids in length and the GAP analysis aligns the two sequences over a region of at least 335 amino acids. Even more preferably, the query sequence is at least 350 amino acids in length and the GAP analysis aligns the two sequences over a region of at least 350 amino acids. Even more preferably, the GAP analysis aligns the two sequences over the entire length of these sequences.

[0119] With respect to defined polypeptides, it will be understood that % identity figures higher than the % identity figures provided above encompass preferred embodiments. Thus, where applicable, in terms of minimum % identity figures, it is preferred that the polypeptide comprises an amino acid sequence that is at least 96%, more preferably at least 97%, more preferably at least 98%, more preferably at least 99%, more preferably at least 99.1%, more preferably at least 99.2%, more preferably at least 99.3%, more preferably at least 99.4%, more preferably at least 99.5%, more preferably at least 99.6%, more preferably at least 99.7%, more preferably at least 99.8%, and even more preferably at least 99.9% identical to the relevant designated SEQ ID NO.

[0120] Amino acid sequence mutants / variants of the polypeptides defined herein, particularly FAD2-1 and / or LOX3 mutants / variants, can be prepared by introducing appropriate nucleotide changes into the nucleic acid or by in vitro synthesis of the desired polypeptide. Such mutants include, for example, deletion, insertion, or substitution of residues in the amino acid sequence. A combination of deletion, insertion, and substitution can be made to arrive at the final construct, so long as the final peptide product has the desired characteristics. Preferred amino acid sequence mutants have less than one, two, three, four, or ten amino acid changes relative to the reference polypeptide. Mutants / variants may be N-terminally and / or C-terminally truncated.

[0121] In one embodiment, the FAD2-1 protein with reduced activity has an N-terminal truncation compared to the wild-type sequence, such as missing the first 3, 4, 5, or 6 N-terminal amino acids. In one embodiment, the mutant lacks the first 6 amino acids of the wild-type FAD2-1 protein. In one embodiment, the LOX3 protein with reduced activity, preferably no activity, has a C-terminal truncation compared to the wild-type sequence, such as missing at least the last 100, 200, 300, 400, 500, 600 or so C-terminal amino acids. In one embodiment, the mutant lacks the last about 500 C-terminal amino acids of the wild-type LOX3 protein. In one embodiment, the genetically modified LOX3 gene encodes only the first about 91 amino acids of the wild-type LOX3 protein.

[0122] Mutant (altered) polypeptides can be prepared using any technique known in the art, for example, using directed evolution, rational design strategies, or mutagenesis (see below). Products derived from the mutated / altered DNA can be easily screened using the techniques described herein to determine whether they confer reduced FAD2-1 or LOX3 protein activity when expressed in a plant, such as rice. For example, a method can include producing a plant with a genetic modification that expresses the mutated / altered DNA and determining the fertility and fatty acid profile of the plant's grain.

[0123] In designing amino acid sequence variants, the location of the mutation site and the nature of the mutation will depend on the characteristic to be altered. The sites for mutation can be modified individually or sequentially, for example, by (1) substituting conservative amino acid choices first and then substituting more radical choices depending on the results achieved, (2) deleting the target residue, or (3) inserting other residues adjacent to the located site.

[0124] Amino acid sequence deletions generally range from about 1 to 15 residues, more preferably about 1 to 10 residues, and typically about 1 to 5 contiguous residues, but can be larger in the case of knockout mutants such as LOX3.

[0125] Substitution variants have at least one amino acid residue in a polypeptide molecule removed and a different residue inserted in its place.If it is desired to maintain a certain activity, it is preferable to make more conservative substitutions at amino acid positions that are highly conserved in related protein families.Examples of conservative substitutions are shown in Table 2 under the heading of "exemplary substitutions". [Table 2]

[0126] In one embodiment, the mutant / variant polypeptide has one, or two, or three, or four conservative amino acid changes when compared to the naturally occurring polypeptide. Details of the conservative amino acid changes are provided in Table 2.

[0127] The primary amino acid sequence of a wild-type polypeptide can be used to design variants / mutants thereof based on comparison to closely related polypeptides (e.g., as shown in Figures 11 and 12). As one of skill in the art will appreciate, residues that are highly conserved among closely related proteins are more likely to be capable of being altered to reduce activity, particularly with non-conservative substitutions.

[0128] In one embodiment, FATB1 with reduced activity has an amino acid sequence in which LNHVKTAG (SEQ ID NO: 41) is replaced with LNHVKTCW (SEQ ID NO: 42). In one embodiment, FATB1 with reduced activity has an amino acid sequence in which FLAAEKOW (SEQ ID NO: 43) is replaced with FLAAENSG (SEQ ID NO: 44) or FLAAEKTV (SEQ ID NO: 45). In one embodiment, FATB1 with reduced activity has an amino acid sequence in which FLAAEKOW is replaced with FLAAENSG.

[0129] In one embodiment, the FATB2 with reduced activity has an amino acid sequence in which MIRSYEIGAD (SEQ ID NO: 46) is replaced with MIRSYEDWC* (SEQ ID NO: 47).

[0130] In one embodiment, the FATB3 with reduced activity has an amino acid sequence in which MIRSYEIGAD (SEQ ID NO: 46) is replaced with MIRSYEDWC* (SEQ ID NO: 47) or MIRSYDWR* (SEQ ID NO: 48). In one embodiment, the FATB3 with reduced activity has an amino acid sequence in which MIRSYEIGAD is replaced with MIRSYEDWC*.

[0131] In one embodiment, FATB4 with reduced activity has an amino acid sequence in which GLLGDGFG (SEQ ID NO: 49) is replaced with GLLGDFWL (SEQ ID NO: 50), GLLGDGFW (SEQ ID NO: 51), GLLGDFG (SEQ ID NO: 52), or GLLFWLNA (SEQ ID NO: 53). In one embodiment, FATB4 with reduced activity has an amino acid sequence in which GLLGDGFG (SEQ ID NO: 49) is replaced with GLLGDFWL (SEQ ID NO: 50).

[0132] In one embodiment, the FAD2-1 knockdown has an amino acid sequence with MGAGGR (SEQ ID NO: 54) deleted from the N-terminus. In one embodiment, the FAD2-1 knockdown has an amino acid sequence with Aa177'PYVYHNPIG'aa185 (SEQ ID NO: 55) replaced with Aa177'PYVYHTIG'aa184 (SEQ ID NO: 56). In one embodiment, the FAD2-1 knockdown has an amino acid sequence with MGAGGR deleted from the N-terminus and Aa177'PYVYHNPIG'aa185 replaced with Aa177'PYVYHTIG'aa184.

[0133] In one embodiment, the grain, husk, and / or plant of the present invention comprises: i) a LOX3 gene encoding only the first approximately 91 amino acids of the wild-type LOX3 protein; ii) a FAD2-1 gene encoding a FAD2-1 polypeptide lacking MGAGGR at the N-terminus and including Aa177'PYVYHTIG'aa184; iii) the FATB2 gene encoding a polypeptide ending with MIRSYEDWC* (SEQ ID NO: 47); iv) a FATB3 gene encoding a polypeptide ending with MIRSYEDWC* (SEQ ID NO: 47); and v) is homozygous for the FATB4 gene encoding a polypeptide comprising GLLGDFWL.

[0134] In one embodiment, the grain, husk, and / or plant of the present invention comprises: i) a LOX3 gene encoding only the first approximately 91 amino acids of the wild-type LOX3 protein; ii) a FAD2-1 gene encoding a FAD2-1 polypeptide lacking MGAGGR at the N-terminus and including Aa177'PYVYHTIG'aa184; iii) the FATB1 gene encoding a polypeptide comprising FLAAENSG; and iv) being homozygous for the FATB4 gene encoding a polypeptide comprising GLLGDFWL;

[0135] In one embodiment, the grain, husk, or plant has wild-type phospholipase D (PLD) activity.

[0136] directional evolution In directed evolution, random mutagenesis is applied to a protein and a selection regime is used to select variants with desired qualities, e.g., reduced activity. Further rounds of mutation and selection are then applied. A typical directed evolution strategy involves three steps: 1) Diversification: Genes encoding proteins of interest are randomly mutated and / or recombined to create large libraries of gene variants. Variant gene libraries can be constructed through error prone PCR from pools of DNase I digested fragments prepared from parental templates (Stemmer, 1994a; Stemmer, 1994b; Crameri et al., 1998; Coco et al., 2001), from degenerate oligonucleotides (Ness et al., 2002; Coco, 2002), or from a mixture of both, or even from undigested parental templates (Zhao et al., 1998; Eggert et al., 2005; Jezequek et al., 2008) (see, e.g., Leung, 1989; Cadwell and Joyce, 1992), and are typically assembled through PCR. Libraries can also be generated from parental sequences that have been recombined in vivo or in vitro by either homologous or non-homologous recombination (Ostermeier et al., 1999; Volkov et al., 1999; Sieber et al., 2001). Variant gene libraries can also be constructed by subcloning the gene of interest into a suitable vector, transforming the vector into a "mutator" strain such as E. coli XL-1 Red (Stratagene), and propagating the transformed bacteria for a suitable number of generations. Variant gene libraries can also be constructed by subjecting the gene of interest to DNA shuffling (i.e., in vitro homologous recombination of a pool of selected mutant genes by random fragmentation and reassembly), as broadly described by Harayama (1998).

[0137] 2) Selection: Screening or selection is used to test the library for the presence of mutants (variants) with desired properties. Screening allows for manual identification and isolation of high-performing mutants, while all non-functional mutants are automatically eliminated during selection. Screening may include screening for the presence of known conserved amino acid motifs. Alternatively, or additionally, screening may include expressing mutant polynucleotides in a host organism or part thereof and assaying activity levels.

[0138] 3) Amplification: Variants identified in selection or screening are replicated many times, allowing researchers to sequence their DNA to understand what mutations have arisen.

[0139] Collectively, these three steps are referred to as a "round" of directed evolution. Most experiments will involve more than one round. In these experiments, the "winners" from the previous round are diversified in the next round to create a new library. At the end of the experiment, biochemical methods are used to characterize all evolved protein or polynucleotide variants.

[0140] rational design Proteins can be rationally designed based on known information about protein structure and folding. This can be accomplished by designing from scratch (de novo design) or by redesigning based on natural scaffolds (see, e.g., Hellinga, 1997, and Lu and Berry, Protein Structure Design and Engineering, Handbook of Proteins 2, 1153-1157 (2007)). Protein design typically involves identifying sequences that fold into a given or target structure, and can be accomplished using computer models. Computational protein design algorithms search sequence-conformation space for sequences that have low energy when folded into the target structure. Computational protein design algorithms use models of protein energetics to evaluate how mutations affect protein structure and function. These energy functions typically include a combination of molecular mechanics, statistical (i.e., knowledge-based), and other empirical terms. Suitable available software includes IPRO (Interative Protein Redesign and Optimization), EGAD (A Genetic Algorithm for Protein Design), Rosetta Design, Sharpen, and Abalone.

[0141] Polynucleotides and Genes The present invention refers to various polynucleotides. As used herein, "polynucleotide" or "nucleic acid" or "nucleic acid molecule" refers to a polymer of nucleotides that can be DNA or RNA or a combination thereof, including genomic DNA, mRNA, cRNA, and cDNA. Less preferred polynucleotides include tRNA, siRNA, shRNA, and hpRNA. It can be DNA or RNA of cellular, genomic, or synthetic origin, for example DNA or RNA made in an automated synthesizer, and can be combined with carbohydrates, lipids, proteins, or other materials to perform a specific activity defined herein, can be labeled with fluorescent or other groups, or attached to a solid support, or can contain one or more modified nucleotides not found in nature, as known to those skilled in the art. The polymer can be single-stranded, essentially double-stranded, or partially double-stranded. As used herein, base pairing refers to standard base pairing between nucleotides, including G:U base pairing. "Complementary" means that two polynucleotides are capable of base pairing (hybridization) along a portion of the length of the two polynucleotides or along the complete length of one or both. The term "polynucleotide" is used interchangeably herein with the term "nucleic acid." Preferred polynucleotides of the invention encode the polypeptides of the invention.

[0142] By "isolated polynucleotide" is meant a polynucleotide that is separated from polynucleotide sequences with which it is generally associated or linked in its natural state when found in nature. Preferably, an isolated polynucleotide is at least 90% free from other components with which it is naturally associated when found in nature. Preferably, the polynucleotide is not a naturally occurring polynucleotide (a chimeric polynucleotide), for example, by covalently linking two shorter polynucleotide sequences in a manner not found in nature.

[0143] The present invention may include the modification of gene activity, as well as the construction and use of chimeric genes. As used herein, the term "gene" includes any deoxyribonucleotide sequence that includes a protein coding region or that is transcribed but not translated in a cell, and associated non-coding and regulatory regions. Such associated regions are typically located adjacent to the coding or transcribed region on both the 5' and 3' ends, over a distance of about 2 kb on either side. In this regard, a gene may include control signals, such as promoters, enhancers, termination and / or polyadenylation signals, that are naturally associated with a given gene, or heterologous control signals, in which case the gene is referred to as a "chimeric gene." Sequences that are located 5' of the coding region and present on the mRNA are referred to as 5' non-translated sequences. Sequences that are located 3' or downstream of the coding region and present on the mRNA are referred to as 3' non-translated sequences. The term "gene" encompasses both cDNA and genomic forms of a gene.

[0144] Genomic forms or clones of a gene containing transcribed regions may be interrupted with non-coding sequences termed "introns" or "intervening regions" or "intervening sequences" that may be either homologous or heterologous to the "exons" of the gene. As used herein, an "intron" is a segment of a gene that is transcribed as part of the primary RNA transcript but is not present in the mature mRNA molecule. Introns are removed or "spliced ​​out" from the nuclear or primary transcript and are therefore not present in the messenger RNA (mRNA). Introns may contain regulatory elements such as enhancers. As used herein, an "exon" refers to a DNA region that corresponds to an RNA sequence that is present in the mature mRNA or mature RNA molecule when the RNA molecule is not translated. The mRNA functions during translation to specify the sequence or order of amino acids in a nascent polypeptide. The term "gene" includes synthetic or fusion molecules that encode all or a portion of the proteins of the invention described herein, as well as complementary nucleotide sequences to any one of the above. The gene can be introduced into a vector suitable for extrachromosomal maintenance in the cell or, preferably, for integration into the host genome.

[0145] As used herein, "chimeric gene" refers to any gene that contains covalently linked sequences that are not found in nature. Typically, chimeric genes contain regulatory and transcriptional or protein coding sequences that are not found together in nature. Thus, chimeric genes may contain regulatory and coding sequences that are derived from different sources, or regulatory and coding sequences that are derived from the same source but are organized in a manner different from that found in nature. In one embodiment, the protein coding region is operably linked to a promoter or polyadenylation / terminator region that is heterologous to the gene, thereby forming a chimeric gene. The term "endogenous" is used herein to refer to a substance that is normally present or produced in an unmodified plant at the same developmental stage as the plant under investigation. An "endogenous gene" refers to a native gene in its natural location in the genome of an organism. As used herein, "recombinant nucleic acid molecule", "recombinant polynucleotide", or variations thereof, refer to a nucleic acid molecule that has been constructed or modified by recombinant DNA / RNA technology. The terms "heterologous polynucleotide" or "exogenous polynucleotide" or "heterologous polynucleotide" and the like refer to any nucleic acid that is introduced into the genome of a cell by experimental manipulation.

[0146] A foreign or exogenous gene can be a gene inserted into a non-native organism or cell, a native gene introduced into a new location in the native host, or a chimeric gene. Alternatively, a foreign or exogenous gene can be the result of editing the genome of an organism or cell, or progeny derived therefrom. A "transgene" is a gene that has been introduced into a genome by a transformation procedure.

[0147] Furthermore, in the context of polynucleotides (nucleic acids), the term "exogenous" refers to a polynucleotide when present in a cell that does not naturally contain the polynucleotide.

[0148] The percent identity of polynucleotides is determined by GAP (Needleman and Wunsch, 1970) analysis (GCG program) with a gap creation penalty of 5 and a gap extension penalty of 0.3. The query sequence is at least 900 nucleotides in length and the GAP analysis aligns the two sequences over a region of at least 900 nucleotides. Preferably, the query sequence is at least 975 nucleotides in length and the GAP analysis aligns the two sequences over a region of at least 975 nucleotides. Even more preferably, the query sequence is at least 1,050 nucleotides in length and the GAP analysis aligns the two sequences over a region of at least 1,050 nucleotides. Even more preferably, the GAP analysis aligns the two sequences over the entire length of these sequences.

[0149] With respect to defined polynucleotides, it will be understood that % identity figures higher than those provided above encompass preferred embodiments. Thus, where applicable, in terms of minimum % identity figures, it is preferred that the polynucleotide comprises a polynucleotide sequence that is at least 50%, at least 60%, more preferably at least 70%, more preferably at least 75%, more preferably at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least 91%, more preferably at least 92%, more preferably at least 93%, more preferably at least 94%, more preferably at least 95%, more preferably at least 96%, more preferably at least 97%, more preferably at least 98%, more preferably at least 99%, more preferably at least 99.1%, more preferably at least 99.2%, more preferably at least 99.3%, more preferably at least 99.4%, more preferably at least 99.5%, more preferably at least 99.6%, more preferably at least 99.7%, more preferably at least 99.8%, and even more preferably at least 99.9% identical to the relevant designated SEQ ID NO.

[0150] The present invention also relates to the use of oligonucleotides, for example in methods of screening for polynucleotides of the present invention or in methods of encoding polypeptides of the present invention. As used herein, an "oligonucleotide" is a polynucleotide of up to 50 nucleotides in length. The minimum size of such oligonucleotides is the size required for the formation of a stable hybrid between the oligonucleotide and a complementary sequence on the nucleic acid molecule of the present invention. They can be RNA, DNA, or any combination or derivative. Oligonucleotides are typically relatively short single-stranded molecules of 10 to 30 nucleotides, generally 15 to 25 nucleotides in length. When used as a guide, probe, or primer for genome editing in an amplification reaction, the minimum size of such oligonucleotides is the size required for the formation of a stable hybrid between the oligonucleotide and a complementary sequence on the target nucleic acid molecule. Preferably, the oligonucleotide is at least 15 nucleotides, more preferably at least 18 nucleotides, more preferably at least 19 nucleotides, more preferably at least 20 nucleotides, more preferably at least 22 nucleotides, and even more preferably at least 25 nucleotides in length. Oligonucleotides of the invention used as probes are typically conjugated to a label, such as a radioisotope, an enzyme, biotin, a fluorescent molecule, or a chemiluminescent molecule.

[0151] As those skilled in the art will recognize, the sequences of the oligonucleotide primers described herein may vary to some extent without affecting their usefulness for the methods of the present invention. The "variants" of the oligonucleotides disclosed herein (also referred to herein as "primers" or "probes" depending on their use) useful for the methods of the present invention include molecules of genomes of varying sizes that are close to and / or capable of hybridizing to the genome of the specific oligonucleotide molecules defined herein. For example, variants may contain additional nucleotides (e.g., one, two, three, four or more) or fewer nucleotides, so long as the nucleotides still hybridize to the target region. Furthermore, some nucleotides may be substituted without affecting the ability of the oligonucleotide to hybridize to the target region. In addition, variants that hybridize close to (e.g., but not limited to, within 50 nucleotides or within 100 nucleotides) the region of the genome that the specific oligonucleotides defined herein hybridize to can be easily designed.

[0152] The present invention includes oligonucleotides that can be used, for example, as guides for RNA-guided endonucleases (see, for example, SEQ ID NOs: 30-37), as probes for identifying nucleic acid molecules, or as primers for producing nucleic acid molecules. Probes and / or primers can be used to clone homologs of the polynucleotides of the present invention from other species. Additionally, hybridization techniques known in the art can also be used to screen genomic or cDNA libraries for such homologs.

[0153] The polynucleotides of the present invention have one or more genetic modifications, which are deletions, insertions, or substitutions of nucleotide residues, when compared to naturally occurring molecules. Variants of the polynucleotides or oligonucleotides of the present invention include molecules of varying sizes of genomes close to the genome of the reference polynucleotides or oligonucleotides defined herein, and / or molecules that are capable of hybridizing to the rice (for example) genome. For example, variants can contain additional nucleotides (e.g., one, two, three, four or more), or fewer nucleotides, so long as the nucleotides still hybridize to the target region. Furthermore, some nucleotides can be substituted without affecting the ability of the oligonucleotide to hybridize to the target region. In addition, variants can be readily designed that hybridize close to, for example, within 50 nucleotides, the region of the plant genome to which a particular oligonucleotide defined herein hybridizes. In particular, this includes polynucleotides that code for the same polypeptide or amino acid sequence, but whose nucleotide sequence varies due to redundancy in the genetic code. The terms "polynucleotide variant" and "variant" include naturally occurring allelic variants.

[0154] nucleic acid construct The present invention includes nucleic acid constructs comprising the polynucleotides of the present invention, as well as vectors and host cells containing them, methods of their production and use, and their use. The present invention refers to operably connected or linked elements. "Operably connected" or "operably linked" and the like refer to the association of polynucleotide elements in a functional relationship. Typically, operably connected nucleic acid sequences are linked contiguously, and where necessary to join two protein coding regions, contiguous and in reading frame. A coding sequence is "operably connected" to another coding sequence when RNA polymerase transcribes the two coding sequences into a single RNA, which, when translated, is then translated into a single polypeptide having amino acids from both coding sequences. The coding sequences do not have to be contiguous to each other, so long as the expressed sequence is ultimately processed to produce the desired protein.

[0155] As used herein, the terms "cis-acting sequence", "cis-acting element", or "cis-regulatory region" or "regulatory region" or similar terms are taken to mean any sequence of nucleotides that, when properly positioned and connected to an expressible genetic sequence, is capable of at least partially regulating the expression of the genetic sequence. Those skilled in the art recognize that a cis-regulatory region may be capable of activating, silencing, enhancing, suppressing, or otherwise altering the level of expression and / or cell type specificity and / or developmental specificity of a genetic sequence at the transcriptional or post-transcriptional level. In a preferred embodiment of the present invention, the cis-acting sequence is an activator sequence that enhances or stimulates the expression of an expressible genetic sequence.

[0156] "Operably linked" a promoter or enhancer element to a transcribable polynucleotide means that the transcribable polynucleotide (e.g., a protein-coding polynucleotide or other transcript) is placed under the regulatory control of the promoter, which then controls the transcription of the polynucleotide. In constructing heterologous promoter / structural gene combinations, it is generally preferred that the promoter or a variant thereof is positioned at a distance from the transcription start site of the transcribable polynucleotide, which distance is approximately the same as the distance between the promoter and the protein-coding region that it controls in its natural context, i.e., the gene from which it is derived. As is known in the art, some variation in this distance can be tolerated without loss of function. Similarly, the preferred positioning of a regulatory sequence element (e.g., an operator, enhancer, etc.) relative to a transcribable polynucleotide that is placed under its control is defined by the positioning of the element in its natural context, i.e., the positioning of the gene from which it is derived.

[0157] As used herein, a "promoter" or "promoter sequence" refers to a region of a gene, generally upstream (5') of the RNA coding region, that controls the initiation and level of transcription in a cell of interest. A "promoter" includes classical genomic gene transcriptional regulatory sequences, such as TATA box and CCAAT box sequences, as well as additional regulatory elements (i.e., upstream activating sequences, enhancers, and silencers) that alter gene expression in response to developmental and / or environmental stimuli or in a tissue- or cell-type-specific manner. Promoters are usually, but not necessarily, located upstream of the structural gene whose expression they regulate (e.g., some PolIII promoters). Furthermore, regulatory elements, including promoters, are usually located within 2 kb of the start site of transcription of the gene. Promoters may contain additional specific regulatory elements, located more distal to the start site, to further enhance expression in the cell and / or alter the timing or inducibility of expression of the structural gene to which the additional specific regulatory elements are operably linked.

[0158] "Constitutive promoter" refers to a promoter that directs the expression of an operably linked transcription sequence in many or all tissues of an organism, such as a plant. As used herein, the term constitutive does not necessarily indicate that a gene is expressed at the same level in all cell types, but indicates that the gene is expressed in a wide range of cell types, although some variation in levels is often detectable. As used herein, "selective expression" refers to expression, for example, almost exclusively in a particular organ of a plant, such as the endosperm, embryo, leaf, fruit, tuber, or root. In a preferred embodiment, the promoter is selectively or preferentially expressed in the leaves and / or stems of a plant, preferably a cereal plant. Thus, selective expression can be contrasted with constitutive expression, which refers to expression in many or all tissues of a plant under most or all of the conditions experienced by the plant.

[0159] Selective expression may also result in compartmentalization of the product of gene expression in specific plant tissues, organs or developmental stages such as adults or seedlings. Compartmentalization in specific subcellular locations such as plastids, cytosol, vacuoles, or apoplastic spaces can be achieved by including within the structure of the gene product an appropriate signal, e.g., a signal peptide, for transport to the required cellular compartment, or, in the case of semi-autonomous organelles (plastids and mitochondria), by direct integration of a transgene with appropriate regulatory sequences into the organelle genome.

[0160] A "tissue-specific promoter" or "organ-specific promoter" is a promoter that is preferentially expressed in one tissue or organ relative to many, preferably most if not all, other tissues or organs, e.g., within a plant. Typically, the promoter is expressed at a 10-fold higher level in a particular tissue or organ than in other tissues or organs.

[0161] The promoters contemplated by the present invention may be native to the host plant to be transformed, or may be derived from alternative sources where the region is functional in the host plant. Other sources include Agrobacterium T-DNA genes such as promoters of genes for the biosynthesis of nopaline, octapine, mannopine, or other opine promoters, tissue-specific promoters (see, e.g., US5,459,252 and WO91 / 13992); promoters from viruses (including host-specific viruses), or partially or wholly synthetic promoters. Numerous promoters that are functional in monocotyledonous and dicotyledonous plants are well known in the art (see, e.g., Greve, 1983; Salomon et al., 1984; Garfinkel et al., 1983; Barker et al., 1983), including various promoters isolated from plants and viruses, such as the cauliflower mosaic virus promoters (CaMV 35S, 19S). Non-limiting methods for assessing promoter activity are disclosed by Medberry et al. (1992, 1993), Sambrook et al. (1989, supra), and US Pat. No. 5,164,316.

[0162] Alternatively or in addition, the promoter may be an inducible promoter or a developmentally regulated promoter, which is capable of driving the expression of the introduced polynucleotide, for example, at the appropriate developmental stage of the plant. Other cis-acting sequences that may be used include transcriptional and / or translational enhancers. Enhancer regions are well known to those skilled in the art and may include an ATG translation initiation codon and adjacent sequences. If included, the initiation codon should be in line with the reading frame of the coding sequence associated with the heterologous or exogenous polynucleotide to ensure translation of the entire sequence, if the entire sequence is translated. The translation initiation region may be provided from the source of the transcription initiation region or from the heterologous or exogenous polynucleotide. The sequence may also be derived from the source of the promoter selected to drive transcription and may be specifically modified to increase translation of mRNA.

[0163] The nucleic acid construct of the present invention may include a 3' untranslated sequence of about 50 to 1,000 nucleotide base pairs that may include a transcription termination sequence. The 3' untranslated sequence may contain a transcription termination signal that may or may not include a polyadenylation signal and any other regulatory signal capable of effecting mRNA processing. The polyadenylation signal functions to add a polyadenylic acid tract to the 3' end of the mRNA precursor. Polyadenylation signals are generally recognized by the presence of homology with the canonical form 5'AATAAA-3', although variations are not uncommon. Transcription termination sequences that do not include a polyadenylation signal include terminators of PolI or PolIII RNA polymerase that include a stretch of four or more thymidines. An example of a suitable 3' non-translated sequence is the 3' transcribed untranslated region containing the polyadenylation signal from the octopine synthase (ocs) or nopaline synthase (nos) genes of Agrobacterium tumefaciens (Bevan et al., 1983). Suitable 3' non-translated sequences may also be derived from plant genes such as the ribulose-1,5-bisphosphate carboxylase (ssRUBISCO) gene, although other 3' elements known to those skilled in the art may also be used.

[0164] Specific leader sequences may also be used, since DNA sequences inserted between the transcription initiation site and the start of the coding sequence, i.e., untranslated 5' leader sequences (5'UTRs), can affect gene expression if the 5'UTR is translated and transcribed. Suitable leader sequences include those that contain sequences selected to direct optimal expression of a foreign or endogenous DNA sequence. For example, such leader sequences include preferred consensus sequences that can increase or maintain mRNA stability and prevent inappropriate initiation of translation, as described, for example, by Joshi (1987).

[0165] vector The present invention includes the use of vectors for the manipulation or transfer of genetic constructs. By "vector" or "chimeric vector" is meant a nucleic acid molecule, preferably a DNA molecule, derived for example from a plasmid, a bacteriophage, or a plant virus, into which a nucleic acid sequence can be inserted or cloned. The vector is preferably double-stranded DNA, contains one or more unique restriction sites, and may be capable of autonomous replication in a defined host cell, including a target cell or tissue or a precursor cell or tissue thereof, or may be capable of integration into the genome of a defined host, such that the cloned sequence can be reproduced. Thus, the vector may be an autonomously replicating vector, i.e., a vector that exists as an extrachromosomal entity, where the replication of the vector is independent of chromosomal replication, e.g., linear or closed circular plasmids, extrachromosomal elements, minichromosomes, or artificial chromosomes. The vector may contain any means for ensuring self-replication. Alternatively, the vector may be a vector that, when introduced into a cell, is integrated into the genome of the recipient cell, where it is replicated together with the chromosome into which it is integrated. A vector system may comprise a single vector or plasmid, two or more vectors or plasmids, or a transposon, which together contain the total DNA to be introduced into the genome of the host cell. The choice of vector typically depends on the compatibility of the vector with the cell into which it is introduced. A vector may also comprise a selection marker, such as an antibiotic resistance gene, a herbicide resistance gene, or other gene that can be used to select suitable transformants. Examples of such genes are well known to those skilled in the art.

[0166] The nucleic acid construct of the present invention can be introduced into a vector such as a plasmid. Plasmid vectors typically contain additional nucleic acid sequences that provide easy selection, amplification, and transformation of the expression cassette in prokaryotic and eukaryotic cells, including, for example, pUC-derived vectors, pSK-derived vectors, pGEM-derived vectors, pSP-derived vectors, pBS-derived vectors, or binary vectors containing one or more T-DNA regions. The additional nucleic acid sequences include an origin of replication to provide autonomous replication of the vector, a selectable marker gene, preferably a selectable marker gene encoding antibiotic or herbicide resistance, a unique multiple cloning site that provides multiple sites for inserting the nucleic acid sequence or gene encoded in the nucleic acid construct, and sequences that enhance transformation of prokaryotic and eukaryotic cells, particularly plant cells.

[0167] By "marker gene" is meant a gene that confers a distinct phenotype to cells expressing the marker gene, thus allowing such transformed cells to be distinguished from cells that do not possess the marker. A selectable marker gene confers a trait that allows for "selection" based on resistance to a selection agent (e.g., herbicide, antibiotic, radiation, heat, or other treatment that damages untransformed cells). A screenable marker gene (or reporter gene) confers a trait that allows for identification by observation or testing, i.e., "screening" (e.g., β-glucuronidase, luciferase, GFP, or other enzymatic activity not present in untransformed cells). The marker gene and the nucleotide sequence of interest need not be linked.

[0168] To facilitate the identification of transformants, the nucleic acid construct desirably includes a selectable or screenable marker gene as or in addition to the heterologous or exogenous polynucleotide. The actual selection of the marker is not important, as long as the marker is functional (i.e., selective) in combination with the plant cell of choice. The marker gene and the heterologous or exogenous polynucleotide of interest do not need to be linked, since co-transformation of unlinked genes is also an efficient process in plant transformation, as described, for example, in US 4,399,216.

[0169] Examples of bacterial selectable markers are markers that confer antibiotic resistance, such as ampicillin, erythromycin, chloramphenicol, or tetracycline resistance, preferably kanamycin resistance. Exemplary selectable markers for the selection of plant transformants include the hyg gene encoding hygromycin B resistance, the neomycin phosphotransferase (nptII) gene conferring resistance to kanamycin, paromomycin, G418, the glutathione-S-transferase gene from rat liver that confers resistance to glutathione-derived herbicides, as described, for example, in EP 256223, the glutamine synthase gene that, upon overexpression, confers resistance to glutamine synthase inhibitors, such as phosphinothricin, as described, for example, in WO 87 / 05327, the acetyltransferase gene from Streptomyces viridochromogenes that confers resistance to the selection agent phosphinothricin, as described, for example, in EP 275957, and the acetyltransferase gene from Streptomyces viridochromogenes that confers resistance to the selection agent phosphinothricin, as described, for example, in Hinchee et al. (1988), genes encoding 5-enolshikimate-3-phosphate synthase (EPSPS) that confers resistance to N-phosphonomethylglycine, e.g., the bar gene that confers resistance to bialaphos, as described in WO 91 / 02071, nitrilase genes such as bxn from Klebsiella ozaenae that confers resistance to bromoxynil (Stalker et al., 1988), dihydrofolate reductase (DHFR) genes that confers resistance to methotrexate (Thillet et al., 1988), al., 1988), a mutant acetolactate synthase gene (ALS) that confers tolerance to imidazolinones, sulfonylureas, or other ALS-inhibiting chemicals (EP 154,204), a mutant anthranilate synthase gene that confers tolerance to 5-methyltryptophan, or a dalapon dehalogenase gene that confers tolerance to herbicides.

[0170] Preferred screenable markers include, but are not limited to, the uidA gene, which encodes the β-glucuronidase (GUS) enzyme, which is known to have various chromogenic substrates, the β-galactosidase gene, which encodes an enzyme for which chromogenic substrates are known, the aequorin gene (Prasher et al., 1985), which can be used in calcium-sensitive bioluminescence detection, the green fluorescent protein gene or derivatives thereof, the luciferase (luc) gene (Ow et al., 1986), which allows for bioluminescence detection, and others known in the art. As used herein, "reporter molecule" refers to a molecule that, by virtue of its chemical nature, provides an analytically identifiable signal, which facilitates the determination of promoter activity by reference to the protein product.

[0171] Preferably, the nucleic acid construct is stably integrated, for example, into the genome of the plant. Thus, the nucleic acid contains appropriate elements that allow the molecule to be integrated into the genome, or the construct is placed into an appropriate vector that can be integrated into the chromosome of the plant cell.

[0172] One embodiment of the present invention includes a recombinant vector, which comprises at least one polynucleotide molecule of the present invention, which is inserted into any vector capable of delivering the nucleic acid molecule into a host cell. Such vectors contain heterologous nucleic acid sequences, i.e., nucleic acid sequences that are not naturally found adjacent to the nucleic acid molecule of the present invention and that are preferably derived from a species other than the species from which the nucleic acid molecule is derived. Vectors can be either RNA or DNA, either prokaryotic or eukaryotic, and are typically viruses or plasmids.

[0173] Numerous vectors suitable for stable transfection of plant cells or for establishing genetically modified plants are described, for example, in Pouwels et al., Cloning Vectors: A Laboratory Manual, 1985, supp. 1987, Weissbach and Weissbach, Methods for Plant Molecular Biology, Academic Press, 1989, and Gelvin et al., Plant Molecular Biology Manual, Kluwer Academic Publishers, 1990. Typically, plant expression vectors contain, for example, one or more cloned plant genes under the transcriptional control of 5' and 3' regulatory sequences, and a dominant selectable marker. Such plant expression vectors can also contain promoter regulatory regions (e.g., regulatory regions that control inducible or constitutive expression, environmentally or developmentally regulated expression, or cell- or tissue-specific expression), transcription initiation sites, ribosome binding sites, RNA processing signals, transcription termination sites, and / or polyadenylation signals.

[0174] Recombinant cells Another embodiment of the present invention includes recombinant cells, including host cells transformed with one or more recombinant molecules of the present invention, or their progeny. Transformation of nucleic acid molecules into cells can be achieved by any method that allows nucleic acid molecules to be inserted into cells. Transformation techniques include, but are not limited to, transfection, particle bombardment / particle bombardment, electroporation, microinjection, lipofection, adsorption, and protoplast fusion. In one embodiment, gene editing is used to transform target cells, for example, using targeted nucleases such as TALEN, Cpf1, MAD7, and Cas9-CRISPR, or engineered nucleases derived therefrom.

[0175] The recombinant cell may remain unicellular or may develop into a tissue, organ, or multicellular organism. The transforming nucleic acid molecule of the invention may remain extrachromosomal or may be integrated into one or more sites within the chromosome of the transformed (e.g., recombinant) cell in such a manner that the ability of the transforming nucleic acid molecule to be expressed is retained. Preferred host cells are plant cells, more preferably cells of cereal plants, more preferably rice or sorghum cells, even more preferably rice cells.

[0176] Genome editing Endonucleases can be used to generate single- or double-stranded breaks in genomic DNA. Genomic DNA breaks in eukaryotic cells are repaired using non-homologous end joining (NHEJ) or homology-directed repair (HDR) pathways. NHEJ can result in imperfect repair resulting in undesired mutations, while HDR can allow precise gene insertion by using an exogenously supplied repair DNA template. Although transcription activator-like effector nucleases (TALENs) and zinc finger nucleases remain useful, CRISPR-associated (Cas) proteins have gained significant interest, and the CRISPR-Cas system provides a simpler, more versatile and less expensive tool for genome modification (Doudna and Charpentier, 2014).

[0177] CRISPR-Cas systems are classified into three main groups, using different nucleases or combinations of nucleases. Within class 1 CRISPR-Cas systems (types I, III, and IV), the effector module consists of a multiprotein complex, while class 2 systems (types II, V, and VI) use only one effector protein (Makarova et al., 2015). Cas contains genes that are bound to or located near or in the vicinity of adjacent CRISPR loci. Haft et al. (2005) provides an overview of the Cas protein family.

[0178] The nuclease is guided by a synthetic small guide RNA (sgRNA or gRNA), which may or may not include a tracRNA, resulting in the simplification of the CRISPR-Cas system to two genes, the endonuclease and the sgRNA (Jinek et al. 2012). The sgRNA is typically under the regulatory control of a U3 or U6 small nuclear RNA promoter. The sgRNA recognizes specific genes and portions of genes for targeting. Protospacer adjacent motifs (PAMs) flank the target site limiting the number of potential CRISPR-Cas targets within a genome, but the expansion of the nuclease also increases the number of available PAMs. There are a number of web tools available to design gRNAs, including CHOPCHOP (http: / / chopchop.cbu.uib.no), CRISPR Design https: / / omictools.com / crispr-design-tool, E-CRISP http: / / www.e-crisp.org / E-CRISP / , Geneious or Benchling https: / / benchling.com / crispr.

[0179] CRISPR-Cas systems, typically using RNA-guided Streptococcus pyogenes Cas9 Cas9 effector proteins or optimized sequence variants in multiple plant species, are currently most frequently employed for eukaryotic work (Luo et al., 2016). Luo et al. (2016) outline a number of studies in which genes have been successfully targeted in various plant species to produce indels and loss-of-function mutant phenotypes within endogenous gene open reading frames and / or promoters. Due to the cell wall on plant cells, delivery of CRISPR-Cas machinery into cells and successful transgenic regeneration has used Agrobacterium tumefaciens infection (Luo et al., 2016) or plasmid DNA particle bombardment or biolistic delivery. Suitable vectors for cereal transformation include pCXUNcas9 (Sun et al., 2016) or pYL CRISPR / Cas9Pubi-H available from Addgene (Ma et al., 2015, accession number KR029109.1).

[0180] Alternative CRISPR-Cas systems refer to effector enzymes that contain the nuclease RuvC domain but not the HNH domain, including Cas12 enzymes, including Cas12a, Cas12b, Cas12f, Cpf1, C2c1, C2c3, and engineered derivatives. Cpf1 creates a double-stranded break at the PAM-distal position in a staggered fashion, and being a smaller endonuclease may provide an advantage for certain species (Begemann et al., 2017). Other CRISPR-Cas systems include RNA-guided ribonucleases, including Cas13, Cas13a (C2c2), Cas13b, and Cas13c.

[0181] Sequence Insertion or Integration The CRISPR-Cas system can be combined with the provision of a nucleic acid sequence to direct the homologous repair of the insertion of a sequence into a genome. Targeted genomic integration of plant transgenes allows for sequential addition of transgenes at the same locus. This "cis-gene stacking" greatly simplifies subsequent breeding efforts, with all transgenes inherited as a single locus. When coupled with CRISPR / Cas9 cleavage at the target site, the transgene can be integrated into this locus by homology-directed repair, facilitated by flanking sequence homology. This approach can be used to rapidly introduce new alleles without linkage drag, or to introduce allele variants that do not exist in nature.

[0182] Nickase The CRISPR-CasII system uses the Cas9 nuclease, which has two enzymatic cleavage domains, the RuvC and HNH domains. Mutations have been shown to change the double-stranded break to a single-stranded break, resulting in a technical variant called nickase or nuclease-inactivated Cas9. The RuvC subdomain cleaves the non-complementary DNA strand, and the HNH subdomain cleaves this DNA strand that is complementary to the gRNA. The nickase or nuclease-inactivated Cas9 retains the DNA binding ability directed by the gRNA. S. pyogenes Cas9 nuclease with mutations in the subdomains, such as the D10A or H840A mutations, is known in the art.

[0183] Genome editing or modification Base editors have been created by fusing deaminases with Cas9 domains (WO2018 / 086623). By fusion, the deaminase can utilize the sequence targeting directed by the gRNA to convert the target cytidine (C) to uracil (U) by deamination of the cytidine in DNA. The mismatch repair machinery of the cell then replaces the U with a T. Suitable cytidine deaminases can include APOBEC1 deaminase, activation-induced cytidine deaminase (AID), APOBEC3G, and CDA1. Additionally, the Cas9-deaminase fusion can be a mutant Cas9 with nickase activity to generate single-strand breaks. It has been suggested that nickase proteins were potentially more efficient in promoting homology-directed repair (Luo et al., 2016).

[0184] Vector-free genome editing or genome modification More recently, a method for using a vector-free approach using Cas9 / sgRNA ribonucleoprotein has been described that successfully reduces off-target events. The method requires in vitro expression of Cas9 ribonucleoprotein (RNP) that is transformed into cells or protoplasts and does not rely on Cas9 being integrated into the host genome, thereby reducing undesired side cleavage associated with random integration of the Cas9 gene. Only short flanking sequences are required to form stable Cas9 and sgRNA stable ribonucleoproteins in vitro. Woo et al. (2015) produced and introduced preassembled Cas9 / sgRNA protein / RNA complexes into Arabidopsis protoplasts, rice, lettuce, and tobacco, and observed up to 45% targeted mutagenesis frequency in regenerated plants. RNP and in vitro have been demonstrated in several species, including dicotyledonous plants (Woo et al., 2015), as well as monocotyledonous maize (Svitashev et al., 2016) and wheat (Liang et al., 2017). Plant genome editing using CRISPR-Cas9 in vitro transcriptomes or ribonucleoproteins is fully described in Liang et al. (2018) and Liang et al. (2019).

[0185] Methods for gene insertion Plant embryos can be bombarded with the Cas9 gene and sgRNA gene targeted to the site of integration along with DNA repair templates. The DNA repair templates can be synthetic DNA fragments or 127-mer oligonucleotides, each encoding a cDNA or gene of interest. Biolistically treated cells are grown on tissue culture medium. DNA can be extracted from callus or leaf tissue of T0 plants using the CTAB DNA extraction method and analyzed by PCR to confirm gene integration. T1 plants are selected if the PCR confirms the presence of the gene of interest.

[0186] The method involves introducing a DNA sequence of interest, referred to as a donor DNA and an endonuclease, into a plant cell. The endonuclease creates a break in the target site, which allows the first and second regions of homology of the donor DNA to undergo homologous recombination with their corresponding genomic regions of homology. The broken genomic DNA acts as an acceptor for the DNA sequence. The resulting exchange of DNA between the donor and genome results in the integration of the polynucleotide of interest of the donor DNA into the strand break in the target site in the plant genome, thereby altering the original target site and producing an altered genomic sequence.

[0187] The donor DNA can be introduced by any means known in the art. For example, a plant with a target site is provided. The donor DNA can be provided to the plant by known transformation methods, including Agrobacterium-mediated transformation or biolistic particle bombardment. The RNA-guided Cas or Cpf1 endonuclease cleaves at the target site, and the donor DNA is inserted into the transformed plant genome.

[0188] Homologous recombination occurs at low frequency in plant cells, but the process is thought to be increased / stimulated by the introduction of double-strand breaks (DSBs) at selected endonuclease target sites. Ongoing efforts to generate variants or alternatives of Cas, particularly Cas9, and Cas12a / Cpf1, MAD7, or Cms1, may improve efficiency.

[0189] Genetically modified plants As used herein as a noun, the term "plant" refers to an entire plant and any member of the plant kingdom, but as an adjective, it refers to any material present in, obtained from, derived from, or associated with a plant, such as plant organs (e.g., leaves, stems, roots, flowers), single cells (e.g., pollen), seeds, and plant cells. Plantlets from which roots and shoots emerge and germinated seeds are also included within the meaning of "plant." As used herein, the term "plant part" refers to one or more plant tissues or organs obtained from a plant and containing the genomic DNA of the plant. Plant parts include vegetative structures (e.g., leaves, stems), roots, floral organs / structures, seeds (including embryos, cotyledons, and seed coats), plant tissues (e.g., vascular tissue, ground tissue, etc.), cells and their progeny. As used herein, the term "plant cell" refers to a cell obtained from or within a plant, including protoplasts or other cells derived from a plant, gamete-producing cells, and cells that regenerate into whole plants. A plant cell may be a cell in culture. "Plant tissue" refers to differentiated tissue in or obtained from a plant ("explant"), or various forms of collections of plant cells in culture, such as undifferentiated tissue derived from immature or mature embryos, seeds, roots, shoots, fruits, tubers, pollen, tumor tissue such as crown galls, and callus. Exemplary plant tissues in or from seeds are cotyledons, embryos, and hypocotyls. Thus, the present invention includes plants and plant parts, and products comprising the same.

[0190] As used herein, the term "seed" refers to the "mature seed" of a plant that is either ready for harvest or has been harvested from a plant, typically as commercially harvested in the field, or the "developing seed" that occurs within the plant after fertilization and before harvest, before seed dormancy is established.

[0191] As used herein, a "genetically modified plant" or variants thereof refers to a plant that contains one or more genetic mutations, such as those introduced by gene editing, that are not found in a wild-type plant of the same species, variety, or cultivar.

[0192] Plants contemplated for use in the practice of the present invention include both monocotyledons and dicotyledons. Target plants include cereals (e.g., wheat, barley, rye, oats, rice, corn, sorghum, and related grains); grapes; beets (sugar beet and fodder beet); pome, stone, and soft fruits (apples, pears, plums, peaches, almonds, cherries, strawberries, raspberries, and blackberries); legumes (beans, lentils, peas, soybeans); oleaginous plants (rapeseed or other canola, mustard, poppy, olive, sunflower, safflower, flax, coconut, castor oil plants, cocoa beans, peanuts); cucumber plants ( Examples of suitable plants include, but are not limited to, mallow, cucumber, melon; fiber plants (cotton, flax, hemp, jute), citrus fruits (orange, lemon, grapefruit, mandarin); vegetables (spinach, lettuce, asparagus, cabbage, carrot, onion, tomato, potato, pepper); Lauraceae (avocado, cinnamon, camphor); or plants such as corn, tobacco, nuts, coffee, sugarcane, tea, vines, hops, grass, banana, and natural rubber plants, and ornamental plants (flowers, shrubs, broadleaf trees, and evergreen trees such as conifers). Preferably, the plant is a cereal plant. In one embodiment, the cereal plant is a rice or sorghum plant. In one embodiment, the cereal plant is rice. In one embodiment, the cereal plant is corn. In one embodiment, the cereal plant is triticale. In one embodiment, the cereal plant is oats. In one embodiment, the cereal plant is barley.

[0193] With respect to dicotyledons, and seeds or husks from dicotyledons, each of the embodiments relating to cereals also apply to the dicotyledons of the present invention, where applicable.

[0194] As used herein, the term "rice" refers to any species of the genus Oryza, including its progeny, as well as its progeny produced by crossing with other species. Preferably, the plant is an Oryza species that is commercially cultivated, such as a strain or cultivar or variety of Oryza sativa, or one suitable for commercial production of grain.

[0195] In one embodiment, the genetically modified plant is homozygous for each and every genetic variation that has been introduced, such that progeny do not segregate from the desired phenotype.

[0196] As used herein, the term "compared to an isogenic plant" or similar phrases refers to a plant that is isogenic or substantially isogenic compared to a genetically modified plant, but lacks genetic variation. Preferably, the corresponding isogenic plant is of the same cultivar or variety as the progenitor of the genetically modified plant of interest. As used herein, "wild type" or "corresponding" refers to a cell, tissue, or plant that has not been modified according to the present invention. The wild type or corresponding cell, tissue, or plant can be used as a control to compare the level of expression of mutant / variant proteins, or the degree and nature of trait modification, with a cell, tissue, or plant modified as described herein.

[0197] As defined in the context of the present invention, a genetically modified plant includes the progeny of a plant that has been genetically modified using recombinant techniques, and the progeny includes the genetic mutation of interest. Such progeny can be obtained by self-fertilization of the primary genetically modified plant, or by crossing such a plant with another plant of the same species. This will generally result in the modulation of the production of at least one protein defined herein in the desired plant or plant organ. A part of a genetically modified plant includes all parts and cells of the plant that include the genetic mutation, such as, for example, cultured tissue, callus, and protoplast.

[0198] Genetically modified plants as defined in the context of the present invention include plants (and parts and cells of said plants) and their progeny that have been genetically modified using recombinant techniques to cause the production of at least one polypeptide as defined herein in the desired plant or plant organ. Genetically modified plants can be produced using techniques known in the art, such as those outlined in A. Slater et al., Plant Biotechnology-The Genetic Manipulation of Plants, Oxford University Press (2003), N. Halford, Crop Technology: Genetic Modification and genome editing, World Scientific Publ Co Pte Ltd (2018), and P. Christou and H. Klee, Handbook of Plant Biotechnology, John Wiley and Sons (2004).

[0199] In one embodiment, the genetically modified plant is homozygous for each and every genetic modification introduced, so that progeny does not segregate from the desired phenotype.The genetically modified plant can also be heterozygous for the genetic modification introduced, for example, in F1 progeny grown from hybrid seeds.Such plants can provide advantages such as hybrid vigor, which are well known in the art.

[0200] Four general methods have been described for direct delivery of genes into cells: (1) chemical methods (Graham et al., 1973), (2) physical methods, such as microinjection (Capecchi, 1980), electroporation (see, e.g., WO87 / 06614, US5,472,869, 5,384,253, WO92 / 09696, and WO93 / 21335), and gene guns (see, e.g., US4,945,050 and US5,141,131), (3) viral vectors (Clapp. 1993, Lu et al., 1993, Eglitis et al., 1988), and (4) receptor-mediated mechanisms (Curiel et al., 1992, Wagner et al., 1992).

[0201] Acceleration methods that can be used include, for example, microprojectile bombardment and the like. One example of a method for transformation that delivers nucleic acid molecules to plant cells is microprojectile bombardment. This method is reviewed by Yang et al..Particle Bombardment Technology for Gene Transfer.Oxford Press.Oxford.England (1994). Non-biological particles (microprojectiles) that can be coated with nucleic acids and delivered into cells by a propelling force. Exemplary particles include particles composed of tungsten, gold, platinum, and the like. In addition to being an effective means of reproducibly transforming monocotyledonous plants, the advantage of microprojectile bombardment is that it does not require isolation of protoplasts or susceptibility to Agrobacterium infection. A particle delivery system suitable for use in the present invention is available from Bio-Rad Laboratories, a helium-accelerated PDS-1000 / He gun. For bombardment, immature embryos or target cells derived from immature embryos, such as scutellum or callus, can be placed on solid medium.

[0202] In another alternative embodiment, plastids can be stably transformed. Methods disclosed for plastid transformation in higher plants include biolistic delivery of DNA containing a selectable marker and targeting the DNA to the plastid genome by homologous recombination (US 5,451,513, US 5,545,818, US 5,877,402, US 5,932479, and WO 99 / 05265).

[0203] Agrobacterium-mediated transfer is a broadly applicable system for introducing genes into plant cells because DNA can be introduced into whole plant tissues, thereby bypassing the need for regeneration of intact plants from protoplasts. The use of Agrobacterium-mediated plant integrating vectors to introduce DNA into plant cells is well known in the art (see, e.g., US 5,177,010, US 5,104,310, US 5,004,863, US 5,159,135). Furthermore, integration of T-DNA is a relatively precise process resulting in few rearrangements. The region of DNA to be transferred is defined by border sequences, and the intervening DNA is usually inserted into the plant genome.

[0204] Agrobacterium transformation vectors are capable of replicating in E. coli as well as Agrobacterium, allowing for convenient manipulation as described (Klee et al., Plant DNA Infectious Agents, Hohn and Schell, (editors), Springer-Verlag, New York, (1985):179-203). Furthermore, technical advances in vectors for Agrobacterium-mediated gene transfer have improved the arrangement of genes and restriction sites in the vector to facilitate the construction of vectors capable of expressing various polypeptide-encoding genes. The vectors described have convenient multilinker regions flanking promoters and polyadenylation sites for direct expression of the inserted polypeptide-encoding genes and are suitable for this purpose. In addition, Agrobacterium containing both armed and unarmed Ti genes can be used for transformation. Due to the ease and defined nature of gene transfer, in plant varieties where Agrobacterium-mediated transformation is efficient, it is the method of choice.

[0205] The genetically modified plants formed using Agrobacterium transformation method typically contain a single locus on one chromosome. Such genetically modified plants can be referred to as hemizygous for the added gene. More preferred are genetically modified plants that are homozygous for the added structural gene, i.e., contain two added genes, one gene at the same locus on each chromosome of a chromosome pair. Homozygous genetically modified plants can be obtained by sexually crossing (self-crossing) independent segregant genetically modified plants that contain a single added gene, germinating a portion of the seeds produced, and analyzing the resulting plants for the gene of interest.

[0206] It should also be understood that two different genetically modified plants can be crossed / hybridized to produce offspring containing two independently segregating exogenous genes. Self-breeding of the appropriate offspring can produce plants that are homozygous for both exogenous genes. Backcrossing to the parent plant and outcrossing with a non-genetically modified plant are also contemplated, as well as vegetative propagation. Descriptions of other breeding methods commonly used for different traits and crops can be found in Fehr, Breeding Methods for Cultivar Development, J. Wilcox (editor) American Society of Agronomy, Madison Wis. (1987).

[0207] Transformation of plant protoplasts can be achieved using methods based on calcium phosphate precipitation, polyethylene glycol treatment, electroporation, and combinations of these treatments. Application of these systems to different plant varieties depends on the ability to regenerate that particular plant strain from protoplasts. Exemplary methods for the regeneration of cereals from protoplasts have been described (Fujimura et al., 1985; Toriyama et al., 1986; Abdullah et al., 1986).

[0208] Other methods of cell transformation can also be used, including, but not limited to, introducing a polynucleotide such as DNA into a plant by direct transfer into pollen, by direct injection of a polynucleotide such as DNA into the reproductive organs of a plant, or by direct injection of a polynucleotide such as DNA into cells of an immature embryo followed by rehydration of the desiccated embryo.

[0209] The regeneration, development, and cultivation of plants from single plant protoplast transformants or from various transformed explants is well known in the art (Weissbach et al., Methods for Plant Molecular Biology, Academic Press, San Diego, (1988)). This regeneration and growth process typically involves the steps of selection of transformed cells, culturing these individualized cells through the usual stages of embryo development to the rooted plantlet stage. Genetically modified embryos and seeds are similarly regenerated. The resulting rooted genetically modified shoots are then planted in a suitable plant growth medium, such as soil.

[0210] The development or regeneration of plants containing a foreign exogenous gene is well known in the art. Preferably, the regenerated plants are self-pollinated to provide homozygous genetically modified plants. Otherwise, pollen obtained from the regenerated plants is crossed with seed-producing cultivated plants of agriculturally important lineages. Conversely, pollen from plants of these important lineages is used to pollinate the regenerated plants. The genetically modified plants of the present invention containing the desired genetic modifications are cultivated using methods well known to those skilled in the art.

[0211] Methods have been published for transforming dicotyledons and obtaining genetically modified plants, mainly by using Agrobacterium tumefaciens, for cotton (US 5,004,863, US 5,159,135, US 5,518,908), soybean (US 5,569,834, US 5,416,011), rapeseed (US 5,463,174), peanut (Cheng et al., 1996), and pea (Grant et al., 1995).

[0212] Methods for transformation of cereal plants such as wheat and barley to introduce genetic variations into the plants by introduction of foreign nucleic acids, as well as methods for regeneration of plants from protoplasts or immature plant embryos are well known in the art, see for example CA2,092,588, AU61781 / 94, AU667939, US6,100,447, WO97 / 048814, US5,589,617, US6,541,257, and other methods are described in WO99 / 14314. Preferably, genetically modified wheat or barley plants are produced by Agrobacterium tumefaciens-mediated transformation procedures. The vector carrying the desired nucleic acid construct can be introduced into a suitable plant system such as a regenerable wheat cell of a tissue cultured plant or explant, or a protoplast. The regenerable wheat cell is preferably from an immature embryo, a mature embryo, a callus derived therefrom, or a scutellum of a meristematic tissue.

[0213] To confirm the presence of genetic mutations in genetically modified cells and plants, polymerase chain reaction (PCR) amplification or Southern blot analysis can be performed using methods known to those skilled in the art. The expression product of the genetically modified gene can be detected in any of a variety of ways, depending on the nature of the product, including Western blot and enzyme assays. One particularly useful method for quantifying protein expression and detecting replication in different plant tissues is to use a reporter gene such as GUS. Once genetically modified plants are obtained, they can be grown to produce plant tissues or parts with the desired phenotype. The plant tissues or plant parts can be harvested and / or the seeds can be collected. The seeds can serve as a source for growing additional plants with tissues or parts with the desired characteristics.

[0214] Marker Assisted Selection Marker-assisted selection is a well-recognized method of selecting heterozygous plants required when backcrossing with the recurrent parent in a classical breeding program. The population of plants in each backcross generation is heterozygous for the gene of interest that is usually present in a 1:1 ratio in the backcross population, and molecular markers can be used to distinguish the two alleles of the gene. By extracting DNA, for example, from young shoots and testing for the desired traits that have been introgressed with specific markers, early selection of plants for further backcrossing is made while focusing energy and resources on fewer plants. To further speed up the backcrossing program, embryos from immature seeds (25 days after flowering) may be excised and grown on nutrient medium under sterile conditions rather than allowing complete seed maturation.

[0215] Any molecular biology technique known in the art may be used in the methods of the present invention. Such methods include, but are not limited to, the use of nucleic acid amplification, nucleic acid sequencing, nucleic acid hybridization with a suitably labeled probe, single-strand conformation analysis (SSCA), denaturing gradient gel electrophoresis (DGGE), heteroduplex analysis (HET), chemical cleavage analysis (CCM), catalytic nucleic acid cleavage, or combinations thereof (see, for example, Lemieux, 2000; Langridge et al., 2001). The present invention also includes the use of molecular marker techniques to detect polymorphisms associated with alleles of (for example) the FAD2-1 gene or LOX3 gene that confer reduced activity. Such methods include detection or analysis of restriction fragment length polymorphisms (RFLPs), RAPDs, amplified fragment length polymorphisms (AFLPs), and microsatellite (simple sequence repeat, SSR) polymorphisms. Tightly linked markers can be readily obtained by methods well known in the art, such as bulk segregant analysis as reviewed by Langridge et al. (2001).

[0216] In one embodiment, a linked locus for marker assisted selection is within at least 1 cM, or 0.5 cM, or 0.1 cM, or 0.01 cM of a gene encoding a polypeptide of the invention.

[0217] "Polymerase chain reaction" ("PCR") is a reaction in which replicate copies are made from a target polynucleotide using a "primer pair" or "primer set" consisting of an "upstream" and a "downstream" primer, and a catalyst for polymerization, e.g., a DNA polymerase, and typically a thermostable polymerase enzyme. Methods for PCR are known in the art and are taught, for example, in "PCR" (MJ McPherson and SG Moller (editors), BIOS Scientific Publishers Ltd, Oxford, (2000)). PCR can be performed on cDNA obtained from reverse transcribing mRNA isolated from plant cells expressing the FAD2-1 and / or LOX3 genes, which confer altered grain fatty acid content to the plant. However, PCR is generally easier when it is performed on genomic DNA isolated from the plant.

[0218] A primer is an oligonucleotide sequence that is capable of hybridizing to a target sequence in a sequence-specific manner and extending during PCR. An amplicon or PCR product, or PCR fragment or amplification product, is an extension product that includes primers and newly synthesized copies of the target sequence. A multiplex PCR system contains multiple sets of primers, which result in the simultaneous production of two or more amplicons. The primers may perfectly match the target sequence, or they may contain internal mismatched bases that may result in the introduction of a restriction enzyme or catalytic nucleic acid recognition / cleavage site into a particular target sequence. Primers may also contain additional sequences and / or modified or labeled nucleotides to facilitate capture or detection of the amplicon. Repeated cycles of thermal denaturation of DNA, annealing of the primers to their complementary sequences, and extension of the annealed primers with a polymerase result in exponential amplification of the target sequence. The term target or target sequence or template refers to the amplified nucleic acid sequence.

[0219] Methods for direct sequencing of nucleotide sequences are well known to those of skill in the art and can be found, for example, in Ausubel et al., (supra) and Sambrook et al., (supra). Sequencing can be performed by any suitable method, such as dideoxy sequencing, chemical sequencing, or variations thereof. Direct sequencing has the advantage of determining variations within any base pair of a particular sequence.

[0220] TILLING Plants of the invention can be produced using a process known as TILLING (Targeting Induced Local Lesions IN Genomes). In a first step, an introduced mutation, such as a novel single base pair change, is induced in a population of plants by treating seeds (or pollen) with a chemical mutagen and then allowing the plants to progress to a generation in which the mutation is stably inherited. DNA is extracted and seeds from all members of the population are banked to create a resource that can be repeatedly accessed over time.

[0221] In the TILLING assay, PCR primers are designed to specifically amplify a single gene target of interest. Specificity is especially important when the target is a member of a gene family or part of a polyploid genome. Dye-labeled primers can then be used to amplify PCR products from the pooled DNA of multiple individuals. These PCR products are denatured and reannealed to allow for the formation of mismatched base pairs. Mismatches or heteroduplexes represent both naturally occurring single nucleotide polymorphisms (SNPs) (i.e., several plants from a population may carry the same polymorphism) and induced SNPs (i.e., only rare individual plants may show the mutation). The use of endonucleases such as Cel I, which recognize and cleave mismatched DNA after heteroduplex formation, is key to discovering novel SNPs within a TILLING population.

[0222] Using this approach, thousands of plants can be screened to identify any individuals with single base changes and small insertions or deletions (1-30 bp) within any gene or within any specific region of the genome. The size of the genomic fragments assayed can range from 0.3-1.6 kb. With 8-fold pooling, 1.4 kb fragments (minus the ends of the fragments where SNP detection becomes problematic due to noise), and 96 lanes per assay, this combination allows up to 1 million base pairs of genomic DNA to be screened per single assay, making TILLING a high-throughput technique.

[0223] TILLING is further described in Slade and Knauf (2005) and Henikoff et al. (2004).

[0224] In addition to allowing efficient detection of mutations, high-throughput TILLING technology is ideal for detecting natural polymorphisms. Thus, unknown homologous DNA is interrogated by heteroduplexing to known sequences, and the number and location of polymorphic sites are found. Both nucleotide changes and small insertions and deletions are identified, which includes at least some repeat polymorphisms. This is called Ecotilling (Comai et al., 2004).

[0225] Each SNP is recorded by its approximate location within a few nucleotides. Thus, each haplotype can be archived based on the mobility of the haplotype. Sequence data can be obtained with relatively small incremental effort using aliquots of the same amplified DNA used for the mismatch cleavage assay. The left or right sequencing primer for a single reaction is selected by the proximity of the sequencing primer to the polymorphism. The Sequencher software runs multiple alignments and finds the base change, which confirmed the gel band in each case.

[0226] Ecotilling can be performed more cheaply than full sequencing, the method currently used for most SNP discovery. Plates containing arrays of ecotype DNA can be screened, rather than pools of DNA from mutagenized plants. Because detection is on gels with near base pair resolution and the background pattern is uniform across lanes, bands of identical size can be matched and therefore SNPs can be discovered and genotyped in a single step. Thus, ultimate sequencing of SNPs is simple and efficient, made even simpler and more efficient by the fact that aliquots of the same PCR products used for screening can be subjected to DNA sequencing.

[0227] Plant / grain processing The grains / seeds of the present invention, preferably cereal grains, and more preferably rice or sorghum grains, or other plant parts of the present invention may be processed to produce food ingredients, food or non-food products using any technique known in the art.

[0228] Techniques routinely practiced in the art can be used to extract, process, and analyze the oils produced by the cells, plants, seeds, hulls, etc. of the present invention. Typically, plant seeds are cooked, pressed, and extracted to produce crude oils, which are then degummed, refined, bleached, and deodorized. Rice is typically milled to remove the husk and polished to remove the hull layer from the white rice. Generally, techniques for crushing seeds and hulls are known in the art. For example, the seeds can be sprayed with water to raise the moisture content to, for example, 8.5%, and adjusted by using a smooth roller with a gap setting of 0.23-0.27 mm to slough off the flakes. Depending on the type of seed, water may not be added before crushing. Rice hulls can be heated by steam at 100°C or higher. The application of heat inactivates enzymes, promotes further rupture of the cells, binds oil droplets, and aggregates protein particles, all of which facilitate the extraction process.

[0229] Rice husks are separated during rice milling. The husks can be stabilized, usually by applying heat or irradiation, and then rice husk oil is recovered using the chemical and / or physical methods described. For a discussion of rice husks and rice husk oil, see Rice Bran and Rice Bran Oil Chemistry, Processing and Utilization AOCS Press, (2019) Editor(s): Ling-Zhi Cheong, Xuebing Xu, ISBN9780128128282. Defatted rice husks provide a nutritious meal that is suitable for human food and animal feed. Further processing can be carried out to isolate valuable fatty acids, starch, or phytates from the rice husk oil or meal. Alternatively, the rice husks can be fermented.

[0230] In one embodiment, the majority of the oil is released by passage through the screw press. The cake discharged from the screw press is then solvent extracted using a heat tracing column, for example with hexane. Alternatively, the crude oil produced by the press operation can be passed through a settling tank with a slotted wire drainage top to remove solids, which are squeezed out of the oil during the press operation. The clarified oil can be passed through a plate and frame filter to remove any remaining fine solid particles. If necessary, the oil recovered from the extraction process can be combined with the clarified oil to produce a blended crude oil.

[0231] Once the solvent is removed from the crude oil, the pressed and extracted fractions are combined and subjected to normal oil processing procedures. As used herein, the term "refined" when used in connection with the oils of the present invention typically means that the extracted lipids or oils have been subjected to one or more processing steps that increase the purity of the lipid / oil components. For example, the refining steps may include one or more or all of the group consisting of degumming, deodorizing, bleaching, drying, and / or fractionation of the extracted oil.

[0232] Degumming is an initial step in oil refining, whose main objective is to remove most of the phospholipids from the oil, which may be present as approximately 1-2% of the total lipids extracted. Addition of about 2% water, usually containing phosphoric acid, to the crude oil at 70-80°C separates most of the phospholipids along with trace metals and pigments. The insoluble material removed is mainly a mixture of phospholipids and triacylglycerols, also known as lecithin. Degumming can be carried out by adding concentrated phosphoric acid to the crude seed oil to convert the non-hydratable phosphatides to a hydratable form and chelate any trace metals present. The gums are separated from the soil by centrifugation.

[0233] Alkaline refining, sometimes also referred to as neutralization, is one of the refining processes for treating crude oil. It usually follows degreasing and precedes bleaching. After degreasing, the oil can be treated by adding a sufficient amount of alkaline solution to titrate out all the fatty acids and phosphoric acids and remove the soaps thus formed. Suitable alkaline materials include sodium hydroxide, potassium hydroxide, sodium carbonate, lithium hydroxide, calcium hydroxide, calcium carbonate, and ammonium hydroxide. This process is usually carried out at room temperature and removes the free fatty acid fraction. The soaps are removed by centrifugation or extraction into a soap solvent, and the neutralized oil is washed with water. If necessary, any excess alkali in the oil can be neutralized with a suitable acid, such as hydrochloric acid or sulfuric acid.

[0234] Bleaching is a refining process in which oil is heated at 90-120°C for 10-30 minutes in the presence of bleaching earth (0.2-2.0%) and in the absence of oxygen, by operation under nitrogen, steam, or vacuum. This step in oil processing is designed to remove unwanted pigments (carotenoids, chlorophyll, gossypol, etc.); the process also removes oxidation products, trace metals, sulfur compounds, and traces of soaps.

[0235] Deodorization is the treatment of oils and fats at high temperature (200-260°C) and low pressure (0.1-1 mm Hg). It is typically accomplished by introducing steam into the oil at a rate of about 0.1 ml / min / 100 ml of oil. After sparging for about 30 minutes, the oil is cooled under vacuum. The oil is typically transferred to glass containers and flushed with argon before being stored under refrigeration. This treatment improves the color of the oil and removes most of the volatiles or odorous compounds, including any remaining free fatty acids, monoacylglycerols, and oxidation products.

[0236] Winterization is a process sometimes used in the commercial production of oils to separate oils and fats into solid (stearin) and liquid (olein) fractions by crystallization at subambient temperatures. The process was originally applied to cottonseed oil to produce a product that was free of solids. It is typically used to reduce the saturated fatty acid content of the oil.

[0237] Transesterification is a process that exchanges fatty acids within and between TAGs by first releasing the fatty acids from the TAGs as either free fatty acids or fatty acid esters, usually fatty acid methyl esters or ethyl esters, or transferring the fatty acids to another alcohol to form esters. When combined with a fractionation process, transesterification can be used to modify the fatty acid composition of lipids. Transesterification can use either chemical (e.g., strong acid or base catalyzed) or enzymatic means, the latter of which can be position-specific (sn-1 / 3 or sn-2 specific) for the fatty acids on the TAGs, or use lipases that prefer some fatty acids over others. Fatty acid fractionation to increase the concentration of LC-PUFAs in oils can be accomplished by any of the methods known in the art, such as, for example, freeze crystallization, complexation with urea, molecular distillation, supercritical fluid extraction, and silver ion complexation. Complexation with urea is a preferred method due to its simplicity and efficiency in reducing the levels of saturated and monounsaturated fatty acids in oils. Initially, the TAGs of the oil, often in the form of fatty acid esters, are split into their constituent fatty acids by hydrolysis under either acid or base catalyzed reaction conditions, whereby one mole of TAGs is reacted with at least three moles of alcohol (e.g. ethanol in the case of ethyl esters, or methanol in the case of methyl esters), or by a lipase, with an excess of alcohol used to allow separation of the alkyl esters formed from the glycerol also formed. These free fatty acids or fatty acid esters are usually not altered in fatty acid composition by the treatment and can then be mixed with an ethanolic solution of urea for complex formation.

[0238] In one embodiment, the product is a whole grain flour, such as an ultrafine milled whole grain flour, or a flour made from about 100% of the grain. Whole grain flour includes the fine flour constituents (refined flour or refined flour) and the coarse fraction (ultrafine milled coarse fraction).

[0239] Refined flour can be, for example, flour prepared by grinding and sieving grains such as washed rice or sorghum grains. The particle size of refined flour is described as flour in which 98% or more pass through a cloth with openings no larger than the openings of a woven wire mesh designated "212 micrometers (US Wire Mesh 70)". The coarse fraction includes at least one of bran and germ. For example, germ is the embryonic plant found within the grain. Germ includes lipids, fiber, vitamins, proteins, minerals, and phytonutrients, such as flavonoids. Bran includes several cell layers and has significant amounts of lipids, fiber, vitamins, proteins, minerals, and phytonutrients, such as flavonoids. Additionally, the coarse fraction can include the aleurone layer, which also includes lipids, fiber, vitamins, proteins, minerals, and phytonutrients, such as flavonoids. Although the aleurone layer is technically considered part of the endosperm, it exhibits many of the same characteristics as the bran and is therefore typically removed along with the bran and germ during the milling process. The aleurone layer contains proteins, vitamins, and phytonutrients, such as ferulic acid.

[0240] Additionally, the coarse fraction can be blended with the refined flour component. The coarse fraction can be mixed with the refined flour component to form a whole grain flour, thus providing a whole grain flour with increased nutritional value, fiber content, and antioxidant capacity compared to refined flour. For example, the coarse fraction or whole grain flour can be used in baked foods, snack products, and food products in various amounts to replace refined or whole grain flour. The whole grain flour of the present invention (i.e., ultrafine milled whole grain flour) can also be directly marketed to consumers for use in their homemade baked products. In an exemplary embodiment, the granulation profile of the whole grain flour is one in which 98% of the particles of the whole grain flour by weight are less than 212 micrometers.

[0241] In a further embodiment, the enzymes found in the bran and germ of the whole grain flour and / or coarse fraction are inactivated to stabilize the whole grain flour and / or coarse fraction. Stabilization is the process of inactivating the enzymes found in the bran and germ layers using steam, heat, radiation, or other treatments. The stabilized flour retains the cooking characteristics of the flour and has a longer shelf life.

[0242] In additional embodiments, the whole grain flour, coarse flour, or refined flour may be a component of or used to manufacture a food product, such as bagels, biscuits, breads, buns, croissants, dumplings, English muffins, muffins, pita bread, quick breads, refrigerated / frozen dough products, dough, baked beans, burritos, chili, tacos, tamales, tortillas, pot pies, prepared cereals, prepared meals, stuffings, microwaveable foods, brownies, cakes, cheesecakes, coffee cakes, cookies, desserts, pastries, sweet rolls, candy bars, pie crusts, pie fillings, baby foods, baking mixes, batters, breadings, gravy mixes, meat extenders, meat substitutes, seasoning mixes, and the like. The snack may be a snack mix, soup mix, gravy, roux, salad dressing, soup, sour cream, noodles, pasta, ramen noodles, chow mein noodles, lo mee noodles, ice cream inclusions, ice cream bars, ice cream cones, ice cream sandwiches, crackers, croutons, donuts, egg rolls, extruded snacks, fruit and grain bars, microwaveable snack products, nutritional bars, pancakes, parbaked bakery products, pretzels, puddings, granola based products, snack chips, snack foods, snack mixes, waffles, pizza crusts, animal foods, or pet foods.

[0243] In alternative embodiments, the whole grain flour, refined flour, or coarse fraction may be a component of a dietary supplement. For example, a dietary supplement may be a product that is added to the diet and contains one or more additional ingredients, typically including vitamins, minerals, herbs, amino acids, enzymes, antioxidants, herbs, spices, probiotics, extracts, prebiotics, and fiber. The whole grain flour, refined flour, or coarse fraction of the present invention includes vitamins, minerals, amino acids, enzymes, and fiber. For example, the coarse fraction contains concentrated amounts of dietary fiber, as well as other essential nutrients, such as B-vitamins, selenium, chromium, manganese, magnesium, and antioxidants, which are essential for a healthy diet. For example, 22 grams of the coarse fraction of the present invention delivers 33% of an individual's recommended daily intake of fiber. Dietary supplements may include any known nutritional components that support the overall health of an individual, including, but not limited to, vitamins, minerals, other fiber components, fatty acids, antioxidants, amino acids, peptides, proteins, lutein, ribose, omega-3 fatty acids, and / or other nutritional components. The supplement may be delivered in the following forms, including but not limited to: instant drink mixes, prepared drinks, nutritional bars, wafers, cookies, crackers, gel shots, capsules, chews, chewable tablets, and pills. One embodiment delivers the fiber supplement in the form of a flavored shake or sprout-type drink, which may be particularly attractive as a fiber supplement for children.

[0244] In additional embodiments, the milling process can be used to create multi-grain flours or multi-grain coarse fractions. For example, the bran and germ from one type of grain can be milled and blended with milled endosperm or whole grain flour of another type of grain. Alternatively, the bran and germ of one type of grain can be milled and blended with milled endosperm or whole grain flour of another type of grain. It is contemplated that the invention encompasses blending any combination of one or more of the bran, germ, endosperm, and whole grain flour of one or more grains. This multi-grain approach can be used to create custom flours and to utilize the quality and nutritional content of multiple types of grains to create one flour.

[0245] It is contemplated that the whole grain flour, coarse fraction, and / or grain product of the present invention may be produced by any milling process known in the art. An exemplary embodiment includes milling the grain in a single stream without separating the endosperm, bran, and germ of the grain into separate streams. The washed and tempered grain is conveyed to a first pass mill, such as a hammer mill, roller mill, pin mill, impact mill, disc mill, air attrition mill, or gap mill. After milling, the grain is discharged and conveyed to a screen. It is further contemplated that the whole grain flour, coarse fraction, and / or grain product of the present invention may be modified or enhanced by a number of other processes, such as fermentation, instantiation, extrusion, encapsulation, toasting, or roasting.

[0246] Sprouted food production The sprout-based beverages provided by the present invention include alcoholic beverages (including distilled beverages) and non-alcoholic beverages made by using sprouts as a part or the whole of the starting material for the sprouts. Examples include beer, happoshu (low sprout beer beverage), whiskey, low alcohol sprout-based beverages (e.g., sprout-based beverages containing less than 1% alcohol), and non-alcoholic beverages.

[0247] Sprouted food production is a process of controlled soaking and germination of grains, such as barley and wheat grains, followed by drying. This sequence of events is important for the synthesis of numerous enzymes that cause grain modifications, mainly processes that depolymerize dead germ cell walls and separate grain nutrients. The subsequent drying process produces flavors and colors due to chemical browning reactions. The main use of sprouted food is for beverage production, but it can also be utilized in other industrial processes, for example as a source of enzymes in the bakery industry or as flavors and colorants in the food industry, for example as sprouted food or sprouted food flour, or indirectly as sprouted food syrup, etc.

[0248] In one embodiment, the present invention relates to a method for producing a germinant composition, the method preferably comprising: (i) providing grain, such as barley or wheat grain, of the present invention; (ii) soaking the grain; (iii) germinating the soaked grain under defined conditions; (iv) drying the germinated grains.

[0249] For example, the sprouts may be produced by any of the methods described in Hoseney (Principles of Cereal Science and Technology, Second Edition, 1994: American Association of Cereal Chemists, St. Paul, Minn.). However, any other suitable method for producing sprouts may be used with the present invention, such as methods for producing specialized sprouts, including, but not limited to, methods for roasting sprouts.

[0250] Sprouted seeds are primarily used for brewing beer, but also for the production of distilled spirits. Brewing involves the production of wort, primary and secondary fermentation, and post-processing. First, the sprouted seeds are crushed, stirred in water and heated. Enzymes activated during the sprouted seed production break down the starch in the seeds into fermentable sugars during this "mashing". The produced wort is clarified, yeast is added, the mixture is fermented, and post-processing is carried out. EXAMPLES

[0251] Example 1 - Materials and Methods Generation of mutants gRNA design In silico analysis of rice FAD2, LOX3, and FATB DNA sequences, DNA sequence annotation and alignment, vector design, and protein sequence prediction were performed using Geneius Prime 2019.1.1 (www.geneious.com). To design gRNAs, rice OsFAD2-1, OsLOX3, and OsFATB1, 2, 3, 4 gene sequences were obtained from the Rice Genome Annotation Project (rice.plantbiology.msu.edu / ). All gRNAs were GC-rich, 19 bp or 20 bp in length, and linked to a canonical PAM (5'-NGG-3'). Gene editing vector V1 targeted OsFAD2-1, OsLOX3, and OsFATB1, and gene editing vector V2 targeted OsFATB1, 2, 3, and 4. In vector V1, gRNA-1 targeted nt 3317–3336 of LOC_OS02g48560 (OsFAD2-1), corresponding to nt 3–22 (20 bp) of the CDS, covering the second in-frame ATG (nt 19–21 of the CDS). gRNA-2 targeted nt 3846–3865 of Loc_OS02g48560, corresponding to nt 532–551 of the OsFAD2-1 CDS. gRNA-3 was designed in the #31–#50 region of the first exon, and gRNA-4 was designed in the 20 bp between #467 and #486, spanning the first intron and second exon of OsLOX3. gRNA-5 was designed to the start of the second exon (#523–542) of OsFATB1. In V2, gRNA-6 targeted #323–342 in the first exon of OsFATB1. gRNA-7 was designed to the conserved region #451–470 in the second exon of both OsFATB2 and 3. gRNA-8 targeted the 20 bp between #624–643 in the second exon of OsFATB4.

[0252] Vector construction Multi-gRNA expression cassettes consisting of two OsU3 promoters and three OsU6 promoters (OsU6a, OsU6b, OsU6c) driving gRNA-1 to 5, respectively, were commercially synthesized by GeneArt (Thermo Fisher Scientific, Regensburg, Germany). Each cassette was cloned into the BsaI restriction site of pMA-RQ by GeneArt. The expression cassettes of pMA-RQ were then cloned into pYL CRISPR / Cas9Pubi-H by simultaneous digestion with BsaI and ligation with the Golden Gate cloning system as described by Ma et al. (2015).

[0253] In a 15 μL reaction, 50 ng of each gRNA expression cassette and vector were mixed with BsaI, T4 ligase, and ligation buffer. The ligation reaction was set up in a PCR machine for 25 cycles of 3 min at 37°C and 4 min at 16°C, and 1 cycle of 5 min at 50°C and 5 min at 80°C. The products were then kept at 4°C before being transformed into Agrobacterium. The resulting positive clones (V1 and V2, see Example 2 for clone details) were confirmed by amplifying the plasmid DNA fragment containing the gRNA cassette using PCR markers (primers SP1 and SP2). The molecular sizes of the PCR products of V1 and V2 were 3143 bp and 1739 bp, respectively. The V1 and V2 vectors were used to transform rice by Agrobacterium-mediated transformation.

[0254] Agrobacterium-mediated transformation of rice Vector V1 or V2, with minor modifications, was transformed into Agrobacterium strain AGL1 for rice transformation (Toki et al., 2006). Mature seeds of Nipponbare cv. were removed from the husk. Seeds were then sterilized in 75% ethanol and 25% bleach successively, followed by eight washes with MilliQ water. Seeds were transferred to N6D solid medium (CHU[N6] basal medium with vitamins 3.99 g / L, myo-inositol 100 mg / L, peptone (crude protein) 300 mg / L, proline 2.9 g / L, sucrose 30 g / L, and 2 ml / L 2,4-D (1 mg / ml)) at pH 5.8 to induce callus for 24 h in a growth room at 25°C under violet and blue light. [Table 3] [Table 4]

[0255] Calli were collected 4-6 weeks after induction and co-cultivated with AGL1 carrying V1 or V2 in 2N6-AS liquid medium in the dark at room temperature for 3 days. Then, the calli were washed with sterile water containing timentin (150 mg / L) and blotted dry with filter paper. Transformed calli were selected on N6D medium plates containing timentin (150 mg / L) and the antibiotic hygromycin (35 mg / L) in the dark at room temperature for 3-4 weeks. Resistant calli were transferred to regeneration medium containing hygromycin for rooting and incubated in a growth chamber at room temperature for 3-4 weeks. Regenerated plantlets were transferred to MS medium containing timentin and hygromycin for further plant development in the growth chamber. [Table 5]

[0256] The transformed rice plants were then transplanted into pots containing general-purpose potting mix and kept in a growth room (12-hour photoperiod, 30°C in light, 24°C in dark). The plants were watered every 3 days until the cultivation stage, when the potted plants were transferred to the greenhouse.

[0257] Determination of targeted mutations in rice T0–T3 plants of 14 transgenic lines were grown in an artificial climate chamber at CSIRO Black Mountain Scientific Innovation Park (Canberra, ACT, Australia) under natural light at 22°C–26.5°C. Genomic DNA samples (100ng / μL) were prepared from leaf tissue of each plant. Leaf tissue was quickly frozen in liquid nitrogen and crushed using chopsticks in a 2mL tube. Approximately 600μL of extraction buffer (100mM Tris-HCl pH 8.0, 50mM EDTA, 1.25% SDS) was added to each sample and suspended by shaking. Samples were incubated in a 65°C oven for at least 1 hour. After cooling, 300μL of cold 6M ammonium acetate was added to each sample and precipitated at 4°C. The supernatant was collected by centrifugation and 300μL of isopropanol was added to precipitate the DNA. The pellet was collected by centrifugation and washed with 250 μL of 70% ethanol. Approximately 50 μL of Mili-Q water was added and the sample was kept at room temperature overnight to dissolve the DNA. The concentration of DNA was measured using a NanoDrop spectrophotometer (model ND-1000, NanoDrop).

[0258] To amplify DNA fragments covering the gRNA target region, PCR primers were designed using Geneius Prime 2019.1.1. The PCR mixture contained 2 μL of 5x Taq polymerase buffer, 0.5 μL of each primer (10 nM), 100 ng of template DNA, and 0.07 μL of MyTaq polymerase (Thermo) in a final volume of 10 μL. The following PCR program was used for amplification: 2 min at 95°C, 34 cycles of 15 s at 95°C, 15 s at 58°C, and 32 s at 72°C, followed by 5 min at 72°C and a hold at 12°C. The PCR products were diluted 10-fold and washed with Shrimp Alkaline Phosphatase (SAP) at a ratio of 2.5:1 (v / v) at 37°C for 15 min and 80°C for 15 min. The cleaned DNA product (2.8 μL) was mixed with 0.3 μL of forward or reverse primer and BigDye buffer to a final volume of 20 μl. PCR was performed under the following conditions: 94°C for 5 min, 96°C for 10 s, 50°C for 5 s, and 60°C for 4 min, with 30 cycles of hold at 12°C. The BigDye product was mixed with 2 μL of 3 M NaOAc (pH 4.8-5) and 50 μL of ice-cold 100% ethanol and precipitated at -80°C for 30 min. The precipitate was washed with 200 μL of 70% ethanol and dried in a vacuum rotary drier before being submitted to the Sanger Sequencing Service (Australian National University (ANU) facility, Canberra Australia).

[0259] Preparation of fatty acid methyl esters After maturity, seeds were harvested and dried at 37°C for approximately 2 weeks and then manually threshed. Brown rice single / multiple kernels (single / half kernels for screening, multiple kernels for homozygous phenotypic characterization) were then ground into flour using a 3M ESPE CapMax™ homogenizer (ESPE, Seefeld, Germany). Approximately 3-5 mg flour samples from single / multiple kernels were used to prepare fatty acid methyl esters (FAMEs) following the procedure described by Zaplin et al. (2013).

[0260] Leaf, root, and anther tissues were dried in a freeze dryer (BencheTop Pro Model BTP-8ZLEVX, SP Scientific) by cutting the plant parts with scissors, and 5–10 mg samples for each replicate were weighed into 2 mL vials. To each vial, 600 μL of 1N methanolic HCl was added, and the samples were methylated at 80 °C for 2 h with the caps tightly closed. After the vials were cooled to room temperature, 300 μL of 0.9% NaCl and 300 μL of hexane were added and mixed in a shaker (Ratek Model MTV1, Ratek Instruments Pty Ltd, Australia) for 5 min. Samples were centrifuged at 1700 g for 5 min (Model2-6E, Sigma). Approximately 280 μL of the upper hexane phase containing FAMEs was transferred to a conical glass insert and evaporated under nitrogen for 5–10 min. FAMEs were redissolved in 50 μL of hexane.

[0261] Analysis of fatty acid profile by gas chromatography FAMEs were analyzed by gas chromatography (7890A GC; Agilent Technologies, Santa Clara, CA) equipped with an SGE BPX70 column (0.25 mm diameter, 30 m length, 2.5 μm film thickness, Agilent) with a 50:1 split essentially as described (Zhou et al., 2011). The column temperature was programmed with an initial temperature of 150° C. held for 1 min, which was increased to 210° C. at 3° C. / min, then further increased to 240° C. at 50° C. / min and held for 1.4 min. The carrier gas was helium with a column head pressure of 17.334 psi and an average velocity of 30 cm / sec. The fatty acid profiles were analyzed by integrating peaks with Agilent Technologies ChemStation software (RevB.04.03) and the total fatty acid composition was calculated as a percentage of the total in each sample.

[0262] SPME GC-MS analysis of rice husk volatile compounds Rice husks (10% of total grain weight) were collected from a TP-3000 PEARLEST Grain Polisher (Kett, USA) during polishing of brown rice kernels. Husk samples were immediately stored at -80°C to avoid sticking. Headspace (HS)-SPME GC-MS using 50 / 30 μm divinylbenzene-carboxene-polydimethylsiloxane (DVB / CAR / PDMS) Stableflex fibers (Supelco, USA) 10 mm length for automatic autosampler was used to analyze volatile compounds. The fibers were preconditioned at 270°C for 30 min before use.

[0263] For sample analysis, 10 mL headspace magnetic cap vials containing 100 mg of sample were pre-incubated at 60° C. for 5 min before extraction. Volatiles were extracted for 60 min under stirring at 60° C. using a Combi-Pal autosampler HTX PAL (CTC Analytics). Samples were desorbed in splitless mode for 1 min at an injector temperature of 250° C. To reduce sample carryover, the fiber was conditioned in a needle heater with helium flow at 250° C. for 5 min before and after sample desorption. Volatile compounds desorbed from the fiber were analyzed by a Shimadzu QP2010 Plus GC-MS equipped with a Shimadzu Stabilwax-DA column (30 m×0.25 mm×0.25 μm). The carrier gas was helium at a constant flow rate of 1 mL / min. The oven ramping program started at 45 °C with a hold for 5.5 min, heated at a rate of 3 °C / min to 170 °C, ramped at 7 °C / min to a final temperature of 250 °C and held for 2 min. Ion fragmentation was acquired under EI mode at 70 eV and scanned in full scan mode from 35 to 350 m / z. Volatiles were identified by comparison with NIST mass spectral library and linear retention index calibration standards (also n-alkanes C10-C40). Authentic standards purchased from different compound classes and blanks (empty HS vials, containing 10 ng of the internal standard 2,4,6-trimethylpyridine) were also analyzed for analytical quality control. Mass spectral matches were considered only with a minimum similarity index of 80%.

[0264] Example 2 - Identification and isolation of the FAD2 gene from rice The Δ12-desaturase (fatty acid desaturase 2) encoded by the OsFAD2 gene is responsible for the introduction of a double bond into 18:1 fatty acids at the Δ12 position. There were four members in the rice OsFAD2 gene family, designated OsFAD2-1 (LOC_Os02g48560), OsFAD2-2 (LOC_Os07g23430), OsFAD2-3 (LOC_Os07g23410), and OsFAD2-4 (LOC_Os07g23390) (Zaplin et al., 2013). The genomic sequences of these Oryza sativa FAD2s were obtained from Genbank. The cDNA sequences were derived and are shown in Figure 1, which shows the alignment of the Fad2 cDNA sequences. The OsFAD2-1 isoform has an in-frame ATG codon (nt 19–21) after the translation initiation codon ATG. The gRNA designed for CRISPR editing of OsFAD2-1 included this second ATG (Figure 1), as outlined below.

[0265] A schematic diagram of the T-DNA binary vector used for transformation is shown in Figure 2. The position of the stop codon is indicated by an asterisk in the modified FAD2 amino acid sequence of line V1-13 in Table 3.

[0266] gRNA and V1 and V2 vector design In CRISPR-Cas9 editing, the base pairs of the gRNA or single guide RNA control the specificity of cleavage and the site of cleavage. Guide RNA design was performed as described in Example 1. To evaluate the contribution of the FAD2-1 gene to oil in the grain, gRNA-1 (GGGTGCCGGCGGCAGGATGA) (SEQ ID NO: 30) targeting nt positions 3-22 and gRNA-2 (TACGTGTACCACAACCCGAT) (SEQ ID NO: 31) targeting nt positions 532-551 were designed. FAD2-1 shares low homology with three other members within the two gRNA regions. gRNA-1 targets 20bp from the end of the start codon covering the second ATG, and gRNA-2 targets 532bp downstream of the start codon of FAD2-1 and is used in the vector design V1 in Example 5 and the vector design V2 in Example 6.

[0267] Example 3 - Identification and isolation of the LOX3 gene from rice LOX (EC 1.13.11.12) catalyzes lipid peroxidation. According to the protein sequence, LOX are classified into three types (Mizuno et al., 2003). Type I lipoxygenases are localized in the chloroplast and are stress-inducible, type II lipoxygenases are localized in the cytoplasm and originate from dicots and are not stress-inducible, and type III lipoxygenases are localized in the cytoplasm and originate from monocots and are involved in seed germination. Type I LOXs have a transit peptide, which is absent in type II and III LOXs. LOXs are also classified as either 9-LOXs or 13-LOXs according to the enzyme's preference for carbon 9 or carbon 13 in the substrate hydrocarbon backbone, generating 9(S)-hydroperoxy- and 9(S)-hydroperoxy derivatives (Feussner and Wasternack, 2002). Based on bioinformatics analysis, the rice genome (rice.plantbiology.msu.edu) is claimed to have 14 LOX protein genes. Protein alignments show that the LOX sequences are relatively well conserved (Umate, 2011).

[0268] Polyunsaturated fatty acids (PUFAs), including linoleic and linolenic acids, are common substrates for different LOXs in seeds. LOXs present in rice kernels are thought to play an important role in fatty acid peroxidation in membrane or storage lipids. LOX activity in rice seeds is associated with the production of volatile compounds derived from lipid peroxidation, such as n-hexanal, a major component of stale or harsh off-flavors in stored rice seeds.

[0269] Three isozymes of type III LOX (LOX1, LOX2, and LOX3) have been identified in developing rice seeds (Ohta et al., 1986). Among them, LOX3 is the most abundant enzyme (Ida et al., 1983). The LOX3 enzyme was purified and characterized as 9-LOX (Ohta et al., 1986). The Thai rice variety DawDam contains a point mutation that causes premature termination of translation of the LOX3 gene, resulting in a null mutant rice variety (Suzuki et al., 1993; Suzuki and Matsukura, 1997). The mutation is associated with reduced development of not-fresh flavor during rice grain storage (Suzuki et al., 1999). Xu et al. (2015) used RNAi silencing to reduce LOX3 activity in transgenic experimental plants, resulting in grains with improved seed storage. Conversely, Ma et al. (2015) used TALENs to target and down-regulate LOX3 and confirmed that seed deterioration is a complex process. They proposed that LOX3 seed longevity effects may be independent of fatty acid peroxidation due to the alleged functional redundancy between LOX1, LOX2, and LOX3 isoenzymes in rice kernels. Although LOX3 deficiency has not been shown to affect major agronomic traits in rice (Ma et al., 2015), it is recognized that silencing all of the LOX1, LOX2, and LOX3 isoenzymes in rice would result in plants with unfavorable agronomic behavior, as observed in the DawDam variety (RoyChowdury et al., 2016).

[0270] To effectively improve rice grain storage quality, inactivation of LOX activity needs to be achieved without compromising nutritional content and agronomic traits. To evaluate the contribution of LOX3 gene to lipid oxidation stability of rice husk or husk oil, gRNA-3 (GACGAGCTCCGCAACCTGCG) (SEQ ID NO: 32) and gRNA-4 (CGTGCGTGCAGATCCGGACT) (SEQ ID NO: 33) were designed into vector V1 in Example 5 and vector V2 in Example 6. gRNA-3 was designed to target the first exon and gRNA-4 was designed to target 20 bp spanning the first intron (nt 30-50) and second exon (nt 467-486) ​​of LOX3.

[0271] Example 4 - Identification and isolation of the FATB gene from rice The FATB gene encodes the enzyme palmitoyl-ACP thioesterase, whose activity preferentially releases fatty acids with a length of 16 carbons or less from acyl-acyl carrier proteins. Putative rice FATB sequences were identified using a homology-based search with the Arabidopsis AtFATB sequence AtACPTE32 (NCBI accession number AF213480). The program used was Megablast, available at NCBI (www.ncbi.nlm.nih.gov / ) with default parameters. Based on homology with Arabidopsis AF213480, the most similar sequences from rice identified were the four OsFATB genes in the Rice Genome Annotation Project Database (http: / / rice.plantbiology.msu.edu / ) (Ouyang et al. 2007). The four OsFATB genes were named FATB1 (LOC_Os06g05130), FATB2 (LOC_Os11g43820), FATB3 (LOC_Os02g43090), and FATB4 (LOC_Os06g39520). Each rice FATB gene contains six exons.

[0272] The rice FATB sequences were translated from the corresponding coding sequences (Figure 3) into amino acid sequences and examined for the presence of conserved motifs. The amino acid residues considered essential in the AtFATB sequences are generally cysteine ​​264, asparagine 227, and histidine 229, known as the catalytic triad. Consistent with AtFATB1, the catalytic triad (aspartic acid N-227, histidine H-229, and cysteine ​​C-264) is located at the C-terminus of FATB shown in Figure 2 (Yuan et al., 1996; Mayer and Shanklin, 2005). FATB1 and FATB2 contain all three catalytic amino acid residues, and FATB4 contains two of the three catalytic amino acids (N-227 and H-229) of the conserved motif NQHVNN (SEQ ID NO: 38) found in the FATB1 and FATB2 sequences. However, all three catalytic amino acid residues and NQHVNN (SEQ ID NO: 38) are absent in FATB3.

[0273] For sequence comparison, the program CLUSTAL with default parameters was used. The nucleotide sequence identity between FATB1 (LOC_Os06g05130) and FATB4 (LOC_Os06g39520) over the entire coding sequence was 64.6% and between their deduced amino acid sequences was 54.3%. The deduced proteins from FATB1, FATB2, FATB3, and FATB4 are known to correspond to amino acid sequences of 427, 425, 298, and 357 amino acids, respectively.

[0274] FATB gene editing To evaluate the contribution of the FATB1 gene to palmitic acid content in rice grains, gRNA-5 targeted the start of the second exon of OsFATB1 (CTGAACCATGTGAAAACTGC) and was included in vector V1 (see Example 1). The functions of other FATB members have not been characterized so far. Therefore, the contribution of each FATB gene to C16:0 content in grains was further characterized by gene editing. Gene editing vector V2 contains gRNA-6 to gRNA-8 (see Example 1). gRNA-6 (TCCTGGCAGCTGAGAAGCAG) (SEQ ID NO: 35) and gRNA-8 (GGGCTGCTAGGAGATGGTTT) (SEQ ID NO: 36) were designed to edit FATB1 and FATB4, and gRNA-7 (ATGATTCGGTCCTACGAGAT) (SEQ ID NO: 37) simultaneously targeted both FATB2 and FATB3 in the conserved region.

[0275] Example 5 - Gene editing of rice FAD2-1, LOX3, and FATB1 using vector V1 Multiplex genome editing methods in rice, demonstrated by Ma et al. (2016) and discussed by Zafar et al. (2020), are being rapidly developed due to their potential to provide a transgene-free method of plant improvement by simultaneously editing several genes. However, rice genetic engineering to alter the lipid profile of the rice husk layer to improve the usability and shelf life of whole rice and prevent rancidity of the husk and RBO without the need for further processing has not been successfully achieved.

[0276] gRNA and V1 vector design To construct gene editing vector V1, we designed two gRNAs targeting FAD2-1 (LOC_Os02g48560), two gRNAs targeting LOX3 (LOC_Os03g49350), and one gRNA targeting FATB1 (LOC_Os06g05130), as described in Examples 2, 3, and 4. The vectors were generated according to the method described by Ma et al. (2015). Each gRNA was under the control of a rice promoter, a gRNA targeting FAD2-1 driven by the U3 promoter, a gRNA targeting LOX3 driven by the U6a promoter, and a gRNA targeting FATB1 driven by the U6c promoter.

[0277] The T-DNA binary vector V1 for CRISPR gene editing is shown in Figure 2. gRNA-1 targeted 20 bp (nt 3-22) from the end of the start codon covering the second ATG, and gRNA-2 targeted nt 532-551 downstream of the start codon of FAD2-1. gRNA-3 was designed at the nt 31-50 region of the first exon, and gRNA-4 was designed at 20 bp (nt 467-486) ​​spanning the first intron and second exon of LOX3. gRNA-5 was designed at the start of the second exon (nt 523-542) of FATB1. A schematic diagram of the multiple gRNA expression cassettes is shown in Figure 2, with detailed plasmid maps.

[0278] Rice transformation According to Example 1, the V1 vector was transformed into Agrobacterium strain AGL1 for rice transformation according to the method described by Toki et al. (2006) with modifications.

[0279] A total of 14 T0 transgenic lines carrying the hygromycin resistance gene were obtained after tissue culture of transformed callus generated from Nipponbare cv. Leaf tissue was used to prepare DNA samples from each transgenic line. DNA was subjected to PCR amplification and PCR products were sequenced as described in Example 1.

[0280] Edited allele Four edited lines were identified by Sanger sequencing of PCR products amplified from genomic DNA corresponding to the three candidate genes. The successfully edited plants are referred to herein as V1-4, V1-7, V1-12, and V1-13 (Table 3).

[0281] Line V1-4 had one mutant allele of fatb1 edited into the gRNA-5 region, resulting in a frameshift with a single nucleotide insertion that introduced a premature stop codon, but left FAD2-1 and LOX3 unchanged. TO plants grew normally but had reduced fertility.

[0282] Line V1-12 was biallelic edited carrying mutations in the LOX3 gene (-7 / +1 in gRNA-3 and +1 / +1 in gRNA-4), but the FAD2-1 and FATB1 genes were unchanged. All lox3 mutations in line V1-12 at the gRNA-3 target site resulted in a downstream premature stop codon. [Table 6-1] [Table 6-2]

[0283] Lines V1-7 and V1-13 were biallelic heterozygotes at the FAD2-1 and LOX3 loci, meaning that both FAD2-1 and LOX3 were edited, but the FATB1 sequence was confirmed as wild type. Mutations in V1-7 fad2 resulted in an insertion of allele 1 and a 14 bp deletion of allele 2 in the gRNA-1 region (+1 / -14 in gRNA-1), and a nucleotide substitution of allele 1 and a 43 bp deletion of allele 2 in the gRNA-2 target region (A->C / -43 in gRNA-2). Gene editing resulted in a premature stop codon downstream of the gRNA-1 region of FAD2-1. V1-7 T0 plants grew normally but were considered sterile. Previously, Zaplin et al. (2013) showed that RNAi suppression could successfully suppress FAD2-1 expression in a tissue-specific manner resulting in higher oleic acid rice compared to wild type. Recently, no significant agronomic defects were reported in a high oleic acid rice FAD2-1 knockout (KO) mutant generated by Abe et al. (2018) using CRISPR-Cas9 gene editing technology, however, no supporting plant growth data were presented. In contrast, knocking out Camelina sativa FAD2-1, FAD2-2, and FAD2-3 showed significant plant growth defects (Morineau et al., 2017). According to our observations, a complete knockout (KO) mutation in the rice FAD2-1 gene induced sterility in T0 plants, most likely due to the lack of C18:3n3 in anthers, as discussed below.

[0284] FAD2-1 editing in the V1-13 lineage resulted in a small deletion in allele 1 and a single nucleotide insertion in allele 2 in the gRNA1 region (-4 / +1 in gRNA-1) and gRNA2 region (-3 / +1 in gRNA-2), resulting in a deletion of 1 to 10 amino acids downstream of the gRNA-1 region in fad2-1, which we designated fad2 knockdown (KD) or fad2-KD. The resulting fad2-KD encodes a truncated protein, missing the first six amino acid residues from the N-terminus (from the gRNA1 edit). In addition, gRNA2 editing resulted in a mutation from N182 / P183 to T182.

[0285] V1-12 and V1-13 were self-pollinated for the purpose of segregating the edited alleles of fad2-1 and lox3 in the T1 progeny. Plants that were homozygous for lox3, allele 1 and allele 2 (Table 3) in the single gene KO mutant were obtained from the T1 and T2 progeny of V1-12. Allele or "Al" refers to the edited allele at the same locus. Plants that were homozygous for fad2-1 KD were identified in the T1 and T2 progeny of V1-13 in combination with lox3-allele 5 or allele 6. Meanwhile, only fad2-1 allele 2 was found by Sanger sequencing, and fad2-1 allele 1 was found in the heterozygous progeny of V1-13. [Table 7-1] [Table 7-2] [Table 8]

[0286] growth phenotype Fertility of V1-13 self-crossed lines was assessed by panicle sterility. To consider the effect of lox3-KO, V1-12 self-crossed lines were also included. The panicles with most florets developed were selected and labeled for each plant. After the seeds matured on the plants, the panicles were collected and dried at 37°C. The number of sterile florets was recorded and sterility was calculated as a percentage by dividing by the total number of florets. The plants were grown in a greenhouse with a day / night temperature of 26°C / 22°C. Panicle sterility was higher in the lines with fad2-1KO (Table 5). No significant differences were observed regarding the physical characteristics and appearance of the seeds.

[0287] Example 6 - Multiplex FATB gene editing with vector V2 gRNA and V2 vector design Previous results have shown that genes encoding FATB (fatty acyl-ACP thioesterase B) isoforms differ in their function and prevalence in plant tissues (Zaplin et al., 2013). To evaluate the contribution of each FATB gene to seed oil content and composition, V2 vectors were designed. The V2 vectors were designed to create mutations in the corresponding target genes: FATB1 (LOC_Os06g05130), FATB2 (LOC_Os11g43820), FATB3 (LOC_Os02g43090), and FATB4 (LOC_Os06g39520). The V2 vectors contain gRNA6, gRNA7, and gRNA8, with gRNA7 simultaneously targeting both FATB2 and FATB3 at the conserved common region as described in Examples 1 and 4. Experiments were performed to attempt to knock out each FATB enzyme activity in the resulting plants.

[0288] Vectors were generated according to the method described in Ma et al. (2015) and modified as described in Example 1. Each gRNA was placed under the control of a rice promoter, with the U3 promoter used to drive gRNA6 expression, the U6a promoter used to drive gRNA7 expression, and the U6b promoter used for gRNA8. A schematic diagram of the T-DNA binary vector and plasmid map for transformation is shown in Figure 4.

[0289] Rice transformation According to Example 1, the V2 vector was transformed into Agrobacterium strain AGL1 for rice transformation according to the method described by Toki et al. (2006) with modifications.

[0290] Gene-edited T0V2 lines were identified in the V2 mutant population by Sanger sequencing as described in Examples 1 and 5. Multiple fertile plants were observed and four lines, V2-2, V2-8, V2-12, and V2-26, were selected for analysis. T0V2 lines were grown in the greenhouse and self-pollinated to the T3 generation (Table 4). Progeny of the four lines were identified to carry six different combinations of the four OsFATB KO alleles, as shown in (Table 6). All FATB isoforms were successfully edited. [Table 9]

[0291] Consideration In general, it was observed that the mutations were 1 or 2 base pair insertions or deletions resulting in frameshift mutations. If the editing caused a 3 base pair insertion or deletion, this resulted in the addition or deletion of one amino acid in the protein (see, for example, line V2-8-4.1-3). The deletion or insertion of amino acids was expected to be unlikely to affect enzyme activity unless it occurred in an essential region that affects the 3D structure or enzyme activity. The incidence of sterility appeared to be associated with the fatb1 / 2 genotype due to the observation that none of the progeny were identified as fatb1 / 2 homozygotes.

[0292] Example 7 - Fatty acid profile of gene-edited rice To analyze the effect of gene editing on fatty acid composition, total lipids were isolated from grain, anther, leaf, and root samples of V1 transformed rice and the negative segregating control line V2-8-4.1-3 ("Neg"). Fatty acid composition was determined for each lipid extract by GC-FID as described in Example 1. The results are presented in Table 6, and some of the data are presented graphically in Figure 5. The proportion of each fatty acid was determined by GC as described in Example 1 and expressed as a percentage of the total fatty acids in the seed oil of the grain. [Table 10]

[0293] In general, it was observed that mutants carrying edited fad2-1 alleles exhibited altered fatty acid composition. However, fatty acid composition was relatively unchanged in lox3-only edited mutants when compared to the negative control (Neg). In mature seeds, an increase in C18:1 was observed at the expense of C18:2 and C16:0 in all fad2-1 mutants compared to Neg. The most significant increase in C18:1 was found in the fad2-1 KO / lox3 KO lines (54% increase), with the smallest increase in the fad2-1 KD / lox3 KO lines (27% increase), and fad2-1 KO / KD (40% increase) observed between the two oil profiles. Notably, C18:2 was reduced to less than 1% in the fad2-1KO / lox3-KO, with a 4-fold reduction observed in the fad2-1 KD / KO lines. Surprisingly, the proportion of C18:3n3 in the fad2 mutant lines was reduced to less than 1% of the total FFAs in the fad2-1KO and fad2-1 KO / KD lines, but was relatively unchanged in the fad2-1 KD homozygous lines when compared to controls.

[0294] Anthers of the control Nipponbare cv were found to contain approximately 50% C18:3n3, 26% C16:0, 9% C18:2, and 11% C18:0. Compared to seed tissue, the oil content of anthers and leaves from plants containing higher C18:1 had a large trade-off in C18:3n3 and C18:2 in the fad2-1 mutant. For example, the fatty acid composition from anthers of the fad2-1 KO line was approximately 62% C18:1, with a dramatic reduction in C18:2 and C18:3n3. In the fad2-1 KO / KD, the shift in C18:1 was less pronounced, but still increased by 18% in anthers and 6% in leaves at the expense of C18:3n3 and C18:2, respectively. On the other hand, fad2-1 KD showed only minor differences in fatty acid composition compared to the control.

[0295] In root tissues, oil from the fad2-1 KO / KD lines contained significantly higher levels of C18:1, 5-fold higher than the control, with both C16:0 and C18:2 reduced (7% and 21%). Changes in oil composition resulting from fad2-1 KD were less pronounced, with a smaller increase in C18:1 at the expense of C18:2. In all tissue types, the fatty acid composition of the FAD2 WT / lox3KO was found to be comparable to the negative control.

[0296] Total fatty acid composition of T3 single seeds of V1-13 Half-seed FAC was performed to investigate the inheritance of phenotypic changes in C18:1 and C18:2 content and fatty acid ratios of mutant V1-13 from V1-13 lines selfed for further generations. All V1-13 lines and progeny contained a mutated LOX3 gene (KO), resulting in no expression of LOX3 protein. Variation in the ratios of C18:1 and C18:2 from seed to seed was observed in fad2-1KO / KD seeds.

[0297] The C18:1 and C18:2 contents of individual seeds were found to be highly correlated regardless of the fad2-1 genotype (Figure 5). The level of C18:2 was reduced from 35% to almost zero, while the content of C18:1 was increased from about 30% to 70%. This observation was previously reported in cotton, Arabidopsis, and rice FAD2 RNAi transgenic plants (Chapman et al., 2001; Zaplin et al., 2013; Stoutjesdijk et al., 2002) and was considered to be a variable degree of suppression. Without manipulation of FAD2-1 gene expression in CRISPR mutants, our results suggest that, for some reason, FAD2 enzyme activity may be somewhat unstable in heterozygotes during seed development. Seeds containing more than 70% C18:1 were found to have several hundred T 1~Few were found in the T3 seeds, further indicating that fad2-1 KO homozygotes may be less fertile and less agronomically useful. Of 43 florets in one panicle of V1-13 T1 plants, 3 florets failed to develop into seeds and 40 developed into viable seeds, with the ratio (C18:1 / C18:2) ranging from 8 to 13 in 20 sampled seeds and 2 to 4 in the other 20 seeds (Figure 5). The corresponding genotypes of fad2-1 in the lines were confirmed as fad2-1 KO / KD and fad2-1 KD / KD, respectively.

[0298] Germination rate To analyze the effect of mutations in the FAD2 gene on seed fertility, the recovered seeds were grown in pots according to Example 1.

[0299] After the plants matured and dried, the panicles from each of fad2-1KD+lox3-KO, FAD2-WT+lox3-KO, and wild-type Nipponbare (Neg) were soaked in water for 2 weeks in a greenhouse. Seeds on panicles of fad2-KD+lox3-KO exhibited higher germination rate and vigor compared to FAD2-WT+lox3-KO and NEG. Germination rate was observed as follows: [Table 11]

[0300] To observe growth habits, seeds were grown in pots as described in Example 1. Mutant lines carrying the fad2-1 KO / KO alleles exhibited delays in seed germination and plant development (FIG. 6). Homozygous fad2-1 KO / KO mutants were unable to survive under normal growth conditions. In comparison, heterozygous and homozygous KD mutants were able to mature and set seeds without obvious agronomic differences. The plant height of fad2-1 KD / KO was slightly shorter compared to other mutants and negative controls.

[0301] Consideration Membrane lipids of cells in various tissues require unsaturated fatty acids (UFAs) to meet fatty acid balance for the maintenance of cellular functions that allow plants to cope with environmental stresses (He and Ding, 2020). Lipids and their derivatives (fatty acids, waxes, and phospholipids) are important for pollen wall maturation and viability (Shi et al., 2015). A recent study reported that downregulation of GhFAD2-3 could result in male sterility in cotton because linoleic acid in anther wax and cutin was significantly reduced (Liu et al., 2019). Anther development was impaired by reduced and abnormal outer surface (Liu et al., 2019). The fatty acid composition of anthers of V13 progeny showed a significant increase in oleic acid, as well as reduction of palmitic acid and linolenic acid at different levels in the corresponding fad2 mutant genotypes (Table 7).

[0302] Sterility rates in single panicles varied in the progeny of the mutant lines, some of which were more than twice the rate of the negative control. Seed set also varied, with some lines producing more seeds than the negative control and others producing fewer seeds than the negative control.

[0303] In this study, we observed fad2 allele segregation patterns that correlated with sterility. The fad2 KO and KD alleles segregated in V1-13 progeny affecting the oleic acid content of fatty acids (Table 7). In the seeds of V1-13 progeny, the fad2-KO / KD lines were found to contain about 68% more oleic acid, while the remaining progeny carrying the fad2-KD genotype contained about 55% oleic acid. One recovered line with a fad2-KO homozygous genotype contained more than 82% oleic acid (Table 7). This suggests that knocking out the FAD2 gene results in high sterility in rice.

[0304] Example 8 - Total fatty acid composition of T3 single seeds of V2 mutant Previous analysis of genes encoding FATB isoforms in rice showed that FATB1 (LOC_Os06g05130) and FATB2 (LOC_Os11g43820) were more highly expressed in grains than the other two genes. To analyze the effect of gene editing on fatty acid composition, healthy recovered V2 lines were propagated to T3 populations. Total lipids were isolated from grains of V2 transformed rice plants and the negative control line V2-8-2.2. Fatty acid composition was determined for each lipid extract by GC-FID as described in Example 1. The data are presented in Table 8, and some of the data are presented graphically in Figure 7. The relative proportion of each fatty acid was expressed as a percentage of the total fatty acids in the seed oil of the grains, as determined by GC as described in Example 1. [Table 12]

[0305] Comparing the C16:0 (palmitic acid) content of the six selected V2 mutants, it was surprising to see a notable 60% reduction in the fatb2 / 3 line and a 55% reduction in the Fatb2 / 3 / 4 line compared to the negative control. Similarly, a notable reduction in palmitic acid content (about 32%) was also observed in the fatb1 / 2 HE mutant, which contained about 17.5% palmitic acid FAC compared to about 26.6% in the negative control (Figure 7). The variation in C16:0% content among fatb4, fatb1, and fatb1 / 4 HE was not significant when compared to the negative control (Neg). This result suggests that fatb4 knockout did not directly contribute to the palmitic acid content in seeds. The fatb1 knockout resulted in a non-significant reduction in palmitic acid content in seeds when combined with the fatb4 mutation. The function of each FATB gene member was not clear in rice prior to this study. The data demonstrate that the FATB2 gene is the major gene within the FATB family that contributes to seed C16:0 content.

[0306] Example 9 - Breeding with mutant rice lines The V1 and V2 lines can be used to develop genetically diverse genetic backgrounds or seed qualities with rice grain benefits including improved nutritional composition and improved shelf life without adverse agronomic effects. Two independent experiments were conducted: (i) to develop a genetic background in indica rice, and (ii) to combine the V1 and V2 mutants.

[0307] Indica To test whether low C18:2 affected the sterility of indica varieties, mutant V1-13, which contains both the fad2-1 KO / KD and lox3 KO mutations, was crossed with indica rice variety IR36ae.

[0308] Several fertile lines were observed in the progeny and seeds were collected. Two F1 seeds were grown to mature plants, and it was noted that only a few seeds were collected from these F1 lines. Total fatty acid composition was tested as described in Example 1. Lines ae1.5-1 and ae1.5-2 were found to contain a C18:1 content of 74.6% and 72.8%, respectively, and a dramatically reduced C18:2 content of 1.6% and 1.8%. Palmitic acid content was reduced from 21.1% in the negative control compared to 16.5% and 17.4% in the experimental lines ae1.5-1 and ae1.5-2, respectively. Further studies are underway to determine whether indica rice is a desirable background for the super high oleic acid mutant rice.

[0309] Hybridization of V1-13 and V2-12 Crosses were performed between V1-13 and V2-12 T0 plants to combine the edited alleles of OsFAD2-1, OsLOX3, and OsFatB in the progeny. V1-13 contained both OsFad2-KO / KD and OsLox3-KO mutant genotypes, and V2-12 contained mutant FatB2 / 3 / 4 genotypes. Panicles of V1-13 were randomly selected 1 day before anthesis for crossing. The florets were cut open by removing the top 1 / 3 of the petals using scissors. The anthers of each floret were removed using forceps without damaging the stigma. The panicles were then enclosed in an envelope on the plant to avoid contamination. The next day, 2-5 anthers of V2-12 were collected with forceps when the anthers extended from the petals and shed pollen. They were then placed into the V1-13 floret with gentle shaking. The procedure was repeated for all florets on a panicle on three consecutive days.

[0310] The F1 plants, designated LFF, were confirmed by Sanger sequencing to carry OsFAD2-1-KD, OsLOX3-KO, OsFatB1-KO, OsFatB2-KO, and OsFatB4-KO from the V2-12 T0 plants. In the progeny of the cross, a new type of OsFAD2-1-KO (Table 9) was identified. The new OsFAD2-1-KO contained a 22-bp deletion in gRNA1 and a 17-bp deletion in gRNA2. The presence of the new alleles indicated that the V1 CRISPR-Cas9, which targets the OsFAD2-1 locus to create new edits, was still present and active. Half-seed fatty acid composition analysis of F2 seeds from LFF presented distinct profiles of seed lipids from the V1 and V2 populations (Figure 8). OsFAD2-KD / KO+OsFatB2-KO and OsFAD2-KD+OsFatB2-KO showed a further 5-10% reduction in C16:0, an 8-13% increase in C18:1, and a 4-5% reduction in C18:2 from OsFAD2-KD / KO and OsFAD2-KD. Surprisingly, the combination of FAD2 KD / KO and FATB2-KO achieved similar oleic acid (C18:1) levels as the V1 FAD2-KO line, but improved from the further reduction in palmitic acid (C16:0) content from the FATB2-KO combination and the reduction of C18:2 to nearly 4% of total FFAs.

[0311] The F2 population was genotyped using PCR and Sanger sequencing as described in Example 1. Progeny with OsFAD2-1-KD but with new OsFAD2-1-KO were isolated and either OsLOX3-KO, OsFatB1-KO, OsFatB2-KO, OsFatB4-KO were selected and designated LEF-KD1, LEF-KD3, and LEF-KD5 for further analysis in F3 seeds. The genotypes of KD1 and KD3 were OsFAD2-1-KD, OsLOX3-KO, FatB1-KO, FatB4-KO, and KD5 was OsFAD2-1-KD, OsLOX3-KO, FatB2-KO, FatB3-KO, FatB4-KO. The F3 plants were grown again and the F4 seeds were analyzed. Fatty acid profile analysis on both pooled and single seeds of F4 was performed. The results (Table 10) suggested that LEF-KD1, LEF-KD3, and LEF-KD5 may be homozygous in the F4 seeds. [Table 13] [Table 14-1] [Table 14-2]

[0312] Example 9 - Oxidative stability of rice husks and rice husk oil The accelerated rancidity test involves GC using a sampler to detect volatiles in the headspace of grains stored at high temperature (40°C). Comparison of the production of volatiles, especially hexanal, upon storage of wild-type and gene-edited plants, and the progeny resulting from the cross. This is an important quality issue in the rice industry for storage of grains and also for storage of rice husks.

[0313] Rice husks isolated from brown rice were passed through a 0.5 mm sieve and then used for headspace analysis following accelerated storage simulation. Vials containing 300 mg of rice husks were incubated in an oven at 37° C. with the cap closed. The vials were removed from the oven at different time points (days 0, 2, 4, and 8) and stored at −80° C. before HS-SPME analysis. Gas samples released from the husks either by heating at 80° C. or by natural diffusion can be obtained in the headspace of the vials. Volatile constituents in the headspace were analyzed by direct injection into a GC-MS machine (Suzuki et al., 1999). Desorption of aroma compounds is then performed thermally and the trapped molecules are analyzed by GC and identified using standards. The production of hexanal from linoleic acid in vitro has been demonstrated by Nielsen et al. (2004).

[0314] Rancimat is a standardized test to measure the oxidative stability of fats and oils by an accelerated aging process created by exposing samples to heat and increased air volume. The time elapsed until oxidation occurs is the oxidative stability index. Rice samples were provided to Primary Industries New South Wales (DPI NSW). Rice husk oil was extracted by DPI NSW ISO659 method. Approximately 1.8g of rice husk oil was used for the Rancimat test. Variation in total fatty acid composition was determined in rice husk extracts from gene edited mutants and stored RNAi lines (Table 11) (WO2008 / 006171). Rancimat testing by DPI NSW service lab was performed according to standard ISO method 110°C, air flow 20L / hr. [Table 15]

[0315] The induction time of oil is used by the edible oil industry to indicate the quality of oxidative stability. As shown in FIG. 9, the oxidative stability of rice husk oil from the fad2-1 KD+lox3 KO line was measured at 39.86 hours, which was more than twice the induction time of the negative control at 18.00 hours. The FAD2-1 WT+lox3 KO mutant line showed a slight increase of 19.09 hours, about 1 hour longer, when compared to the negative control. In comparison, the FAD2-RNAi oil induction time was 12.37 hours, showing a 1.7-fold increase compared to its negative control (7.28 hours). This suggested that the lower content percentage of C18:2 levels in rice husk oil from the fad2-1 KD+lox3 KO and FAD2-RNAi lines in oil contributed to the higher oxidative stability in these lines compared to their respective controls. In our analysis, there was an 8% difference in C18:2 content between the fad2-1 KD / KD+lox3 KO and FAD2-RNAi silent lines, which would have contributed to the variation in rice husk oil stability between the two lines. This strongly supports our conclusion that rice husks from the fad2-1 KD / KD+lox3 KO not only have an improved oil composition than the previously published FAD2-RNAi lines, but also provide higher stability and longer shelf life of the rice kernel and rice husk itself. Knockout of LOX3 in combination with the fad2-1 KD mutation contributed to improved oxidative stability compared to the negative control, as C18:2 could prevent oxidation during storage after milling and before the oil was extracted. Here, the reduced activity of the tested FAD2 mutant proteins is shown in Example 10. Nevertheless, it should be noted that the RNAi and gene-edited samples may not be suitable for direct comparison due to different harvest years.

[0316] Hexanal Headspace results showed that the accumulation of hexanal compounds increased in each sample during the 3-day stimulated storage treatment at 40° C. The overall amount of hexanal increased in all samples, but at different paces and from different starting concentrations (FIG. 10).

[0317] Before storage stimulation, the amount of hexanal was approximately 100-200 ng / g and was comparable between mutant lines with fad2-1 KO / KD+lox3KO, fad2-1KD / KD+lox3KO, or FAD2WT+lox3KO, while the measured hexanal levels were above 700 ng / g in the negative control. This indicated that peroxidation of linoleic acid may have already been initiated either during or immediately after the grinding process. After storage stimulation, the most significant increase in hexanal production was observed in the negative control over the test period, an almost 2.5-fold increase, resulting in more than 1700 ng / g at the end of the test. The lowest amount of hexanal was approximately 400-500 ng / g in fad2-1 KO / KD+lox3KO and fad2-1KD / KD+lox3KO. The lox3 line (i.e., FAD2WT+lox3KO) showed a greater than four-fold increase in the amount of hexanal produced, reaching approximately 650 ng / g.

[0318] The percentage of the control was calculated to compare with the amount of hexanal in FAD2-RNAi. FAD2-RNAi produced about 44% hexanal compared to its negative control line. In contrast, fad2-1 KO / KD+lox3KO and fad2-1KD / KD+lox3KO, and FAD2WT+lox3KO were 29%, 25%, and 37% of their negative controls. The fact that the hexanal produced by fad2-1 KO / KD+lox3KO and fad2-1KD / KD+lox3KO was lower than that of FAD2WT+lox3KO indicates that knocking out LOX3 in a high oleic acid background can further reduce the rate of C18:2 peroxidation and peroxidation as measured by the ability to produce hexanal. The lox3 mutant also had a lower hexanal production level at day 0. All mutants showed lower levels of hexanal accumulation on day 3 than the negative control samples on day 0. When lox3 KO was combined with reduced expression of FAD2-1, hexanal levels could be reduced by 15-20% more than simply knocking out expression of LOX3 alone.

[0319] Example 10 - Activity of FAD2 mutants FAD2-1 WT, fad2-1 KD, and fad2-1 KD variants were synthesized and cloned into yeast expression vector pYES2 to generate pXZP1101 and pXZP1102, respectively. Plasmids were transformed into yeast strain S288C for selection, and transformants were selected on SD-Ura(glu) plates. At least three positive single colonies of each transformant were then selected for overnight cell culture in 3 mL of SD-Ura(glu) at 30 °C. Cells were collected by centrifugation, then washed with sterile H2O, and resuspended in 3 mL of SD-Ura(gal) to an OD of 0.1 than inoculated into 5 mL of yeast minimal medium SD-Ura(gal). After 2-3 days of cell culture, cells were harvested, washed with H2O, and lyophilized for FAME preparation, followed by GC analysis of total fatty acid composition. Conversion rates measured by the ratio between C18:2 / (C18:1+C18:2) were used to assess FAD2-1 enzyme activity in yeast transformants. In vector control cells, C18:2 was barely detectable, indicating that endogenous FAD2 is absent in S288C (Table 12). FAD2-1 WT showed a C18:2 conversion rate of approximately 48%, however, the mutant fad2-1 KD enzyme showed only 30% reduced conversion, nearly 20% reduced activity, compared to the control wild-type enzyme, which was approximately 60%-62% of the wild type. The variation in conversion rates in fad2-1 KD suggested that the enzyme activity was reduced due to the six amino acid truncation at the N-terminus. [Table 16]

[0320] To identify other suitable mutants, fad2-1 KD enzyme mutants were expressed in yeast system.Variants are shown in Table 13. FAD2-WT activity represents about 100% conversion in the model.As shown, further mutants are shown to have some conversion efficiency, for example, M3 mutant retains about 4% of wild type activity.

[0321] FAD2 functions as a homodimeric enzyme, and expression of a non-functional mutant of FAD2 can cause inhibition of its activity through the formation of a non-functional heterodimer. The Cas9 / sgRNA construct used in this study targets the start codon and causes a frameshift mutation in the 5' region of the target FAD2 gene, disrupting the N-terminal FAD2 domain. We have shown the reduction in activity resulting from the frameshift mutation in a yeast model. [Table 17]

[0322] Six alternative open reading frames (ORFs) were found for FAD2-1 in the Rice Genome Annotation Database at MSU (http: / / rice.plantbiology.msu.edu / index.shtml), four of which started from the start codon (the second ATG), whereas ORF1 and ORF6 started from the first ATG of the intron and the third ATG at the 5′ end of the exon, respectively. Presumably, all of the ORFs can code for proteins of the FAD2-1 isoform. The 4-bp deletion of the fad2-1 KD allele induced a frameshift in five possible ORFs, but not in the sixth alternative ORF. The corresponding protein was miscoded due to the mutation, resulting in a premature stop codon and terminating translation. ORF6 is predicted to be uninterrupted because the 4-bp deletion occurred just before the third ATG. The predicted ORF6 encodes a cleavage enzyme, FAD2-KD, with six amino acid residues removed from the N-terminus. As shown in this example, the enzymatic activity of the FAD2-KD protein was reduced to about 2 / 3 of the wild-type enzyme FAD2-1. Thus, the higher C18:1 content in mutant rice lines carrying the KD mutation may be due to the knockout of the wild-type ORF and / or all five alternative ORFs, with the retention of ORF6 contributing to the residual enzymatic activity. Alternative editing strategies for stably reducing the expression and / or activity of FAD2-1 can be generated using tools commonly available in the art.

[0323] This application claims priority from AU2021 / 903546, filed November 5, 2021, the entire contents of which are incorporated herein by reference.

[0324] As shown in the specific embodiments, it will be appreciated by those skilled in the art that numerous variations and / or modifications may be made to the present invention without departing from the spirit or scope of the invention as broadly described. The present embodiments are therefore to be considered in all respects as illustrative and not restrictive.

[0325] All publications discussed and / or referenced herein are incorporated herein in their entirety.

[0326] Any discussion of documents, acts, materials, devices, articles or the like which has been included in the present specification is solely for the purpose of providing a context for the present invention and is not to be construed as an admission that any or all of such matters form part of the prior art base or were general knowledge in the field relevant to the present invention as they existed prior to the priority date of each claim of this application.

[0327] References Abe et al. (2018) Plant Physiol Biochem 131:58-62. Abdullah et al. (1986)Biotechnology 4:1087. Barker et al. (1983) Plant Mol. Biol. 2:235-350. Begemann et al. (2017) Sci Rep.7:11606. Berger et al.(2005)Eur.J.Nutr.44:163-173. Bevan et al. (1983) Nucl. Acid Res. 11:369-385. Bumrungpert et al. (2019) J. Altern. Complement. Med. 25:353-358. Cadwell and Joyce (1992) PCR Methods Appl.2:28-33. Capecchi (1980) Cell 22:479-488. Chapman et al. (2001) Journal of the American Oil Chemists' Society 78:941-947. Cheng et al. (1996) Plant Cell Rep. 15:653-657. Clapp et al.(1993)Clin.Perinatol.20:155-168. Coco et al. (2001) Nature Biotechnology 19:354-359. Coco (2002) Nature Biotechnology 20:1246-1250. Comai et al.(2004)Plant J 37:778-786. Crameri et al. (1998) Nature 391:288-291. Curiel et al. (1992) Hum.Gen.Ther.3:147-154. Doudna and Charpentier(2014)Science 28:346(6213):1258096. Eggert et al. (2005)Chembiochem 6:1062-1067. Eglitis et al. (1988) Biotechniques 6:608-614. Feussner and Wasternack (2002)Annu Rev Plant Biol,53:275-97. Fujimura et al. (1985) Plant Tissue Cultural Letters 2:74. Garfinkel et al. (1983) Cell 27:143-153. Graham et al. (1973)Virology 54:536-539. Grant et al. (1995) Plant Cell Rep.15:254-258. Greve(1983)J.Mol.Appl.Genet.1:499-511. Ha(2005)Nutrition research 25:597-606. Harayama(1998)Trends Biotechnol.16:76-82. Haft et al.(2005)Computational Biology,PLoS Comput Biol 1(6):e60. He and Ding(2020)Frontiers in Plant Science,11:562785-85. Hellinga(1997)Proc.Natl.Acad.Sci.94:10015-10017. Henikoff et al.(2004)Plant Physiol 135:630-636. Hinchee et al.(1988)Biotech.6:915. Ida et al.(1983)Agricultural and Biological Chemistry 47:637-41. Jezequek et al.(2008)Biotechniques 45:523-532. Jinek et al.(2012)Science 337:816-821. Joshi(1987)Nucl.Acid Res.15:6643-6653. Juliano(1985)Rice:Chemistry and Technology(American Association of Cereal Chemists). Langridge et al.(2001)Aust.J.Agric.Res.52:1043-1077. Lemieux(2000)Current Genomics 1:301-311. Leung et al.(1989)Technique 1:11-15. Liang et al.(2017)Nat Commun.8:14261. Liang et al.(2018)Plant Biotechnol J.16:2053-2062. Liang et al.(2019)Methods Mol Biol.1917:327-335. Liu et al.(2019)BMC Plant Biology,19:393-93. Lu et al.(1993)J.Exp.Med.178:2089-2096. Luo et al.(2016)Plant Cell Rep 35(7):1439-1450. Ma et al.(2015)Mol Plant,8:1274-84. Makarova(2015)Nat.Rev.Microbiol.13:722-736. Mayer and Shanklin(2005)Journal of Biological Chemistry,280:3621-27. Medberry et al.(1992)Plant Cell 4:185-192. Medberry et al.(1993)Plant J.3:619-626. Mizuno et al.(2003)Plant Cell Physiol,44:1168-75. Moghadasian and Frohlich(1999)Am.J.Med.107:5 88-94. Morineau et al.(2017)Plant Biotechnol.J.15:729-739. Morrison(1988)J Cereal Sci.8:l-15. Most et al.(2005)Am J Clin Nutr 81:64-8. Needleman and Wunsch(1970)J.Mol Biol.45:443-453. Ness et al.(2002)Nature Biotechnology 20:1251-1255. Newcomer and Brash(2015)Protein Sci.24:298-309. Nielsen et al.(2004)Journal of Agricultural and Food Chemistry 52:23 15-232 1. Ohta et al.(1986)Plant Cell Physiol.27:911-918. Ostermeier et al.(1999)Nature Biotechnology 17:1205-1209. Ouyang et al.(2007)Nucleic Acids Research,35:D883-D87. Ow et al.(1986)Science 234:856-859. Pal and Pratap(2017)J.Oleo.Sci.66:551-556. Prasher et al.(1985)Biochem.Biophys.Res.Comm.126:1259-68. RoyChowdury et al.(2016)Biomed.Res.Int.doi:10.1155 / 2016 / 4275904.Epub 2016 Jun 15. Rukmini and Raghuram(1991)J.Am.Coll.Nutr 10:593-601. Salomon et al.(1984)EMBO J.3:141-146. Shanklin et al.(1998)Annu.Rev.Physiol.Plant Mol.Biol.49:611-641. Shi et al.(2015)Trends in Plant Science,20:741-53. Sieber et al.(2001)Nature Biotechnology 19:456-460. Slade and Knauf(2005)Transgenic Res.14:109-115. Stalker et al.(1988)Science 242:419-423. Stemmer(1994a)Proc.Natl.Acad.Sci.USA 91:10747-10751. Stemmer (1994b) Nature 370(6488):389-391. Stoutjesdijk et al. (2002) Plant Physiol 129:1723-1731. Sun et al. (2016)Molecular Plant 9:628-631. Suzuki et al. (1993)J Agric Food Chem,47:1119-24. Suzuki et al. (1999)J Agric Food Chem,47:1119-24. Suzuki and Matsukura (1997) Plant Science,125:119-26. Svitashev et al.(2016)Nat Commun.7:13274. Theriault et al. (1999)Clin.Biochem.32:309-19. Thillet et al.(1988)J.Biol.Chem.263:12500. Toki et al. (2006)The Plant Journal,47:969-76. Toriyama et al.(1986)Theor.Appl.Genet.205:34. Umate(2011)Plant Signaling&Behavior,6:335-38. Volkov et al. (1999) Nucleic Acids Research 27:e18. Wagner et al. (1992)Proc.Natl.Acad.Sci.USA 89:6099-6103. Woo et al.(2015)Nat Biotechnol.33:1162-1164. Xu et al.(2015)Plant Biotechnol J.13:526-539. Yuan et al.(1996)J Biol Chem,271:11034a-34. Zafar et al.(2020)J.Exp.Botany 71:470-479. Zaplin et al.(2013)Functional Plant Biology 40:996-1004. Zhao et al.(1998)Nature Biotechnology 16:258-261. Zhou et al.(2011)J.Biol.Chem.286:43644-43650.

Claims

1. A fertile cereal grain comprising a genetically modified FAD2-1 gene and a genetically modified LOX3 gene, the grain comprising: i) at least some FAD2-1 protein activity, wherein said FAD2-1 activity is reduced when compared to wild-type cereal grain; and ii) reduced LOX3 protein activity when compared to said wild-type cereal grain.

2. The grain of claim 1 which is rice grain.

3. i) the grain has a total fatty acid content comprising at least 50%, at least 60%, at least 70%, at least 75%, 50%-80%, 55%-75%, 55%-70% oleic acid (w / w dry weight); ii) the grain has a total fatty acid content comprising 18%, less than 15%, between 15% and 22%, or between 15% and 21% palmitic acid (w / w dry weight); and iii) the grain has a total fatty acid content of less than 20%, less than 15%, less than 10%, less than 5%, between 2% and 20%, or between 5% and 15% linoleic acid (w / w dry weight); The grain according to claim 1, wherein one or more or all of the following apply:

4. i) the grain does not have LOX3 protein activity; ii) the genetic modification of the LOX3 gene is a premature stop codon in the LOX3 gene; and iii) the genetically modified FAD2-1 gene encodes a mutant FAD2-1 protein; The grain according to claim 1, wherein one or more or all of the following apply:

5. 1. A cereal husk comprising genetically modified cells, i) at least some FAD2-1 protein activity, wherein said FAD2-1 activity is reduced when compared to wild-type cereal husks; and ii) a cereal husk that has reduced LOX3 protein activity when compared to said wild-type cereal husk.

6. Extracted cereal kernel oil or cereal husk oil, 10. An extracted cereal grain oil or cereal husk oil having a total fatty acid content comprising 50% to 80%, or 55% to 80% oleic acid (w / w dry weight), having an induction time of at least 25 hours as measured by a Rancimat test performed at 110°C and an air flow rate of 20 L / h, and / or being more stable than cereal oils extracted from cereal grains or husks lacking i) and ii) of claim 1.

7. 10. A cell, preferably a rice cell, comprising a genetic modification as defined in claim 1 or an exogenous polynucleotide encoding a mutant FAD2-1 protein having Δ12 desaturase activity that is 5% to 95%, 20% to 80%, 40% to 70%, or 50% to 60% lower than the corresponding wild-type FAD2-1 protein.

8. A fertile cereal plant, preferably a rice plant, comprising one or more of the cereal grain according to any one of claims 1 to 4, the cereal husk according to claim 5, a mutant FAD2-1 protein having a Δ12 desaturase activity that is 5% to 95%, 20% to 80%, 40% to 70%, or 50% to 60% lower than that of the corresponding wild-type FAD2-1 protein, a polynucleotide encoding the mutant FAD2-1, a vector comprising said polynucleotide, or a cell comprising said polynucleotide or said vector.

9. 1. A method for producing a genetically modified cereal plant, comprising: i) introducing a genetic modification into a cereal cell to encode a mutant FAD2-1 protein having a Δ12 desaturase activity that is 5% to 95% lower, 20% to 80% lower, 40% to 70% lower, or 50% to 60% lower than the corresponding wild-type FAD2-1 protein; ii) producing a plant from said cell.

10. i) the cell does not encode a functional LOX3 protein, or 10. The method of claim 9, wherein ii) the method further comprises introducing a genetic modification such that the plant or its progeny does not encode a functional LOX3 protein in its grain and / or husk.

11. 9. A method for identifying a cereal plant according to claim 8, comprising: i) obtaining a nucleic acid sample from a cereal plant; ii) screening the sample for the presence or absence of a first genetic modification that reduces, but does not neutralize, FAD2-1 protein activity in the grain of the plant compared to wild-type grain, and a second genetic modification that reduces LOX3 protein activity in the grain of the plant compared to wild-type grain.

12. 1. A process for producing extracted cereal kernel oil and / or cereal husk oil, comprising: i) obtaining kernels and / or husks according to any one of claims 1 to 5 from a cereal plant; ii) extracting oil from said grains and / or grain husks.

13. 1. A method for producing a part of a cereal plant, comprising: a) growing a cereal plant according to claim 8 or at least 100 such cereal plants in a field; b) harvesting a portion of said cereal plant from said cereal plant or plants.

14. 1. A method for producing cereal flour, hulls, whole grain flour, germinated grain, starch, or oil obtained from cereal grains, comprising the steps of: a) obtaining a kernel of a plant according to claim 8 or a kernel and / or husk according to any one of claims 1 to 5; b) processing the grain to produce the flour, hulls, whole grain flour, germinated starch, or oil.

15. 9. A product made from the plant of claim 8 or the grain and / or husks of any one of claims 1 to 5, wherein the product is a food ingredient, a beverage ingredient, a food product, or a beverage product.

16. 16. A method for preparing a food ingredient, beverage ingredient, food product or beverage product according to claim 15, comprising processing grain of a cereal plant according to claim 8, grain and / or husks according to any one of claims 1 to 5, or husks, flour, wholemeal, germination product, starch or oil from said grains to produce said food ingredient, beverage ingredient, food product or beverage product.

Images