Composite substance usable as energy transmission path

Abstract

To provide a composite substance that can be utilized as an energy transmission path more conveniently.SOLUTION: A composite material includes a donor luminescent element composed of a luminescent protein or its split fragments, a polymer incorporating a mediator dye, and an acceptor. The donor luminescent element and the acceptor are coupled to the polymer. The donor luminescent element, the mediator dye, and the acceptor are arranged to enable energy transfer via BRET from the donor luminescent element to the mediator dye and via FRET from the mediator dye to the acceptor.SELECTED DRAWING: None

Description

[Technical Field]

[0001] The present invention relates to a composite material that can be used as an energy transmission path. [Background technology]

[0002] Plants efficiently utilize scarce solar energy through a complex consisting of a photosynthetic reaction center and a core protein in the light-harvesting antenna. This complex contains hundreds of chlorophyll molecules. The received light energy is passed from molecule to molecule through this complex to the reaction center. This energy transfer is difficult to mimic. Non-Patent Document 1 reports that energy transfer was achieved by placing multiple fluorescent dyes on DNA as a scaffold and causing fluorescence resonance energy transfer (FRET) between these fluorescent dyes. However, this technique uses a bulk excitation light source, which excites all fluorescent dyes present in the system. As a result, observing the net energy transfer was impossible without using multiphoton excitation, which has many limitations. [Prior art documents] [Non-patent literature]

[0003] H. Kashida et al. Angew. Chem. Int. Ed. 2020, 59 (28), 11360-11363. Summary of the Invention [Problem to be solved by the invention]

[0004] An object of the present invention is to provide a composite material that can be more easily used as an energy transmission path. [Means for solving the problem]

[0005] The present inventors have conducted extensive research in light of the above-mentioned problems and have found that the above-mentioned problems can be solved by a composite substance comprising a donor light-emitting element consisting of a photoprotein or a fragment thereof, a polymer containing a mediator dye, and an acceptor, wherein the donor light-emitting element and the acceptor are linked to the polymer, and the donor light-emitting element, mediator dye, and acceptor are arranged so that energy transfer occurs by BRET from the donor light-emitting element to the mediator dye, and from the mediator dye to the acceptor. Based on this finding, the present inventors have conducted further research and have completed the present invention. Specifically, the present invention encompasses the following aspects.

[0006] Item 1. A light-emitting device comprising a donor light-emitting element made of a photoprotein or a fragment thereof, a polymer containing a mediator dye, and an acceptor, the donor light-emitting element and the acceptor are linked to the polymer; and a composite material, wherein the donor light-emitting element, the mediator dye, and the acceptor are arranged so that energy transfer occurs by BRET from the donor light-emitting element to the mediator dye, and from the mediator dye to the acceptor.

[0007] Item 2. The composite substance according to Item 1, wherein the donor light-emitting element is a split fragment of a photoprotein.

[0008] Item 3. The composite substance according to Item 1, wherein the donor luminescent element is a fragment of a substrate-dependent photoprotein.

[0009] Item 4. The composite material according to Item 1, wherein the donor light-emitting element is linked to the polymer via a linker.

[0010] Item 5. The composite material according to Item 1, wherein the distance between the donor light-emitting element and the nearest mediator dye is 9 nm or less.

[0011] Item 6. The composite substance according to Item 1, wherein the polymer is a polynucleotide.

[0012] Item 7. The composite substance according to Item 1, which contains a plurality of the mediator dyes, and the distance between any one of the mediator dyes and the adjacent mediator dye is 20 base lengths or less or a length equivalent thereto.

[0013] Item 8. The composite substance according to Item 1, which contains a plurality of the mediator dyes, and the distance between any one of the mediator dyes and the adjacent mediator dye is 10 base lengths or less or a length equivalent thereto.

[0014] Item 9. The conjugate substance according to Item 1, wherein the distance between the acceptor and the nearest mediator dye is 20 base lengths or less or a length equivalent thereto.

[0015] Item 10. An energy transmission line comprising the composite material according to any one of Items 1 to 9. [Effects of the Invention]

[0016] According to the present invention, it is possible to provide a composite material that can be more easily used as an energy transmission path. [Brief explanation of the drawings]

[0017] [Figure 1] 1 shows the results of measuring the emission spectrum when 0FAM-Alexa Fluor 594 was used as complementary DNA in Example 1. [Figure 2] 1 shows the results of measuring the emission spectrum when 1FAM-Alexa Fluor 594 (left graph) or 2FAM-Alexa Fluor 594 (right graph) was used as the complementary DNA in Example 1. [Figure 3] 1 shows the results of measuring the emission spectrum when 4FAM-Alexa Fluor 594 was used as the complementary DNA in Example 1. [Figure 4]This shows a comparison when 0FAM-Alexa Fluor 594 or 4FAM was used as the complementary DNA in Example 1 (left graph), and a comparison when 4FAM or 4FAM-Alexa Fluor 594 was used (right graph). [Figure 5] 1 shows the results of measuring the emission spectrum when SYBR Green I was used as the DNA-binding fluorescent dye in Example 2. [Figure 6] 1 shows the results of measuring the emission spectrum when SYTO9 was used as the DNA-binding fluorescent dye in Example 2. [Figure 7] The results of measuring the emission spectrum in Example 3 are shown. The complementary DNA used is shown in the legend. [Figure 8] 1 shows the results of measuring the energy transfer efficiency in Example 3. [Figure 9] 1 shows the relationship between the energy transfer efficiency measured in Example 3 and the distance from the 3' end of the complementary DNA to FAM. DETAILED DESCRIPTION OF THE INVENTION

[0018] In this specification, the expressions "contain" and "comprise" include the concepts of "contain", "include", "consist essentially of" and "consist only of".

[0019] 1.Definition In this specification, the expressions "contain" and "comprise" include the concepts of "contain", "include", "consist essentially of" and "consist only of".

[0020] "Identity" of amino acid sequences refers to the degree of correspondence between the amino acid sequences of two or more comparable amino acid sequences. Thus, the greater the correspondence between two amino acid sequences, the greater the identity or similarity between those sequences. The level of identity of amino acid sequences can be determined, for example, using the sequence analysis tool FASTA with default parameters. Alternatively, it can be determined using the BLAST algorithm by Karlin and Altschul (S. Karlin, S. F. Altschul. "Methods for assessing the statistical significance of molecular sequence features by using general scoring schemes," Proc. Natl. Acad. Sci. USA 87, 2264-2268 (1990); S. Karlin, S. F. Altschul. "Applications and statistics for multiple high-scoring segments in molecular sequences," Proc. Natl. Acad. Sci. USA 90, 5873-5877 (1993)). A program called BLASTX has been developed based on the BLAST algorithm. Specific techniques for these analysis methods are known and can be found on the National Center of Biotechnology Information (NCBI) website (http: / / www.ncbi.nlm.nih.gov / ). The "identity" of nucleotide sequences is also defined in the same manner as above.

[0021] As used herein, "conservative substitution" refers to the substitution of an amino acid residue with an amino acid residue having a similar side chain. For example, substitution between amino acid residues having basic side chains such as lysine, arginine, and histidine constitutes a conservative substitution. Other examples of conservative substitution include substitution between amino acid residues having acidic side chains such as aspartic acid and glutamic acid; amino acid residues having uncharged polar side chains such as glycine, asparagine, glutamine, serine, threonine, tyrosine, and cysteine; amino acid residues having nonpolar side chains such as alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, and tryptophan; amino acid residues having β-branched side chains such as threonine, valine, and isoleucine; and amino acid residues having aromatic side chains such as tyrosine, phenylalanine, tryptophan, and histidine.

[0022] 2. Composite substances In one aspect, the present invention relates to a composite substance (sometimes referred to herein as the "composite substance of the present invention") comprising a donor light-emitting element consisting of a photoprotein or a fragment thereof, a polymer containing a mediator dye, and an acceptor, wherein the donor light-emitting element and the acceptor are linked to the polymer, and the donor light-emitting element, the mediator dye, and the acceptor are arranged so that energy transfer occurs by BRET from the donor light-emitting element to the mediator dye and from the mediator dye to the acceptor. This will be described below.

[0023] The donor light-emitting element is made of a photoprotein or a fragment thereof. By using a photoprotein or a fragment thereof as the donor light-emitting element, it is possible to suppress background light and observe net energy transfer.

[0024] The photoprotein is not particularly limited as long as it is a protein that can emit light by itself. From the viewpoint of suppressing background light, etc., substrate-dependent photoproteins are preferred as the photoprotein.

[0025] Examples of substrate-dependent photoproteins include luciferase, β-galactosidase, lactamase, horseradish peroxidase, alkaline phosphatase, β-glucuronidase, β-glucosidase, etc., with luciferase being particularly preferred. Examples of luciferases include Pleurotus ostreatus luciferase, Renilla luciferase, firefly luciferase, coelenterate luciferase, North American glowworm luciferase, click beetle luciferase, railroad worm luciferase, bacterial luciferase, Gaussia luciferase, aequorin, Mycobacterium hikari luciferase, etc. Substrate-dependent photoproteins can emit light in the presence of a substrate (e.g., furimazine, luciferin, calcium, coelenterazine, a derivative or analog of coelenterazine, etc.). The substrate-dependent photoprotein may have mutations such as amino acid substitutions, deletions, additions, or insertions introduced into it, as long as the substrate-dependent photoactivity is not significantly impaired (for example, the photoactivity is, for example, 50% or more, preferably 70% or more, more preferably 80% or more, and even more preferably 90% or more of the non-mutated form).

[0026] The split fragments of a photoprotein are not particularly limited, as long as they cannot emit light by themselves and can restore luminescence activity by associating with another split fragment that pairs with the split fragment. The amino acid sequences of the split fragments of a split protein can be determined according to or in accordance with publicly known information (e.g., International Publication No. 2014 / 151736) depending on the type of photoprotein, the desired dissociation constant, and the like. Examples of the split fragments that can be used include LgBiT (Promega) and SmBiT (Promega), which are split fragments of NanoLuc (Promega). LgBiT is a large subunit of approximately 18 kDa, and SmBiT is a small subunit of 11 amino acid residues.

[0027] When the donor light-emitting element is a fragment of a photoprotein, it can be brought into contact with a counterpart fragment at the time of use, whereby the two associate and the luminescence activity can be restored.

[0028] The donor light-emitting element is preferably a fragment of a substrate-dependent photoprotein. The donor light-emitting element is preferably a peptide having a relatively short length of amino acid residues, for example, 5 to 30, preferably 6 to 20, amino acid residues.

[0029] The donor light-emitting element may be linked to the polymer directly or via a linker, but is preferably linked to the polymer via a linker from the viewpoints of appropriate exertion of the light-emitting activity of the photoprotein and the association between the split fragment of the photoprotein and its paired split fragment.

[0030] The linker is not particularly limited as long as it has a flexibly operable structure. The linker may consist of only a chain structure, or may contain a chain structure and a ring structure. The chain structure may be linear or branched.

[0031] More specifically, the linker is preferably a hydrocarbon chain in which at least one carbon atom constituting the main chain may be replaced with a heteroatom and / or a linking structure. When at least one carbon atom constituting the main chain is replaced with a heteroatom and / or a linking structure, the number of carbon atoms replaced with the linking structure is, for example, 1 to 5, preferably 1 to 3, and more preferably 1 to 2.

[0032] The hydrocarbon chain is preferably an alkylene group. The alkylene group may be either linear or branched, but is preferably linear. The number of carbon atoms constituting the main chain of the alkylene group (the chain connecting the donor light-emitting element and the polymer) is preferably 6 or more, from the viewpoints of the appropriate exertion of luminescence activity of the photoprotein and the association between the photoprotein fragments and their paired fragments. The number of carbon atoms is more preferably 6 to 40, even more preferably 8 to 30, and even more preferably 10 to 30.

[0033] Examples of heteroatoms include oxygen atoms, sulfur atoms, and nitrogen atoms. When at least one carbon atom constituting the main chain of an alkylene group is replaced with an oxygen atom, specifically, -CH2- in the main chain of the alkylene group is replaced with, for example, -O-. When at least one carbon atom constituting the main chain of an alkylene group is replaced with a sulfur atom, specifically, -CH2- in the main chain of the alkylene group is replaced with, for example, -S-, -S(=O)2-, -S(=O)-. When at least one carbon atom constituting the main chain of an alkylene group is replaced with a nitrogen atom, specifically, -CH2- in the main chain of the alkylene group is replaced with, for example, -NR- (R represents a hydrogen atom or a hydrocarbon group (preferably an alkyl group, more preferably an alkyl group having 1 to 8 carbon atoms)).

[0034] The linking structure is not particularly limited as long as it is a divalent group that is a bond structure formed by the reaction of two identical or different reactive groups. Examples of the reactive group include an amino group, a carboxy group, a hydroxy group, a ketone group, an ethynyl group, a vinyl group, an azide group, an epoxy group, an aldehyde group, an oxylamino group, a thiol group, an isocyanate group, and an isothiocyanate group.

[0035] Examples of reactions between reactive groups are as follows: Amino groups are known to react with carboxy groups (or groups formed by esterifying carboxy groups with N-hydroxysuccinimide (NHS)) to form amide bonds. Ethynyl groups are known to undergo 1,3-dipolar cycloaddition with azide groups to form 1,2,3-triazole rings. Cyclooctyne is known to undergo 1,3-dipolar cycloaddition with azide groups to form 1,2,3-triazole rings. Amino groups are known to react with carboxy groups to form amide bonds. Carboxy groups are known to react with hydroxy groups to form ester bonds. Carboxy groups are known to react with thiol groups to form thioester bonds. Phosphate groups are known to react with hydroxy groups to form phosphodiester bonds. Vinyl groups are known to react with thiol groups to form bonds. Epoxy groups are known to react with amino and thiol groups to form bonds. Aldehyde groups react with amino groups to form Schiff bases, which can be reduced to form bonds. The oxylamino group reacts with a ketone group or an aldehyde group to form an oxime.

[0036] In one embodiment of the present invention, the linking structure may comprise at least one linking structure selected from the group consisting of a linking structure containing a triazole ring, a linking structure containing an amide bond, a linking structure containing a (3-thio)succinimide, a disulfide bond, a phosphodiester bond, and an intracellularly cleavable peptide linking bond. In one embodiment of the present invention, the linking structure may comprise a linking structure containing a triazole ring and / or a linking structure containing an amide bond. More specifically, the linking structure containing a triazole ring may be, for example, a 1,2,3-triazole ring, or a fused ring (e.g., a bicyclic or tricyclic ring) of a 1,2,3-triazole ring with another ring (e.g., a 3- to 8-membered ring, or a fused ring). Specific examples of the linking structure containing an amide bond include, for example, an amide bond (-CO-NR-) or -O-CO-NR- (wherein R is as defined above).

[0037] The linker, in a more specific embodiment, preferably has the general formula (L1):

[0038] [ka] [In the formula: R l1 and R l2 are the same or different and represent a single bond or a linking structure. l3 and R l5 R may be the same or different and represent a hydrocarbon chain in which at least one carbon atom constituting the main chain may be replaced with a heteroatom. l4 represents a single bond or a hydrocarbon chain in which at least one carbon atom constituting the main chain may be replaced with a heteroatom. *1 is the moiety that connects to the donor light-emitting element, and *2 is the moiety that connects to the polymer.] It is a divalent group represented by the formula:

[0039] In one embodiment of the present invention, R l1 is a linking structure containing a triazole ring, and R l2 is a linking structure containing an amide bond, and R l4 is a hydrocarbon chain in which at least one carbon atom constituting the main chain may be replaced with a heteroatom. l1 and R l4 is a single bond, and R l2 is a linking structure containing an amide bond.

[0040] In a preferred embodiment of the present invention, R l3 , R l4 , and R l5 The number of atoms constituting the main chain of R is 3 to 20. More specifically, l3 The number of atoms constituting the main chain of R is preferably 3 to 10, more preferably 3 to 6, and even more preferably 3 to 4. l4 The number of atoms constituting the main chain of R is preferably 3 to 10, more preferably 3 to 6, and even more preferably 3 to 4. l5 The number of atoms constituting the main chain is preferably 5 to 20, more preferably 8 to 16, and even more preferably 10 to 15.

[0041] The polymer is not particularly limited as long as it is a polymer in which monomer units are linked by phosphodiester bonds, phosphorothioate bonds, or amide bonds. Preferably, the polymer is a polymer in which monomer units are linked by phosphodiester bonds or phosphorothioate bonds.

[0042] The polymer may be either linear or branched.

[0043] The monomer units are not particularly limited and may be linked by phosphodiester or phosphorothioate bonds. Preferably, the monomer units are formed by polymer synthesis using a phosphoramidite monomer via the phosphoramidite method. Examples of the monomer units include nucleosides, N-(2-aminoethyl)glycine, oligoethylene glycol chains or alkyl chains with functional groups introduced therein, and PNA monomer units (monomer units containing bases).

[0044] The polymer is particularly preferably a polynucleotide. Use of a polynucleotide enables the composite substance of the present invention to be easily prepared. The polynucleotide may be either a single-stranded polynucleotide or a double-stranded polynucleotide, but from the viewpoint of ease of preparation of the composite substance of the present invention, a double-stranded polynucleotide is preferred. In a more preferred embodiment of the present invention, the composite substance of the present invention comprises a double-stranded polynucleotide formed by the association of a single-stranded polynucleotide A linked to a donor fluorescent element and a single-stranded polynucleotide B linked to an acceptor through complementary base pairing. The single-stranded polynucleotide A or the single-stranded polynucleotide B can be used as a staple nucleic acid in DNA origami, and in this case, the paired polynucleotide (single-stranded polynucleotide B or single-stranded polynucleotide A) can be part of the single-stranded circular nucleic acid that constitutes the DNA origami.

[0045] As used herein, polynucleotides such as DNA and RNA may be chemically modified as described below. To prevent degradation by hydrolases such as nucleases, the phosphate residues of each nucleotide may be substituted with chemically modified phosphate residues such as phosphorothioate (PS), methylphosphonate, and phosphorodithioate. The hydroxyl group at the 2-position of the sugar (ribose) of each ribonucleotide may be substituted with -OR (where R represents, for example, CH3(2'-O-Me), CH2CHOCH3(2'-O-MOE), CH2CH2NHC(NH)NH2, CH2CONHCH3, or CH2CH2CN). Furthermore, the base moiety (pyrimidine or purine) may be chemically modified, for example by introducing a methyl group or a cationic functional group into the 5-position of the pyrimidine base, or by substituting a thiocarbonyl group for the carbonyl group at the 2-position. Further examples include, but are not limited to, those in which the phosphate moiety or hydroxyl moiety is modified with, for example, biotin, an amino group, a lower alkylamine group, or an acetyl group. Also usable are BNA (LNA), in which the 2' oxygen and 4' carbon of the sugar moiety of the nucleotide are crosslinked to fix the conformation of the sugar moiety to N-type. Furthermore, peptide nucleic acids (e.g., PNA) can also be used.

[0046] The bases constituting nucleosides / nucleotides include not only typical bases in natural nucleic acids such as RNA and DNA (adenine (A), thymine (T), uracil (U), guanine (G), cytosine (C), etc.), but also other bases such as hypoxanthine (I) and modified bases. Modified bases include, for example, pseudouracil, 3-methyluracil, dihydrouracil, 5-alkylcytosine (e.g., 5-methylcytosine), 5-alkyluracil (e.g., 5-ethyluracil), 5-halouracil (5-bromouracil), 6-azapyrimidine, 6-alkylpyrimidine (6-methyluracil), 4-acetylcytosine, 5-(carboxyhydroxymethyl)uracil, 5'-carboxymethylaminomethyl-2-thiouracil, 5-carboxymethylaminomethyluracil, 1-methyladenine, 1-methylhypoxanthine, etc. Examples of suitable amino acids include uracil, 2,2-dimethylguanine, 3-methylcytosine, 2-methyladenine, 2-methylguanine, N6-methyladenine, 7-methylguanine, 5-methoxyaminomethyl-2-thiouracil, 5-methylaminomethyluracil, 5-methylcarbonylmethyluracil, 5-methyloxyuracil, 5-methyl-2-thiouracil, 2-methylthio-N6-isopentenyladenine, uracil-5-oxyacetic acid, 2-thiocytosine, purine, 2-aminopurine, isoguanine, indole, imidazole, xanthine, and cyanuric acid.

[0047] The number of monomer units in the polymer is not particularly limited, but is, for example, 2 or more, preferably 3 or more, more preferably 5 or more, even more preferably 10 or more, and still more preferably 20 or more. The upper limit of the number of monomer units is not particularly limited, and is, for example, 2000, 1000, 500, 200, 100, or 50.

[0048] The polymer has a structure in which monomer units and phosphodiester bonds, phosphorothioate bonds, or amide bonds are arranged alternately. Specifically, the polymer can have a structure represented by the following general formula (1) or (2):

[0049] [ka] [In general formula (1): R 1 O - or S - Indicates R 2 represents O or S. R 3 represents a monomer unit, and n represents an integer of 2 or more. [In general formula (2): R 4 represents a monomer unit, and n represents an integer of 2 or more. In one embodiment of the present invention, R 1 S - and R 2 is O. In another embodiment of the present invention, R 1 O - and R 2 is S.

[0050] The polymer contains a mediator dye. The mediator dye is not particularly limited as long as it is a dye that can cause BRET (Bioluminescence Resonance Energy Transfer) with a donor light-emitting element and can cause FRET (Fluorescence Resonance Energy Transfer) with an acceptor.

[0051] Mediator dyes include, for example, Alexa Fluor dyes, Bodipy dyes, Cy dyes, fluorescein, dansyl, umbelliferone, fluorescent microspheres, luminescent microspheres, fluorescent nanocrystals, Marina Blue, Cascade Blue, Cascade Yellow, Pacific Blue, Oregon Green, tetramethylrhodamine, rhodamine, Texas Red, rare earth element chelates, or any combination or derivative thereof. Further, as more detailed specific examples of the above or examples other than those described above, 618 fluorescent ligand, 7-AAD, Alexa Fluor (registered trademark) 488, Alexa Fluor (registered trademark) 350, Alexa Fluor (registered trademark) 546, Alexa Fluor (registered trademark) 555, Alexa Fluor (registered trademark) 568, Alexa Fluor (registered trademark) 594, Alexa Fluor (registered trademark) 633, Alexa Fluor (registered trademark) 647, Cy™ 2, DsRED, EGFP, EYFP, FITC, PerCP™, R-Phycoerythrin, Propidium Iodide, AMCA, DAPI, ECFP, Methylcoumarin, Allophycocyanin, Cy™ 3, Cy™ 5, SYBR (registered trademark) Green, SYTO, Rhodamine-123, Tetramethylrhodamine, Texas Instruments Incorporated (TSE10111), and the like. Red (registered trademark), PE, PE-CyTM5, PE-CyTM5.5, PE-CyTM7, APC, APC-CyTM7, Oregon Green, carboxyfluorescein, carboxyfluorescein diacetate, pyrene, HyLite, and the like.

[0052] From the viewpoint of energy transmission efficiency, the mediator dye may be one that satisfies the following: the maximum (100%) emission wavelength of the donor light-emitting element is, for example, 5% or more, preferably 10% or more, more preferably 20% or more, even more preferably 40% or more, still more preferably 60% or more, and particularly preferably 80% or more of the excitation wavelength of the mediator dye. From the same viewpoint, the mediator dye may be one that satisfies the following: the maximum (100%) emission wavelength of the donor light-emitting element is, for example, 40% or more, preferably 50% or more, more preferably 60% or more, even more preferably 70% or more, still more preferably 80% or more, and particularly preferably 90% or more of the excitation wavelength of the mediator dye.

[0053] The mediator dye may be contained as a monomer unit of the polymer, or may be a dye bound to the polymer. In the latter case, such dyes include intercalators and group binders. From the viewpoint of energy transmission efficiency, group binders are particularly preferred.

[0054] The distance between the donor light-emitting element and the mediator dye closest to the donor light-emitting element is not particularly limited as long as BRET from the donor light-emitting element to the mediator dye occurs, and may vary depending on the types of donor light-emitting element and dye used. In one embodiment, from the viewpoint of energy transmission efficiency, the distance is preferably 9 nm or less, more preferably 7.5 nm or less, even more preferably 7 nm or less, and particularly preferably 6.5 nm or less.

[0055] The polymer preferably contains a plurality of mediator dyes. This allows the luminescent energy of the donor light-emitting element to be transmitted over a longer distance and more efficiently. The number of mediator dyes contained in the polymer is, for example, 2 or more, preferably 3 or more, more preferably 4 or more, even more preferably 5 or more, still more preferably 6 or more, and even more preferably 7 or more. There is no particular upper limit, and it is, for example, 200, 150, 100, 50, 30, or 20.

[0056] When the polymer contains multiple mediator dyes, the multiple mediator dyes can be those satisfying the following: from the viewpoint of energy transfer efficiency, the maximum (100%) fluorescence wavelength of any one mediator dye is, for example, 5% or more, preferably 10% or more, more preferably 20% or more, even more preferably 40% or more, even more preferably 60% or more, and particularly preferably 80% or more of the maximum (100%) excitation wavelength of the adjacent mediator dye on the acceptor side. From the same viewpoint, the multiple mediator dyes can be those satisfying the following: from the viewpoint of energy transfer efficiency, the maximum (100%) fluorescence wavelength of any one mediator dye is, for example, 40% or more, preferably 50% or more, more preferably 60% or more, even more preferably 70% or more, even more preferably 80% or more, and particularly preferably 90% or more of the excitation wavelength of the adjacent mediator dye on the acceptor side.

[0057] When a polymer contains multiple mediator dyes, the distance between any one mediator dye and the adjacent mediator dye is not particularly limited as long as FRET between the mediator dyes occurs, and may vary depending on the type of dye used. However, in one embodiment, from the viewpoint of energy transfer efficiency, the distance is preferably 20 bases or less or a length equivalent thereto. The distance is more preferably 15 bases or less or a length equivalent thereto, even more preferably 10 bases or less or a length equivalent thereto, even more preferably 8 bases or less or a length equivalent thereto, particularly preferably 6 bases or less or a length equivalent thereto, and particularly preferably 5 bases or less or a length equivalent thereto. The "length equivalent thereto" refers to a length equivalent to the base length of DNA. The base length of DNA is known or can be easily determined from the structure of DNA. The distances shown in Figure 9 can also be referenced.

[0058] When a polymer contains multiple mediator dyes, from the viewpoint of suppressing quenching due to the Dexter mechanism and quenching due to the Förster mechanism caused by resonance energy transfer, it is preferable that any mediator dye be separated from an adjacent mediator dye by a certain distance or more (for example, by two or more monomer units, preferably three or more monomer units, or four or more monomer units) or that they be located on opposite sides of the double helix (for example, by a multiple of 4±1 (preferably 4) monomer units).

[0059] The acceptor is not particularly limited as long as it is a substance different from the mediator dye, can undergo FRET (Fluorescence Resonance Energy Transfer) with the mediator dye, and can thereby emit photons and / or electrons. Examples of the acceptor include fluorescent dyes (e.g., the dyes listed above as mediator dyes), as well as ruthenium complexes, rhodium complexes, transition metal complexes, and lanthanoid complexes.

[0060] From the viewpoint of energy transfer efficiency, the acceptor can be one in which the maximum (100%) fluorescence wavelength of the mediator dye closest to the acceptor is, for example, 5% or more, preferably 10% or more, more preferably 20% or more, even more preferably 40% or more, even more preferably 60% or more, and particularly preferably 80% or more of the excitation wavelength of the acceptor. From the same viewpoint, the multiple mediator dyes can be one in which, from the viewpoint of energy transfer efficiency, the excitation wavelength of at least one of the 70% fluorescence wavelengths of the maximum (100%) fluorescence wavelength of the mediator dye closest to the acceptor is, for example, 40% or more, preferably 50% or more, more preferably 60% or more, even more preferably 70% or more, even more preferably 80% or more, and particularly preferably 90% or more of the excitation wavelength of the acceptor.

[0061] The distance between the acceptor and the nearest mediator dye is not particularly limited as long as FRET occurs between the acceptor and the mediator, and may vary depending on the type of dye used. However, in one embodiment, from the viewpoint of energy transfer efficiency, the distance is preferably 20 bases or less or a length equivalent thereto. The distance is more preferably 15 bases or less or a length equivalent thereto, even more preferably 10 bases or less or a length equivalent thereto, even more preferably 8 bases or less or a length equivalent thereto, particularly preferably 6 bases or less or a length equivalent thereto, and particularly preferably 5 bases or less or a length equivalent thereto. The "length equivalent thereto" refers to a length equivalent to the base length in DNA. The base length in DNA is known or can be easily determined from the structure of DNA. The distances shown in Figure 9 can also be referenced.

[0062] The acceptor may be linked to the polymer directly or via a linker, the above description of which is incorporated herein by reference.

[0063] In the composite substance of the present invention, the donor light-emitting element, the mediator dye, and the acceptor are arranged so that energy transfer occurs by BRET from the donor light-emitting element to the mediator dye and by FRET from the mediator dye to the acceptor. Specific arrangements can be easily determined based on conventional techniques related to BRET and FRET. Examples or preferred examples include the arrangements described above.

[0064] The composite material of the present invention may contain multiple donor-emitting elements, multiple acceptors, and may have a branched structure. Furthermore, in the composite material of the present invention, the donor-emitting elements and / or acceptors may be located at the terminal or internal positions. The structure of the composite material of the present invention can be designed with reference to the structure described in Non-Patent Document 1, for example.

[0065] The composite substance of the present invention enables energy transfer with suppressed background light by the simple procedure of causing a photoprotein or a reconstituted product of a photoprotein fragment to emit light (contacting the reconstituted product with its counterpart fragment and / or with a substrate). Furthermore, periodic energy transfer is possible when the photoprotein or a reconstituted product of a photoprotein fragment emits light periodically. The composite substance of the present invention can be used as an energy transmission path through which energy is transmitted from a donor light-emitting element at any time, constantly, or periodically, and a signal (photons or electrons) can be emitted from an acceptor, for example, as the wiring / light source of a quantum computer, the light-harvesting antenna of an artificial photosynthesis system, or the wiring / network portion of a DNA molecular computer. [Example]

[0066] The present invention will be described in detail below based on examples, but the present invention is not limited to these examples.

[0067] Reference Example 1. Synthesis of peptide-modified DNA First, a C-terminal azido-peptide (sequence: VSGWRLFKKISX (SEQ ID NO: 1, an 11-residue peptide chain (HiBit) that constitutes NanoLuc (a photoprotein) and exhibits luminescence activity by associating with the remaining fragment (LgBit)) was chemically synthesized. In this example, a peptide (desalted grade) in which X is ornithine with an azido side chain was obtained by custom peptide synthesis.

[0068] [ka] Next, DBCO (dibenzocyclooctyne group)-modified DNA was chemically synthesized. The DNA sequence was TAAGAGGCTGGGTTTTGCTC (SEQ ID NO: 2). In a reaction using an automated DNA synthesizer using the phosphoramidite method, a DBCO group was introduced at the 5'-end using commercially available 5'-DBCO-TEG Phosphoramidite (Glen Research, USA). After treatment with a simple DNA purification column, the DNA was purified by reverse-phase HPLC, and the production of the target product was confirmed by MALDI-TOF / MS.

[0069] [ka] Next, the C-terminal azido-peptide and DBCO-modified DNA were linked via a Cu-ion-free click reaction. Specifically, 2.5 nmol of the C-terminal azido-peptide and 2.5 nmol of DBCO-modified DNA were mixed in 50 μL of 1X PBS(-), reacted at room temperature for 16 hours, and then purified by reverse-phase HPLC. The resulting product was confirmed to be the desired product by MALDI-TOF / MS.

[0070] Example 1. Optical energy transmission with a fixed number of mediators The peptide (VSGWRLFKKIS (SEQ ID NO: 3) modified DNA (5'-TAAGAGGCTGGGTTTTGCTC (SEQ ID NO: 2)-3') was synthesized according to the method of Example 1.

[0071] Complementary DNAs were synthesized by the phosphoramidite method in accordance with the method of Example 1, in which a fluorescent dye was added to the end of DNA having the base sequence 5'-GAGCAAAACCCAGCCTCTTA (SEQ ID NO: 4)-3' and / or a fluorescent dye was inserted between the nucleotides of the DNA. The synthesized complementary DNAs are as follows: X represents FAM, and Y represents Alexa Fluor 594.

[0072] 0FAM-Alexa Fluor 594: 5'-Y-GAGCAAACCCAGCCTCTTA-3' 1FAM-Alexa Fluor 594: 5'-Y-GAGCAAACCCAGCCTCTTA-X-3' 2FAM-Alexa Fluor 594: 5'-Y-GAGCAAACC X CAGCCTCTTA-X-3' 4FAM-Alexa Fluor 594: 5'-Y-GAGCA X AAACC X CAGCC X TCTTA-X-3' 4FAM: 5'-GAGCA X AAACC X CAGCC X TCTTA-X-3.

[0073] The structure of Alexa Fluor 594-NHS ester used for DNA modification is as follows:

[0074] [ka] The structure of FAM (6-Fluorescein Phosphoramidite) used for DNA modification is as follows:

[0075] [ka] Peptide-modified DNA and complementary DNA were hybridized. Specifically, 1 pmol of peptide-modified DNA was mixed with 1 pmol of complementary DNA or control DNA in 30 μL of 1X PBS(-), heated to 90°C in an aluminum bath, and then slowly cooled to room temperature. 10 μL of LgBiT Protein solution (Promega, Nano-Glo HiBiT Blotting System) was added, and the mixture was left at room temperature for 15 minutes. Then, 10 μL of a 50-fold diluted solution of Nano-Glo Luciferase Assay Substrate (furimazine) was added, and the emission spectrum was measured using a multimode plate reader (Molecular Devices, Spectramax iD5).

[0076] The results when FAM-Alexa Fluor 594 was used as the complementary DNA are shown in Figure 1. Without the incorporation of FAM, the mediator dye that transmits energy, direct energy transfer from the donor light-emitting element (photoprotein) to the acceptor (Alexa Fluor 594) did not occur.

[0077] The results when 1FAM-Alexa Fluor 594 or 2FAM-Alexa Fluor 594 was used as the complementary DNA are shown in Figure 2. When one molecule of FAM was introduced in front of the photoprotein, slight Alexa Fluor 594 fluorescence was observed, and when another molecule of FAM was added 10 bases away, which is not directly excited by the photoprotein, the Alexa Fluor 594 fluorescence became even more pronounced.

[0078] The results when 4FAM-Alexa Fluor 594 was used as the complementary DNA are shown in Figure 3. When four molecules of FAM were introduced every five bases, the fluorescence intensity of Alexa Fluor 594 exceeded that of NanoLuc, demonstrating that energy transfer was occurring more efficiently.

[0079] Figure 4 shows a comparison of the results when 0FAM-Alexa Fluor 594, 4FAM, or 4FAM-Alexa Fluor 594 was used as the complementary DNA. In a system without Alexa Fluor 594, when four FAM molecules were present in the complementary strand, the emission of NanoLuc was quenched by 85.0% (= energy transfer efficiency of 85%). When Alexa Fluor 594 was introduced, the FAM fluorescence was quenched by 66.6%. In other words, the energy transfer efficiency from NanoLuc to Alexa Fluor 594 was 0.85 × 0.67 × 100 = 57%.

[0080] Example 2. Light energy transfer by DNA-binding fluorescent dyes The peptide-modified DNA used was the same as in Example 1, and the complementary DNA used was either 0FAM-Alexa Fluor 594 of Example 1 or a complementary DNA without Alexa Fluor 594 (SEQ ID NO: 4).

[0081] Peptide-modified DNA and complementary DNA were hybridized. Specifically, 1 pmol of peptide-modified DNA was mixed with 1 pmol of complementary DNA or control DNA in 30 μL of 1X PBS(-), heated to 90°C in an aluminum bath, and then slowly cooled to room temperature. 10 μL of LgBiT Protein solution (Promega, Nano-Glo HiBiT Blotting System) was added, and the mixture was left at room temperature for 15 minutes. Then, 0.3 μL of DNA-binding fluorescent dye (SYBR Green I or SYTO9) (final concentration: 50 μM) was added, and the mixture was left at room temperature for 2 hours. Finally, 9.7 μL of a 50-fold diluted solution of Nano-Glo Luciferase Assay Substrate (furimazine) was added, and the emission spectrum was measured using a multimode plate reader (Molecular Devices, Spectramax iD5).

[0082] Figure 5 shows the results when SYBR Green I was used as the DNA-binding fluorescent dye. Compared to a system in which the fluorescent dye was added to free luminescent protein (control SG), when the fluorescent dye was added to luminescent protein reconstituted at the end of a DNA double helix (Nluc-SG), the luminescence of NanoLuc was quenched by 85.1% (=energy transfer efficiency to SYBR Green I). Furthermore, when the acceptor Alexa Fluor 594 was introduced, significant acceptor fluorescence was observed. Although accurate calculation of the energy transfer efficiency was not possible due to changes in the luminescence / fluorescence intensity, the ratio of the luminescence intensity of the acceptor fluorescence to that of the donor (luminescent protein) was 4.56.

[0083] Figure 6 shows the results when SYTO9 was used as a DNA-binding fluorescent dye. When SYTO9, a known groove binder, was used as a mediator, 93.4% of the energy was transferred from NanoLuc reconstituted at the DNA end to SYTO9. When the acceptor Alexa Fluor 594 was introduced, the acceptor fluorescence reached 13.6 times the donor fluorescence.

[0084] Example 3. Measurement of BRET coverage The peptide-modified DNA used was the same as in Example 1.

[0085] Complementary DNAs with or without a fluorescent dye inserted between nucleotides of DNA having the base sequence 5'-GAGCAAAACCCAGCCTCTTA (SEQ ID NO: 4)-3' were synthesized by the phosphoramidite method in accordance with the method of Example 1. The synthesized complementary DNAs are as follows. X represents FAM.

[0086] Int1: 5'-GAGCAAAACCCAGCCTCTTXA-3' (distance between furimazine and FAM: 6.52 nm) Int2: 5'-GAGCAAAACCCAGCCTCTXTA-3' (6.87 nm) Int3: 5'-GAGCAAACCCAGCCTCXTTA-3' (7.14 nm) Int5: 5'-GAGCAAACCCAGCCXTCTTA-3' (7.70 nm) Int6: 5'-GAGCAAAACCCAGCXCTCTTA-3' (7.91 nm) Int9: 5'-GAGCAAAACCCXAGCCTCTTA-3' (9.34 nm) Int10: 5'-GAGCAAAACCXCAGCCTCTTA-3' (9.61 nm) Int0: 5'-GAGCAAAACCCAGCCTCTTA-3' (control DNA without FAM) 3'-end: 5'-GAGCAAAACCCAGCCTCTTAX-3' (Patent application 2021-132865, 6.59 nm) Peptide-modified DNA was hybridized with complementary DNA. Specifically, 1 pmol of peptide-modified DNA was mixed with 1 pmol of complementary DNA or control DNA in 30 μL of 1X PBS(-), heated to 90°C in an aluminum bath, and then slowly cooled to room temperature. 10 μL of LgBiT Protein solution (Promega, Nano-Glo HiBiT Blotting System) was added and left at room temperature for 15 minutes. Then, 10 μL of a 50x diluted solution of Nano-Glo Luciferase Assay Substrate (furimazine) was added, and the emission spectrum was measured using a multimode plate reader (Molecular Devices Spectramax iD5). Energy transfer efficiency was calculated as the emission at 450 nm for the system with FAM (Int1-10) divided by the emission at 450 nm for the system without FAM (Int0). The 3'-end value was based on the data presented in Japanese Patent Application No. 2021-132865.

[0087] The results are shown in Figures 7 to 9. When a photoprotein was used as the excitation source, the distance dependence of energy transfer efficiency became more pronounced, and no energy transfer occurred at a distance of 10 bases. Considering the distance from furimazine to FAM, a substrate within NanoLuc, measured using a three-dimensional molecular model, the distance at which energy transfer efficiency reaches 50% is approximately 7.3 nm, and it is estimated that this distance becomes nearly zero at distances exceeding 9.5 nm.

[0088] On the other hand, when a similar test was performed using modified DNA in which the peptide portion was replaced with Alexa 350 instead of the peptide-modified DNA (irradiation with Alexa 350 excitation light instead of the addition of LgBiT and furimazine), the energy transfer efficiency was approximately 30% even with Int10.

[0089] From the above, it was found that energy transmission with low background is possible by using a photoprotein as an excitation source.

Claims

1. The present invention comprises a donor light-emitting element comprising a luminescent protein or a fragment thereof, a polymer containing a mediator dye, and an acceptor, the donor light-emitting element and the acceptor are linked to the polymer; and A composite material, wherein a donor light-emitting element, a mediator dye, and an acceptor are arranged such that energy transfer occurs by BRET from the donor light-emitting element to the mediator dye, and from the mediator dye to the acceptor.

2. The composite material of claim 1 , wherein the donor luminescent element is a split fragment of a photoprotein.

3. The composite material of claim 1 , wherein the donor luminescent element is a split fragment of a substrate-dependent photoprotein.

4. The composite material of claim 1 , wherein the donor light-emitting element is linked to the polymer via a linker.

5. 2. The composite material of claim 1, wherein the distance between the donor light-emitting element and the nearest mediator dye is 9 nm or less.

6. The composite material of claim 1 , wherein the polymer is a polynucleotide.

7. 2. The composite substance according to claim 1, comprising a plurality of said mediator dyes, wherein the distance between any one of said mediator dyes and an adjacent mediator dye is 20 base lengths or less or a length equivalent thereto.

8. 2. The composite substance according to claim 1, comprising a plurality of said mediator dyes, wherein the distance between any one of said mediator dyes and an adjacent mediator dye is 10 base lengths or less or a length equivalent thereto.

9. 2. The conjugated substance of claim 1, wherein the distance between the acceptor and the nearest mediator dye is less than or equal to 20 base lengths.

10. An energy transmission path comprising the composite material according to any one of claims 1 to 9.

Images