Systems and methods for modulating RNA

Abstract

To provide a RNA-targeting system (CIRTS) for manipulating programmable RNA effector proteins to overcome the large size and microbial-derived nature of current RNA-targeting systems.SOLUTION: The present invention provides a RNA regulatory system comprising at least one of each: (i) a RNA hairpin binding domain; (ii) a RNA targeting molecule comprising a RNA targeting region and at least one hairpin structure, wherein the hairpin structure of the RNA targeting molecule specifically binds to (i); and (iii) a RNA regulatory domain.SELECTED DRAWING: None

Description

Technical Field

[0001] Cross - Reference to Related Applications This application claims the benefit of priority of U.S. Provisional Patent Application No. 62 / 788,571, filed on January 4, 2019; U.S. Provisional Patent Application No. 62 / 831,342, filed on April 9, 2019; U.S. Provisional Patent Application No. 62 / 903,080, filed on September 20, 2019; and U.S. Provisional Patent Application No. 62 / 929,339, filed on November 1, 2019, all of which are hereby incorporated by reference in their entirety.

[0002] Statement of Government Support This invention was made with government support under grants GM119840 and HG008935 awarded by the National Institutes of Health. The government has certain rights in this invention.

[0003] 1. Field of the Invention The present invention generally relates to the fields of chemistry and medicine. More particularly, the present invention relates to the use of systems for modulating RNA.

Background Art

[0004] 2. Description of the Related Art Programmable nucleic acid-binding proteins have revolutionized genomics research and editing technologies (Chandrasegaran and Carroll, 2016; Filipovska et al., 2011; Gootenberg et al., 2018; Hilton et al., 2015; Joung and Sander, 2012; Kearns et al., 2015; Strutt et al., 2018) and expanded new therapeutic opportunities for treating human diseases (Liao et al., 2017; Monteys et al., 2017). In particular, the CRISPR / Cas9 system, which evolved as a bacterial immune defense mechanism, has transformed the ability to site-specifically study and manipulate intracellular DNA (Cong et al., 2013; Jiang et al., 2013; O'Connell et al., 2014; Wiedenheft et al., 2012). An important advantage of the CRISPR / Cas system compared to conventional methods (Desjarlais and Berg, 1993; Hockemeyer et al., 2011; Joung and Sander, 2012; Schierling et al., 2012) is that these systems are easily programmable to target almost any locus of interest. The CRISPR / Cas system is a ribonucleoprotein complex that uses base-pair interactions of the displayed guide RNA (gRNA) to interact with the target nucleic acid sequence. The simplicity of this base-pair-guided targeting expands the possibility of programming the system to interact with a defined nucleic acid sequence simply by changing the nucleic acid sequence on the guide strand.

[0005] Directly targeting DNA would have profound clinical ramifications, but diseases involving subtle mutations in many genes would be difficult to target using DNA editing technologies (Fuxman Bass et al., 2015). Additionally, the risk of potential side effects or permanent genetic mutations would not be tolerable. For example, genes that can be targeted to activate a heightened wound healing response are likely to be targets with a risk of cancer development, making permanent DNA-based strategies risky. Targeting the flow of information at the RNA level offers several opportunities for therapeutic intervention, including, but not limited to, the ability to discontinue treatment if side effects occur, target genes that are too risky to mutate at the DNA level, and manipulate gene expression without permanent mutations in the host genome. Inhibiting or enhancing transcription at the genomic level provides one possibility for controlling gene expression (Du et al., 2017; Fuxman Bass et al., 2015; Qi et al., 2013). On the other hand, recently discovered RNA epitranscriptome regulatory mechanisms provide a wide range of RNA regulatory processes for targeting, including editing, degradation, transport, and translation of RNA transcripts (Nishikura, 2010; Roundtree et al., 2017; Zhao et al., 2017). Although the mechanisms and significance of this epitranscriptome regulatory layer have only recently been elucidated, it is clear that RNA-mediated information flow is tightly regulated and offers many new opportunities for both basic research discoveries and therapeutic development.

[0006] Programmable RNA targeting tools similar to the dCas9 DNA targeting system are quite promising for the study of the mechanisms of epitranscriptome regulation and therapeutic applications. Current tools for RNA targeting involve the delivery of large complexes and raise issues of immunogenicity. From a basic science perspective, the large size of the delivery vehicle can potentially disrupt the RNA under investigation, complicating the study of RNA regulatory mechanisms. From a translational perspective, this large size presents challenges for viral packaging or direct protein delivery. Additionally, while DNA editing therapies are likely to consist of a one-time irreversible treatment, RNA targeting therapies need to be administered continuously, making the delivery problem particularly important. Furthermore, recently, it has been discovered that 85% of people already have circulating antibodies against CRISPR / Cas proteins (Kim et al., 2018; Wagner et al., 2018), suggesting that the issue of immunogenicity can be a problem in clinical applications. Therefore, in this technical field, there is a need for an improved system that can target RNA and be efficiently delivered without activating an immune response.

Summary of the Invention

[0007] To overcome the large size and microbe-derived nature of current RNA targeting systems, the inventors present a CRISPR / Cas-inspired RNA targeting system (CIRTS), a general method for engineering programmable RNA effector proteins. Similar to CRISPR / Cas-based systems, CIRTS is a ribonucleoprotein complex that uses Watson-Crick-Franklin base pair interactions to site-specifically deliver protein cargo to the transcriptome. The inventors show that CIRTS can be readily engineered to deliver a wide range of regulatory proteins to transcripts, including nucleases for degradation, deadenylation regulatory machinery for degradation, or translational activation machinery for enhanced protein production. On the other hand, CIRTS is up to five times smaller than the smallest current CRISPR / Cas systems and can be fully engineered from human parts.

[0008] Aspects of the disclosure relate to an RNA regulatory system or method that includes at least one of: (i) an RNA hairpin binding domain; (ii) an RNA targeting molecule that includes an RNA targeting region and at least one hairpin structure, wherein the hairpin structure specifically binds to (i); and (iii) an RNA regulatory domain. In some embodiments, any combination of (i) and (ii), (i) and (iii), (ii) and (iii), or (i), (ii), and (iii) are included. Any aspect disclosed herein can contain any of these combinations.

[0009] A further aspect relates to a vector system that includes: (i) an RNA hairpin binding domain; (ii) an RNA targeting molecule that includes an RNA targeting region and at least one hairpin structure, wherein the hairpin structure specifically binds to (i); and (iii) one or more nucleic acid vectors that include nucleotides encoding an RNA regulatory domain.

[0010] A further aspect relates to fusion proteins comprising an RNA hairpin binding protein and an RNA regulatory domain, and nucleic acids encoding such fusion proteins.

[0011] A further aspect relates to a conjugate comprising an RNA regulatory domain functionally linked to an RNA targeting molecule, wherein the RNA targeting molecule comprises an RNA targeting region and at least one hairpin structure. In some embodiments, the RNA regulatory domain and the RNA targeting molecule are functionally linked through a peptide bond. In some embodiments, the polypeptide further comprises one or more linkers. In some embodiments, the RNA regulatory domain and the RNA targeting molecule are functionally linked through non-covalent interactions. In some embodiments, the RNA regulatory domain is covalently linked to a first dimerization domain and the RNA targeting molecule is covalently linked to a second dimerization domain, wherein the first and second dimerization domains are capable of dimerizing to form a linkage by non-covalent or covalent bonds. In some embodiments, the conjugate comprises one or more nuclear localization signals (NLS).

[0012] Yet a further aspect relates to a delivery vehicle comprising the system of the present disclosure. In some embodiments, the delivery vehicle comprises liposome(s), particle(s), exosome(s), microvesicle(s), gene gun or one or more nucleic acid vectors.

[0013] A further aspect relates to a composition or cell comprising the system, delivery vehicle or fusion protein of the present disclosure.

[0014] A further aspect relates to a method of modulating at least one target RNA, the method comprising contacting the target RNA with the disclosed system, composition, or fusion protein. In some embodiments, modulating at least one target RNA includes cleavage, demethylation, methylation, activation of translation, suppression of translation, promotion of degradation, or binding to RNA. In some embodiments, at least two target RNAs are modulated. In some embodiments, at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, or 25 (or any derivable range therein) target RNAs are modulated. In some embodiments, multiple RNAs are modulated by the same RNA regulatory domain or by regulatory domains having the same activity. In some embodiments, different target RNAs are modulated with different activities, such as by cleavage, demethylation, methylation, activation of translation, suppression of translation, promotion of degradation, or binding to RNA.

[0015] In some embodiments, the RNA regulatory domain does not bind to RNA. In some embodiments, the RNA regulatory domain comprises a polypeptide that does not have RNA binding activity. In some embodiments, the RNA regulatory domain does not bind to modified RNA. In some embodiments, the RNA regulatory domain does not bind to m6A-modified RNA.

[0016] A further aspect relates to a cell or progeny thereof comprising a modulated target RNA, wherein the target RNA has been modulated according to the disclosed method. A further aspect relates to a multicellular organism comprising one or more cells of the present disclosure. A further aspect relates to a plant or animal comprising one or more cells of the present disclosure. A further aspect relates to a kit comprising the disclosed system, vector, delivery vehicle, or fusion protein.

[0017] A further aspect relates to a method for modulating a target RNA in a subject, the method comprising administering to the subject the disclosed system or composition.

[0018] The term "RNA hairpin" refers to an RNA molecule having intrastrand base pairing within a stem-loop molecule. A hairpin can occur when two regions of the same strand (usually with nucleotide sequences that are complementary when read in opposite directions) base pair to form a double helix that ends in an unpaired loop. The present disclosure relates to engineered RNA targeting molecules that include an RNA targeting region and one or more hairpins. Thus, the engineered RNA molecules of the present disclosure are non-naturally occurring chimeric molecules.

[0019] The term "RNA targeting region" refers to a region of RNA that is capable of hybridizing to a target RNA. The target RNA can be a disease-related RNA or an RNA that is a modulation target by current systems and methods.

[0020] "RNA regulatory domain" refers to a peptide or polypeptide having activity directed to an RNA. Examples of activity include methylation activity, RNA binding activity, nuclease activity, translational activation or repression activity. Further examples of activities and proteins that include an RNA regulatory domain are described throughout the present disclosure.

[0021] In some embodiments, the RNA hairpin binding domain and the RNA regulatory domain are functionally linked. The term "functionally linked" refers to two proteins that are linked through either a covalent or non-covalent interaction. For example, two proteins can be covalently linked by a peptide bond. In some embodiments, the proteins are non-covalently linked. One or more proteins of the present disclosure can be functionally linked to another protein through linkage to a pair of accessory proteins that have a strong affinity for each other. Such accessory proteins are known in the art. For example, SunTag is one such system that includes an antibody that has a strong affinity for a peptide. To enable functional linkage of two proteins, polypeptides or domains through the interaction of the SunTag peptide and the antibody, one protein, polypeptide or domain of the present disclosure can be linked to the SunTag peptide and another protein, polypeptide or domain of the present disclosure can be linked to the antibody. Further examples include biotin and avidin / streptavidin and spytag and spycatcher.

[0022] In some embodiments, the system is inducible by providing the RNA regulatory domain and the hairpin binding domain as two unlinked polypeptides that become linked in the presence of a stimulant. The induction can be, for example, by photoinduction or by chemical induction. Such inducibility enables activation of RNA regulation at a desired time point. In some embodiments, the RNA regulatory domain is covalently linked to a first dimerization domain and the RNA hairpin binding domain is covalently linked to a second dimerization domain, wherein the first and second dimerization domains can dimerize to form a non-covalent or covalent linkage. In some embodiments, the dimerization is inducible. In some aspects, the dimerization is induced by binding of a ligand to the dimerization domain. The term inducible refers to dimerization that is formed in response to a stimulus such as, for example, a ligand, chemical, temperature change or light.

[0023] Optogenetic capabilities can be achieved, for example, by designing a fusion complex in which the first and second dimerization domains comprise CRY2PHR and CIBN. This system is particularly useful for the optogenetic induction of protein interactions in living cells and is further described in Konermann S, et al. Nature. 2013;500:472-476 (incorporated herein by reference).

[0024] Suitable dimerization domains and corresponding ligands are known in the art. For example, Liang, F.S., Ho, W.Q., and Crabtree, G.R. (2011). Engineering the ABA plant stress pathway for regulation of induced proximity. Sci. Signal. 4, rs2 (incorporated by reference) describes a suitable dimerization / ligand system that is useful in aspects of the present disclosure. In some aspects, one of the first or second dimerization domains comprises PYR / PYR1-like (PYL1), the other of the first or second domains comprises ABA-insensitive 1 (ABI1), and the ligand comprises abscisic acid (ABA) or a derivative or fragment thereof. The dimerization domain can be a fragment or portion of a full protein and can be a variant or modification. In some aspects, the first and / or second dimerization domains comprise FKBP12 and the ligand comprises FK1012 or a derivative or fragment thereof. In some aspects, one of the first or second dimerization domains comprises FK506-binding protein (FKBP), the other of the first or second domains comprises the FKBP-Rap binding domain (Frb) of mammalian Rap target mTOR, and the ligand comprises rapamycin (Rap) or a derivative or fragment thereof.

[0025] Derivatives refer to modified ligands and domains that each retain their binding to the dimerization domain or ligand or have enhanced binding. Fragments refer to contiguous portions of the dimerization domain that retain binding to the ligand. In some embodiments, the dimerization domain can be a modified fragment.

[0026] In some embodiments, i, ii, and / or iii are human or of human origin. In some embodiments, the system, conjugate, and / or fusion protein are non-immunogenic. A human protein, polypeptide, domain, or nucleic acid refers to a protein, polypeptide, domain, or nucleic acid from the human genome, but may be recombinantly produced in a non-human system. The term "human-derived" refers to a protein, polypeptide, domain, or nucleic acid that is a variant or fragment of a protein, polypeptide, domain, or nucleic acid from the human genome, but may be recombinantly produced in a non-human system. In some embodiments, the fusion protein, conjugate, system, or parts thereof, such as parts i, ii, and / or iii, are non-immunogenic and / or non-toxic when expressed in or administered to a human.

[0027] In some embodiments, the nucleic acids or polypeptides of the present disclosure are synthetic, non-natural, and / or not naturally occurring.

[0028] In some embodiments, the system further comprises a stabilizer polypeptide; wherein the stabilizer polypeptide comprises a cationic polypeptide that binds non-specifically to nucleic acids. In some embodiments, the stabilizer polypeptide is of human origin. In some embodiments, the stabilizer polypeptide is operably linked to an RNA regulatory domain and / or an RNA hairpin binding domain. In some embodiments, the stabilizer polypeptide comprises ORF5 or a fragment thereof. In some embodiments, the stabilizer polypeptide comprises SEQ ID NO:5, a variant thereof, or a polypeptide having at least 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 75, 76, 77, 78, 79, 80, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% (or any derivable range therein) identity or homology to SEQ ID NO:5. In some embodiments, the stabilizer polypeptide comprises HEBGF or a fragment thereof. In some embodiments, the stabilizer polypeptide comprises SEQ ID NO:19, a variant thereof, or a polypeptide having at least 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 75, 76, 77, 78, 79, 80, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% (or any derivable range therein) identity or homology to SEQ ID NO:19. In some embodiments, the stabilizer polypeptide comprises β-defensin 3 or a fragment thereof. In some embodiments, the stabilizer polypeptide comprises SEQ ID NO:20, a variant thereof, or a polypeptide having at least 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 75, 76, 77, 78, 79, 80, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% (or any derivable range therein) identity or homology to SEQ ID NO:20.

[0029] In some embodiments, the stabilizer polypeptide, conjugate, fusion protein, conjugate, RNA regulatory domain, and / or RNA hairpin binding domain is smaller than 175, 170, 165, 160, 155, 150, 145, 140, 135, 130, 125, 120, 115, 110, 105, 100, 95, 90, 85, 80, 75, 70, 65, 60, 55, 50, 45, 40, 35, 30, 25, 20, 15, 10, or 5 kDa (or any derivable range therein), greater than 175, 170, 165, 160, 155, 150, 145, 140, 135, 130, 125, 120, 115, 110, 105, 100, 95, 90, 85, 80, 75, 70, 65, 60, 55, 50, 45, 40, 35, 30, 25, 20, 15, 10, or 5 kDa (or any derivable range therein), or at most 175, 170, 165, 160, 155, 150, 145, 140, 135, 130, 125, 120, 115, 110, 105, 100, 95, 90, 85, 80, 75, 70, 65, 60, 55, 50, 45, 40, 35, 30, 25, 20, 15, 10, or 5 kDa (or any derivable range therein) or at least 175, 170, 165, 160, 155, 150, 145, 140, 135, 130, 125, 120, 115, 110, 105, 100, 95, 90, 85, 80, 75, 70, 65, 60, 55, 50, 45, 40, 35, 30, 25, 20, 15, 10, or 5 kDa (or any derivable range therein).In some embodiments, the entire complex comprising the RNA regulatory domain and the hairpin binding domain is less than 175, 170, 165, 160, 155, 150, 145, 140, 135, 130, 125, 120, 115, 110, 105, 100, 95, 90, 85, 80, 75, 70, 65, 60, 55, 50, 45, 40, 35, 30, 25, 20, 15, 10, or 5 kDa (or any derivable range therein), greater than 175, 170, 165, 160, 155, 150, 145, 140, 135, 130, 125, 120, 115, 110, 105, 100, 95, 90, 85, 80, 75, 70, 65, 60, 55, 50, 45, 40, 35, 30, 25, 20, 15, 10, or 5 kDa (or any derivable range therein), or at most 175, 170, 165, 160, 155, 150, 145, 140, 135, 130, 125, 120, 115, 110, 105, 100, 95, 90, 85, 80, 75, 70, 65, 60, 55, 50, 45, 40, 35, 30, 25, 20, 15, 10, or 5 kDa (or any derivable range therein) or at least 175, 170, 165, 160, 155, 150, 145, 140, 135, 130, 125, 120, 115, 110, 105, 100, 95, 90, 85, 80, 75, 70, 65, 60, 55, 50, 45, 40, 35, 30, 25, 20, 15, 10, or 5 kDa (or any derivable range therein).In some embodiments, the entire complex comprising a stabilizer polypeptide, an RNA regulatory domain, and a hairpin binding domain is less than 175, 170, 165, 160, 155, 150, 145, 140, 135, 130, 125, 120, 115, 110, 105, 100, 95, 90, 85, 80, 75, 70, 65, 60, 55, 50, 45, 40, 35, 30, 25, 20, 15, 10, or 5 kDa (or any derivable range therein), greater than 175, 170, 165, 160, 155, 150, 145, 140, 135, 130, 125, 120, 115, 110, 105, 100, 95, 90, 85, 80, 75, 70, 65, 60, 55, 50, 45, 40, 35, 30, 25, 20, 15, 10, or 5 kDa (or any derivable range therein), or at most 175, 170, 165, 160, 155, 150, 145, 140, 135, 130, 125, 120, 115, 110, 105, 100, 95, 90, 85, 80, 75, 70, 65, 60, 55, 50, 45, 40, 35, 30, 25, 20, 15, 10, or 5 kDa (or any derivable range therein) or at least 175, 170, 165, 160, 155, 150, 145, 140, 135, 130, 125, 120, 115, 110, 105, 100, 95, 90, 85, 80, 75, 70, 65, 60, 55, 50, 45, 40, 35, 30, 25, 20, 15, 10, or 5 kDa (or any derivable range therein).

[0030] In some embodiments, the RNA hairpin binding domain comprises an RNA hairpin binding domain derived from U1A (TBP6.7), SLBP, or a variant thereof. In some embodiments, the RNA hairpin binding domain comprises an RNA hairpin binding domain derived from U1A (TBP6.7), SLBP, Ku70, nucleolin, or a variant thereof. In some embodiments, the RNA hairpin binding domain comprises a polypeptide having at least 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 75, 76, 77, 78, 79, 80, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% (or any derivable range therein) identity or homology to SEQ ID NO:7 or 18, a variant thereof, or SEQ ID NO:7 or 18.

[0031] In some embodiments, the RNA targeting molecule comprises a TAR hairpin scaffold. In some embodiments, the RNA targeting molecule comprises a TAR hairpin scaffold of nucleotides having at least 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 75, 76, 77, 78, 79, 80, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% (or any derivable range therein) identity to SEQ ID NO:1 or SEQ ID NO:1. In some embodiments, the RNA targeting molecule comprises an SLBP hairpin scaffold. In some embodiments, the RNA targeting molecule comprises an SLBP hairpin scaffold of nucleotides having at least 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 75, 76, 77, 78, 79, 80, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% (or any derivable range therein) identity to SEQ ID NO:2 or SEQ ID NO:2.

[0032] In some embodiments, the RNA targeting molecule comprises exactly one hairpin. In some embodiments, the RNA targeting molecule comprises at least one hairpin. In some embodiments, the RNA targeting molecule comprises exactly two hairpins. In some embodiments, the RNA targeting molecule comprises at least two hairpins. In some embodiments, the RNA targeting molecule comprises exactly three hairpins. In some embodiments, the RNA targeting molecule comprises at least three hairpins. In some embodiments, the RNA targeting molecule comprises exactly four hairpins. In some embodiments, the RNA targeting molecule comprises at least four hairpins. In some embodiments, the RNA targeting molecule comprises exactly five hairpins. In some embodiments, the RNA targeting molecule comprises at least five hairpins. In some embodiments, the RNA targeting molecule comprises from 1 to 4 hairpins. In some embodiments, the RNA targeting molecule comprises from 1 to 3 hairpins. In some embodiments, the RNA targeting molecule comprises from 1 to 2 hairpins. In some embodiments, the RNA targeting molecule comprises from 2 to 4 hairpins. In some embodiments, the RNA targeting molecule comprises from 2 to 3 hairpins. In some embodiments, the RNA targeting molecule comprises at least 1, 2, 3, 4, 5, or 6 hairpins (or any derivable range therein), at most 1, 2, 3, 4, 5, or 6 hairpins (or any derivable range therein), or exactly 1, 2, 3, 4, 5, or 6 hairpins (or any derivable range therein). In some embodiments, the RNA targeting molecule comprises at least one hairpin that does not bind to an RNA hairpin binding protein and at least one hairpin that binds to an RNA hairpin binding protein. In some embodiments, the RNA targeting molecule binds to more than one RNA binding protein. In some embodiments, the RNA targeting molecule comprises 2, 3, or 4 hairpin structures and binds to at least two RNA binding proteins. In some embodiments, the RNA regulatory system comprises at least two regulatory domains, where each regulatory domain binds to a different RNA binding molecule.

[0033] In some embodiments, the RNA targeting molecule comprises one or more modified nucleotides. In some embodiments, the modified nucleotide comprises a modification such as phosphorothioate, locked nucleotide, ethylene-bridged nucleotide, peptide nucleic acid, 5'E-VP, etc., or is modified to morpholino. In some embodiments, the modification comprises those described herein.

[0034] In some embodiments, the RNA hairpin binding domain comprises the RNA hairpin binding domain of U1A, its variants, or a polypeptide having at least 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 75, 76, 77, 78, 79, 80, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% (or any derivable range therein) identity or homology to SEQ ID NO:7, and the RNA targeting molecule comprises a TAR hairpin scaffold, or nucleotides having at least 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 75, 76, 77, 78, 79, 80, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% (or any derivable range therein) identity to SEQ ID NO:1.

[0035] In some embodiments, the RNA hairpin binding domain comprises the RNA hairpin binding domain of SLBP, its variant, or a polypeptide having at least 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 75, 76, 77, 78, 79, 80, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% (or any derivable range therein) identity or homology to SEQ ID NO:18, and the RNA targeting molecule comprises the SLBP hairpin scaffold, or nucleotides having at least 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 75, 76, 77, 78, 79, 80, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% (or any derivable range therein) identity to SEQ ID NO:2.

[0036] In some embodiments, the RNA hairpin binding domain comprises the RNA hairpin binding domain of ku70 or its variant, and the RNA targeting molecule comprises a hairpin scaffold, or nucleotides having at least 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 75, 76, 77, 78, 79, 80, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% (or any derivable range therein) identity to SEQ ID NO:83.

[0037] In some embodiments, the RNA hairpin binding domain comprises the RNA hairpin binding domain of nucleolin or its variant, and the RNA targeting molecule comprises a hairpin scaffold, or nucleotides having at least 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 75, 76, 77, 78, 79, 80, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% (or any derivable range therein) identity to one of SEQ ID NOs:84 - 86.

[0038] In some embodiments, the RNA hairpin binding domain, the stabilizer polypeptide, or the RNA hairpin binding domain includes a linker. In some embodiments, the linker includes a polypeptide comprising SEQ ID NO: 6, 21, 22, 23, or 25, or a polypeptide having at least 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 75, 76, 77, 78, 79, 80, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% (or any derivable range therein) identity or homology to SEQ ID NO: 6, 21, 22, 23, or 25. In some embodiments, the linker is a rigid linker. In some embodiments, the linker is a flexible linker. In some embodiments, the linker includes glycine and serine residues. In some embodiments, the linker is at least 4 amino acids. In some embodiments, the linker is at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43 44, 45, 46, 47, 48, 49, or 50 amino acids (or any derivable range therein), or at most 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43 44, 45, 46, 47, 48, 49, or 50 amino acids (or any derivable range therein), or exactly 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43 44, 45, 46, 47, 48, 49, or 50 amino acids (or any derivable range therein).

[0039] In some embodiments, the stabilizer polypeptide comprises a polypeptide such as an RNA-binding polypeptide from cJun, HBEGF, HRX, NDEK, NHGF, beta-defensin 3, or scGFP. In some embodiments, the RNA regulatory domain is operably linked to the stabilizer polypeptide at the carboxy terminus of the RNA regulatory domain. In some embodiments, the RNA regulatory domain is operably linked to the stabilizer polypeptide at the amino terminus of the RNA regulatory domain. In some embodiments, the RNA regulatory domain is operably linked to the RNA hairpin binding domain polypeptide at the carboxy terminus of the RNA regulatory domain. In some embodiments, the RNA regulatory domain is operably linked to the RNA hairpin binding domain polypeptide at the amino terminus of the RNA regulatory domain. In some embodiments, the RNA hairpin binding domain polypeptide is operably linked to the stabilizer polypeptide at the carboxy terminus of the RNA hairpin binding domain polypeptide. In some embodiments, the RNA hairpin binding domain polypeptide is operably linked to the stabilizer polypeptide at the amino terminus of the RNA hairpin binding domain polypeptide.

[0040] In some embodiments, the RNA targeting region comprises at least 12 nucleotides. In some embodiments, the RNA targeting region comprises at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, or 79 nucleotides (or any derivable range therein), at most 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, or 79 nucleotides (or any derivable range therein), or exactly 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, or 79 nucleotides (or any derivable range therein).

[0041] In some embodiments, the RNA regulatory domain comprises a nuclease, a methylase, a demethylase, a translation activator, a translation repressor, a single-stranded RNA cleavage activity, a double-stranded RNA cleavage activity, or an RNA binding activity. In some embodiments, the RNA regulatory domain comprises the activities described herein.

[0042] In some embodiments, the RNA regulatory domain comprises a Pin nuclease domain or an m6A reader protein or a portion thereof. In some embodiments, the RNA regulatory domain comprises a domain or polypeptide from SMG6, YTHDF1, or YTHDF2. In some embodiments, the RNA regulatory domain comprises a domain or polypeptide from an ADAR protein. In some embodiments, the RNA regulatory domain comprises a domain or polypeptide from a human ADAR protein. In some embodiments, the RNA regulatory domain comprises a polypeptide having at least 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 75, 76, 77, 78, 79, 80, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% (or any derivable range therein), at most 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 75, 76, 77, 78, 79, 80, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% (or any derivable range therein), or exactly 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 75, 76, 77, 78, 79, 80, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% (or any derivable range therein) identity or homology to SEQ ID NO:9, 11, 15, 16, 17, or 123 - 125. In some embodiments, the RNA regulatory domain further comprises a helical region.In some embodiments, the helical region comprises a polypeptide having at least 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 75, 76, 77, 78, 79, 80, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% (or any derivable range therein) identity or homology to SEQ ID NO:24, at most 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 75, 76, 77, 78, 79, 80, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% (or any derivable range therein) identity or homology, or exactly 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 75, 76, 77, 78, 79, 80, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% (or any derivable range therein) identity or homology.

[0043] In some embodiments, the RNA regulatory domain increases the translation of the target RNA. In some embodiments, the RNA regulatory domain increases the degradation of the target RNA. In some embodiments, the RNA regulatory domain modifies the localization of the target RNA. In some embodiments, the RNA regulatory domain modifies the processing of the target RNA.

[0044] In some embodiments, the RNA regulatory domain comprises a polypeptide having RNA regulatory activity derived from a polypeptide such as IFIT2, eIF4a, eIF4e, PABP, PAIP, SLBP, BOLL, ICP27, YTHDF1, YTHDF2, or YTHDF3. In some embodiments, the RNA regulatory domain comprises a polypeptide having RNA regulatory activity derived from a polypeptide such as YTHDF2, TOB2, ZFP36, CNOT7, ribonuclease A, ribonuclease L, ribonuclease P, ribonuclease 4, ribonuclease 1, ribonuclease U2, or HRSP12. In some embodiments, the RNA regulatory domain increases the expression of a polypeptide encoded by a target RNA, wherein the RNA regulatory domain comprises IFIT2, eIF4a, eIF4e, PABP, PAIP, SLBP, BOLL, ICP27, YTHDF1, or YTHDF3. In some embodiments, the RNA regulatory domain comprises a polypeptide having RNA regulatory activity derived from a polypeptide such as YTHDF2, TOB2, ZFP36, CNOT7, ribonuclease A, ribonuclease L, ribonuclease P, ribonuclease 4, ribonuclease 1, ribonuclease U2, or HRSP12. In some embodiments, the RNA regulatory domain decreases the expression of a polypeptide encoded by a target RNA, wherein the RNA regulatory domain comprises YTHDF2, TOB2, ZFP36, CNOT7, ribonuclease A, ribonuclease L, ribonuclease P, ribonuclease 4, ribonuclease 1, ribonuclease U2, or HRSP12.

[0045] In some embodiments, one or more nuclear export signals (NESs) are fused to an RNA regulatory domain, an RNA hairpin binding domain, and / or a stabilizing polypeptide. In some embodiments, the NES is at the carboxy terminus of the RNA regulatory domain, the RNA hairpin binding domain, and / or the stabilizing polypeptide. In some embodiments, the NES is at the amino terminus of the RNA regulatory domain, the RNA hairpin binding domain, and / or the stabilizing polypeptide. In some embodiments, the NES comprises a polypeptide having at least 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 75, 76, 77, 78, 79, 80, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% (or any derivable range therein) identity or homology to SEQ ID NO:8, at most 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 75, 76, 77, 78, 79, 80, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% (or any derivable range therein) identity or homology, or exactly 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 75, 76, 77, 78, 79, 80, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% (or any derivable range therein) identity or homology.

[0046] In some embodiments, one or more nuclear localization signals (NLSs) are fused to an RNA regulatory domain, an RNA hairpin binding domain, and / or a stabilizing polypeptide. In some embodiments, the NLS is at the carboxy terminus of the RNA regulatory domain, the RNA hairpin binding domain, and / or the stabilizing polypeptide. In some embodiments, the NLS is at the amino terminus of the RNA regulatory domain, the RNA hairpin binding domain, and / or the stabilizing polypeptide. In some embodiments, the NES has at least 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 75, 76, 77, 78, 79, 80, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% (or any derivable range therein) identity or homology to SEQ ID NO:13, at most 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 75, 76, 77, 78, 79, 80, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% (or any derivable range therein) identity or homology to SEQ ID NO:13, or exactly 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 75, 76, 77, 78, 79, 80, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% (or any derivable range therein) identity or homology to SEQ ID NO:13 and includes a polypeptide having such identity or homology.

[0047] In some embodiments, the RNA targeting region of ii hybridizes to a target RNA in a prokaryotic or eukaryotic cell. In some embodiments, the target RNA is in a human cell. In some embodiments, the target RNA is in vitro or in vivo.

[0048] In some embodiments, the system includes at least two of each of i, ii, and iii. In some embodiments, at least two of i, ii, and iii are expressed in the same cell. In some embodiments, the method includes modulating at least two target RNAs. In some embodiments, the system includes at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, or 50 or more (or any derivable range therein), at most 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, or 50 or more (or any derivable range therein), or exactly 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, or 50 or more (or any derivable range therein) of i, ii, and iii. In some embodiments, at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, or 50 or more (or any derivable range therein), at most 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, or 50 or more (or any derivable range therein), or exactly 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, or 50 or more (or any derivable range therein) of target RNAs are modulated in a cell.

[0049] In some embodiments, the RNA regulatory domain cleaves RNA, promotes RNA translation, inhibits RNA translation, or modifies the nucleotide sequence of RNA.

[0050] In some embodiments, the vectors of the present disclosure further comprise regulatory elements operably linked to the nucleotides encoding i, ii, and / or iii. Regulatory elements include, in addition to NLS and NES as described above, promoters, polyadenylation signals, enhancers, and the like. Other regulatory elements are known in the art and are described herein and may be used in the embodiments of the present disclosure. In some embodiments, one or more nucleic acid vectors are optimized for expression in eukaryotic cells. In some embodiments, the expression of a domain, RNA, or polypeptide in a cell or from a vector is constitutive. In some embodiments, the expression of a domain, RNA, or polypeptide in a cell or from a vector is conditional. In some embodiments, i, ii, and iii are on a single vector. In some embodiments, i, ii, iii, and the stabilizer polypeptide are encoded on a single vector. In some embodiments, i, iii, and the stabilizer polypeptide are encoded on a single vector. In some embodiments, one or more of the vectors are viral vectors. In some embodiments, one or more vectors include one or more retroviral, lentiviral, adenoviral, adeno-associated viral, or herpes simplex viral vectors. In some embodiments, one or more of the vectors are non-viral vectors. In some embodiments, the system or composition is non-viral, meaning that it contains no viral components at all.

[0051] In some aspects, there is a system or kit that includes one or more of the following components: a polypeptide comprising an RNA regulatory domain, a polypeptide comprising an RNA binding domain, a polypeptide comprising a stabilizer, a nucleic acid encoding an RNA regulatory domain, a nucleic acid encoding an RNA binding domain, a nucleic acid encoding a stabilizer, a nucleic acid encoding an RNA targeting molecule comprising an RNA targeting region and at least one hairpin structure; a conjugate of the present disclosure; a vector of the present disclosure, a fusion protein of the present disclosure, a recombinant host cell, an expression construct, an engineered viral vector, or an engineered attenuated virus. In certain aspects, the polypeptides of the present disclosure are under the control of a heterologous promoter. It is specifically contemplated that any protein or polypeptide function used in the aspects may be used as a nucleic acid encoding that protein or polypeptide function. Also, any polypeptide, protein, nucleic acid molecule may be contained within a cell or other living organism such as a virus (e.g., a phage).

[0052] The kit may contain one or more components, separately or together, in suitable container means such as a sterile, non-reactive container. In some aspects, cells or viruses containing one or more nucleic acid constructs encoding the polypeptides of the present disclosure are provided. The term "promoter" is used according to its ordinary meaning as in the field of molecular biology; it generally refers to a site on a nucleic acid to which polymerase can bind to initiate transcription. In specific aspects, the promoter is recognized by T7 RNA polymerase.

[0053] The compositions, vectors, systems, methods, and proteins of the present disclosure are useful for a variety of clinical and research-related applications. Aspects of the present disclosure may be useful for the treatment of diseases or conditions such as cancer or autoimmunity. In some aspects, the methods and compositions are for the acute treatment of a disease or condition. In some aspects, the methods and compositions are useful for the transient modulation of RNA. In some aspects, permanent modification of gene activity is excluded. In some aspects, the methods and compositions are safer for acute modulation of RNA and / or for the ability to control the expression of the system in vivo.

[0054] As used herein, the term "a" or "an" can mean one or more. When used in a claim(s), the term "a" or "an" when used in conjunction with the term "comprising" can mean one or more than one.

[0055] As used herein, the terms "or" and "and / or" are utilized to describe combinations or multiple components that are mutually exclusive. For example, "x, y, and / or z" can refer to "x" alone, "y" alone, "z" alone, "x, y, and z", "(x and y) or z", "x or (y and z)", or "x or y or z". It is specifically contemplated that x, y, or z may be specifically excluded from a particular aspect.

[0056] Throughout this application, the term "about" is used in accordance with its plain and ordinary meaning in the field of cell biology to indicate that a value includes the standard deviation of error for the apparatus or method used to determine that value.

[0057] The term "comprising", which is synonymous with "including", "containing", or "characterized by", is inclusive or non-limiting and does not exclude additional, unrecited elements or method steps. The phrase "consisting of" excludes any element, step, or ingredient not specified. The phrase "consisting essentially of" limits the scope of the described subject matter to those that do not materially affect the basic and novel characteristics of the recited materials or steps. Aspects described in connection with the term "comprising" are also contemplated to be practiced in connection with the terms "consisting of" or "consisting essentially of".

[0058] It is specifically contemplated that any limitation discussed with respect to one aspect of the invention may apply to any other aspect of the invention. Moreover, any composition of the invention may be used in any method of the invention, and any method of the invention may be used to produce or utilize any composition of the invention. Aspects of an aspect shown in an example may also be aspects that may be practiced in connection with aspects discussed elsewhere in different examples or elsewhere in this application, for example, in the summary of the invention, the detailed description of the aspect, the claims, and the description of the drawing legends.

[0059] [Invention 1001] (i) an RNA hairpin binding domain; (ii) an RNA targeting molecule comprising an RNA targeting region and at least one hairpin structure, wherein the hairpin structure specifically binds to (i); and (iii) an RNA regulatory domain An RNA regulatory system comprising at least one of each of. [Invention 1002] The system of the present invention 1001, in which an RNA hairpin binding domain and an RNA regulatory domain are functionally linked. [The present invention 1003] The system of the present invention 1001, in which parts (i), (ii), and / or (iii) are human or of human origin. [The present invention 1004] The system of the present invention 1002 or 1003, in which (i) and (iii) are functionally linked through a peptide bond. [The present invention 1005] The system of the present invention 1002 or 1003, in which (i) and (iii) are functionally linked through a non-covalent interaction. [The present invention 1006] The system according to any one of the present inventions 1001 to 1005, in which the RNA regulatory domain is covalently linked to a first dimerization domain, and the RNA hairpin binding domain is covalently linked to a second dimerization domain, wherein the first and second dimerization domains can dimerize to form a non-covalent or covalent linkage. [The present invention 1007] The system of the present invention 1006, in which dimerization is inducible. [The present invention 1008] The system of the present invention 1007, in which dimerization includes ligand-induced dimerization. [The present invention 1009] The system of the present invention 1008, in which one of the first or second dimerization domains includes PYR / PYR1-like (PYL1), the other of the first or second domains includes abscisic acid-insensitive 1 (ABI1), and the ligand includes abscisic acid (ABA) or a derivative or fragment thereof. [The present invention 1010] The system of the present invention 1008, in which the first and / or second dimerization domains include FKBP12, and the ligand includes FK1012 or a derivative or fragment thereof. [The present invention 1011] In the system of the present invention 1008, one of the first or second dimerization domains contains a FK506 binding protein (FKBP), the other of the first or second domains contains the FKBP-Rap binding domain (Frb) of mammalian Rap target mTOR, and the ligand contains rapamycin (Rap) or its derivative or fragment. [The present invention 1012] (ii) The system according to any one of the present inventions 1001 to 1011, which contains at least two hairpin structures. [The present invention 1013] (ii) The system according to any one of the present inventions 1001 to 1012, which contains one or more modified nucleotides. [The present invention 1014] The system according to any one of the present inventions 1001 to 1013, wherein the system further contains a stabilizer polypeptide, and the stabilizer polypeptide contains a cationic polypeptide that binds non-specifically to nucleic acid. [The present invention 1015] The system of the present invention 1014, wherein the stabilizer polypeptide is of human origin. [The present invention 1016] The system according to any one of the present inventions 1001 to 1015, the overall size of which is less than 150 kDa. [The present invention 1017] (i) The system according to any one of the present inventions 1001 to 1016, which contains U1A, SLBP, or a variant thereof. [The present invention 1018] (ii) The system according to any one of the present inventions 1001 to 1017, which contains the TAR hairpin scaffold of SEQ ID NO: 1. [The present invention 1019] (ii) The system according to any one of the present inventions 1001 to 1018, which contains the SLBP hairpin scaffold of SEQ ID NO: 2. [The present invention 1020] (ii) The system according to any one of the present inventions 1001 to 1019, which contains a linker. [The present invention 1021] The system of the present invention 1020, wherein the linker is at least 5 amino acids. [The present invention 1022] The system of any one of the present inventions 1001 to 1021, wherein the RNA targeting region comprises at least 12 nucleotides. [The present invention 1023] (iii) of the system of any one of the present inventions 1001 to 1022, which comprises a nuclease, a methylase, a demethylase, a translation activator, a translation repressor, a single-stranded RNA cleavage activity, a double-stranded RNA cleavage activity, or an RNA binding activity. [The present invention 1024] (iii) of the system of any one of the present inventions 1001 to 1023, which comprises a Pin nuclease domain or an m6A reader protein or a portion thereof. [The present invention 1025] (iii) of the system of the present invention 1024, which comprises YTHDF1, YTHDF2, or ADAR. [The present invention 1026] The system of any one of the present inventions 1014 to 1025, wherein the stabilizer protein comprises HBEGF, beta-defensin, or a variant or portion thereof. [The present invention 1027] (ii) of the system of any one of the present inventions 1001 to 1026, wherein the RNA targeting region hybridizes to a target RNA in a prokaryotic or eukaryotic cell. [The present invention 1028] (i) and / or (iii) of the system of any one of the present inventions 1001 to 1027, which comprises one or more nuclear localization signals (NLS). [The present invention 1029] The system of any one of the present inventions 1001 to 1028, which comprises at least two of each of (i), (ii), and (iii). [The present invention 1030] The system of any one of the present inventions 1001 to 1029, wherein the RNA regulatory domain cleaves RNA, promotes RNA translation, inhibits RNA translation, or modifies the nucleotide sequence of RNA. [The present invention 1031] (i) RNA hairpin binding domain; (ii) An RNA targeting molecule comprising an RNA targeting region and at least one hairpin structure, wherein the hairpin structure specifically binds to (i), and (iii) RNA regulatory domain One or more nucleic acid vectors containing nucleotides encoding A vector system comprising. [Invention 1032] The vector system of Invention 1031, wherein the RNA hairpin binding domain and the RNA regulatory domain are functionally linked. [Invention 1033] The vector system of Invention 1031, further comprising a regulatory element functionally linked to the nucleotide encoding (i), (ii), and / or (iii). [Invention 1034] The vector system of Invention 1031 or 1033, wherein one or more nucleic acid vectors are optimized for expression in eukaryotic cells. [Invention 1035] The vector system of any one of Inventions 1031 to 1034, wherein the expression is constitutive or conditional. [Invention 1036] The vector system of any one of Inventions 1031 to 1035, wherein (i), (ii), and (iii) are on a single vector. [Invention 1037] The vector system of any one of Inventions 1031 to 1036, wherein one or more of the vectors are viral vectors. [Invention 1038] The vector system of any one of Inventions 1031 to 1037, wherein one or more vectors comprise one or more retroviral, lentiviral, adenoviral, adeno-associated viral, or herpes simplex viral vectors. [Invention 1039] The vector system of any one of Inventions 1031 to 1036, wherein one or more of the vectors are non-viral vectors. [Invention 1040] A conjugate comprising an RNA regulatory domain functionally linked to an RNA targeting molecule, wherein the RNA targeting molecule comprises an RNA targeting region and at least one hairpin structure. [Invention 1041] The conjugate of Invention 1040, wherein the RNA regulatory domain is of human origin. [Invention 1042] The conjugate of Invention 1040 or 1041, wherein the RNA regulatory domain and the RNA targeting molecule are functionally linked through a peptide bond. [Invention 1043] The conjugate of any one of Inventions 1040 to 1042, wherein the polypeptide further comprises one or more linkers. [Invention 1044] The conjugate of Invention 1040 or 1041, wherein the RNA regulatory domain and the RNA targeting molecule are functionally linked through non-covalent interactions. [Invention 1045] The conjugate of any one of Inventions 1040 to 1044, wherein the RNA regulatory domain is covalently linked to a first dimerization domain, and the RNA targeting molecule is covalently linked to a second dimerization domain, and the first and second dimerization domains can dimerize to form a link through non-covalent or covalent bonds. [Invention 1046] The conjugate of Invention 1045, wherein dimerization is inducible. [Invention 1047] The conjugate of Invention 1046, wherein dimerization comprises ligand-induced dimerization. [Invention 1048] The conjugate of Invention 1047, wherein one of the first or second dimerization domains comprises PYR / PYR1-like (PYL1), the other of the first or second domains comprises abscisic acid-insensitive 1 (ABI1), and the ligand comprises abscisic acid (ABA) or a derivative or fragment thereof. [Invention 1049] The conjugate of the present invention 1047, wherein the first and / or second dimerization domain comprises FKBP12 and the ligand comprises FK1012 or its derivative or fragment. [The present invention 1050] The conjugate of the present invention 1047, wherein one of the first or second dimerization domains comprises a FK506 binding protein (FKBP), the other of the first or second domains comprises the FKBP-Rap binding domain (Frb) of mammalian Rap target mTOR, and the ligand comprises rapamycin (Rap) or its derivative or fragment. [The present invention 1051] The conjugate of any one of the present inventions 1040 to 1050, wherein the RNA targeting molecule comprises at least two hairpin structures. [The present invention 1052] The conjugate of any one of the present inventions 1040 to 1051, wherein the RNA targeting molecule comprises one or more modified nucleotides. [The present invention 1053] The conjugate of any one of the present inventions 1040 to 1052, wherein the RNA targeting molecule comprises the TAR hairpin scaffold of SEQ ID NO:1. [The present invention 1054] The conjugate of any one of the present inventions 1040 to 1053, wherein the RNA targeting molecule comprises the SLBP hairpin scaffold of SEQ ID NO:2. [The present invention 1055] The conjugate of any one of the present inventions 1040 to 1054, wherein the RNA targeting molecule comprises a linker. [The present invention 1056] The conjugate of the present invention 1055, wherein the linker comprises at least 5 amino acids. [The present invention 1057] The conjugate of any one of the present inventions 1040 to 1056, wherein the RNA targeting region comprises at least 12 nucleotides. [The present invention 1058] A conjugate according to any one of aspects 1040 to 1057 of the present invention, wherein the RNA regulatory domain comprises a nuclease, a methylase, a demethylase, a translation activator, a translation repressor, a single-stranded RNA cleavage activity, a double-stranded RNA cleavage activity, or an RNA binding activity. [Aspect 1059 of the present invention] A conjugate according to any one of aspects 1040 to 1057 of the present invention, wherein the RNA regulatory domain comprises a Pin nuclease domain or an m6A reader protein or a portion thereof. [Aspect 1060 of the present invention] A conjugate according to any one of aspects 1040 to 1059 of the present invention, wherein the RNA regulatory domain comprises YTHDF1, YTHDF2, or ADAR. [Aspect 1061 of the present invention] A conjugate according to any one of aspects 1040 to 1060 of the present invention, wherein the RNA targeting region of the RNA targeting molecule hybridizes to a target RNA in a prokaryotic or eukaryotic cell. [Aspect 1062 of the present invention] A conjugate according to any one of aspects 1040 to 1061 of the present invention, comprising one or more nuclear localization signals (NLSs). [Aspect 1063 of the present invention] A conjugate according to any one of aspects 1040 to 1062 of the present invention, wherein the RNA regulatory domain cleaves RNA, promotes RNA translation, inhibits RNA translation, or modifies the nucleotide sequence of RNA. [Aspect 1064 of the present invention] A fusion protein comprising an RNA hairpin binding domain and an RNA regulatory domain. [Aspect 1065 of the present invention] A fusion protein comprising an RNA regulatory domain and a first dimerization domain. [Aspect 1066 of the present invention] A fusion protein comprising an RNA hairpin binding domain and a second dimerization domain. [Aspect 1067 of the present invention] A fusion protein according to aspect 1065 or 1066 of the present invention, wherein dimerization of the first and / or second dimerization domain is inducible. [Aspect 1068 of the present invention] The fusion protein of the present invention 1067, wherein dimerization includes ligand-induced dimerization. [The present invention 1069] The fusion protein of the present invention 1068, wherein the first and second dimerization domains are selected from PYL1 and ABI1, and the ligand includes ABA or its derivative or fragment. [The present invention 1070] The fusion protein of the present invention 1068, wherein the first and / or second dimerization domain includes FKBP12, and the ligand includes FK1012 or its derivative or fragment. [The present invention 1071] The fusion protein of the present invention 1068, wherein the first and second dimerization domains are selected from FKBP and Frb, and the ligand includes rapamycin or its derivative or fragment. [The present invention 1072] The fusion protein according to any one of the present inventions 1064 to 1071, wherein the RNA hairpin binding domain and / or the RNA regulatory domain is of human origin. [The present invention 1073] The fusion protein according to any one of the present inventions 1064 to 1072, which is less than 150 kDa. [The present invention 1074] The fusion protein according to any one of the present inventions 1064 to 1073, wherein the RNA hairpin binding domain includes U1A, SLBP, or its variant or fragment. [The present invention 1075] The fusion protein according to any one of the present inventions 1064 to 1074, wherein the RNA regulatory domain includes nuclease, methylase, demethylase, translation activator, translation repressor, single-stranded RNA cleavage activity, double-stranded RNA cleavage activity, or RNA binding activity. [The present invention 1076] The fusion protein of the present invention 1075, wherein the RNA regulatory domain includes the Pin nuclease domain or the m6A reader protein or a portion thereof. [The present invention 1077] The fusion protein of the present invention 1076, wherein the RNA regulatory domain includes YTHDF1 or YTHDF2. [The present invention 1078] A fusion protein according to any one of the present inventions 1064 to 1077, further comprising one or more nuclear localization signals (NLS). [The present invention 1079] A fusion protein according to any one of the present inventions 1064 to 1077, wherein the RNA regulatory domain cleaves RNA, promotes RNA translation, inhibits RNA translation, or modifies the nucleotide sequence of RNA. [The present invention 1080] A nucleic acid encoding a fusion protein according to any one of the present inventions 1064 to 1079. [The present invention 1081] A delivery vehicle comprising a system according to any one of the present inventions 1001 to 1039, a conjugate according to any one of the present inventions 1040 to 1063, or a fusion protein according to any one of the present inventions 1064 to 1079. [The present invention 1082] The delivery vehicle of the present invention 1081, comprising liposome(s), particle(s), exosome(s), microvesicle(s), gene gun, or one or more nucleic acid vectors. [The present invention 1083] A composition comprising a system according to any one of the present inventions 1001 to 1039, a conjugate according to any one of the present inventions 1040 to 1063, a fusion protein according to any one of the present inventions 1064 to 1079, or a delivery vehicle according to any one of the present inventions 1081 to 1082. [The present invention 1084] A cell comprising a system according to any one of the present inventions 1001 to 1039, a conjugate according to any one of the present inventions 1040 to 1063, a fusion protein according to any one of the present inventions 1064 to 1079, a delivery vehicle according to any one of the present inventions 1081 to 1082, or a composition according to the present invention 1083. [The present invention 1085] A method of modulating at least one target RNA, comprising: A step of contacting a system according to any one of 1001 to 1039 of the present invention, a conjugate according to any one of 1040 to 1063 of the present invention, a fusion protein according to any one of 1064 to 1079 of the present invention, a delivery vehicle according to any one of 1081 to 1082 of the present invention, or a composition according to 1083 of the present invention with a target RNA A method comprising: [1086 of the present invention] The method according to 1085 of the present invention, wherein modulating at least one target RNA comprises cleavage, demethylation, methylation, activation of translation, suppression of translation, promotion of degradation, and / or binding to RNA. [1087 of the present invention] The method according to 1085 or 1086 of the present invention, wherein the target RNA is in a prokaryotic or eukaryotic cell. [1088 of the present invention] The method according to 1087 of the present invention, wherein the target RNA is in a human cell. [1089 of the present invention] The method according to 1087 or 1088 of the present invention, wherein the target RNA is in vitro or in vivo. [1090 of the present invention] A cell or its progeny comprising a modulated target RNA, wherein the target RNA has been modulated according to any one of the methods of 1085 to 1089 of the present invention. [1091 of the present invention] A multicellular organism comprising one or more cells according to 1090 of the present invention. [1092 of the present invention] A plant or animal comprising one or more cells according to 1091 of the present invention. [1093 of the present invention] A kit comprising a system according to any one of 1001 to 1039 of the present invention, a conjugate according to any one of 1040 to 1063 of the present invention, a fusion protein according to any one of 1064 to 1079 of the present invention, a delivery vehicle according to any one of 1081 to 1082 of the present invention, or a composition according to 1083 of the present invention. [1094 of the present invention] A method for modulating a target RNA in a subject, comprising: administering a conjugate according to any one of 1040 to 1063 of the present invention, a fusion protein according to any one of 1064 to 1079 of the present invention, a delivery vehicle according to any one of 1081 to 1082 of the present invention, or a composition according to 1083 of the present invention A method comprising: Other objects, features and advantages of the present invention will become apparent from the following detailed description. However, since various changes and modifications within the spirit and scope of the present invention will become apparent to those skilled in the art from this detailed description, it should be understood that the detailed description and specific examples are given by way of illustration only while showing preferred embodiments of the present invention.

Brief Description of the Drawings

[0060] The following drawings form a part of this specification and are included to further demonstrate certain aspects of the present invention. The present invention can be better understood by referring to one or more of these drawings in combination with the detailed description of the specific embodiments presented herein. (FIG. 1A) FIGS. 1A-D. Design of an RNA targeting system (CIRTS) inspired by CRISPR / Cas. (A) Schematic overview of the design strategy. CIRTS is composed of an ssRNA binding protein, an RNA hairpin binding protein, an effector protein, and a guiding RNA. (B) List of modular CIRTS constructs used in this study. (C) Design of guiding RNA against TBP6.7. The HIV TAR hairpin was fused to a nucleotide linker (L) and a guide sequence (SEQ ID NO: 139). (D) Design of guiding RNA against the RRM of SLBP. The human histone mRNA hairpin was fused to a flexible five-nucleotide linker and a guide sequence (SEQ ID NO: 140). (FIG. 1B) See the description of FIG. 1A. (FIG. 1C) See the description of FIG. 1A. (FIG. 1D) See the description of FIG. 1A. (Figure 2) Figures 2A - C. CIRTS-1 in vitro binding and RNA cleavage assay. (A) Electrophoretic mobility shift assay (EMSA) to evaluate the binding affinity of the MBP-CIRTS-1:on-target gRNA (R3) complex to the labeled RNA substrate (R1). The reaction buffer was supplemented with EDTA to avoid any cleavage. (B) Calculation of the binding affinity by fitting the fraction of TBP6.7:gRNA bound to the substrate to a secondary binding equation. (C) Cleavage assay lane on a denaturing gel after 2 hours of incubation. The labeled RNA substrate (R2) is cleaved in a gRNA-dependent manner. (Figure 3-1) Figures 3A - G. CIRTS mammalian cell reporter assay. (A) General overview of the dual luciferase assay. A reporter construct containing both firefly luciferase and Renilla luciferase was used in all assays. The inventors targeted their CIRTS to the firefly luciferase transcript while maintaining Renilla luciferase constant for use as a transfection control. For all subsequent assays, HEK293T cells were transfected with the reporter vector, CIRTS vector, and gRNA vector. (B) Catalytically inactive CIRTS-0 was used as a control. After 48 hours of incubation, the inventors observed no decrease in the protein readout. (C) Comparison of CIRTS-1 and Cas13b nuclease. Cells transfected with either CIRTS-1 or Cas13 and the corresponding gRNA targeting showed decreased protein levels after incubation. (D) HEK293T cells transfected with CIRTS-2 showed an increase in protein levels after 48 hours. (E) Cells transfected with CIRTS-3, however, showed the predicted decrease in protein levels. (F) Switching the hairpin-binding protein to SLBP also resulted in a decrease in protein levels after 48 hours. (G) Cells transfected with the fully humanized CIRTS (CIRTS-5 and CIRTS-6) system and the on-target gRNA for firefly luciferase also resulted in decreased protein levels in this case. (FIG. 3-2) See the description of FIG. 3-1. (FIG. 4) FIGS. 4A - C. Targeting of endogenous transcripts by CIRTS. (A) Nuclease-mediated knockdown of five endogenous transcripts upon transfection of cells with CIRTS-1 as assayed using qPCR. Endogenous transcripts of interest can be targeted by co-transfecting CIRTS-1 with the corresponding on-target guide sequence for the gRNA. (B) qPCR analysis of nuclease-independent knockdown of endogenous transcripts by CIRTS-3. Cells transfected with CIRTS-3 show a gRNA-dependent decrease in RNA levels for all five transcripts tested. (C) Protein-level analysis using Western blot after transfection with CIRTS-2 or CIRTS-3. CIRTS-2 can induce an increase in protein levels, while CIRTS-3 shows an expected decrease in protein levels (as a control). (FIG. 5) FIGS. 5A - B. Multidimensional targeting by CIRTS. (A) Illustration of the vectors used for multiplex targeting. CIRTS-6 was co-transfected with its gRNA construct targeting PPIB, while CIRTS-7 was co-transfected with the corresponding gRNA construct targeting SMARCA4. (B) Heatmap showing knockdown of multiplex targeting. When both CIRTS-6 and CIRTS-7 are present in the cell, co-transfection of either the on-target gRNA or off-target control gRNA can guide CIRTS to decrease endogenous transcripts. When both CIRTS have on-target gRNAs for the presence of PPIB or SMARCA4, both transcripts can be knocked down in the same sample. (FIG. 6) Comparison of CIRTS with other DNA and RNA targeting CRISPR / Cas systems. Size comparison by illustration of currently used Cas9, Cas13, and fusion protein systems. Cas9- and Cas13-based delivery systems are substantially larger than the engineered CIRTS system. (FIG. 7) FIGS. 7A-C. Control EMSA and cleavage assays. (A) EMSA evaluation of MBP-CIRTS-1-dependent binding shift in the absence of any gRNA. (B) EMSA assay of binding shift in the presence of only labeled substrate (R1) and on-target gRNA (R3). (C) Complete cleavage gel shown in FIG. 2C of the text. (FIG. 8-1) FIGS. 8A-D. CIRTS linker and gRNA optimization. (A) Luciferase assay by the CIRTS nuclease system using different linkers between the hairpin-binding protein and the effector protein. (B) Luciferase assay by CIRTS-YTHDF2-mediated decay using different linkers between the hairpin-binding protein and the effector protein. (C) Different engineered gRNAs against TBP6.7 based on the design shown in FIG. 1C. Two different targeting lengths of 20 and 40 nucleotides were used in combination with different numbers of linker nucleotides (L) between the hairpin and the guiding sequence. A dual luciferase assay was used to evaluate nuclease-mediated decay. (D) The same engineered gRNAs as in FIG. 8C were used with CIRTS-3 to induce epitranscriptome-directed RNA decay. n = 3 biological replicate experiments. (FIG. 8-2) See the description of FIG. 8-1. (FIG. 9) FIGS. 9A-H. Control luciferase assay and RT-qPCR. (A) RT-qPCR analysis of RNA levels at the “dead” Pin nuclease domain CIRTS (CIRTS-0). (B) Luciferase assay comparing nuclease-mediated decay of the TBP6.7-Pin nuclease domain without (CIRTS-8) and with (CIRTS-9) the additional ssRNA-binding protein ORF5. (C) The CIRTS nuclease can mediate a decrease in RNA and thus protein levels in both the nucleus and cytoplasm (n = 6). (D) Comparison of RNA levels when cells were transfected with CIRTS-1 and the active Cas13b nuclease. CIRTS-1-Pin-mediated RNA cleavage showed substantially less RNA degradation compared to the Cas13b system. (E-H) All engineered CIRTS systems tested by the inventors in the dual luciferase assay were also subjected to RT-qPCR analysis to evaluate changes in RNA levels. CIRTS-2 containing the YTHDF1 effector domain that induces translational activation did not show a significant change in RNA levels, while all YTHDF2-containing CIRTS showed the expected decrease in RNA levels (S3F and S3H: n = 2 or 3). Unless otherwise noted, n = 3 biological replicate experiments. Student's t-test: * P < 0.05, ** P < 0.01, *** P < 0.001. (Figure 10) Figures 10A - C. Immunoprecipitation, control qPCR, Western blot, Y2 truncation. (A) Cells were transfected with CIRTS-0-3xFLAG and either gRNA for PPIB, B4GALTN1, or NT. After crosslinking and FLAG IP, RT-qPCR was used to quantify the pulled-down RNA. Reactants containing on-target gRNA for either transcript showed 3.5 - 5-fold enrichment for these transcripts, indicating guide-type RNA targeting (n = 2 or 3). (B) RT-qPCR analysis of RNA levels when cells were transfected with CIRTS-2. As predicted, no significant change in RNA levels was observed when using the YTHDF1-containing protein. (C) Different truncations of YTHDF2 were assayed to determine which was more efficient. We compared luciferase data (left) to qPCR data (right) and concluded to use the Y2(100 - 200) construct for luciferase assays and the Y2(1 - 200) construct for endogenous normalization to enable the best quantification of this tool. Unless otherwise noted, n = 3 biological replicate experiments. Student's t-test: * P < 0.05, ** P < 0.01. (Figure 11) Figures 11A - C. Endogenous normalization by CIRTS. (A) Changes in RNA levels evaluated after transfection of CIRTS5-7 alone for PPIB. (B) Similar to Figure 11A, SMARCA4 levels were assayed when cells were transfected with CIRTS5-7. (C) A gRNA screen parallel to SMARCA4 that induces gRNA-dependent RNA decay using CIRTS-3. We observed a significant change in the amount of decay induced depending on where the transcript was targeted (n = 2 or 3). Unless otherwise noted, n = 3 biological replicate experiments. Student's t-test: * P < 0.05, ** P < 0.01, *** P < 0.001. (Figure 12) Figures 12A - D. Design of the RNA targeting system (CIRTS) inspired by CRISPR / Cas. (A) Schematic overview of the design strategy. CIRTS is composed of an ssRNA-binding protein, an RNA hairpin-binding protein, an effector protein, and a guiding RNA. (B) List of important CIRTS used in this study. (C) Design of the guiding RNA for TBP6.7. The HIV TAR hairpin was fused to a nucleotide linker (L) and a guide sequence. The nucleotide linker was changed during optimization (as described in the Supplementary Information), but L = UUAUU (SEQ ID NO: 139) was used in all subsequent studies. (D) Design of the guiding RNA for the RNA recognition motif (RRM) of SLBP. The human histone mRNA hairpin was fused to a flexible five-nucleotide linker and a guide sequence (SEQ ID NO: 141). (Figure 13) Figures 13A - B. CIRTS-1 in vitro binding and RNA cleavage assays. (A) Filter-binding assay to evaluate the binding affinity of MBP-CIRTS-1 to the labeled RNA substrate with the on-target gRNA and non-targeted RNA complex. When the data was fitted to a secondary binding equation, an apparent K of 22 ± 7 nM was revealed for the on-target:protein complex D , and an apparent K of around 500 nM for the non-targeted:protein interaction D . (B) Cleavage assay lane on a 10% denaturing urea PAGE gel in the presence of 0.5 mM MnCl 2 . The RNA substrate labeled with IR800 is cleaved in a gRNA-dependent manner. (Figure 14) Figures 14A - G. CIRTS mammalian cell reporter assay. (A) General overview of the dual luciferase assay. A reporter construct containing both firefly luciferase and Renilla luciferase is used in all assays. The inventors targeted CIRTS to the firefly luciferase transcript while using Renilla luciferase as an internal control. For all subsequent assays, HEK293T cells were transfected with the reporter vector, the CIRTS vector, and the gRNA vector. (B) Catalytically inactive CIRTS - 0 was used as a control. After 48 hours of incubation, the inventors observed no decrease in the protein readout values. Values are shown as mean ± SEM in biological replicate experiments with n = 3. (C) Comparison of CIRTS - 1 and Cas13b nuclease. Cells transfected with either CIRTS - 1 or Cas13 and the corresponding gRNA - targeted Fluc showed decreased protein levels after incubation. Values are shown as mean ± SEM in biological replicate experiments with n = 3. Student's t - test: * P < 0.05, ** P < 0.01. (D) HEK293T cells transfected with CIRTS - 2 showed an increase in protein levels after 48 hours. Values are shown as mean ± SEM in biological replicate experiments with n = 3. Student's t - test: ** P < 0.01. (E) HEK293T cells transfected with CIRTS - 3 showed a predicted decrease in protein levels. Values are shown as mean ± SEM in biological replicate experiments with n = 3. Student's t - test: * P < 0.05. (F) Switching the hairpin - binding protein to SLBP also resulted in a decrease in protein levels after 48 hours. Values are shown as mean ± SEM in biological replicate experiments with n = 3. Student's t - test: *P < 0.05. (G) Cells transfected with the fully humanized CIRTS (CIRTS-5 and CIRTS-6) system and the on-target gRNA for firefly luciferase also resulted in decreased protein levels in this case. Values are shown as mean ± SEM in biological replicate experiments with n = 3. Student's t-test: * P < 0.05. (Figure 15) Figures 15A - B. CIRTS for RNA editing. (A) Schematic overview of the RNA editing reporter assay used. Introduction of a single G-to-A mutation into the coding sequence of firefly luciferase resulted in a W417X (X = STOP) codon switch and no measurable firefly luciferase signal (Figure 22J). (B) Delivery of CIRTS-7 (hADAR2 wt) and CIRTS-8 (hADAR E488Q) together with the on-target gRNA shows significant RNA editing resulting in a measurable firefly luciferase signal. It can be seen that both the background and the editing efficiency of CIRTS-8, a highly active hADAR2 mutant, are higher compared to the wild type. Values are shown as mean ± SEM in biological replicate experiments with n = 3. Student's t-test: *** P < 0.001. (Figure 16) Figures 16A - C. Targeting of endogenous transcripts by CIRTS. (A) Nuclease-mediated knockdown of five endogenous transcripts upon transfection of cells with CIRTS-1 as assayed by qPCR. Endogenous transcripts of interest can be targeted by using CIRTS-1 and co-transfecting the gRNA with the corresponding on-target guide sequence. Values are shown as mean ± SEM in biological replicate experiments with n = 3. Student's t-test: * P < 0.05, ** P < 0.01, ***P < 0.001. (B) qPCR analysis of YTHDF2-mediated knockdown of endogenous transcripts by CIRTS-3. Cells transfected with CIRTS-3 show gRNA-dependent decreases in RNA levels for all five transcripts tested. Values are shown as mean ± SEM in biological replicates with n = 3. Student's t-test: * P < 0.05. (C) Protein level analysis by Western blot after transfection with CIRTS-2 or CIRTS-3. CIRTS-2 induces an increase in protein level, while CIRTS-3 shows the expected decrease in protein level (both gRNA-dependent). (Figure 17) Targeted proximity determines the knockdown efficiency of CIRTS. A gRNA screen in parallel with SMARCA4 that induces gRNA-dependent RNA decay using CIRTS-3. We observe a significant variation in the amount of decay induced depending on where the transcript is targeted (n = 2 or 3). (Figure 18) Figures 18A - D. Multidimensional targeting by CIRTS. (A) Schematic of the delivery of CIRTS-6 and three gRNAs. (B) Delivery of CIRTS-6 together with three separate gRNAs against PPIB, SMARCA4, and NRAS can cause knockdown of all three transcripts simultaneously. Biological replicates with n = 5. Student's t-test: ** P < 0.05, *** P < 0.001. (C) Schematic of simultaneous CIRTS delivery with different effector proteins. (D) Changes in luciferase protein level and PPIB transcript level when cells are transfected with both CIRTS-9 (YTHDF1) and CIRTS-10 (YTHDF2) and gRNAs against Fluc and PPIB, respectively. Both orthogonal CIRTS retain their individual functions and act simultaneously in cells. Biological replicates with n = 5. Student's t-test: * P < 0.1, ** P < 0.05. (Figure 19) Figures 19A - C. AAV delivery of CIRTS. (A) Transfer plasmid for AAV delivery containing both the CIRTS-6 (YTHDF2) and the gRNA components of this system. The total insert size between the two inverted terminal repeats (ITRs) was 2.7 kb. (B) In a dual luciferase reporter assay, gRNA targeting CIRTS-6 and luciferase packaged in AAV was delivered to HEK293T cells to knock down firefly luciferase. (C) gRNA targeting CIRTS-6 and SMARCA4 packaged in AAV was delivered to HEK293T cells to knock down the endogenous gene, which revealed an efficiency comparable to that achieved by transient transfection. Values are shown as mean ± SEM in biological replicate experiments with n = 3. Student's t-test: * P < 0.05. (Figure 20) Comparison of CIRTS with other DNA and RNA targeting CRISPR / Cas systems. Schematic size comparison of commonly used Cas9, Cas12, Cas13, and fusion protein systems. (Figure 21) List of CIRTS continued from Figure 12B. Reference list of all remaining CIRTS used in this study. The figure discloses "(GGS) 6 " as SEQ ID NO:6 and "(GGS) 3 " as SEQ ID NO:21. (Figure 22) Figures 22A - J. Control luciferase assay and RT - qPCR. (A) Luciferase assay comparing nuclease - mediated decay of the TBP6.7 - Pin nuclease domain without additional ssRNA - binding protein ORF5 (CIRTS - 11) and with it (CIRTS - 12). (B) CIRTS nuclease can mediate a decrease in RNA, and thus protein levels, in both the nucleus and cytoplasm (n = 6). (C) RT - qPCR analysis of RNA levels with the 'dead' Pin nuclease domain CIRTS (CIRTS - 0). (D) Comparison of RNA levels when cells were transfected with CIRTS - 1 and active Cas13b nuclease. CIRTS - 1 - Pin - mediated RNA cleavage showed substantially less RNA degradation compared to the Cas13b system. (E - H) All engineered CIRTS systems tested in the dual - luciferase assay were also subjected to RT - qPCR analysis to evaluate changes in RNA levels. CIRTS - 2 containing the YTHDF1 effector domain that induces translational activation showed no significant change in RNA levels, while all YTHDF2 - containing CIRTS showed the expected decrease in RNA levels. (I) Engineered CIRTS - 18 containing the PP7 dimer as a hairpin - binding protein. Knockdown of PPIB after transfection of CIRTS - 18 as measured by qPCR. (J) Comparison of reporter only and reporter with CIRTS - 7 (hADAR wt) using non - targeted or targeted gRNA (S3F and S3H: n = 2 or 3). Unless otherwise noted, n = 3 biological replicate experiments. Student's t - test: * P < 0.05, ** P < 0.01, *** P < 0.001. (Figure 23) Figures 23A - D. CIRTS linker and gRNA optimization. (A) Luciferase assay by the CIRTS nuclease system using different linkers between the hairpin - binding protein and the effector protein. Previously published L8 = SGSETPGTSESATPES (SEQ ID NO:133) (Guilinger et al., 2014), 10 - nm helical linker = TIFF2025084877000001.tif12158. The figure is from "(GGS) 6 " with SEQ ID NO:6, "(GGS) 3 " is disclosed as SEQ ID NO:21. (B) Luciferase assay with CIRTS-YTHDF2-mediated disruption using different linkers between the hairpin binding protein and the effector protein. The figure shows "(GGS) 6 " is disclosed as SEQ ID NO:6. (C) Different engineered gRNAs against TBP6.7 based on the design shown in Figure 1C. Two different targeting lengths of 20 and 40 nucleotides were used in combination with different numbers of linking nucleotides (L) between the hairpin and the guiding sequence. A dual luciferase assay was used to assess nuclease-mediated decay. NT = non-targeting, different linker nucleases containing Fluc gRNA (Figure 1), L2 = UU, L3 = UUU, L5 = UUAUU. (D) The same engineered gRNAs as in Figure S3C were used with CIRTS-3 to induce epitranscriptome-guided RNA decay. NT = non-targeting, different linker nucleases containing Fluc gRNA (Figure 1), L2 = UU, L3 = UUU, L5 = UUAUU. n = 3 biological replicates. (Fig. 24) Figs. 24A - D. Control qPCR, Western blot, YTHDF2 truncation. (A) CIRTS - 1 can be delivered to RNA species other than mRNA. As a proof of principle, the inventors transfected cells with CIRTS - 1 (Pin nuclease) and two different gRNAs against lncRNA MALAT1 and evaluated the RNA levels by RT - qPCR. (B) RT - qPCR analysis of RNA levels when cells were transfected with CIRTS - 2. As predicted, no significant change in RNA levels was observed when using YTHDF1 - containing proteins. (C) Quantification of protein levels as measured by Western blot (n = 3) when cells were transfected with CIRTS - 2 or CIRTS - 3 and targeted to PPIB. (D) Different truncations of YTHDF2 were assayed to determine which was more efficient. The inventors compared luciferase data (left) with qPCR data (right) and concluded that the Y2(100 - 200) construct was used for luciferase assays and the Y2(1 - 200) construct was used for endogenous normalization to enable the best quantification of this tool. Unless otherwise noted, n = 3 biological replicate experiments. Student's t - test: * P < 0.05, ** P < 0.01. (FIG. 25-1) FIGS. 25A-H. Specificity of CIRTS targeting. (A) Schematic of the KRAS4b-luciferase mismatch reporter assay. The inventors selected four KRAS4b variants with an increasing number of mismatches to a designed 20-nt-long gRNA and fused it to the N-terminus of a dual luciferase reporter. The figure discloses SEQ ID NOs: 142-148 in the order of appearance, respectively. (B) CIRTS-mediated knockdown of KRAS4b-Fluc with different numbers of mismatches between the gRNA and the target RNA as described in FIG. S5A. CIRTS was found to be most sensitive to mismatches in the center of its guiding sequence. (C) Cas13b-mediated knockdown in the same KRAS4b-Fluc reporter assay as described above. Cas13b shows higher knockdown efficiency but is less sensitive to introduced mismatches. Similar to CIRTS, Cas13b is most affected by knockdown by mismatches in the center of the guided target duplex region. (D) Knockdown efficiency of CIRTS on the KRAS4b-luciferase mismatch reporter when using a 40-nt gRNA length. Longer guiding sequences in the gRNA can rescue some of the loss of knockdown efficiency. (E-F) Average expression levels (n = 3) of the transcriptome in units of transcripts per million (TPM + 1) when CIRTS Pin nuclease (E) or CIRTS YTHDF2 (F) is placed on SMARCA4 in cells. (G) Knockdown level of SMARCA4 as determined by RNA sequencing. (H) Cells were transfected with gRNAs of either CIRTS-0-3xFLAG and PPIB, B4GALNT1, or NT. After crosslinking and FLAG IP, RT-qPCR was used to quantify the pulled-down RNA. Reactants containing the on-target gRNA for any of the transcripts showed a 3.5- to 5-fold enrichment for these transcripts, indicating guide-type RNA targeting (n = 2 or 3). 2 (transcripts per million (TPM) + 1) of the transcriptome (n = 3). (G) Knockdown level of SMARCA4 as determined by RNA sequencing. (H) Cells were transfected with gRNAs of either CIRTS-0-3xFLAG and PPIB, B4GALNT1, or NT. After crosslinking and FLAG IP, RT-qPCR was used to quantify the pulled-down RNA. Reactants containing the on-target gRNA for any of the transcripts showed a 3.5- to 5-fold enrichment for these transcripts, indicating guide-type RNA targeting (n = 2 or 3). (FIG. 25-2) See the description of FIG. 25-1. (Figure 26) Figures 26A - C. Endogenous targeting by CIRTS. (A) Changes in RNA levels as evaluated by RT - qPCR after transfection of CIRTS5 - 7 alone against PPIB. (B) Similar to Figure S6A, SMARCA4 levels were assayed when cells were transfected with CIRTS5 - 7. (C) Comparison of knockdown levels of PPIB after delivery of active Cas13b nuclease or engineered dCas13b - YTHDF2(1 - 200) construct to PPIB (n = 2 or 3). Unless otherwise noted, n = 3 biological replicate experiments. Student's t - test: * P < 0.01, ** P < 0.05, *** P < 0.01, **** P < 0.001. (Figure 27) Figures 27A - C. Multiplex targeting by CIRTS. (A) Schematic of the vectors used for multiplex targeting. Cells were transfected with an expression vector for CIRTS - 6, and an expression vector for CIRTS - 10, a CIRTS - 6 gRNA construct targeting PPIB or an expression vector for a non - targeting control, and a CIRTS - 9 gRNA targeting SMARCA4 or an expression vector for a non - targeting control. (B) Heatmap showing knockdown of the multiplex targeting described in (A). When both CIRTS have on - target gRNAs against the presence of PPIB or SMARCA4, both transcripts can be knocked down in the same sample. Values are shown as the mean expression levels of each target transcript compared to GAPDH in n = 8 biological replicate experiments. (C) Computational prediction of immunogenicity. We first used the IEDB database to predict 9 - mer peptides that are MHC I binders, and the top 1 percentile of binders was subjected to immunogenicity prediction using the IEDB immunogenicity predictor. (Figure 28) gRNA screen by ADAR. Test of whether guide RNA designs featuring multiple hairpins increase the potency of CIRTS. The left panel shows gRNA designs featuring either the original design, or a guide with one TAR hairpin on either end, or a guide with two hairpins on either end. The additional hairpin guides increase the potency of CIRTS in a cellular ADAR activity assay. The right panel is a test of whether the second hairpin needs to be a TAR hairpin or can instead serve the function of just a “stabilizing hairpin” (meaning a hairpin that does not directly interact with the CIRTS protein but delays degradation). As can be seen from the data, the second hairpin increases potency compared to the one-hairpin gRNA design. (Figure 29) Figures 29A - B. (A) Editor from C to U: The data in A demonstrate that CIRTS based on a base editor from C to U is functional using a mammalian cell reporter assay. (B) ssRNA-binding protein. The data in B demonstrate that other ssRNA-binding proteins can function as the RNA-binding protein in the systems and methods of the present disclosure. (Figure 30) Figures 30A - C. (A) Protein containing an RNA regulatory domain capable of activating translation. Guide RNAs are arrayed at various locations on a reporter RNA, and the translation activation of each is measured. (B - C) Protein containing an RNA regulatory domain potentially degrading or destabilizing RNA. Guide RNAs are arrayed at various locations on a reporter RNA, and the RNA degradation of each is measured. (Figure 31) Figures 31A - B. (A) Aspects demonstrating different orientations of elements of the system of the present disclosure. (B) Data using CNOT7 in different orientations (as shown in A) and on two RNA targets: luciferase reporter (left) and endogenous RNA (right). Some different orientations of the protein still function, indicating that the proteins can be engineered in different orders depending on the need for the effector. (FIG. 32) FIGS. 32A - D. CIRTS biosensors for inducible RNA targeting. (A) Schematic overview of the abscisic acid (ABA) CIRTS biosensor design. The gRNA-mediated targeting component of CIRTS is fused to one of the ABA heterodimerization domains (ABI), while the effector component of CIRTS is fused to its binding partner (PYL). Addition of low molecular weight ABA causes the two CIRTS components to dimerize and bring the effector into proximity to the targeted transcript. (B) ABA-induced RNA degradation of the red fluorescent protein (RFP) reporter transcript 48 hours after transfection can be mediated by the Pin nuclease domain or YTHDF2. (C) ABA-induced translational activation of RFP by CIRTS - YTHDF1 48 hours after transfection. (D) Delivery of CIRTS - hADAR with an on-target gRNA in the presence of ABA to cells transfected with a luciferase reporter inactivated by mutation (FlucW417X for editing from A to I or GlucC82R for editing from C to U) induces ABA-dependent RNA editing. **DETAILED DESCRIPTION OF THE INVENTION**

[0061] **Description of Exemplary Embodiments** Epitranscriptome regulation controls information flow through the central dogma and provides a unique opportunity to manipulate cellular states at the RNA level. However, both fundamental mechanism studies and potential translational applications are hampered by the lack of an effective method to target specific RNAs with effector proteins. Here, we present the design and validation of a CRISPR / Cas-inspired RNA targeting system (CIRTS), a new protein engineering strategy for constructing programmable RNA regulation systems. We show that CIRTS is a simple and generalizable approach for delivering a diverse array of effector proteins, including nucleases, degradation machinery, and translation activators, to target transcripts. CIRTS is not only smaller than naturally occurring CRISPR / Cas programmable RNA-binding systems but can also be entirely constructed from human protein parts. The small size and human-derived nature of CIRTS provide a less confounding method for fundamental RNA regulation studies and also offer a potential strategy to avoid immune-related issues when applied to epitranscriptome modulating therapies.

[0062] I. RNA Regulatory Domain It is contemplated that any RNA regulatory domain may be used in the methods and systems of the present disclosure. For example, an RNA regulatory domain having one or more of the following activities may be used: methylation, 5'-3' guanylylation, phosphoribosylation, deamination, carbamoylation, isopentenylation, agmatinylation, acetylation, lysylation, O / S exchange, galactosylation, glutamylation, mannosylation, hydrogenation, pseudouridylation, carboxymethylaminomethylation, aminomethylation, decarboxymethylation, dehydrogenation, carboxymethylation, hydroxylation, methylthiolation, 3-amino-3-carboxypropylylation, demethylation, 5'-5' guanylylation, and dephosphorylation.

[0063] Exemplary RNA regulatory domains include domains (or functional fragments thereof) from the proteins in Table 1 below.

[0064]

Table 1

[0065] Additional RNA regulatory domains include functional domains from the human proteins in Table 2 below.

[0066]

Table 2

[0067] The RNA regulatory domain can be a protein selected from Table 1 or Table 2, or a functional domain derived from a protein selected from the list of proteins in Table 1 or 2. In some embodiments, the RNA regulatory domain comprises a fragment derived from a protein selected from the list of proteins in Table 1 or 2. In some embodiments, the RNA regulatory domain has at least 100, 99, 98, 97, 96, 95, 94, 93, 92, 91, 90, 89, 88, 87, 86, 85, 84, 83, 82, 81, 80, 79, 78, 77, 76, 75, 74, 73, 72, 71, 70, 69, 68, 67, 66, 65, 64, 63, 62, 61, or 60% (or any derivable range therein), up to 100, 99, 98, 97, 96, 95, 94, 93, 92, 91, 90, 89, 88, 87, 86, 85, 84, 83, 82, 81, 80, 79, 78, 77, 76, 75, 74, 73, 72, 71, 70, 69, 68, 67, 66, 65, 64, 63, 62, 61, or 60% (or any derivable range therein), or exactly 100, 99, 98, 97, 96, 95, 94, 93, 92, 91, 90, 89, 88, 87, 86, 85, 84, 83, 82, 81, 80, 79, 78, 77, 76, 75, 74, 73, 72, 71, 70, 69, 68, 67, 66, 65, 64, 63, 62, 61, or 60% (or any derivable range therein) homology or sequence identity to a protein in Table 1 or 2 or a fragment of a protein from Table 1 or 2.

[0068] In some embodiments, the RNA regulatory domain comprises at least 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1050, 1100, 1150, 1200, 1250, 1300, 1350, 1400, 1450, 1500, 1550, 1600, 1650, 1700, 1750, 1800, 1850, 1900, 1950, or 2000 contiguous amino acids (or any derivable range therein) from the proteins of Table 1 or Table 2, at most 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1050, 1100, 1150, 1200, 1250, 1300, 1350, 1400, 1450, 1500, 1550, 1600, 1650, 1700, 1750, 1800, 1850, 1900, 1950, or 2000 contiguous amino acids (or any derivable range therein), or exactly 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1050, 1100, 1150, 1200, 1250, 1300, 1350, 1400, 1450, 1500, 1550, 1600, 1650, 1700, 1750, 1800, 1850, 1900, 1950, or 2000 contiguous amino acids (or any derivable range therein).

[0069] In some embodiments, the RNA regulatory domain comprises a fragment of a protein from Table 1 or 2, wherein the fragment has one or more of the following activities: methylation, 5'-3' guanylylation, phosphoribosylation, deamination, carbamoylation, isopentenylation, agmatinylation, acetylation, lysylation, O / S exchange, galactosylation, glutamylation, mannosylation, hydrogenation, pseudouridine formation, carboxymethylaminomethylation, aminomethylation, decarboxymethylation, dehydrogenation, carboxymethylation, hydroxylation, methylthiolation, 3-amino-3-carboxypropylylation, demethylation, 5'-5' guanylylation, dephosphorylation, nuclease, editing, RNA transport, translational activation, translational repression, single-stranded RNA cleavage activity, double-stranded RNA cleavage activity, and RNA binding activity.

[0070] In some embodiments, the RNA regulatory domain is at or near the carboxy terminus of the RNA hairpin-binding protein. In some embodiments, the RNA regulatory domain is at or near the amino terminus of the RNA hairpin-binding protein. In some embodiments, the RNA regulatory domain is fused to the RNA hairpin-binding protein by a peptide bond. In some embodiments, the RNA regulatory domain is linked to the RNA hairpin-binding protein by a linker moiety.

[0071] II. RNA Hairpin-Binding Domain and Hairpin Structure Other RNA hairpin-binding domains and the hairpin structures to which they bind are known in the art and can be used in the systems, compositions, fusion proteins, kits, vectors, and methods of the present disclosure. For example, embodiments include the RNA hairpin-binding domains and hairpin structures according to the following table (Table 3), which lists proteins containing RNA hairpin-binding domains and the hairpin structures to which they specifically bind.

[0072] (Table 3) RNA Hairpin-Binding Domain TIFF2025084877000029.tif171160

[0073] By using RNA hairpin binding domains that bind to different hairpin structures, it is envisioned that multiple different RNA hairpin binding domains and / or RNA regulatory domains can be used in a multiplexed fashion to target multiple different RNAs in the same cell. The different RNAs can be modulated in the same or different ways. For example, in the same cell, one RNA can be modulated by translational activation while a second RNA can be modulated by translational repression. Therefore, the systems of the present disclosure can be used in a multiplexed fashion for the modulation of at least 2, 3, 4, 5, 6, 7, 8, 9, 10 or more RNAs in one cell, tissue or organism.

[0074] III. Nucleic Acids In certain embodiments, there are recombinant nucleic acids encoding the proteins, polypeptides, regulatory domains or RNA targeting molecules described herein.

[0075] As used in this application, the term "polynucleotide" refers to a nucleic acid molecule that is either recombinant or isolated without including genomic nucleic acids. The term "polynucleotide" includes oligonucleotides (nucleic acids of 100 residues or shorter length), for example, recombinant vectors including plasmids, cosmids, phages, viruses, etc. A polynucleotide includes regulatory sequences that are substantially isolated from their naturally occurring genes or protein coding sequences in certain aspects. A polynucleotide can be single-stranded (coding or antisense) or double-stranded and can be RNA, DNA (genomic, cDNA or synthetic), analogs thereof, or combinations thereof. Additional coding or non-coding sequences may or may not be present within the polynucleotide.

[0076] In this regard, the terms "gene", "polynucleotide" or "nucleic acid" are used to refer to a nucleic acid encoding a protein, polypeptide or peptide (including any sequences required for proper transcription, post-translational modification or localization). As will be understood by those skilled in the art, this term encompasses genomic sequences, expression cassettes, cDNA sequences, as well as smaller engineered nucleic acid segments that can be adapted to express or be adapted to express proteins, polypeptides, domains, peptides, fusion proteins and variants. A nucleic acid encoding all or part of a polypeptide may contain a continuous nucleic acid sequence encoding all or part of such polypeptide. It is also contemplated that a particular polypeptide may contain mutations having slightly different nucleic acid sequences but may still be encoded by nucleic acids encoding the same or substantially similar proteins (see above).

[0077] In certain embodiments, there are isolated nucleic acid segments and recombinant vectors that incorporate a nucleic acid sequence encoding a polypeptide (e.g., a polymerase, RNA polymerase, one or more truncated polymerase domains or interacting components that are polypeptides) that drives gene transcription upon interaction of the interacting components, depending on the polymerase activity from the polymerase domain. The term "recombinant" can be used with a polypeptide or the name of a specific polypeptide and generally refers to a polypeptide that is produced from a nucleic acid molecule that has been manipulated in vitro or a replication product of such a molecule.

[0078] The nucleic acid segment may be combined with other nucleic acid sequences such as a promoter, a polyadenylation signal, additional restriction enzyme sites, a multiple cloning site, other coding segments, etc., regardless of the length of the coding sequence itself, and its overall length can vary significantly. Therefore, it is envisioned that nucleic acid fragments of almost any length can be employed, although the full length is preferably restricted by the ease of preparation and use in the intended recombinant nucleic acid protocol. In some cases, the nucleic acid sequence may encode a polypeptide sequence together with additional heterologous coding sequences, for example, to enable purification, transport, secretion, post-translational modification of the polypeptide, or for therapeutic benefits such as targeting or efficacy. As discussed above, a tag or other heterologous polypeptide may be added to the sequence encoding the modified polypeptide, where "heterologous" here refers to a polypeptide that is not the same as the modified polypeptide.

[0079] In certain embodiments, polynucleotide variants having substantial identity to the sequences disclosed herein; polynucleotide variants having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or higher sequence identity (including any value and range therebetween) when compared to the polynucleotide sequences provided herein using the methods described herein (e.g., BLAST analysis using standard parameters). In certain aspects, the isolated polynucleotide will be a nucleotide sequence encoding a polypeptide having at least 90%, preferably 95% and above identity over the full length of the amino acid sequence described herein; or a nucleotide sequence complementary to said isolated polynucleotide.

[0080] A. Vector A polypeptide can be encoded by a nucleic acid molecule. The nucleic acid molecule can be in the form of a nucleic acid vector. The term "vector" is used to refer to a carrier nucleic acid molecule into which a heterologous nucleic acid sequence can be inserted for introduction into a cell that can be replicated and expressed. The nucleic acid sequence can be "heterologous," which means that the nucleic acid sequence is in a context that is foreign to the cell into which the vector is introduced or to the nucleic acid into which it is integrated, and includes sequences that are homologous to sequences in the cell or nucleic acid but are in a position in the host cell or nucleic acid where they are not normally found. Vectors include DNA, RNA, plasmids, cosmids, viruses (bacteriophages, animal viruses, and plant viruses), and artificial chromosomes (e.g., YACs). One of ordinary skill in the art will be well equipped to construct vectors through standard recombinant techniques (e.g., Sambrook et al., 2001; Ausubel et al., 1996, both incorporated herein by reference). A vector may be used in a host cell to produce an interaction component that is fused, attached, or linked to a polymerase, an RNA polymerase, one or more truncated polymerase domains, or one or more truncated RNA polymerase domains.

[0081] The term "expression vector" refers to a vector that contains a nucleic acid sequence encoding at least a portion of a gene product that can be transcribed. In some cases, the RNA molecule is then translated into a protein, polypeptide, or peptide. An expression vector can contain a variety of "control sequences," which refers to the nucleic acid sequences necessary for the transcription and possibly translation of a functionally linked coding sequence in a particular host organism. In addition to the control sequences that govern transcription and translation, vectors and expression vectors can perform other functions and contain the nucleic acid sequences described herein.

[0082] B. Cells The present disclosure provides a method for modifying a target RNA of interest, specifically, a target RNA of interest in a prokaryotic cell, eukaryotic cell, tissue, organ or organism, and more specifically, in a mammalian cell, tissue, organ or organism. The target RNA can be contained in a nucleic acid molecule within a cell. In some embodiments, the target RNA is in a eukaryotic cell such as a mammalian cell or a plant cell. The mammalian cell can be a cell of a human, non-human primate, cow, pig, rodent or mouse. The cell can be a non-mammalian eukaryotic cell such as a poultry, fish or shrimp cell. The plant cell can be a cell of a crop such as cassava, corn, sorghum, wheat or rice. The plant cell can also be a cell of an algae, tree or vegetable. The modulation of RNA induced in a cell by the methods, systems and compositions of the present disclosure can be a modulation such that the cell and the progeny of the cell are altered for the improved production of a biological product such as an antibody, starch, alcohol or other desired cell product. The modulation of RNA induced in a cell can be a modulation that includes alterations that change the biological product produced by the cell and the progeny of the cell.

[0083] Mammalian cells can be cells of humans or non-human mammals, such as primates, bovines, ovines, porcines, canines, rodents, lagomorphs, such as monkeys, cows, sheep, pigs, dogs, rabbits, rats or mice. The cells can be non-mammalian eukaryotic cells, such as avian (e.g., chickens), vertebrate fish (e.g., salmon) or crustacean (e.g., oysters, bivalves, lobsters, shrimp) cells. The cells can also be plant cells. The plant cells can be cells of monocotyledonous or dicotyledonous plants, or crop or cereal plants such as cassava, corn (maize), sorghum, soybeans, wheat, barley or rice. The plant cells can also be cells of algae, trees or production plants, fruits or vegetables (e.g., trees, e.g., citrus trees, e.g., orange, grapefruit or lemon trees; peach or nectarine trees; apple or pear trees; nut trees, such as almond or walnut or pistachio trees; solanaceous plants; brassica plants; aconite plants; spinach plants; capsicum plants; cotton, tobacco, asparagus, carrots, cabbages, broccoli, cauliflower, tomatoes, eggplants, peppers, lettuce, spinach, strawberries, blueberries, raspberries, blackberries, grapes, coffee, cocoa, etc.).

[0084] As used herein, the terms "cell", "cell line" and "cell culture" can be used interchangeably. All of these terms include all of their progeny, which are all subsequent generations. It is understood that all progeny may not be identical due to intentional or accidental mutations. In the context of the expression of heterologous nucleic acid sequences, "host cell" refers to a prokaryotic or eukaryotic cell and includes any transformable organism capable of replicating a vector or expressing a heterologous gene encoded by a vector. Host cells can be used as recipients of vectors or viruses, as has been used heretofore. Host cells can be "transfected" or "transformed", which refers to the process by which exogenous nucleic acids, such as recombinant protein coding sequences, are introduced or transferred into a host cell. Transformed cells include the subject primary cells and their progeny.

[0085] Some vectors may employ control sequences that enable it to be replicated and / or expressed in both prokaryotic and eukaryotic cells. Those skilled in the art will further understand the conditions for incubating them so that all of the above-described host cells are maintained, and for enabling replication of the vector. Also, techniques and conditions for large-scale production of the vector, and for production of the nucleic acids encoded by the vector and their cognate polypeptides, proteins or peptides are understood and are known.

[0086] C. Expression Systems There are numerous expression systems that include at least a portion or all of the compositions discussed above. Prokaryotic and / or eukaryotic-based systems can be employed for use in certain embodiments to produce nucleic acid sequences or their cognate polypeptides, proteins and peptides. For example, the vectors, fusion proteins, RNA hairpin binding proteins, RNA targeting molecules, RNA regulatory domains, and accessory proteins of the present disclosure can utilize expression systems such as inducible or constitutive expression systems. Many such systems are commercially and widely available.

[0087] The insect cell / baculovirus system can result in high-level protein expression of heterologous nucleic acid segments, which is described, for example, in U.S. Pat. Nos. 5,871,986 and 4,879,236, which are hereby incorporated by reference in their entirety, and can be purchased, for example, under the names INVITROGEN® MAXBAC® 2.0 and CLONTECH® BACPACK™ BACULOVIRUS EXPRESSION SYSTEM.

[0088] In addition to the disclosed expression system, examples of other expression systems include the COMPLETE CONTROL Inducible Mammalian Expression System from STRATAGENE® that includes a synthetic ecdysone-inducible receptor, or its pET expression system, which is an E. coli expression system. Another example of an inducible expression system is available from INVITROGEN® and is the T-REX™ (tetracycline-regulated expression) system, an inducible mammalian expression system that uses a full-length CMV promoter. INVITROGEN® also offers a yeast expression system called the Pichia methanolica expression system, which is designed for high-level recombinant protein production in the methylotrophic yeast Pichia methanolica. Those skilled in the art will be aware of methods for expressing vectors, such as expression constructs, to produce nucleic acid sequences or their cognate polypeptides, proteins or peptides.

[0089] D. Conjugation of Nucleic Acids and Polypeptides Aspects of the present disclosure relate to the conjugation of nucleic acids to polypeptides. Methods for conjugating nucleic acids to polypeptides are known in the art and include those described hereinafter. Aspects of the present disclosure relate to nucleic acid-polypeptide molecules and methods of making the molecules themselves in which nucleic acids are conjugated to polypeptides by the methods described herein. One such example involves click chemistry. The "click reaction," also referred to as "click chemistry," is a name commonly used to describe a stepwise variant of the Huisgen 1,3-dipolar cycloaddition of azides and alkynes that produces 1,2,3-triazoles. This reaction is carried out under ambient conditions or mild microwave irradiation, typically in the presence of a Cu(I) catalyst, and exhibits exclusive regioselectivity for 1,4-disubstituted triazole products when mediated by a catalytic amount of a Cu(I) salt [V. Rostovtsev, L. G. Green, V. V. Fokin, K. B. Sharpless, Angew. Chem. Int. Ed. 2002, 41, 2596; H. C. Kolb, M. Finn, K. B. Sharpless, Angew Chem., Int. Ed. 2001, 40, 2004].

[0090] In other conjugation methods, mutant forms of the human DNA repair protein O6-alkylguanine-DNA alkyltransferase react rapidly and specifically with O6-benzylguanine (BG) and derivatives bearing a large moiety linked to the benzyl group. When guanine serves as a leaving group, the benzyl moiety becomes covalently linked to a cysteine in the active site of the enzyme. This enzyme has also been mutagenized to be specific for O6-benzylcytosine (BC) in a similar manner. These enzyme domains (˜20 kDa) are commercially available as the SNAP-tag and the CLIP-tag, respectively.

[0091] Additional conjugation methods utilize the HaloTag. The HaloTag utilizes a chemical reaction orthogonal to eukaryotes, namely, the dehalogenation of haloalkane ligands, and thus provides highly specific covalent labeling of tags and, by extension, proteins in both live and fixed cells.

[0092] E. Nucleic Acid Modifications Oligonucleotides of the disclosure, such as RNA targeting molecules and other nucleic acids described herein, may have modifications that enhance the stability of the nucleic acid. In some embodiments, the RNA targeting molecule is an oligonucleotide analog. The term "oligonucleotide analog" refers to a compound that functions like an oligonucleotide but has a moiety that does not occur naturally. Oligonucleotide analogs can have a modified sugar moiety, a modified base moiety, or a modified sugar-sugar linkage. The term "oligomer" is intended to include oligonucleotides, oligonucleotide analogs, or oligonucleosides. Thus, when referring to an "oligomer," it is meant a series of nucleosides or nucleoside analogs connected via either a native phosphodiester bond or other linkages including a four-atom linker. The linkage is generally a linkage from the 3' carbon of one nucleoside to the 5' carbon of a second nucleoside, but the term "oligomer" can also include other linkages such as 2'-5' linkages.

[0093] Oligonucleotide analogs can also include other modifications, specifically modifications that increase nuclease resistance, improve binding affinity, and / or improve binding specificity. For example, when the sugar moiety of a nucleoside or nucleotide is replaced by a carbocyclic moiety, it is no longer a sugar. Further, when other substitutions are made, such as substitution of the internucleoside phosphodiester linkage, the resulting substance is no longer a true nucleic acid species. All such compounds are considered analogs. Throughout this specification, reference to the sugar moiety of a nucleic acid species is to be understood to refer to either the true sugar or a species incorporating the structural location of the sugar of the wild-type nucleic acid. Further, reference to an internucleoside linkage is to be understood to include moieties that serve to connect sugar or sugar analog moieties in the manner of a wild-type nucleic acid.

[0094] The present disclosure relates to modified oligonucleotides, i.e., oligonucleotide analogs or oligonucleosides, and methods for achieving such modifications. These modified oligonucleotides and oligonucleotide analogs can exhibit increased chemical and / or enzymatic stability compared to their naturally occurring counterparts. Extracellular and intracellular nucleases generally do not recognize backbone-modified compounds and, therefore, do not bind to such compounds. The absence of a negatively charged backbone when present in the protonated acid form can facilitate cell permeation.

[0095] Modified internucleoside linkages are intended to confer nuclease resistance and high intracellular uptake to compounds by replacing the naturally occurring phosphodiester-5'-methylene linkage with a four-atom linking group. Preferred linkages have the structure CH2--RA--NR1 CH2, CH2--NR1--RA--CH2, RA--NR1--CH2--CH2, CH2--CH2--NR1--RA, CH2--CH2--RA--NR1, or NR1--RA--CH2--CH2, where RA is O or NR2.

[0096] Modifications can be achieved using a solid support that can be manually operated or a solid support that can be used in combination with a DNA synthesizer using methodologies generally known to those skilled in the art of solid supports or DNA synthesizers. Generally, the procedure involves functionalizing the sugar moieties of two adjacent nucleosides in the selected sequence. In the 5' to 3' direction, the "upstream" synthon is modified at its 3' site at the end, while the "downstream" synthon is modified at its 5' site at the end.

[0097] Oligonucleosides linked by hydrazine, hydroxylamines and other linking groups can be protected at the 5'-hydroxyl by a dimethoxytrityl group and activated at the 3'-hydroxyl using a cyanoethyl diisopropyl-phosphite moiety for coupling. These compounds can be inserted into any desired sequence by standard solid-phase automated DNA synthesis techniques. One of the most popular processes is the phosphoramidite technique. Oligonucleotides containing uniform backbone linkages can be synthesized by the use of a CPG-solid support and standard nucleic acid synthesizers such as the Applied Biosystems Inc. 380B and 394 and the Milligen / Biosearch 7500 and 8800s. The initial nucleotide (number 1 at the 3' end) is attached to a solid support such as controlled pore glass. In a sequence-specific order, each new nucleotide is attached either manually or by an automated synthesizer system.

[0098] The free amino group can be alkylated, for example, in acetic acid with acetone and sodium cyanoborohydride. The alkylation step can be used to introduce other useful functional molecules onto the macromolecule. Such useful functional molecules include, but are not limited to, reporter molecules, RNA cleavage groups, groups for improving the pharmacokinetic properties of oligonucleotides, and groups for improving the pharmacodynamic properties of oligonucleotides. Such molecules can be attached or conjugated to the macromolecule via attachment to a nitrogen atom in the backbone linkage. Alternatively, such molecules can be attached to pendant groups extending from the hydroxyl groups of one or more sugar moieties of the nucleotide. Examples of such other useful functional groups are provided by WO1993007883, which is incorporated herein by reference, and other of the patent applications referenced above.

[0099] The solid support can include any of the solid supports known in the art for polynucleotide synthesis, including controlled pore glass (CPG), oxalyl controlled pore glass

[53] , TentaGel Support (aminopolyethylene glycol derivatized support)

[54] , or Poros (a copolymer of polystyrene / divinylbenzene). Attachment and cleavage of nucleotides and oligonucleotides can be accomplished via standard procedures

[55] . As used herein, the term solid support further includes any linker (e.g., long chain alkylamines and succinyl residues) used to attach a growing oligonucleoside to a stationary phase such as CPG.

[0100] 1. Locked nucleotides In some embodiments, the nucleic acids of the present disclosure, such as RNA targeting molecules, include locked nucleic acids. Locked nucleic acids, also referred to as inaccessible RNA (LNA or Ln), are modified RNA nucleotides. The ribose portion of an LNA nucleotide is modified with a special bridge that links the 2'-oxygen and the 4'-carbon. This bridge "locks" the ribose in the 3'-end (North) conformation commonly seen in A-form duplexes. LNA nucleotides can be mixed with DNA or RNA residues in an oligonucleotide at any desired time and hybridize to DNA or RNA according to Watson-Crick base pairing rules. Such oligomers are chemically synthesized and commercially available. The locked ribose conformation enhances base stacking and pre-organization of the backbone. This significantly increases the hybridization properties (melting point) of the oligonucleotide.

[0101] 2. Ethylene-bridged nucleotides In some embodiments, the nucleic acids of the present disclosure, such as RNA targeting molecules, include one or more ethylene-bridged nucleotides. Ethylene-bridged nucleic acids (ENA or En) are modified nucleotides having a 2'-O, 4'C ethylene linkage. Like locked nucleotides, these nucleotides also restrict sugar packing into the N-conformation of RNA.

[0102] 3. Peptide nucleic acids In some embodiments, the nucleic acids of the disclosure, such as RNA targeting molecules, include one or more peptide nucleic acids. Peptide nucleic acids (PNA or Pn) mimic the behavior of DNA and bind to complementary nucleic acid strands. The term "peptide" as used herein may also refer to peptide nucleic acids. PNA is an artificially synthesized polymer similar to DNA or RNA. DNA and RNA have deoxyribose and ribose sugar backbones, respectively, while the backbone of PNA is composed of repeating N-(2-aminoethyl)-glycine units linked by peptide bonds. Various purine and pyrimidine bases are linked to the backbone by methylene bridges (-CH2-) and carbonyl groups (-(C=O)-). PNA is depicted with the N-terminus at the first (left) position and the C-terminus at the last (right) position, like a peptide.

[0103] Since the backbone of PNA does not contain charged phosphate groups, the binding between PNA / DNA strands is stronger than that between DNA / DNA strands due to the absence of electrostatic repulsion. PNA is not readily recognized by either nucleases or proteases, and thereby PNA becomes resistant to enzymatic degradation. PNA is also stable over a wide pH range. In some aspects, the PNA described herein has improved cytosolic delivery over other PNAs.

[0104] 4. 5'(E)-vinyl-phosphonic acid (VP) modification In some embodiments, the nucleic acids of the disclosure, such as RNA targeting molecules, include one or more 5'(E)-vinyl-phosphonic acid (VP) modifications. 5'-vinyl-phosphonic acid modification (a metabolically stable phosphate mimic) has been reported to enhance the metabolic stability and potency of oligonucleotides.

[0105] 5. Morpholino In some embodiments, the nucleic acids of the disclosure, such as RNA targeting molecules, include morpholinos. Morpholinos are synthetic molecules that are products of the re-engineering of the natural nucleic acid structure. They are typically 25 bases in length and they bind to complementary sequences of RNA or single-stranded DNA by standard nucleic acid base pairing. Structurally, the difference between a morpholino and DNA is that although morpholinos have standard nucleic acid bases, these bases are attached to a methylene morpholine ring linked through phosphorodiamidate groups instead of phosphates. The figure compares the structures of two strands where one depicted therein is RNA and the other is a morpholino. Replacing the anionic phosphate with a non-charged phosphorodiamidate group eliminates ionization in the normal physiological pH range, so that morpholinos in an organism or cell are non-charged molecules. The entire backbone of the morpholino is made from these modified subunits.

[0106] IV. Delivery Vehicle The disclosure contemplates several delivery systems that are compatible with nucleic acids and that provide a substantially uniform distribution and have a controllable release rate. A variety of different media that are useful in creating nucleic acid delivery systems are described below. It is not intended that any of the media or carriers be limiting of the invention. Note that any media or carrier may be combined with another media or carrier; for example, in one embodiment, a polymeric microparticle carrier attached to a compound may be combined with a gel media.

[0107] Carriers or media contemplated by the present disclosure include materials selected from the group consisting of gelatin, collagen, cellulose ester, dextran sulfate, pentosan polysulfate, chitin, saccharides, albumin, fibrin sealant, synthetic polyvinyl pyrrolidone, polyethylene oxide, polypropylene oxide, block polymers of polyethylene oxide and polypropylene oxide, polyethylene glycol, acrylate, acrylamide, methacrylates including 2-hydroxyethyl methacrylate without limitation, poly(ortho ester), cyanoacrylate, gelatin-resorcinol-aldehyde type bioadhesives, polyacrylic acid, and their copolymers and block copolymers.

[0108] A. Particles Some aspects of the present disclosure contemplate delivery systems that include particles. Preferably, the particles include liposomes, nanoparticles, microspheres, nanospheres, microcapsules, and nanocapsules. Preferably, some of the particles contemplated by the present invention include aliphatic polyesters including, without limitation, poly(lactide-co-glycolide), poly-glycolic acid, and poly-lactic acid, hyaluronic acid, modified polysaccharides, chitosan, cellulose, dextran, polyurethane, polyacrylic acid, pseudotyped poly(amino acids), polyhydroxybutyrate-related copolymers, polyanhydrides, polymethyl methacrylate, poly(ethylene oxide), lecithin, and phospholipids.

[0109] B. Liposomes One aspect of the present disclosure contemplates liposomes that can attach and release nucleic acid conjugates, polypeptides, and fusion proteins as described herein. Liposomes are microscopic spherical lipid bilayers surrounding an aqueous core, composed of amphiphilic molecules such as phospholipids. For example, liposomes can trap nucleic acids between the hydrophobic tails of phospholipid micelles. Water-soluble agents can be confined in the core, and lipid-soluble agents can be dissolved in the shell-like bilayer. Liposomes have special properties in that they allow water-soluble and water-insoluble chemicals to be used together in a medium without using surfactants or other emulsifiers. Liposomes can be formed spontaneously by vigorously mixing phospholipids in an aqueous medium. Water-soluble compounds are dissolved in an aqueous solution that can hydrate the phospholipids. Therefore, when liposomes are formed, these compounds are trapped inside the aqueous liposome core. The liposome wall is a phospholipid membrane that holds lipid-soluble materials such as oil. Liposomes provide controlled release of the incorporated compounds. In addition, liposomes can be coated with water-soluble polymers such as polyethylene glycol to increase the pharmacokinetic half-life. One aspect of the present invention contemplates an ultra-high shear technique for improving liposome production that results in stable unilamellar (single-layer) liposomes with specially designed structural features. These unique properties of liposomes allow the simultaneous storage of normally immiscible compounds and their ability to be released in a controlled manner.

[0110] In some aspects, the present disclosure contemplates both cationic and anionic liposomes as well as liposomes having neutral lipids. Preferably, cationic liposomes contain negatively charged materials by mixing the materials with fatty acid liposome components and allowing their charge-association. Clearly, the choice of cationic or anionic liposomes depends on the desired pH of the final liposome mixture. Examples of cationic liposomes include lipofectin, lipofectamine, and lipofectace.

[0111] One aspect of the present disclosure contemplates a delivery system comprising liposomes that provide controlled release of at least one molecule described herein. Preferably, the liposomes capable of controlled release are: i) biodegradable and non-toxic; ii) possess both water-soluble and oil-soluble compounds; iii) solubilize intractable compounds; iv) prevent oxidation of compounds; v) promote protein stabilization; vi) control hydration; vii) control compound release by variations in bilayer composition, including but not limited to fatty acid chain length, fatty acid lipid composition, relative amounts of saturated and unsaturated fatty acids, and physical configuration; viii) have solvent dependence; iv) have pH dependence; and v) have temperature dependence.

[0112] Liposome compositions are broadly categorized into two classifications. Conventional liposomes are generally mixtures of stabilized natural lecithins (PC) that may or may not contain synthetic identical-chain phospholipids and may contain glycolipids. Specific liposomes may include: i) bipolar fatty acids; ii) the ability to attach to antibodies for tissue-targeted therapy; iii) being coated with materials such as but not limited to lipoproteins and carbohydrates; iv) multiple encapsulation; and v) emulsion compatibility.

[0113] Liposomes can be readily prepared in the laboratory by methods such as but not limited to sonication and vibration. Alternatively, compound delivery liposomes are commercially available. For example, Collaborative Laboratories is known to manufacture custom-designed liposomes for special delivery requirements.

[0114] C. Microspheres, microparticles, and microcapsules Microspheres and microcapsules are useful because they can maintain an overall uniform distribution, provide stable controlled release of compounds, and are economical with respect to production and distribution. Preferably, the accompanying delivery gel or compound-permeating gel is transparent or the gel is colored to facilitate visualization by medical personnel.

[0115] Microspheres are commercially available (Prolease™, Alkermes: Cambridge, Mass.). For example, a freeze-dried medium containing at least one therapeutic agent is homogenized in a suitable solvent and sprayed to produce microspheres in the range of 20-90 μm. Next, techniques follow to maintain the integrity of the sustained release during the stages of purification, encapsulation, and storage. Scott et al., Improving Protein Therapeutics With Sustained Release Formulations, Nature Biotechnology, Volume 16:153-157 (1998). Modification of the microsphere composition by use of biodegradable polymers can provide the ability to control the release rate of the nucleic acid. Miller et al., Degradation Rates of Oral Resorbable Implants {Polylactates and Polyglycolates: Rate Modification and Changes in PLA / PGA Copolymer Ratios, J. Biomed. Mater. Res., Vol. 11:711-719 (1977).

[0116] Alternatively, sustained release or controlled release microsphere preparations are prepared using the water-in-oil drying method, in which case first an organic solvent solution of a biodegradable polymer metal salt is prepared. Thereafter, a nucleic acid dissolution or dispersion medium is added to the biodegradable polymer metal salt solution. The weight ratio of the nucleic acid to the biodegradable polymer metal salt can be, for example, from about 1:100,000 to about 1:1, preferably from about 1:20,000 to about 1:500, more preferably from about 1:10,000 to about 1:500. Next, the organic solvent solution containing the biodegradable polymer metal salt and the nucleic acid is poured into the aqueous phase to prepare an oil / water emulsion. Then, the solvent in the oil phase is removed by evaporation to obtain microspheres. Finally, these microspheres are recovered, washed, and lyophilized. Thereafter, the microspheres may be heated under reduced pressure to remove residual water and organic solvents.

[0117] Other methods useful in producing microspheres compatible with the biodegradable polymer metal salt and nucleic acid mixture are: i) phase separation during stepwise addition of a coacervating agent; ii) a water-in-oil drying method or a phase separation method in which an anti-aggregation agent is added to prevent aggregation of the particles; and iii) by spray drying.

[0118] In one aspect, the present invention contemplates a medium comprising microspheres or microcapsules capable of delivering controlled release of nucleic acid over a period of approximately 1 day to 6 months. In one aspect, the microspheres or microparticles may be colored so that they can be clearly recognized by a medical practitioner when the medium is dispersed. In another aspect, the microspheres or microcapsules can be transparent. In another aspect, the microspheres or microparticles are impregnated with a radiopaque fluoroscopic dye.

[0119] Controlled-release microcapsules can be produced by using known encapsulation techniques such as centrifugal extrusion, pan coating, and suspension in air. Such microspheres and / or microcapsules can be manipulated to achieve the desired release rate. For example, Oliosphere™ (Macromed) is a controlled-release microsphere system. These particular microspheres are available in a uniform size in the range of 5 to 500 μm and are composed of biocompatible and biodegradable polymers. The special polymer composition of the microspheres can control the nucleic acid release rate so that custom-designed microspheres are possible, including effective management of the burst effect. ProMaxx™ (Epic Therapeutics, Inc.) is a protein-matrix delivery system. This system is naturally aqueous and adaptable to standard pharmaceutical delivery models. In particular, ProMaxx™ is a bioerodible protein microsphere that delivers both low-molecular-weight and high-molecular-weight drugs and may be customized with respect to both microsphere size and desired release characteristics.

[0120] In one aspect, the microspheres or microparticles comprise a pH-sensitive encapsulating material that is stable at a pH lower than the pH within the mesentery. A typical range within the mesentery is from pH 7.6 to pH 7.2. As a result, the microcapsules should be maintained at a pH below 7. However, if pH fluctuations are anticipated, the pH-sensitive material can be selected based on different pH criteria required for dissolution of the microcapsules. Therefore, the nucleic acid to be encapsulated is selected with respect to the pH environment in which dissolution is desired and stored at a pH preselected to maintain stability. Examples of pH-sensitive materials useful as encapsulating materials are Eudragit™ L-100 or S-100 (Rohm GMBH), hydroxypropylmethylcellulose phthalate, hydroxypropylmethylcellulose acetate succinate, polyvinyl acetate phthalate, cellulose acetate phthalate, and cellulose acetate trimellitate. In one aspect, lipids constitute the inner coating of the microcapsules. In these compositions, these lipids can be, but are not limited to, partial esters of fatty acids and hexitiol anhydrides, and edible fats such as triglycerides. Lew C. W., Controlled-Release pH Sensitive Capsule And Adhesive System And Method. U.S. Patent No. 5,364,634 (incorporated herein by reference).

[0121] In one aspect, the present invention contemplates microparticles comprising gelatin, or other polymer cations having a charge density similar to gelatin (i.e., poly-L-lysine), which are used as a complex for forming primary microparticles. The primary microparticles are produced as a mixture of the following compositions: i) gelatin (60 bloom, type A from porcine skin), ii) chondroitin 4-sulfate (0.005% - 0.1%), iii) glutaraldehyde (25%, grade 1), and iv) 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC hydrochloride), and ultra-high purity sucrose (Sigma Chemical Co., St. Louis, Mo.). The source of gelatin is not considered important; gelatin can be derived from bovine, porcine, human, or other animal sources. Typically, the polymer cation is between 19,000 and 30,000 daltons. Then, chondroitin sulfate is added to the complex as a coacervation agent together with sodium sulfate or ethanol.

[0122] Following the formation of the microparticles, the nucleic acid is either directly bound to the surface of the microparticles or indirectly attached using a "bridge" or "spacer". The amino groups of the gelatin lysine groups are readily derivatized, providing sites for direct coupling of compounds. Alternatively, spacers such as avidin-biotin (i.e., linking a molecule and a derivatized moiety on a targeting ligand) are also useful for indirectly coupling a targeting ligand to the microparticles. The stability of the microparticles is controlled by the amount of glutaraldehyde-spacer cross-linking induced by EDC hydrochloride. Also, the controlled release medium is empirically determined by the final density of the glutaraldehyde-spacer cross-linking.

[0123] In one aspect, the present invention contemplates microparticles formed by spray drying a composition containing fibrinogen or thrombin together with a nucleic acid. Preferably, these microparticles are soluble and the selected protein (i.e., fibrinogen or thrombin) creates the walls of the microparticles. As a result, the nucleic acid is incorporated within and between the protein walls of the microparticles. Heath et al., Microparticles And Their Use In Wound Therapy. U.S. Patent No. 6,113,948 (incorporated herein by reference). After the microparticles are applied to living tissue, the subsequent reaction of fibrinogen and thrombin creates a tissue sealant, whereby the incorporated compound is released into the immediate surrounding area.

[0124] One of ordinary skill in the art will understand that the shape of the microspheres need not be precisely spherical; simply very small particles that can be sprayed or diffused (i.e., opened or closed) into or onto the surgical site will suffice. In one aspect, the microparticles are composed of a biocompatible and / or biodegradable material selected from the group consisting of polylactide, polyglycolide, and copolymers of lactide / glycolide (PLGA), hyaluronic acid, modified polysaccharides, and any other well-known materials.

[0125] V. Proteinaceous Composition The polypeptides or polynucleotides of the present disclosure, such as CIRT fusion proteins, stabilizer polypeptides, linkers, RNA hairpin binding domains, NES, RNA regulatory domains, tags, NLS, RNA targeting molecules, hairpin regions of RNA targeting molecules, helical regions, or targeting regions of RNA targeting molecules, may contain 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 or more variant amino acid or nucleic acid substitutions of SEQ ID NOs: 1-132, or at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193,194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 300, 400, 500, 550, 1000 or more or at most 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 300, 400, 500, 550, 1000 or more consecutive amino acids or nucleic acids, or any derivable range thereof, may be at least 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% similar, identical or homologous.

[0126] The polypeptides or polynucleotides of the present disclosure, such as CIRT fusion proteins, stabilizer polypeptides, linkers, RNA hairpin binding domains, NES, RNA regulatory domains, tags, NLS, RNA targeting molecules, hairpin regions of RNA targeting molecules, helical regions, or targeting regions of RNA targeting molecules, are SEQ IDNO: 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 300, 400, 500, 550, 1000 or more consecutive amino acids, or any derivable range thereof may be included.

[0127] In some embodiments, the fusion protein is 1 to 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265 of SEQ ID NO: 87 - 106 or 128 - 132.266、267、268、269、270、271、272、273、274、275、276、277、278、279、280、281、282、283、284、285、286、287、288、289、290、291、292、293、294、295、296、297、298、299、300、301、302、303、304、305、306、307、308、309、310、311、312、313、314、315、316、317、318、319、320、321、322、323、324、325、326、327、328、329、330、331、332、333、334、335、336、337、338、339、340、341、342、343、344、345、346、347、348、349、350、351、352、353、354、355、356、357、358、359、360、361、362、363、364、365、366、367、368、369、370、371、372、373、374、375、376、377、378、379、380、381、382、383、384、385、386、387、388、389、390、391、392、393、394、395、396、397、398、399、400、401、402、403、404、405、406、407、408、409、410、411、412、413、414、415、416、417、418、419、420、421、422、423、424、425、426、427、428、429、430、431、432、433、434、435、436、437、438、439、440、441、442、443、444、445、446、447、448、449、450、451、452、453、454、455、456、457、458、459、460、461、462、463、464、465、466、467、468、469、470、471、472、473、474、475、476、477、478、479、480、481、482、483、484、485、486、487、488、489、490、491、492、493、494、495、496、497、498、499、500、501、502、503、504、505、506、507、508、509、510、511、512、513、514、515、It may contain amino acids of 516, 517, 518, 519, 520, 521, 522, 523, 524, 525, 526, 527, 528, 529, 530, 531, 532, 533, 534, 535, 536, 537, 538, 539, 540, 541, 542, 543, 544, 545, 546, 547, 548, 549, 550, 551, 552, 553, 554, 555, 556, 557, 558, 559, 560, 561, 562, 563, 564, 565, 566, 567, 568, 569, 570, 571, 572, 573, 574, 575, 576, 577, 578, 579, 580, 581, 582, 583, 584, 585, 586, 587, 588, 589, 590, 591, 592, 593, 594, 595, 596, 597, 598, 599, 600, 601, 602, 603, 604, 605, 606, 607, 608, 609, 610, 611, 612, 613, 614, or 615 (or any derivable range therein).

[0128] In some embodiments, the fusion protein is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265 of SEQ ID NO: 87-106 or 128-132.266、267、268、269、270、271、272、273、274、275、276、277、278、279、280、281、282、283、284、285、286、287、288、289、290、291、292、293、294、295、296、297、298、299、300、301、302、303、304、305、306、307、308、309、310、311、312、313、314、315、316、317、318、319、320、321、322、323、324、325、326、327、328、329、330、331、332、333、334、335、336、337、338、339、340、341、342、343、344、345、346、347、348、349、350、351、352、353、354、355、356、357、358、359、360、361、362、363、364、365、366、367、368、369、370、371、372、373、374、375、376、377、378、379、380、381、382、383、384、385、386、387、388、389、390、391、392、393、394、395、396、397、398、399、400、401、402、403、404、405、406、407、408、409、410、411、412、413、414、415、416、417、418、419、420、421、422、423、424、425、426、427、428、429、430、431、432、433、434、435、436、437、438、439、440、441、442、443、444、445、446、447、448、449、450、451、452、453、454、455、456、457、458、459、460、461、462、463、464、465、466、467、468、469、470、471、472、473、474、475、476、477、478、479、480、481、482、483、484、485、486、487、488、489、490、491、492、493、494、495、496、497、498、499、500、501、502、503、504、505、506、507、508、509、510、511、512、513、514、515、It may contain contiguous amino acids of 516, 517, 518, 519, 520, 521, 522, 523, 524, 525, 526, 527, 528, 529, 530, 531, 532, 533, 534, 535, 536, 537, 538, 539, 540, 541, 542, 543, 544, 545, 546, 547, 548, 549, 550, 551, 552, 553, 554, 555, 556, 557, 558, 559, 560, 561, 562, 563, 564, 565, 566, 567, 568, 569, 570, 571, 572, 573, 574, 575, 576, 577, 578, 579, 580, 581, 582, 583, 584, 585, 586, 587, 588, 589, 590, 591, 592, 593, 594, 595, 596, 597, 598, 599, 600, 601, 602, 603, 604, 605, 606, 607, 608, 609, 610, 611, 612, 613, 614, or 615 (or any derivable range therein).

[0129] In some embodiments, the fusion protein is at least 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%, at most 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%, or exactly 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% similar, identical or homologous to one of SEQ ID NOs: 87-106 or 128-132, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125,126、127、128、129、130、131、132、133、134、135、136、137、138、139、140、141、142、143、144、145、146、147、148、149、150、151、152、153、154、155、156、157、158、159、160、161、162、163、164、165、166、167、168、169、170、171、172、173、174、175、176、177、178、179、180、181、182、183、184、185、186、187、188、189、190、191、192、193、194、195、196、197、198、199、200、201、202、203、204、205、206、207、208、209、210、211、212、213、214、215、216、217、218、219、220、221、222、223、224、225、226、227、228、229、230、231、232、233、234、235、236、237、238、239、240、241、242、243、244、245、246、247、248、249、250、251、252、253、254、255、256、257、258、259、260、261、262、263、264、265、266、267、268、269、270、271、272、273、274、275、276、277、278、279、280、281、282、283、284、285、286、287、288、289、290、291、292、293、294、295、296、297、298、299、300、301、302、303、304、305、306、307、308、309、310、311、312、313、314、315、316、317、318、319、320、321、322、323、324、325、326、327、328、329、330、331、332、333、334、335、336、337、338、339、340、341、342、343、344、345、346、347、348、349、350、351、352、353、354、355、356、357、358、359、360、361、362、363、364、365、366、367、368、369、370、371、372、373、374、375、It may contain consecutive amino acids of 376, 377, 378, 379, 380, 381, 382, 383, 384, 385, 386, 387, 388, 389, 390, 391, 392, 393, 394, 395, 396, 397, 398, 399, 400, 401, 402, 403, 404, 405, 406, 407, 408, 409, 410, 411, 412, 413, 414, 415, 416, 417, 418, 419, 420, 421, 422, 423, 424, 425, 426, 427, 428, 429, 430, 431, 432, 433, 434, 435, 436, 437, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 459, 460, 461, 462, 463, 464, 465, 466, 467, 468, 469, 470, 471, 472, 473, 474, 475, 476, 477, 478, 479, 480, 481, 482, 483, 484, 485, 486, 487, 488, 489, 490, 491, 492, 493, 494, 495, 496, 497, 498, 499, 500, 501, 502, 503, 504, 505, 506, 507, 508, 509, 510, 511, 512, 513, 514, 515, 516, 517, 518, 519, 520, 521, 522, 523, 524, 525, 526, 527, 528, 529, 530, 531, 532, 533, 534, 535, 536, 537, 538, 539, 540, 541, 542, 543, 544, 545, 546, 547, 548, 549, 550, 551, 552, 553, 554, 555, 556, 557, 558, 559, 560, 561, 562, 563, 564, 565, 566, 567, 568, 569, 570, 571, 572, 573, 574, 575, 576, 577, 578, 579, 580, 581, 582, 583, 584, 585, 586, 587, 588, 589, 590, 591, 592, 593, 594, 595, 596, 597, 598, 599, 600, 601, 602, 603, 604, 605, 606, 607, 608, 609, 610, 611, 612, 613, 614, or 615 (or any derivable range therein).

[0130] In other embodiments, the stabilizer polypeptide may comprise amino acids 1 to 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, or 90, or any derivable range thereof, of SEQ ID NO: 5, 19, or 20.

[0131] In some embodiments, the stabilizer polypeptide may comprise consecutive amino acids 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, or 90 (or any derivable range thereof) of SEQ ID NO: 5, 19, or 20.

[0132] In some embodiments, the stabilizer polypeptide is at least 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%, at most 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%, or exactly 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% similar, identical or homologous to one of SEQ ID NO: 5, 19, or 20 and may comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, or 90 (or any derivable range therein) consecutive amino acids of SEQ ID NO: 5, 19, or 20.

[0133] In some embodiments, the RNA hairpin binding domain may comprise the amino acids of SEQ ID NO: 7 or 18 at positions 1 to 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, or 102 (or any derivable range therein).

[0134] In some embodiments, the RNA hairpin binding domain may comprise consecutive amino acids of SEQ ID NO: 7 or 18 at positions 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, or 102 (or any derivable range therein).

[0135] In some embodiments, the RNA hairpin binding domain is at least 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%, at most 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%, or exactly 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% similar, identical or homologous to one of SEQ ID NO:7 or 18, and may comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, or 102 (or any derivable range therein) consecutive amino acids of SEQ ID NO:7 or 18.

[0136] In some embodiments, the RNA regulatory domain is 1 to 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264 of SEQ ID NO: 9, 11, 15 - 17, or 123 - 125It may contain amino acids of 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337, 338, 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363, or 364 (or any derivable range thereof).

[0137] In some embodiments, the RNA regulatory domain is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264 of SEQ ID NO:9, 11, 15 - 17, or 123 - 125.It may contain consecutive amino acids of 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337, 338, 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363, or 364 (or any derivable range thereof).

[0138] In some aspects, any one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, twenty, twenty-one, twenty-two, twenty-three, twenty-four, twenty-five, twenty-six, twenty-seven, twenty-eight, twenty-nine, thirty, thirty-one, thirty-two, thirty-three, thirty-four, thirty-five, thirty-six, thirty-seven, thirty-eight, thirty-nine, forty, forty-one, forty-two, forty-three, forty-four, forty-five, forty-six, forty-seven, forty-eight, forty-nine, fifty, fifty-one, fifty-two, fifty-three, fifty-four, fifty-five, fifty-six, fifty-seven, fifty-eight, fifty-nine, sixty, sixty-one, sixty-two, sixty-three, sixty-four, sixty-five, sixty-six, sixty-seven, sixty-eight, sixty-nine, seventy, seventy-one, seventy-two, seventy-three, seventy-four, seventy-five, seventy-six, seventy-seven, seventy-eight, seventy-nine, eighty, eighty-one, eighty-two, eighty-three, eighty-four, eighty-five, eighty-six, eighty-seven, eighty-eight, eighty-nine, ninety, ninety-one, ninety-two, ninety-three, ninety-four, ninety-five, ninety-six, ninety-seven, ninety-eight, ninety-nine, one hundred, one hundred and one, one hundred and two, one hundred and three, one hundred and four, one hundred and five, one hundred and six, one hundred and seven, one hundred and eight, one hundred and nine, one hundred and ten, one hundred and eleven, one hundred and twelve, one hundred and thirteen, one hundred and fourteen, one hundred and fifteen, one hundred and sixteen, one hundred and seventeen, one hundred and eighteen, one hundred and nineteen, one hundred and twenty, one hundred and twenty-one, one hundred and twenty-two, one hundred and twenty-three, one hundred and twenty-four, one hundred and twenty-five, one hundred and twenty-six, one hundred and twenty-seven, one hundred and twenty-eight, one hundred and twenty-nine, one hundred and thirty, one hundred and thirty-one, one hundred and thirty-two, one hundred and thirty-three, one hundred and thirty-four, one hundred and thirty-five, one hundred and thirty-six, one hundred and thirty-seven, one hundred and thirty-eight, one hundred and thirty-nine, one hundred and forty, one hundred and forty-one, one hundred and forty-two, one hundred and forty-three, one hundred and forty-four, one hundred and forty-five, one hundred and forty-six, one hundred and forty-seven, one hundred and forty-eight, one hundred and forty-nine, one hundred and fifty, one hundred and fifty-one, one hundred and fifty-two, one hundred and fifty-three, one hundred and fifty-four, one hundred and fifty-five, one hundred and fifty-six, one hundred and fifty-seven, one hundred and fifty-eight, one hundred and fifty-nine, one hundred and sixty, one hundred and sixty-one, one hundred and sixty-two, one hundred and sixty-three, one hundred and sixty-four, one hundred and sixty-five, one hundred and sixty-six, one hundred and sixty-seven, one hundred and sixty-eight, one hundred and sixty-nine, one hundred and seventy, one hundred and seventy-one, one hundred and seventy-two, one hundred and seventy-three, one hundred and seventy-four, one hundred and seventy-five, one hundred and seventy-six, one hundred and seventy-seven, one hundred and seventy-eight, one hundred and seventy-nine, one hundred and eighty, one hundred and eighty-one, one hundred and eighty-two, one hundred and eighty-three, one hundred and eighty-four, one hundred and eighty-five, one hundred and eighty-six, one hundred and eighty-seven, one hundred and eighty-eight, one hundred and eighty-nine, one hundred and ninety, one hundred and ninety-one, one hundred and ninety-two, one hundred and ninety-three, one hundred and ninety-four, one hundred and ninety-five, one hundred and ninety-six, one hundred and ninety-seven, one hundred and ninety-eight, one hundred and ninety-nine, two hundred, two hundred and one, two hundred and two, two hundred and three, two hundred and four, two hundred and five, two hundred and six, two hundred and seven, two hundred and eight, two hundred and nine, two hundred and ten, two hundred and eleven, two hundred and twelve, two hundred and thirteen, two hundred and fourteen, two hundred and fifteen, two hundred and sixteen, two hundred and seventeen, two hundred and eighteen, two hundred and nineteen, two hundred and twenty, two hundred and twenty-one, two hundred and twenty-two, two hundred and twenty-three, two hundred and twenty-four, two hundred and twenty-five, two hundred and twenty-six, two hundred and twenty-seven, two hundred and twenty-eight, two hundred and twenty-nine, two hundred and thirty, two hundred and thirty-one, two hundred and thirty-two, two hundred and thirty-three, two hundred and thirty-four, two hundred and thirty-five, two hundred and thirty-six, two hundred and thirty-seven, two hundred and thirty-eight, two hundred and thirty-nine, two hundred and forty, two hundred and forty-one, two hundred and forty-two, two hundred and forty-three, two hundred and forty-four, two hundred and forty-five, two hundred and forty-six, two hundred and forty-seven, two hundred and forty-eight, two hundred and forty-nine, two hundred and fifty, two hundred and fifty-one, two hundred and fifty-two, two hundred and fifty-three, two hundred and fifty-four, two hundred and fifty-five, two hundred and fifty-six, two hundred and fifty-seven, two hundred and fifty-eight, two hundred and fifty-nine, two hundred and sixty, two hundred and sixty-one, two hundred and sixty-two, two hundred and sixty-three, two hundred and sixty-four, two hundred and sixty-five, two hundred and sixty-six, two hundred and sixty-seven, two hundred and sixty-eight, two hundred and sixty-nine,270、271、272、273、274、275、276、277、278、279、280、281、282、283、284、285、286、287、288、289、290、291、292、293、294、295、296、297、298、299、300、301、302、303、304、305、306、307、308、309、310、311、312、313、314、315、316、317、318、319、320、321、322、323、324、325、326、327、328、329、330、331、332、333、334、335、336、337、338、339、340、341、342、343、344、345、346、347、348、349、350、351、352、353、354、355、356、357、358、359、360、361、362、363、364、365、366、367、368、369、370、371、372、373、374、375、376、377、378、379、380、381、382、383、384、385、386、387、388、389、390、391、392、393、394、395、396、397、398、399、400、401、402、403、404、405、406、407、408、409、410、411、412、413、414、415、416、417、418、419、420、421、422、423、424、425、426、427、428、429、430、431、432、433、434、435、436、437、438、439、440、441、442、443、444、445、446、447、448、449、450、451、452、453、454、455、456、457、458、459、460、461、462、463、464、465、466、467、468、469、470、471、472、473、474、475、476、477、478、479、480、481、482、483、484、485、486、487、488、489、490、491、492、493、494、495、496、497、498、499、500、501、502、503、504、505、506、507、508、509、510、511、512、513、514、515、516、517、518、519、starting at position 520, 521, 522, 523, 524, 525, 526, 527, 528, 529, 530, 531, 532, 533, 534, 535, 536, 537, 538, 539, 540, 541, 542, 543, 544, 545, 546, 547, 548, 549, 550, 551, 552, 553, 554, 555, 556, 557, 558, 559, 560, 561, 562, 563, 564, 565, 566, 567, 568, 569, 570, 571, 572, 573, 574, 575, 576, 577, 578, 579, 580, 581, 582, 583, 584, 585, 586, 587, 588, 589, 590, 591, 592, 593, 594, 595, 596, 597, 598, 599, 600, 601, 602, 603, 604, 605, 606, 607, 608, 609, 610, 611, 612, 613, 614, or 615, and any 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173 of SEQ ID NO:1~132174、175、176、177、178、179、180、181、182、183、184、185、186、187、188、189、190、191、192、193、194、195、196、197、198、199、200、201、202、203、204、205、206、207、208、209、210、211、212、213、214、215、216、217、218、219、220、221、222、223、224、225、226、227、228、229、230、231、232、233、234、235、236、237、238、239、240、241、242、243、244、245、246、247、248、249、250、251、252、253、254、255、256、257、258、259、260、261、262、263、264、265、266、267、268、269、270、271、272、273、274、275、276、277、278、279、280、281、282、283、284、285、286、287、288、289、290、291、292、293、294、295、296、297、298、299、300、301、302、303、304、305、306、307、308、309、310、311、312、313、314、315、316、317、318、319、320、321、322、323、324、325、326、327、328、329、330、331、332、333、334、335、336、337、338、339、340、341、342、343、344、345、346、347、348、349、350、351、352、353、354、355、356、357、358、359、360、361、362、363、364、365、366、367、368、369、370、371、372、373、374、375、376、377、378、379、380、381、382、383、384、385、386、387、388、389、390、391、392、393、394、395、396、397、398、399、400、401、402、403、404、405、406、407、408、409、410、411、412、413、414、415、416、417、418、419、420、421、422、423、There is a nucleic acid molecule or polypeptide comprising a continuous nucleotide or polypeptide of 424, 425, 426, 427, 428, 429, 430, 431, 432, 433, 434, 435, 436, 437, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 459, 460, 461, 462, 463, 464, 465, 466, 467, 468, 469, 470, 471, 472, 473, 474, 475, 476, 477, 478, 479, 480, 481, 482, 483, 484, 485, 486, 487, 488, 489, 490, 491, 492, 493, 494, 495, 496, 497, 498, 499, 500, 501, 502, 503, 504, 505, 506, 507, 508, 509, 510, 511, 512, 513, 514, 515, 516, 517, 518, 519, 520, 521, 522, 523, 524, 525, 526, 527, 528, 529, 530, 531, 532, 533, 534, 535, 536, 537, 538, 539, 540, 541, 542, 543, 544, 545, 546, 547, 548, 549, 550, 551, 552, 553, 554, 555, 556, 557, 558, 559, 560, 561, 562, 563, 564, 565, 566, 567, 568, 569, 570, 571, 572, 573, 574, 575, 576, 577, 578, 579, 580, 581, 582, 583, 584, 585, 586, 587, 588, 589, 590, 591, 592, 593, 594, 595, 596, 597, 598, 599, 600, 601, 602, 603, 604, 605, 606, 607, 608, 609, 610, 611, 612, 613, 614, or 615.,

[0139] In some embodiments, the RNA regulatory domain is at least 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%, at most 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%, or exactly 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% similar, identical or homologous to one of SEQ ID NO: 9, 11, 15-17, or 123-125, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122,123、124、125、126、127、128、129、130、131、132、133、134、135、136、137、138、139、140、141、142、143、144、145、146、147、148、149、150、151、152、153、154、155、156、157、158、159、160、161、162、163、164、165、166、167、168、169、170、171、172、173、174、175、176、177、178、179、180、181、182、183、184、185、186、187、188、189、190、191、192、193、194、195、196、197、198、199、200、201、202、203、204、205、206、207、208、209、210、211、212、213、214、215、216、217、218、219、220、221、222、223、224、225、226、227、228、229、230、231、232、233、234、235、236、237、238、239、240、241、242、243、244、245、246、247、248、249、250、251、252、253、254、255、256、257、258、259、260、261、262、263、264、265、266、267、268、269、270、271、272、273、274、275、276、277、278、279、280、281、282、283、284、285、286、287、288、289、290、291、292、293、294、295、296、297、298、299、300、301、302、303、304、305、306、307、308、309、310、311、312、313、314、315、316、317、318、319、320、321、322、323、324、325、326、327、328、329、330、331、332、333、334、335、336、337、338、339、340、341、342、343、344、345、346、347、348、349、350、351、352、353、354、355、356、357、358、359、360、361、362、363、It may contain 364 (or any derivable range therein) consecutive amino acids.

[0140] In some embodiments, the hairpin structure of the RNA targeting molecule, e.g., the stem, loop, or both the stem and loop, may contain 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, or 43 (or any derivable range therein) of the nucleic acids of SEQ ID NO: 1, 2, 26, 28, or 83 - 86.

[0141] In some embodiments, the hairpin structure of the RNA targeting molecule, e.g., the stem, loop, or both the stem and loop, may contain 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, or 43 (or any derivable range therein) of the consecutive nucleic acids of SEQ ID NO: 1, 2, 26, 28, or 83 - 86.

[0142] In some embodiments, the hairpin structure of the RNA targeting molecule, e.g., the stem, loop, or both the stem and loop, is at least 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%, at most 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%, or exactly 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% similar or identical to one of SEQ ID NO: 1, 2, 26, 28, or 83 - 86, and may comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, or 43 (or any derivable range therein) consecutive nucleic acids of SEQ ID NO: 1, 2, 26, 28, or 83 - 86.

[0143] In some embodiments, the RNA targeting region or RNA targeting molecule may comprise 1 to 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 (or any derivable range therein) nucleic acids of SEQ ID NOs: 30-62.

[0144] In some embodiments, the RNA targeting region or RNA targeting molecule may comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 (or any derivable range therein) consecutive nucleic acids of SEQ ID NOs: 30-62.

[0145] In some embodiments, the RNA targeting region or RNA targeting molecule is at least 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%, at most 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%, or exactly 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% similar or identical to one of SEQ ID NOs: 30 - 62 and may comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 (or any derivable range therein) consecutive nucleic acids of SEQ ID NOs: 30 - 62.

[0146] In some aspects, the stabilizer polypeptide can have one or more substitutions that reduce or eliminate binding to endogenous proteins. In some aspects, the stabilizer polypeptide can have one or more substitutions that reduce or eliminate activity directed to endogenous proteins.

[0147] The polypeptides and nucleic acids of the present disclosure, such as CIRT fusion proteins, stabilizer polypeptides, linkers, RNA hairpin binding domains, NES, RNA regulatory domains, tags, NLS, RNA targeting molecules, hairpin regions of RNA targeting molecules, helical regions, or targeting regions of RNA targeting molecules, have at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242,243、244、245、246、247、248、249、250、251、252、253、254、255、256、257、258、259、260、261、262、263、264、265、266、267、268、269、270、271、272、273、274、275、276、277、278、279、280、281、282、283、284、285、286、287、288、289、290、291、292、293、294、295、296、297、298、299、300、301、302、303、304、305、306、307、308、309、310、311、312、313、314、315、316、317、318、319、320、321、322、323、324、325、326、327、328、329、330、331、332、333、334、335、336、337、338、339、340、341、342、343、344、345、346、347、348、349、350、351、352、353、354、355、356、357、358、359、360、361、362、363、364、365、366、367、368、369、370、371、372、373、374、375、376、377、378、379、380、381、382、383、384、385、386、387、388、389、390、391、392、393、394、395、396、397、398、399、400、401、402、403、404、405、406、407、408、409、410、411、412、413、414、415、416、417、418、419、420、421、422、423、424、425、426、427、428、429、430、431、432、433、434、435、436、437、438、439、440、441、442、443、444、445、446、447、448、449、450、451、452、453、454、455、456、457、458、459、460、461、462、463、464、465、466、467、468、469、470、471、472、473、474、475、476、477、478、479、480、481、482、483、484、485、486、487、488、489、490、491、492、493, 494, 495, 496, 497, 498, 499, 500, 501, 502, 503, 504, 505, 506, 507, 508, 509, 510, 511, 512, 513, 514, 515, 516, 517, 518, 519, 520, 521, 522, 523, 524, 525, 526, 527, 528, 529, 530, 531, 532, 533, 534, 535, 536, 537, 538, 539, 540, 541, 542, 543, 544, 545, 546, 547, 548, 549, 550, 551, 552, 553, 554, 555, 556, 557, 558, 559, 560, 561, 562, 563, 564, 565, 566, 567, 568, 569, 570, 571, 572, 573, 574, 575, 576, 577, 578, 579, 580, 581, 582, 583, 584, 585, 586, 587, 588, 589, 590, 591, 592, 593, 594, 595, 596, 597, 598, 599, 600, 601, 602, 603, 604, 605, 606, 607, 608, 609, 610, 611, 612, 613, 614, or 615, at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152153、154、155、156、157、158、159、160、161、162、163、164、165、166、167、168、169、170、171、172、173、174、175、176、177、178、179、180、181、182、183、184、185、186、187、188、189、190、191、192、193、194、195、196、197、198、199、200、201、202、203、204、205、206、207、208、209、210、211、212、213、214、215、216、217、218、219、220、221、222、223、224、225、226、227、228、229、230、231、232、233、234、235、236、237、238、239、240、241、242、243、244、245、246、247、248、249、250、251、252、253、254、255、256、257、258、259、260、261、262、263、264、265、266、267、268、269、270、271、272、273、274、275、276、277、278、279、280、281、282、283、284、285、286、287、288、289、290、291、292、293、294、295、296、297、298、299、300、301、302、303、304、305、306、307、308、309、310、311、312、313、314、315、316、317、318、319、320、321、322、323、324、325、326、327、328、329、330、331、332、333、334、335、336、337、338、339、340、341、342、343、344、345、346、347、348、349、350、351、352、353、354、355、356、357、358、359、360、361、362、363、364、365、366、367、368、369、370、371、372、373、374、375、376、377、378、379、380、381、382、383、384、385、386、387、388、389、390、391、392、393、394、395、396、397、398、399、400、401、402、403, 404, 405, 406, 407, 408, 409, 410, 411, 412, 413, 414, 415, 416, 417, 418, 419, 420, 421, 422, 423, 424, 425, 426, 427, 428, 429, 430, 431, 432, 433, 434, 435, 436, 437, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 459, 460, 461, 462, 463, 464, 465, 466, 467, 468, 469, 470, 471, 472, 473, 474, 475, 476, 477, 478, 479, 480, 481, 482, 483, 484, 485, 486, 487, 488, 489, 490, 491, 492, 493, 494, 495, 496, 497, 498, 499, 500, 501, 502, 503, 504, 505, 506, 507, 508, 509, 510, 511, 512, 513, 514, 515, 516, 517, 518, 519, 520, 521, 522, 523, 524, 525, 526, 527, 528, 529, 530, 531, 532, 533, 534, 535, 536, 537, 538, 539, 540, 541, 542, 543, 544, 545, 546, 547, 548, 549, 550, 551, 552, 553, 554, 555, 556, 557, 558, 559, 560, 561, 562, 563, 564, 565, 566, 567, 568, 569, 570, 571, 572, 573, 574, 575, 576, 577, 578, 579, 580, 581, 582, 583, 584, 585, 586, 587, 588, 589, 590, 591, 592, 593, 594, 595, 596, 597, 598, 599, 600, 601, 602, 603, 604, 605, 606, 607, 608, 609, 610, 611, 612, 613, 614, or 615, or exactly 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49,50、51、52、53、54、55、56、57、58、59、60、61、62、63、64、65、66、67、68、69、70、71、72、73、74、75、76、77、78、79、80、81、82、83、84、85、86、87、88、89、90、91、92、93、94、95、96、97、98、99、100、101、102、103、104、105、106、107、108、109、110、111、112、113、114、115、116、117、118、119、120、121、122、123、124、125、126、127、128、129、130、131、132、133、134、135、136、137、138、139、140、141、142、143、144、145、146、147、148、149、150、151、152、153、154、155、156、157、158、159、160、161、162、163、164、165、166、167、168、169、170、171、172、173、174、175、176、177、178、179、180、181、182、183、184、185、186、187、188、189、190、191、192、193、194、195、196、197、198、199、200、201、202、203、204、205、206、207、208、209、210、211、212、213、214、215、216、217、218、219、220、221、222、223、224、225、226、227、228、229、230、231、232、233、234、235、236、237、238、239、240、241、242、243、244、245、246、247、248、249、250、251、252、253、254、255、256、257、258、259、260、261、262、263、264、265、266、267、268、269、270、271、272、273、274、275、276、277、278、279、280、281、282、283、284、285、286、287、288、289、290、291、292、293、294、295、296、297、298、299、300、301、302、303、304、305、306、307、308、309、310、311、312、313、314、315、316、317、318、319、320、321、322、323、324、325、326、327、328、329、330、331、332、333、334、335、336、337、338、339、340、341、342、343、344、345、346、347、348、349、350、351、352、353、354、355、356、357、358、359、360、361、362、363、364、365、366、367、368、369、370、371、372、373、374、375、376、377、378、379、380、381、382、383、384、385、386、387、388、389、390、391、392、393、394、395、396、397、398、399、400、401、402、403、404、405、406、407、408、409、410、411、412、413、414、415、416、417、418、419、420、421、422、423、424、425、426、427、428、429、430、431、432、433、434、435、436、437、438、439、440、441、442、443、444、445、446、447、448、449、450、451、452、453、454、455、456、457、458、459、460、461、462、463、464、465、466、467、468、469、470、471、472、473、474、475、476、477、478、479、480、481、482、483、484、485、486、487、488、489、490、491、492、493、494、495、496、497、498、499、500、501、502、503、504、505、506、507、508、509、510、511、512、513、514、515、516、517、518、519、520、521、522、523、524、525、526、527、528、529、530、531、532、533、534、535、536、537、538、539、540、541、542、543、544、545、546、547、548、549、550、551、552、553、554、555、556、557、558、559、560、561、It may include substitutions of 562, 563, 564, 565, 566, 567, 568, 569, 570, 571, 572, 573, 574, 575, 576, 577, 578, 579, 580, 581, 582, 583, 584, 585, 586, 587, 588, 589, 590, 591, 592, 593, 594, 595, 596, 597, 598, 599, 600, 601, 602, 603, 604, 605, 606, 607, 608, 609, 610, 611, 612, 613, 614, or 615.

[0148] The substitution is one of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271 of SEQ ID NO:1 - 132272、273、274、275、276、277、278、279、280、281、282、283、284、285、286、287、288、289、290、291、292、293、294、295、296、297、298、299、300、301、302、303、304、305、306、307、308、309、310、311、312、313、314、315、316、317、318、319、320、321、322、323、324、325、326、327、328、329、330、331、332、333、334、335、336、337、338、339、340、341、342、343、344、345、346、347、348、349、350、351、352、353、354、355、356、357、358、359、360、361、362、363、364、365、366、367、368、369、370、371、372、373、374、375、376、377、378、379、380、381、382、383、384、385、386、387、388、389、390、391、392、393、394、395、396、397、398、399、400、401、402、403、404、405、406、407、408、409、410、411、412、413、414、415、416、417、418、419、420、421、422、423、424、425、426、427、428、429、430、431、432、433、434、435、436、437、438、439、440、441、442、443、444、445、446、447、448、449、450、451、452、453、454、455、456、457、458、459、460、461、462、463、464、465、466、467、468、469、470、471、472、473、474、475、476、477、478、479、480、481、482、483、484、485、486、487、488、489、490、491、492、493、494、495、496、497、498、499、500、501、502、503、504、505、506、507、508、509、510、511、512、513、514、515、516、517、518、519、520、521、It may be at the amino acid position or nucleic acid position of positions 522, 523, 524, 525, 526, 527, 528, 529, 530, 531, 532, 533, 534, 535, 536, 537, 538, 539, 540, 541, 542, 543, 544, 545, 546, 547, 548, 549, 550, 551, 552, 553, 554, 555, 556, 557, 558, 559, 560, 561, 562, 563, 564, 565, 566, 567, 568, 569, 570, 571, 572, 573, 574, 575, 576, 577, 578, 579, 580, 581, 582, 583, 584, 585, 586, 587, 588, 589, 590, 591, 592, 593, 594, 595, 596, 597, 598, 599, 600, 601, 602, 603, 604, 605, 606, 607, 608, 609, 610, 611, 612, 613, 614, or 615.

[0149] A substitution variant typically involves replacing one amino acid at one or more sites within a protein with another amino acid and can be designed to modulate one or more properties of the polypeptide, with or without loss of other functions or properties. The substitution can be conservative. That is, one amino acid is replaced with an amino acid of similar shape and charge. Conservative substitutions are well known in the art and include, for example, from alanine to serine; from arginine to lysine; from asparagine to glutamine or histidine; from aspartic acid to glutamic acid; from cysteine to serine; from glutamine to asparagine; from glutamic acid to aspartic acid; from glycine to proline; from histidine to asparagine or glutamine; from isoleucine to leucine or valine; from leucine to valine or isoleucine; from lysine to arginine; from methionine to leucine or isoleucine; from phenylalanine to tyrosine, leucine or methionine; from serine to threonine; from threonine to serine; from tryptophan to tyrosine; from tyrosine to tryptophan or phenylalanine; and changes from valine to isoleucine or leucine. Alternatively, the substitution can be non-conservative such that the function or activity of the polypeptide is affected. Non-conservative changes typically involve substituting one residue with a chemically different residue, such as substituting a polar or charged amino acid with a non-polar or uncharged amino acid (and vice versa).

[0150] The protein may be recombinant or synthesized in vitro. Alternatively, non-recombinant or recombinant proteins may be isolated from bacteria. It is also contemplated that bacteria containing such variants may be practiced in compositions and methods. As a result, the protein need not be isolated.

[0151] The term "functionally equivalent codons" is used herein to refer to codons that encode the same amino acid, such as the six codons for arginine or serine, and also to codons that encode biologically equivalent amino acids.

[0152] Also, amino acid and nucleic acid sequences can each contain additional residues, such as additional N-terminal or C-terminal amino acids, or 5' or 3' sequences, and yet still be essentially as set forth in one of the sequences disclosed herein so long as the sequence meets the above criteria, including maintaining the biological protein activity related to protein expression. The addition of terminal sequences applies particularly to nucleic acid sequences. For example, a nucleic acid sequence can contain various non-coding sequences adjacent to either the 5' or 3' portion of its coding region.

[0153] The following are considerations based on amino acid changes in proteins to create equivalent or even improved second-generation molecules. For example, a particular amino acid can be substituted with another amino acid in the protein structure without an apparent loss of interaction binding ability. For example, structures such as enzyme catalytic domains or interaction components can have amino acids substituted to maintain such functions. Since the biological functional activity of a protein is defined by the protein's interaction ability and properties, certain amino acid substitutions can be made in the protein sequence and its underlying DNA coding sequence, and still peptides with similar characteristics can be obtained. Therefore, the inventors envision that various changes can be made to the DNA sequence of a gene without an apparent loss of biological availability or activity.

[0154] In other aspects, alteration of the function of a polypeptide is intended by introducing one or more substitutions. For example, for the purpose of modifying the interaction binding ability of an interaction component, certain amino acids may be substituted with other amino acids in the protein structure. For example, structures such as protein interaction domains, nucleic acid interaction domains, and catalytic sites may have amino acids substituted to modify such functions. Since the biological functional activity of a protein is defined by its interaction ability and properties, certain amino acid substitutions can be made in the protein sequence and its underlying DNA coding sequence, yet still obtain peptides with different characteristics. Thus, it is contemplated by the inventors that various changes may be made to the DNA sequence of a gene while accompanying an apparent change in biological availability or activity.

[0155] When making such changes, the hydropathic index of amino acids may be considered. The importance of the hydropathic index of amino acids in conferring an interaction biological function to a protein is generally understood in the art (Kyte and Doolittle, 1982). The relative hydropathic properties of amino acids contribute to the secondary structure of the resulting peptide, and it has been recognized that this secondary structure defines the interaction of the protein with other molecules, such as enzymes, substrates, receptors, DNA, antibodies, antigens, etc.

[0156] It is also understood in the art that similar amino acid substitutions can be effectively made based on hydrophilicity. U.S. Patent No. 4,554,101, which is incorporated herein by reference, specifies that the maximum local average hydrophilicity of a protein, which is governed by the hydrophilicity of its adjacent amino acids, correlates with the biological properties of the protein. It is understood that substituting an amino acid with another having a similar hydrophilicity value can produce a biologically equivalent and immunologically equivalent protein.

[0157] As outlined above, amino acid substitutions generally are based on the relative similarity of the amino acid side chain substituents, for example, their hydrophobicity, hydrophilicity, charge, size, and the like. Exemplary substitutions taking into account the various foregoing characteristics are well known and include arginine and lysine; glutamic acid and aspartic acid; serine and threonine; glutamine and asparagine; and valine, leucine, and isoleucine.

[0158] In a specific embodiment, all or part of the proteins described herein also can be synthesized in solution or on a solid support according to conventional techniques. A variety of automated synthesizers are commercially available and can be used according to known protocols. See, for example, Stewart and Young, (1984); Tam et al., (1983); Merrifield, (1986); and Barany and Merrifield (1979), each incorporated herein by reference. Alternatively, recombinant DNA techniques can be employed by inserting a nucleotide sequence encoding the peptide or polypeptide into an expression vector, transforming or transfecting into a suitable host cell, and culturing under conditions suitable for expression.

[0159] One aspect involves the use of gene transfer into cells, including microorganisms, for the production and / or presentation of proteins. The gene for the protein of interest can be transferred into a suitable host cell and subsequently the cells can be cultured under appropriate conditions. Nucleic acids encoding almost any polypeptide can be employed. The generation of recombinant expression vectors and the elements contained therein are discussed herein. Alternatively, the protein to be produced can be an endogenous protein normally synthesized by the cells used for protein production.

[0160] VI. Sequences TAR hairpin scaffold: ggccagaucugagccugggagcucucuggcc (SEQ ID NO:1)

[0161] Human SLBP hairpin scaffold: ccaaaggcucuucucagagccaccca (SEQ ID NO:2) TIFF2025084877000030.tif85166TIFF2025084877000031.tif244166TIFF2025084877000032.tif244166TIFF2025084877000033.tif234166TIFF2025084877000034.tif244166TIFF2025084877000035.tif234166TIFF2025084877000036.tif244166TIFF2025084877000037.tif244166TIFF2025084877000038.tif243166TIFF2025084877000039.tif154166

[0162] gRNA sequences used in this study (all gRNAs are expressed from the hU6 promoter) TIFF2025084877000040.tif77160

[0163] gRNA guiding sequences; all are expressed by the same hU6 promoter as TBP-OT TIFF2025084877000041.tif230166TIFF2025084877000042.tif120166

[0164] RNA oligonucleotides used for in vitro characterization: TIFF2025084877000043.tif89166

[0165] qPCR primers: TIFF2025084877000044.tif105167

[0166] RNA hairpin structure: TIFF2025084877000045.tif4158Nucleolin recognition sequence: UCCCGA (SEQ ID NO:84) RNA hairpin structure: TIFF2025084877000046.tif4128 and TIFF2025084877000047.tif4128

[0167] TIFF2025084877000048.tif99167 TIFF2025084877000049.tif240167 TIFF2025084877000050.tif245167 TIFF2025084877000051.tif245167 TIFF2025084877000052.tif245167 TIFF2025084877000053.tif245167 TIFF2025084877000054.tif79167

Example

[0168] VII. Example The following examples are included to demonstrate preferred embodiments of the present disclosure. The techniques disclosed in the following examples have been found by the inventors to function well enough to practice the present disclosure and can therefore be considered to constitute preferred modes for their implementation. However, those skilled in the art should understand that, in light of the present disclosure, many changes can be made to the specific embodiments disclosed without departing from the spirit and scope of the invention, and yet equivalent or similar results can still be obtained.

[0169] Example 1 - Programmable RNA-guided RNA effector protein constructed from human parts A. Introduction To overcome the large size and microbial origin of current RNA targeting systems, the inventors present a CRISPR / Cas-inspired RNA targeting system (CIRTS), a general method for engineering programmable RNA effector proteins. The inventors show that CIRTS enables searching the human proteome for functional parts and constructing programmable RNA regulatory proteins. CIRTS is a ribonucleoprotein complex that uses Watson-Crick-Franklin base pair interactions to site-specifically deliver protein cargo to the transcriptome. The inventors show that CIRTS can be readily engineered to deliver a wide range of regulatory proteins to transcripts, including nucleases for degradation, deadenylation regulatory mechanisms for degradation, or translational activation mechanisms for enhanced protein production. On the other hand, CIRTS is up to five times smaller than the smallest current CRISPR / Cas systems and can be fully engineered from human parts.

[0170] The inventors inferred that the following components are required for a minimal programmable RNA targeting system: (1) an RNA hairpin binding protein that serves as the core of the system and is a selective high-affinity binder to a specific RNA structure displayed on the engineered gRNA, (2) a gRNA that features both a structure that interacts with the engineered hairpin binding protein and a sequence that is complementary to the target RNA of interest, and (3) an effector protein, such as a nuclease or an epitranscriptome regulator, that acts in a proximity-dependent manner on the targeted RNA. In some embodiments, a charged protein that binds nonspecifically to the displayed gRNA sequence is used to stabilize and protect the guide RNA prior to target engagement (Figure 1A). CIRTS combines multiple protein domains that perform these functions in the engineered system.

[0171] Here, the inventors present the design and validation of CIRTS. First, the inventors engineered a programmable CIRTS ribonuclease and used it for both in vitro and mammalian cell reporter assay optimization and validation. Next, the inventors demonstrated the versatility of CIRTS by showing that all four component parts of CIRTS-1, including the gRNA, hairpin-binding protein, ssRNA-binding protein, and effector domain, could be replaced with other parts to develop five additional CIRTS (Figure 1B). The inventors targeted an endogenous epitranscriptome regulatory pathway, including degradation machinery and translational activation, using a CIRTS engineered as an m 6 A leader protein can be targeted using CIRTS. In addition, the inventors also showed that endogenous transcripts for proximal-dependent nuclease-mediated decay, non-nuclease-mediated decay, or translational activation can be targeted using CIRTS. Finally, the inventors showed that multiple genes can be simultaneously targeted using orthogonal CIRTS. In summary, this study validates the CIRTS strategy as a viable new approach for engineering RNA effector proteins assembled from small and human parts.

[0172] B. Results 1. Development and in vitro validation of CIRTS-1 Regarding CIRTS-1, the first-generation system of the present inventors, the inventors have previously engineered an evolved human hairpin-binding protein, U1A protein (TBP6.7) (Blakeley and McNaughton, 2014; Crawford et al., 2016), which binds to the HIV TAR hairpin and does not have an endogenous human RNA hairpin target (Figure 1B). The inventors designed a gRNA that included the TAR hairpin structure, a nucleotide linker sequence (L), and then a guiding sequence (Figure 1C). To develop and validate this system, the inventors first engineered a programmable nuclease by fusing TBP6.7 to the Pin nuclease domain of human SMG6, which has previously been used as a non-specific proximal-dependent RNA endonuclease (Batra et al., 2017; Choudhury et al., 2012). This simplest design already exhibited gRNA-mediated transcript degradation in cell-based assays (Figure 9B, left), but its performance was rather low, and the inventors thought this was due to potential degradation of the displayed targeting sequences. The protein surface and hairpin channel of the Cas13 system tend to be highly charged and are likely to bind non-specifically to the guiding RNA sequence and stabilize it (Liu et al., 2017). To engineer this RNA-protecting function into our system, the inventors aimed to incorporate an RNA-binding protein that is non-specific and has low affinity for single-stranded RNA. However, the human protein toolbox did not readily contain annotated small non-specific single-stranded RNA-binding proteins. Therefore, the inventors developed CIRTS-1 using the small viral ssRNA-binding protein ORF5 (Zhou et al., 2006). Briefly, CIRTS-1 is composed of a protein fusion complex of ORF5-TBP6.7-Pin nuclease domain and the corresponding gRNA (Figure 1A).

[0173] The inventors first characterized the in vitro programmable RNA-binding and RNA nuclease activities of CIRTS-1 against a model RNA target substrate. Using purified MBP-CIRTS-1 protein and gRNA in an electrophoretic mobility shift assay (EMSA) run in the presence of EDTA, which inactivates nucleases, the inventors found that MBP-CIRTS-1 binds to the target RNA with an apparent K D of 105 nM in a gRNA-dependent manner (Figures 2A and 2B). Excluding either the gRNA (Figure 7A) or the CIRTS-1 protein (Figure 7B) from the assay resulted in no measurable binding being detected, confirming the gRNA-dependent binding mode as designed in this system. Furthermore, in the cleavage assay, the inventors found that CIRTS-1 degrades the RNA substrate in a gRNA- and Mn 2+ -dependent manner (Figure 2C). Collectively, these in vitro results validate the design principle underlying CIRTS-1 and motivated the inventors to optimize this system for use in living cells.

[0174] 2. Optimization of CIRTS-1 in Living Cells To examine the target nuclease activity of CIRTS-1 in live mammalian cells, we established a dual luciferase reporter assay that reports on gRNA-dependent transcriptional changes to target RNA (Figure 3A). Using this system, we optimized the placement of CIRTS-1 by assaying different protein linker types (Figure 8A), gRNA structures (Figure 8C), and CIRTS-1 intracellular localization (Figure 9C). After optimization, we compared the ability of the optimized CIRTS-1 system to degrade target reporter RNA with current state-of-the-art Cas13 systems. We designed gRNAs targeting firefly luciferase mRNA in the dual luciferase reporter assay for both CIRTS-1 and Cas13b, as well as off-target gRNA controls for each programmable nuclease. To examine whether binding to the transcript alone changes the transcript level, we engineered CIRTS-0, which contains a previously reported “dead” mutation in the nuclease domain of CIRTS-1 and serves as a negative control (Eberle et al., 2009). We found that CIRTS-0 had little effect on the target transcript (Figures 3B and 9A), indicating that the CIRTS ribonucleoprotein target RNA complex causes minimal perturbation to the RNA of interest. Next, we examined whether CIRTS-1, together with the active nuclease, can mediate target degradation. Indeed, we found gRNA-dependent degradation of the target gene, measured both at the protein level as monitored by luciferase activity (Figure 3C) and at the mRNA level as monitored by RT-qPCR (Figure 9D). Encouragingly, we found that CIRTS-1 is slightly less efficient than nuclease-mediated target cleavage by Cas13b when targeting the luciferase reporter gene, indicating that the CIRTS strategy is a viable approach in live cells.Driven by the performance of CIRTS-1, the inventors then sought to evaluate the versatility of its design by examining whether various system components could be replaced with other parts while maintaining CIRTS functionality.

[0175] 3. Modularity of CIRTS To explore the versatility of the CIRTS design, the inventors next tested different protein domains for each component of the CIRTS protein delivery system. First, the inventors assayed whether CIRTS could deliver the RNA epitranscriptome regulatory "reader" protein (Rauch et al., 2018) that they had previously delivered using the dCas13b system. The inventors replaced the Pin nuclease effector protein of CIRTS-1 with the N-terminal domain of YTHDF1, an m 6 6-methyladenosine (m 6 A) reader protein, to generate CIRTS-2. When CIRTS-2 was delivered to the same target sequence as the CIRTS-1 experiment, the RNA levels remained relatively unchanged (Figure 9E), but a substantial increase in protein levels from the RNA was brought about (Figure 3D). Next, the inventors replaced the YTHDF1 fragment with a fragment of YTHDF2, an m 6 A reader protein that recruits the RNA deadenylation machinery to induce RNA degradation, to generate CIRTS-3. Delivery of CIRTS-3 to the reporter mRNA induces degradation of the target transcript as measured by both RNA (Figure 9F) and protein levels (Figure 3E). CIRTS-1 to 3 demonstrate the versatility of the design strategy for delivering a diverse range of effector protein cargos to target RNAs in living cells.

[0176] After demonstrating the modularity of the effector domain, the inventors sought to evaluate whether other human parts could also be used for the RNA hairpin-binding domain and non-specific ssRNA-binding proteins. The inventors replaced TBP6.7 in CIRTS-3 with the RNA hairpin-binding domain of human histone stem-loop binding protein (SLBP) to generate CIRTS-4. Additionally, the inventors designed gRNAs based on the histone mRNA stem-loop structure (Figure 1D). When CIRTS-4 was assayed in a reporter assay (Figure 3F) and by RT-qPCR to evaluate RNA levels (Figure 9G), performance similar to that of CIRTS-3 was revealed. Finally, the inventors sought to engineer a fully humanized version of the CIRTS system. As described above, the inventors designed an initial proof-of-concept system based on the viral non-specific single-stranded RNA-binding protein ORF5. In the absence of an annotated human single-stranded non-specific RNA-binding protein, the inventors reasoned that highly charged cationic human proteins could fulfill the role of ORF5 in the CIRTS system (Cronican et al., 2011). Therefore, the inventors engineered two cationic human proteins, HBEGF and β-defensin 3, in place of ORF5 in CIRTS-3 to generate CIRTS-5 and CIRTS-6, respectively. Again, when these programmable effectors were placed in a luciferase reporter assay, gRNA-dependent degradation of the target gene was revealed (Figure 3G). The inventors also assayed changes in RNA levels by qPCR and observed a decrease in both CIRTS-5 and CIRTS-6 (Figure 9H). Collectively, the performance of CIRTS-1 to CIRTS-6 in the reporter assay demonstrates the modularity of the CIRTS design in all dimensions, including the hairpin-binding domain and corresponding gRNA, single-stranded RNA-binding protein, and effector protein. Next, the inventors sought to examine whether CIRTS could also be used to target endogenous transcripts.

[0177] 4. Targeting of endogenous mRNA by CIRTS As a first step towards the selective targeting of endogenous transcripts, we verified whether CIRTS-0 could bind to the target endogenous transcripts by RNA immunoprecipitation followed by RT-qPCR. We designed gRNAs to target two endogenous transcripts, PPIB and SMARCA4 (Cox et al., 2017; Konermann et al., 2018), which had been previously targeted by the Cas13 system. We delivered each gRNA separately together with CIRTS-0 fused to a 3×FLAG-tag. We then isolated total RNA, immunoprecipitated it using an anti-Flag antibody, and quantified the relative amounts of each target RNA bound to the protein. Indeed, both endogenous transcripts were enriched 2.5- to 5-fold in a gRNA-dependent manner (Figure 10A), demonstrating that CIRTS can function as a programmable RNA-guided RNA-binding protein against endogenous transcripts.

[0178] Next, the inventors used the CIRTS-1 programmable nuclease and the CIRTS-3 programmable YTHDF2-mediated decay system as representative examples to attempt to evaluate whether the CIRTS system could deliver effector proteins to target endogenous transcripts. The inventors selected five RNA transcripts that had been previously validated as Cas13 targets because they are available for RNA targeting by programmable RNA-binding systems. The inventors then designed gRNAs for each target using the same binding sites on the targets that had been used in previous Cas13 experiments (assuming that these sites were available for CIRTS targeting) (Konermann et al., 2018). The inventors assayed the effect of the CIRT system on the RNA levels of each target by RT-qPCR. When cells were transfected with either CIRTS-1 or CIRTS-3 along with a specific gRNA expression vector, the inventors observed a substantial decrease in RNA levels for each of the five endogenous transcripts: PPIB, NFKB1, NRAS, B4GALTN1, and SMARCA4 by RT-qPCR (Figures 4A and 4B). The relative knockdown efficiency varied for each gene, which was also observed in other RNA targeting systems and was potentially mediated by gene-specific proximity or other regulatory pathways. Nevertheless, these results support that CIRTS can target endogenous transcripts and mediate decay either through active nuclease activity against the target or by inducing endogenous epitranscriptome regulatory pathways.

[0179] Next, the inventors sought to evaluate whether CIRTS-2 could induce protein production of endogenous transcripts through the YTHDF1-mediated epitranscriptome pathway. The inventors selected abundant transcripts (protein products of CypB, PPIB) along with reported reliable antibodies for protein production analysis by Western blotting. Indeed, cells transfected with CIRTS-2 and the on-target gRNA showed an increase in protein levels (Figure 4C), but no change in RNA levels (Figure 10B), which supports the effect of YTHDF1 on transcripts. As a control, the same experiment was performed using CIRTS-3 that delivers YTHDF2, resulting in decreased protein levels, which correlates with a decrease in mRNA levels (Figure 3B). Collectively, these experiments show that the CIRTS platform can function in a gRNA-dependent manner on endogenous transcripts, inducing a degradation mechanism that actively degrades target transcripts, acts on target transcripts, or activates translation from target transcripts and increased protein production. The versatility of CIRTS gave the inventors the idea to engineer them to target more than one transcript simultaneously.

[0180] 5. Multiplex targeting of multiple endogenous RNAs using CIRT Finally, the inventors aimed to evaluate whether CIRTS engineered with different hairpin binding domains could function orthogonally in living cells to selectively target different transcripts. In principle, CIRTS constructed from the TBP hairpin binding domain and CIRTS constructed from the SLBP hairpin binding domain, each using separately engineered gRNAs (Figures 1C and 1D), should be orthogonal to each other. For these orthogonality tests of multiplexed targeting CIRTS, the inventors placed two fully humanized CIRTS that deliver YTHDF2, CIRTS-6, and CIRTS-7, respectively, which should each bind to different hairpin structures and have minimal interference with each other. The inventors aimed to use CIRTS-6 to target PPIB and CIRTS-7 to target SMARCA4 (Figure 5A). The inventors co-transfected cells with expression vectors for both CIRTS proteins together with expression vectors for the gRNAs of each CIRTS, displaying either a non-targeting gRNA sequence as a control or a gRNA sequence targeting each endogenous gene. The inventors then evaluated changes in the relative RNA levels of the two target genes by RT-qPCR. Indeed, each CIRTS system degraded the target transcripts in an on-target gRNA-dependent manner without any interference between the two systems (Figure 5B). Importantly, the inventors were able to selectively degrade either one of the transcripts in the presence of both CIRTS proteins and also able to degrade both transcripts simultaneously.

[0181] RNA degradation by CIRTS-6 showed levels equivalent to when only CIRTS-6 was delivered to cells (Figure 11A), while targeting by CIRTS-7 resulted in slightly reduced RNA degradation compared to individual transfections (Figure 11B). For the multiplex targeting experiments, we transfected cells daily with CIRTS and gRNA vectors for two consecutive days. We believe this decreased activity is due to the reduced transfection efficiency on the second day of CIRTS-7 transfection. Additionally, while the TBP6.7-based CIRTS has an RNA hairpin orthogonal to the endogenous mammalian cell machinery, the SLBP-based construct can theoretically still bind to cellular histone mRNAs, which could have led to a decrease in overall activity. Interestingly, when both CIRTS were delivered with the on-target gRNA, they exhibited the highest capabilities in this assay. In this regard, we conclude that the two orthogonal CIRTS systems can be orthogonal to each other and each can target endogenous transcripts in a gRNA-dependent manner simultaneously. We are currently working on engineering orthogonal CIRTS that can act without potentially disrupting cellular events without having additional endogenous binding partners.

[0182] C. Discussion Upon organization, here the inventors present CIRTS, a new strategy for engineering programmable RNA effector proteins. CIRTS is small, fully humanizable, can target endogenous RNAs in living cells, and can be orthogonal and synergistic for multidimensional control. As a research tool, CIRTS should offer advantages over conventional methods due to its smaller size. For example, CIRTS-2 and CIRTS-3 are 65 kDa and 36 kDa, respectively, while the equivalent Cas13b-based programmable YTHDF1 and YTHDF2 systems are 155 kDa and 126 kDa, respectively (Figure 6). CIRTS-1 is even smaller than the smallest DNA-targeting Cas protein Cas14a discovered to date (Harrington et al., 2018). The smaller size of the delivery system should be less perturbing to the endogenous transcripts under study, providing an opportunity to elucidate the role of RNA regulatory proteins in living cells.

[0183] From a translational perspective, CIRTS should offer several important advantages and opportunities. The humanized nature of CIRTS provides a path towards avoiding immune responses, which would likely expand the potential for continuous delivery therapies. Regarding the use of accessory proteins such as human β-defensin 3, this protein has been extensively studied and the structural basis of its function has been elucidated (Dhople et al., 2006; Kluver et al., 2005). This knowledge would enable those skilled in the art to engineer β-defensin 3 peptides that retain charge but abrogate endogenous function. Currently, the small size of CIRTS would still enable, for example, the simultaneous delivery of multiple regulatory proteins via a viral delivery system to target one transcript for degradation and another for translational activation. The multiplexable ability of CIRTS, combined with its small size and the diversity of effector proteins that can be delivered, expands the potential for cell reprogramming by targeting multiple genes in multiple dimensions simultaneously.

[0184] From a broader perspective, the CIRTS platform demonstrates the potential to engineer proteins with new properties by combining parts contained within the human protein toolbox. The CIRTS system provides a new approach for studying and exploring RNA regulation and will likely open up many future opportunities for intervening in cellular regulation for disease treatment.

[0185] Example 2 - Programmable RNA-guided RNA effector proteins constructed from human parts A. Results 1. Design of CIRTS Cas9-based systems targeting DNA employ complex biophysical mechanisms to unwind DNA and anneal it to the target sequence (Rutkauskas et al., 2015; Sternberg et al., 2014; Szczelkun et al., 2014). In contrast, studies of the Cas13 mechanism have shown that RNA targeting is initiated by the central seed region in the gRNA (Liu et al., 2017). Additionally, the Cas13 system exhibits large variability in sequence-based target-directedness for individual transcripts (Abudayyeh et al., 2017; Cox et al., 2017; Konermann et al., 2018). Collectively, these findings suggest that not only the proximity of a given site but also the sequence complementarity between the gRNA and the targeted transcript are important requirements for RNA targeting. We sought to display gRNA sequences and deliver protein cargo to target RNAs by engineering a system inspired by Cas13 that uses defined protein-RNA interactions, similar to past RNA tethering assays (Coller and Wickens, 2007) using overexpressed reporter constructs. Indeed, hairpin-binding proteins and covalent RNA fusions have been used to deliver RNA editing machinery to transcripts (Montiel-Gonzalez et al., 2016; Sinnamon et al., 2017; Vogel et al., 2018).

[0186] Based on the current characterization of Cas13 (Abudayyeh et al., 2017; Cox et al., 2017; Gootenberg et al., 2018; Konermann et al., 2018; Liu et al., 2017), the inventors inferred that the minimal programmable RNA targeting system could have the following four components: (1) an RNA hairpin binding protein that serves as the nucleus of the system and is a selective high-affinity binder to a specific RNA structure displayed on the engineered gRNA, (2) a gRNA characterized by both a structure that interacts with the engineered hairpin binding protein and a sequence complementary to the target RNA of interest, (3) a charged protein that binds non-specifically to the displayed gRNA sequence and can stabilize and protect the guiding RNA prior to target engagement, and (4) an effector protein such as a ribonuclease or an epitranscriptome regulator that acts in a proximity-dependent manner on the targeted RNA (Figure 12A). Cas13 accommodates all of these functional components within a single protein domain (Liu et al., 2017; Tambe et al., 2018), while the inventors envisioned engineering a system that combines multiple protein domains, each performing one of these functions, which the inventors referred to as a CRISPR / Cas-inspired RNA targeting system (CIRTS). CIRTS has diverse modular compositions and is uniquely numbered as listed in Figure 12A and Figure 21.

[0187] 2. Development and in vitro validation of CIRTS-1 Regarding the CIRTS-1, which is a first-generation system, the inventors have previously engineered an evolved human hairpin-binding protein U1A protein (TBP6.7) (Blakeley and McNaughton, 2014; Crawford et al., 2016) that binds to the HIV trans-activation response (TAR) hairpin and has no endogenous human RNA hairpin target (Figure 12B). The inventors designed a gRNA that includes the TAR hairpin, a nucleotide linker sequence (L), and then a guiding sequence (Figure 12C). To develop and validate this system, the inventors first engineered a programmable ribonuclease by fusing TBP6.7 to the Pin nuclease domain of the human nonsense-mediated mRNA decay factor SMG6, which has previously been used as a non-specific proximal-dependent RNA endonuclease (Batra et al., 2017; Choudhury et al., 2012). This simplest design already exhibited promising gRNA-mediated transcript degradation in a cell-based luciferase assay (Figure 22A, left), but its performance was quite low, and the inventors thought that this was due to the degradation of the displayed guiding sequence. The protein surface and hairpin channel of the Cas13 system tend to be highly charged and are likely to bind non-specifically to the guiding RNA sequence and stabilize it (Liu et al., 2017). To engineer this RNA protection function into this system, the inventors aimed to incorporate a non-specific and low-affinity single-stranded RNA-binding protein (ssRNA-binding protein). However, the human proteome could not readily contain an annotated small non-specific single-stranded RNA-binding protein to the best of the inventors' knowledge. Therefore, the inventors developed CIRTS-1 using the small viral ssRNA-binding protein ORF5 (Zhou et al., 2006). In short, CIRTS-1 is composed of a protein fusion complex of ORF5-TBP6.7-Pin nuclease domain and the corresponding gRNA.

[0188] The inventors first characterized the in vitro programmable RNA-binding and RNA nuclease activities of CIRTS-1 against a model RNA target substrate. The Pin nuclease domain has been shown to be active in the presence of Mn2+ in the past and its activity could be quenched by the addition of EDTA (Choudhury et al., 2012). Direct overexpression of CIRTS-1 led to insoluble proteins in the cell pellet, but the inventors solved this by fusing an N-terminal MBP tag to CIRTS-1 (MBP-CIRTS-1). Using the purified MBP-CIRTS-1 protein and gRNA in a filter-binding assay, the inventors found that MBP-CIRTS-1 binds to the target RNA in a gRNA-dependent manner with an apparent binding dissociation constant (KD) of 22 nM (Figure 13A). Importantly, if the inventors provided a non-targeting gRNA to the system, they would observe a binding that is approximately 50-fold weaker. Furthermore, in the cleavage assay, the inventors found that MBP-CIRTS-1 degrades the RNA substrate in a gRNA- and Mn 2+ -dependent manner, which corroborates the activity of the Pin ribonuclease domain in the fusion context (Figure 13B). Collectively, these in vitro results validate the design principle behind CIRTS-1 and gave the inventors the motivation to optimize this system for use in living cells.

[0189] 3. Optimization of CIRTS-1 in Living Cells To examine the target nuclease activity of CIRTS-1 in live mammalian cells, we established a dual luciferase reporter assay that reports on gRNA-dependent transcriptional changes to target firefly luciferase (Fluc) RNA (Figure 14A). Using this system, we optimized the placement of the Pin nuclease CIRTS by assaying different protein linker types (Figure 23A), gRNA structure and length (Figure 23C), and CIRTS nuclease intracellular localization (Figure 22B). We found that a long flexible linker between the hairpin binding protein and the 40-nucleotide-long gRNA gave the best knockdown efficiency. After optimization, we compared the ability of the optimized CIRTS-1 (Pin nuclease) system to degrade the target reporter RNA with the Cas13b system (Cox et al., 2017). We designed gRNAs that target firefly luciferase mRNA in the dual luciferase reporter assay for both CIRTS-1 and Cas13b, as well as non-targeting gRNA (targeting lambda phage sequences) controls for each programmable nuclease. To examine whether binding to the transcript changes the protein level, we engineered CIRTS-0, which contains a previously reported “dead” mutation in the Pin nuclease domain of CIRTS-1, to serve as a negative control (Eberle et al., 2009). We found that CIRTS-0 had little effect on the expression level of the target transcript (Figures 14B and 22C), indicating that binding of the CIRTS ribonucleoprotein to the target RNA results in minimal perturbation of the targeted transcript. Next, we examined whether CIRTS-1 containing the active nuclease could mediate target degradation. Indeed, we found gRNA-dependent degradation of the target Fluc mRNA, measured by both protein level as monitored by luciferase activity (Figure 14C) and mRNA level as monitored by RT-qPCR (Figure 22D).Both results suggest that the CIRTS strategy is a feasible method in living cells. Although CIRTS-1 is less efficient than Cas13b when targeting reporter genes, its performance was not significantly different, considering that the Cas13b system has evolved to perform this knockdown function. Motivated by the performance of CIRTS-1 (Pin nuclease), the inventors then sought to evaluate the versatility of its design by replacing each component of the system, including the gRNA, hairpin-binding domain, non-specific RNA-binding domain, and effector protein, with other parts to achieve CIRTS with diverse functions.

[0190] 4. Modularity of CIRTS against reporter transcripts To explore the generality of the CIRTS design, the inventors next tested different protein domains for each component of the CIRT protein delivery system. First, the inventors assayed whether CIRTS could deliver the RNA epitranscriptome regulatory "reader" protein (Rauch et al., 2018) that they had previously delivered using the dCas13b system. For this study, the inventors decided to focus on the regulatory protein for N6-methyladenosine, the most prevalent mRNA modification. On average, each transcript contains three modification sites with high m6A abundance detected in the 3'UTR, and m6A has been shown to have regulatory roles in splicing (Xiao et al., 2016), translation (Meyer et al., 2015; Wang et al., 2015), and stability (Du et al., 2016; Wang et al., 2013). The inventors replaced the Pin nuclease effector protein of CIRTS-1 with the N-terminal domain of the YT521-B homology domain family protein 1 (YTHDF1), a cytoplasmic m6A reader protein that recruits the translation machinery (Wang et al., 2015) to generate CIRTS-2. Note that for simplicity in studying the reader protein in an m6A-dependent manner and to avoid complications from the various m6A levels in cellular mRNAs when validating CIRTS, the current design of the inventors does not include the C-terminal YTH domain of YTHDF1 that recognizes m6A. When CIRTS-2 (YTHDF1) was delivered to the same target sequence as the CIRTS-1 experiment, the RNA levels remained relatively unchanged (Figure 22E), but a significant increase in protein levels from the RNA was brought about (Figure 14D), as expected based on the known translation activation role of YTHDF1 (Wang et al., 2015). Next, the inventors replaced the YTHDF1 fragment with a fragment of YTHDF2, a different m6A reader protein that recruits the RNA deadenylation machinery to induce RNA degradation (Du et al., 2016; Wang et al., 2013) to generate CIRTS-3.Delivery of CIRTS-3 (YTHDF2) to reporter mRNA induces degradation of the target transcript as measured by both RNA (Figure 22F) and protein levels (Figure 14E). CIRTS-1 to 3 demonstrate the generality of the design strategy to deliver diverse effector protein cargos to target RNAs in living cells.

[0191] After demonstrating the modularity of the effector domain, we sought to evaluate whether other human parts could also be used for the RNA hairpin-binding domain and non-specific ssRNA-binding proteins. We replaced TBP6.7 in CIRTS-3 (YTHDF2) with the RNA hairpin-binding domain of human histone stem-loop binding protein (SLBP) to generate CIRTS-4 (YTHDF2). At the same time, we designed gRNA based on the histone mRNA stem-loop structure (Figure 12D). When CIRTS-4 (YTHDF2) was assayed in a reporter assay (Figure 14F) and by RT-qPCR to evaluate RNA levels (Figure 22G), performance similar to that of CIRTS-3 was revealed, supporting that other hairpin-binding domains can be used as the core of CIRTS.

[0192] Next, the inventors attempted to manipulate a fully humanized version of the CIRTS system. As described above, the inventors designed an initial proof-of-concept system based on the viral non-specific single-stranded RNA-binding protein ORF5. In the absence of an annotated human single-stranded non-specific RNA-binding protein, the inventors inferred that highly charged cationic human proteins could perform the role of ORF5 in the CIRTS system (Cronican et al., 2011). Therefore, the inventors engineered two cationic human proteins, HBEGF and β-defensin 3, in place of ORF5 in CIRTS-3 to generate CIRTS-5 and CIRTS-6, respectively. Again, when these programmable effectors were placed in the luciferase reporter assay, gRNA-dependent degradation of the target gene mediated by YTHDF2 epitranscriptome regulation was revealed (Figs. 14G and S2H).

[0193] Finally, the inventors used CIRTS to deliver the catalytic domain of human ADAR2 (hADAR2) to RNA transcripts and confirmed the versatility of CIRTS in the functional range when using additional effector proteins. The inventors designed a dual luciferase reporter containing a G-to-A mutation in the coding region of firefly luciferase that results in premature termination of translation and undetectable firefly luciferase activity (Figures 15A and 22J). The inventors then positioned CIRTS to deliver wt ADAR2 (CIRTS-7) or hADAR2 E488Q (CIRTS-8), a known hyperactive mutant of hADAR2 (Kuttan and Bass, 2012), to the mutated position, and as a result, in both cases, gRNA-dependent rescue of luciferase activity was brought about (Figure 15B). The hyperactive hADAR2 mutant showed higher editing efficiency and a higher background in the absence of the on-target gRNA based on the luciferase assay. On the other hand, since the hyperactive mutant has relaxed sequence constraints, using the hyperactive mutant may be beneficial to enable targeting of a broader substrate range (Kuttan and Bass, 2012). Overall, the performance of these various CIRTS in the reporter assay demonstrates the modularity of the CIRTS design, including the hairpin-binding domain and the corresponding gRNA, single-stranded RNA-binding protein, and effector protein.

[0194] 5. Targeting of endogenous mRNA by CIRTS Next, the inventors used the CIRTS-1 programmable nuclease and the CIRTS-3 programmable YTHDF2-mediated decay system as representative examples to attempt to evaluate whether the CIRTS system can deliver effector proteins to target endogenous transcripts. The inventors selected five RNA transcripts that had been previously validated as Cas13 targets because they are available for RNA targeting by programmable RNA-binding systems. The inventors then designed gRNAs for each target using the same binding sites on the targets that had been used in previous Cas13 experiments (Abudayyeh et al., 2017; Konermann et al., 2018). The inventors assayed the effect of the CIRT system on the RNA levels of each target by RT-qPCR. When cells were transfected with either CIRTS-1 or CIRTS-3 together with a specific gRNA expression vector, the inventors observed a substantial decrease in RNA levels for each of the five endogenous mRNA transcripts: PPIB, NFKB1, NRAS, B4GALNT1, and SMARCA4 by RT-qPCR (Figures 16A and 16B). In addition to mRNA targeting, the inventors also verified whether other RNA species such as lncRNAs can be targeted by directing CIRTS-1 (Pin nuclease) to MALAT1 (Figure 24A). The relative knockdown efficiency varies for each gene, which is also observed in other RNA targeting systems and is potentially mediated by gene-specific proximity or other regulatory pathways. Nevertheless, these results support that CIRTS can target endogenous transcripts and mediate decay either through active nuclease activity against the target or by inducing endogenous epitranscriptome regulatory pathways.

[0195] Next, the inventors attempted to evaluate whether CIRTS-2 could induce protein production of endogenous transcripts through the YTHDF1-mediated epitranscriptome pathway. The inventors selected the abundant transcript PPIB along with a reported reliable antibody for CypB (the protein product of PPIB) protein production analysis by Western blotting. Indeed, cells transfected with CIRTS-2 and the on-target gRNA showed an increase in protein level (Figures 16C and 24C), but no change in RNA level (Figure 24B), which is consistent with the previously reported YTHDF1 effect on transcripts (Wang et al., 2015). As a control, when the same experiment was performed using CIRTS-3 that delivers YTHDF2, a slight decrease in protein level was brought about, which correlated with a decrease in mRNA level (Figures 16B and 24C).

[0196] Finally, as a first test of the transcript position-specific effect, the inventors tiled gRNAs along the SMARCA4 mRNA and examined YTHDF2-mediated decay by CIRTS-3. The inventors found that the performance of the system varied greatly depending on where the gRNA attaches on the targeted mRNA (Figure 17), which is likely the result of both CIRTS binding proximity and regulatory protein sequence requirements. In summary, these experiments show that the CIRTS platform can function in a gRNA-dependent manner on endogenous transcripts, inducing a degradation mechanism that actively degrades the target transcript, acting on the target transcript by inducing a degradation mechanism, or activating translation from the target transcript to increase protein production.

[0197] 6. Targeting Specificity of CIRTS To gain insights into how specific CIRTS target RNA substrates, the inventors designed a series of experiments addressing gRNA sensitivity to mismatches, transcriptome-wide off-targets, and endogenous substrate targeting. To assess mismatch tolerance, the inventors designed a luciferase-based mismatch experiment that enables assay of the targeting effect when introducing one, two, or three mismatches into the duplex formed between the gRNA and the target RNA. The inventors chose to fuse the disease-related KRAS4b transcript to a luciferase reporter and sought to determine whether the engineered system could distinguish cancer-related G12D (target 1), wild-type (target 2), G12C (target 3), and G12W (target 4) KRAS4b variants (Figure 25A). The inventors found that CIRTS resulted in comparable knockdown of the G12D and wild-type variants, indicating that one mismatch does not cause a major change in targeting specificity (Figure 25B). However, when the inventors targeted this system to the G12C and G12W reporters containing two and three mismatches, respectively, the CIRTS knockdown efficiency decreased.

[0198] Next, since the inventors showed the greatest effect on knockdown efficiency in the assay, they focused on the mismatches in the central region of the duplex formed between the gRNA and the target RNA, and evaluated whether an increase in gRNA length affects the mismatch tolerance of CIRTS. As observed with the shorter 20-nt gRNA, the inventors found no difference in knockdown efficiency when targeting a reporter with no or one mismatch. However, the longer 40-nt gRNA was able to partially rescue the effect when targeting two-mismatch variants, indicating that the length of the gRNA contributes to the specificity of the system (Figure 25D). As a comparison with existing technologies, the inventors subjected Cas13b to the same mismatch assay and found that Cas13b was generally less sensitive to mismatches. Targeting Cas13b to reporters with one and two mismatches resulted in little change in knockdown efficiency, while three mismatches led to a significant decrease in knockdown efficiency (Figure 25C). Both Cas13b and CIRTS were most sensitive to mismatched base pairing in the center of the duplex formed between the gRNA and the target RNA, which is consistent with previous studies on Cas13b (Abudayyeh et al., 2017).

[0199] To evaluate transcriptome-wide off-targets, we subjected the system to RNA sequencing. We assayed the effects of the CIRTS Pin nuclease and CIRTS YTHDF2 targeting the endogenous transcript SMARCA4 (Figures 25E and 25F). In both cases, we found no statistically significant off-targets. However, we observed knockdown by CIRTS-3 (YTHDF2) of the targeted transcript, and even a statistically significant knockdown, when looking only at the target transcript (p-value < 0.1), while the knockdown level did not fall within a statistically significant region when evaluated in a transcriptome-wide manner (q-value < 0.1). In this regard, we conclude that overexpression of the system does not introduce major perturbations to the transcriptome, and together with our mismatch studies, we show that target specificity, and thus knockdown efficiency, can be further optimized by additional optimization in future studies.

[0200] To verify that CIRTS binds to transcripts of interest, we further performed RNA immunoprecipitation followed by RT-qPCR. We designed gRNAs to target two endogenous transcripts, PPIB and B4GALNT1, which had been previously targeted by the Cas13 system (Cox et al., 2017; Konermann et al., 2018). We delivered each gRNA separately together with CIRTS-0 (dead nuclease CIRTS) fused to a 3×FLAG-tag. We then subjected the lysates to immunoprecipitation with an anti-Flag antibody and quantified the relative amounts of each target RNA bound to the protein. Indeed, both endogenous transcripts were enriched 2.5- to 5-fold in a gRNA-dependent manner (Figure 25H), which supports that CIRTS functions as a programmable RNA-guided RNA-binding protein for endogenous transcripts.

[0201] 7. Multiplex targeting of multiple endogenous RNAs using CIRTS Together, the targeting specificity and modularity of CIRTS gave the inventors the idea of expanding the use of CIRTS in a multiplexed targeting format. Instead of delivering a single effector protein and targeting a single transcript at a time, the inventors aimed to investigate whether CIRTS can target more than one transcript or deliver more than one effector protein in the same sample. In principle, CIRTS constructed from the TBP hairpin-binding domain and CIRTS constructed from the SLBP hairpin-binding domain using gRNAs that are each separately engineered (Figures 12C and 12D) should be orthogonal to each other, allowing for the selective targeting of multiple transcripts with the same or different CIRTS.

[0202] First, the inventors investigated whether a single CIRTS can be used to simultaneously target multiple transcripts. The inventors co-transfected cells with CIRTS-6 along with three gRNAs targeting PPIB, SMARCA4, and NRAS and evaluated changes in RNA levels by RT-qPCR. As expected, the inventors observed a decrease in RNA levels for all three targeted transcripts (Figures 18A and 18B). However, the inventors observed a slight decrease in efficiency when some gRNAs or CIRTS were placed in the same cells. The inventors believe this decrease is due to the co-transfection of the cells with four plasmids. Further optimization of the protein and gRNA levels as well as the vectors may be needed to recover the performance of the single CIRTS / gRNA experiments.

[0203] To investigate whether two different types of effectors can be used simultaneously, the inventors next placed both a fully humanized version of the YTHDF1 construct targeting firefly luciferase, CIRTS-9, and CIRTS-10 (YTHDF2) targeting SMARCA4 (Figures 18C and 18D). The inventors found that both proteins were active and induced the predicted increase in luciferase protein and decrease in RNA levels, respectively. Furthermore, to further demonstrate the orthogonality of the multiplexed CIRTS, the inventors placed two CIRTS, CIRTS-6 (TBP6.7) and CIRTS-10 (SLBP) (Figures 26A and 26B), but used different hairpin-binding modules to deliver YTHDF2 to two different endogenous target mRNAs (Figure 27A). Each CIRT system degraded the target transcripts in an on-target gRNA-dependent manner while minimizing cross-interference between the two systems (Figure 27B).

[0204] In this regard, the inventors conclude that the TBP6.7- and SLBP-based CIRTS can each simultaneously target endogenous transcripts in a gRNA-dependent manner. The inventors are currently working on engineering orthogonal CIRTS without endogenous binding partners by evolving human proteins towards new specificities as was done with TBP6.7. Although of non-human origin, the inventors have found that other hairpin-binding systems such as PP7 can also be used to create CIRTS, suggesting that it is possible to create a wide variety of selective and orthogonal systems (Figure 22I). CIRTS enables the simultaneous delivery of multiple regulatory proteins, for example, to target one transcript for degradation and another for translational activation, which expands the potential for cell reprogramming by targeting multiple genes simultaneously in multiple dimensions (Bao et al., 2017; Gao et al., 2016).

[0205] 8. Viral Delivery of CIRTS by AAV Leaving aside the human-derived properties of CIRTS, another central advantage is the small size of CIRTS, which should enable more efficient virus packaging and delivery. Adeno-associated virus (AAV) is a versatile delivery vehicle for delivering transgenes and gene therapies to different cell types due to its wide range of available serotypes (Gao et al., 2005), low stimulation of the immune response (Vasileva and Jessberger, 2005), and low genomic insertion risk (Gao et al., 2005; Naso et al., 2017). However, packaging and delivering many Cas13 proteins has been difficult due to the limited packaging capacity of approximately 4.7 kb (Wu et al., 2010). To show the possibility of delivery of CIRTS by AAV, the inventors designed a dual CIRTS-6 / gRNA transfer plasmid and packaged it into an AAV delivery vehicle. The total insert, including the CIRTS protein and gRNA, is only 2.7 kb (Figure 19A). The inventors found that when HEK293T cells were transduced with the produced virus, the knockdown efficiency of CIRTS-6 was reproduced for both the luciferase reporter and the endogenous target (Figures 19B and 19C), which confirmed that the virus-delivered CIRTS is still functional and provides a path towards clinical development. In future applications, it is also imaginable to package more than one CIRT system into an AAV delivery vehicle and simultaneously target one transcript for upregulation and one transcript for degradation by transient transfection, as has been shown in the past.

[0206] B. Discussion Upon sorting, the inventors present here CIRTS, a versatile strategy for engineering programmable RNA effector proteins. CIRTS is small, fully humanizable, can target endogenous RNAs in living cells, and can be useful for multidimensional transcriptome control. As a research tool, CIRTS should offer advantages over conventional methods due to its smaller size. For example, CIRTS-2 and CIRTS-3 are 65 kDa and 36 kDa, respectively, while the equivalent Cas13b-based programmable YTHDF1 and YTHDF2 systems are 155 kDa and 126 kDa, respectively (Figure 20). CIRTS-1 is even smaller than the smallest DNA-targeting Cas protein Cas14a and the smallest Cas12gRNA-targeting protein discovered to date (Harrington et al., 2018; Yan et al., 2019).

[0207] From a translational perspective, CIRTS should offer several important advantages and opportunities. The humanized nature of CIRTS provides a path towards avoiding immune responses, which would likely expand the possibilities for continuous delivery therapies. Fusions between human proteins in CIRTS present potential design limitations that the immune system could respond to (Glaesner et al., 2010), although this is a problem that can in principle be avoided. When the inventors computationally predicted the immunogenicity of the most likely MHC I-binding peptides in their engineered constructs, they found that fully humanized CIRTS is less likely to elicit an immune response (Figure 27C), although further experimental investigation is needed to discover where the design limitations arise.

[0208] There are still several known problems in the current CIRT system. First, the alternative hairpin-binding protein SLBP, in its current form, has its endogenous RNA hairpin-binding partner, which can affect stem-loop RNA trafficking. To minimize the endogenous effects of our fusion constructs, we included only the minimal RNA recognition motif (RRM) necessary for hairpin recognition in this system, omitting potential interaction regions with other proteins or nucleic acids. Similarly, we tried to keep the required RNA hairpin as small as possible to avoid potential endogenous interactions. The stem-loop hairpin was already very short and could not be further shortened, but we decided to use only the minimal region required for TBP6.7 to bind to the TAR hairpin, resulting in a gRNA that is less than half the length of the original hairpin. Second, the cationic peptide β-defensin 3, in its current form, can still interact with its intracellular binding partner in theory and cause unwanted biological responses. However, human β-defensin 3 has been extensively studied and the structural basis of its function has been elucidated (Dhople et al., 2006; Kluver et al., 2005). To engineer an orthogonal RNA targeting system based on human parts, we can utilize this knowledge to engineer β-defensin 3 mutants that retain the high charge required for CIRTS but abolish endogenous functions.

[0209] From a broader perspective, the CIRTS platform demonstrates the potential to engineer proteins with new properties by combining parts contained within the human protein toolbox. The presented CIRTS was created through minimal protein engineering and optimization efforts and functions nearly identically to naturally evolved CRISPR / Cas systems. In particular, when the inventors compared Cas13b-based knockdowns by its endogenous nuclease and by delivering YTHDF2 (Figure 26C) to CIRTS-mediated knockdowns, the inventors found that the Cas13b nuclease worked substantially better than the CIRTS nuclease, while there was no difference in knockdown mediated by YTHDF2, suggesting that CIRTS-3 (YTHDF2) is already efficient to use in its current state to study the epitranscriptome. Further studies to optimize CIRTS using directed evolution are likely to yield variants with improved performance in mammalian systems (Hu et al., 2018). Understanding the target site design and effector protein-related requirements will also improve the performance of the CIRTS system, and a better understanding of the epitranscriptome pathways utilized will enable the inventors to design better systems. Additionally, there are likely many other regulatory proteins contained within the human proteome that possess unique RNA regulatory properties (Dominguez et al., 2018), which can be combined with CIRTS to create programmable versions of each protein for both functional characterization and potential translational applications. The CIRTS system provides a new approach for studying and exploring RNA regulation and will expand future opportunities to intervene in cellular regulation for disease treatment.

[0210] All of the methods disclosed and claimed in this specification can be made and executed without undue experimentation in light of this disclosure. Although the compositions and methods of the present invention are described from the perspective of preferred embodiments, it will be apparent to those skilled in the art that changes may be applied to the methods described herein, and at or during the stages or series of stages of the methods, without departing from the concept, spirit, and scope of the present invention. More specifically, certain agents that are both chemically and physiologically related may be substituted for the agents described herein, but it will be apparent that the same or similar results will be achieved. All such similar substitutions and modifications that are apparent to those skilled in the art are considered to be within the spirit, scope, and concept of the present invention as defined by the appended claims.

[0211] References The following references are specifically incorporated herein by reference to the extent that they provide exemplary procedural or other details for capturing the matters described herein. TIFF2025084877000055.tif19160TIFF2025084877000056.tif238160TIFF2025084877000057.tif238160TIFF2025084877000058.tif238160TIFF2025084877000059.tif237160TIFF2025084877000060.tif245160TIFF2025084877000061.tif237160TIFF2025084877000062.tif238160TIFF2025084877000063.tif245160TIFF2025084877000064.tif19160

[0212] Sequence Information SEQUENCE LISTING <110> THE UNIVERSITY OF CHICAGO <120> SYSTEMS AND METHODS FOR MODULATING RNA <150> US 62 / 929,339 <151> November 1, 2019 <150> US 62 / 903,080 <151> September 20, 2019 <150> US 62 / 831,342 <151> April 9, 2019 <150> US 62 / 788,571 <151> January 4, 2019 <160> 148 <170> PatentIn version 3.5 <210> 1 <211> 31 <212> RNA <213> Homo sapiens <400> 1 ggccagaucu gagccuggga gcucucuggc c 31 <210> 2 <211> 26 <212> RNA <213> Homo sapiens <400> 2 ccaaaggcuc uucucagagc caccca 26 <210> 3 <211> 369 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 3 Met Lys Ile Glu Glu Gly Lys Leu Val Ile Trp Ile Asn Gly Asp Lys 1 5 10 15 Gly Tyr Asn Gly Leu Ala Glu Val Gly Lys Lys Phe Glu Lys Asp Thr 20 25 30 Gly Ile Lys Val Thr Val Glu His Pro Asp Lys Leu Glu Glu Lys Phe 35 40 45 Pro Gln Val Ala Ala Thr Gly Asp Gly Pro Asp Ile Ile Phe Trp Ala 50 55 60 His Asp Arg Phe Gly Gly Tyr Ala Gln Ser Gly Leu Leu Ala Glu Ile 65 70 75 80 Thr Pro Asp Lys Ala Phe Gln Asp Lys Leu Tyr Pro Phe Thr Trp Asp 85 90 95 Ala Val Arg Tyr Asn Gly Lys Leu Ile Ala Tyr Pro Ile Ala Val Glu 100 105 110 Ala Leu Ser Leu Ile Tyr Asn Lys Asp Leu Leu Pro Asn Pro Pro Lys 115 120 125 Thr Trp Glu Glu Ile Pro Ala Leu Asp Lys Glu Leu Lys Ala Lys Gly 130 135 140 Lys Ser Ala Leu Met Phe Asn Leu Gln Glu Pro Tyr Phe Thr Trp Pro 145 150 155 160 Leu Ile Ala Ala Asp Gly Gly Tyr Ala Phe Lys Tyr Glu Asn Gly Lys 165 170 175 Tyr Asp Ile Lys Asp Val Gly Val Asp Asn Ala Gly Ala Lys Ala Gly 180 185 190 Leu Thr Phe Leu Val Asp Leu Ile Lys Asn Lys His Met Asn Ala Asp 195 200 205 Thr Asp Tyr Ser Ile Ala Glu Ala Ala Phe Asn Lys Gly Glu Thr Ala 210 215 220 Met Thr Ile Asn Gly Pro Trp Ala Trp Ser Asn Ile Asp Thr Ser Lys 225 230 235 240 Val Asn Tyr Gly Val Thr Val Leu Pro Thr Phe Lys Gly Gln Pro Ser 245 250 255 Lys Pro Phe Val Gly Val Leu Ser Ala Gly Ile Asn Ala Ala Ser Pro 260 265 270 Asn Lys Glu Leu Ala Lys Glu Phe Leu Glu Asn Tyr Leu Leu Thr Asp 275 280 285 Glu Gly Leu Glu Ala Val Asn Lys Asp Lys Pro Leu Gly Ala Val Ala 290 295 300 Leu Lys Ser Tyr Glu Glu Glu Leu Ala Lys Asp Pro Arg Ile Ala Ala 305 310 315 320 Thr Met Glu Asn Ala Gln Lys Gly Glu Ile Met Pro Asn Ile Pro Gln 325 330 335 Met Ser Ala Phe Trp Tyr Ala Val Arg Thr Ala Val Ile Asn Ala Ala 340 345 350 Ser Gly Arg Gln Thr Val Asp Glu Ala Leu Lys Asp Ala Gln Thr Asn 355 360 365 Ser <210> 4 <211> 40 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 4 Ile Thr Ser Leu Tyr Lys Lys Ala Gly Ser Glu Thr Val Arg Phe Gln 1 5 10 15 Ser His His His His His His Ser Ser Gly Val Asp Leu Gly Thr Glu 20 25 30 Asn Leu Tyr Phe Gln Ser Asn Ala 35 40 <210> 5 <211> 90 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 5 Met Asp Asp Pro Ser Phe Leu Thr Gly Arg Ser Thr Tyr Ala Lys Arg 1 5 10 15 Arg Arg Ala Arg Arg Met Asn Val Cys Lys Cys Gly Ala Ile Leu His 20 25 30 Asn Asn Lys Asp Cys Arg Ser Ser Thr Ile Ser Gly His Lys Leu Asp 35 40 45 Arg Leu Arg Phe Val Lys Glu Gly Arg Val Ala Leu Glu Gly Glu Thr 50 55 60 Pro Val Tyr Arg Thr Trp Val Lys Trp Val Glu Thr Glu Tyr His Ile 65 70 75 80 Asn Ile Leu Glu Thr Ser Asp Asp Glu Glu 85 90 <210> 6 <211> 18 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 6 Gly Gly Ser Gly Gly Ser Gly Gly Ser Gly Gly Ser Gly Gly Ser Gly 1 5 10 15 Gly Ser <210> 7 <211> 102 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 7 Met Ala Val Pro Glu Thr Arg Pro Asn His Thr Ile Tyr Ile Asn Asn 1 5 10 15 Leu Asn Ser Lys Ile Lys Lys Asp Glu Leu Lys Lys Ser Leu Tyr Ala 20 25 30 Ile Phe Ser Gln Phe Gly Gln Ile Leu Asp Ile Leu Val Pro Arg Gln 35 40 45 Arg Thr Pro Arg Gly Gln Ala Phe Val Ile Phe Lys Glu Val Ser Ser 50 55 60 Ala Thr Asn Ala Leu Arg Ser Met Gln Gly Phe Pro Phe Tyr Asp Lys 65 70 75 80 Pro Met Arg Ile Gln Tyr Ala Lys Thr Asp Lys Arg Ile Pro Ala Lys 85 90 95 Met Lys Gly Thr Phe Val 100 <210> 8 <211> 11 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 8 Leu Gln Leu Pro Pro Leu Glu Arg Leu Thr Leu 1 5 10 <210> 9 <211> 181 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 9 Met Glu Leu Glu Ile Arg Pro Leu Phe Leu Val Pro Asp Thr Asn Gly 1 5 10 15 Phe Ile Asp His Leu Ala Ser Leu Ala Arg Leu Leu Glu Ser Arg Lys 20 25 30 Tyr Ile Leu Val Val Pro Leu Ile Val Ile Asn Glu Leu Asp Gly Leu 35 40 45 Ala Lys Gly Gln Glu Thr Asp His Arg Ala Gly Gly Tyr Ala Arg Val 50 55 60 Val Gln Glu Lys Ala Arg Lys Ser Ile Glu Phe Leu Glu Gln Arg Phe 65 70 75 80 Glu Ser Arg Asp Ser Cys Leu Arg Ala Leu Thr Ser Arg Gly Asn Glu 85 90 95 Leu Glu Ser Ile Ala Phe Arg Ser Glu Asp Ile Thr Gly Gln Leu Gly 100 105 110 Asn Asn Asp Asp Leu Ile Leu Ser Cys Cys Leu His Tyr Cys Lys Asp 115 120 125 Lys Ala Lys Asp Phe Met Pro Ala Ser Lys Glu Glu Pro Ile Arg Leu 130 135 140 Leu Arg Glu Val Val Leu Leu Thr Asp Asp Arg Asn Leu Arg Val Lys 145 150 155 160 Ala Leu Thr Arg Asn Val Pro Val Arg Asp Ile Pro Ala Phe Leu Thr 165 170 175 Trp Ala Gln Val Gly 180 <210> 10 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic 6xHis tag <400> 10 His His His His His His 1 5 <210> 11 <211> 181 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 11 Met Glu Leu Glu Ile Arg Pro Leu Phe Leu Val Pro Asp Thr Asn Gly 1 5 10 15 Phe Ile Asp His Leu Ala Ser Leu Ala Arg Leu Leu Glu Ser Arg Lys 20 25 30 Tyr Ile Leu Val Val Pro Leu Ile Val Ile Asn Glu Leu Asp Gly Leu 35 40 45 Ala Lys Gly Gln Glu Thr Asp His Arg Ala Gly Gly Tyr Ala Arg Val 50 55 60 Val Gln Glu Lys Ala Arg Lys Ser Ile Glu Phe Leu Glu Gln Arg Phe 65 70 75 80 Glu Ser Arg Asp Ser Cys Leu Arg Ala Leu Thr Ser Arg Gly Asn Glu 85 90 95 Leu Glu Ser Ile Ala Phe Arg Ser Glu Asp Ile Thr Gly Gln Leu Gly 100 105 110 Asn Asn Ala Asp Leu Ile Leu Ser Cys Cys Leu His Tyr Cys Lys Asp 115 120 125 Lys Ala Lys Asp Phe Met Pro Ala Ser Lys Glu Glu Pro Ile Arg Leu 130 135 140 Leu Arg Glu Val Val Leu Leu Thr Asp Asp Arg Asn Leu Arg Val Lys 145 150 155 160 Ala Leu Thr Arg Asn Val Pro Val Arg Asp Ile Pro Ala Phe Leu Thr 165 170 175 Trp Ala Gln Val Gly 180 <210> 12 <211> 22 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 12 Asp Tyr Lys Asp His Asp Gly Asp Tyr Lys Asp His Asp Ile Asp Tyr 1 5 10 15 Lys Asp Asp Asp Asp Lys 20 <210> 13 <211> 16 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 13 Lys Arg Pro Ala Ala Thr Lys Lys Ala Gly Gln Ala Lys Lys Lys Lys 1 5 10 15 <210> 14 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 14 Asp Tyr Lys Asp Asp Asp Asp Lys 1 5 <210> 15 <211> 364 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 15 Met Ser Ala Thr Ser Val Asp Thr Gln Arg Thr Lys Gly Gln Asp Asn 1 5 10 15 Lys Val Gln Asn Gly Ser Leu His Gln Lys Asp Thr Val His Asp Asn 20 25 30 Asp Phe Glu Pro Tyr Leu Thr Gly Gln Ser Asn Gln Ser Asn Ser Tyr 35 40 45 Pro Ser Met Ser Asp Pro Tyr Leu Ser Ser Tyr Tyr Pro Pro Ser Ile 50 55 60 Gly Phe Pro Tyr Ser Leu Asn Glu Ala Pro Trp Ser Thr Ala Gly Asp 65 70 75 80 Pro Pro Ile Pro Tyr Leu Thr Thr Tyr Gly Gln Leu Ser Asn Gly Asp 85 90 95 His His Phe Met His Asp Ala Val Phe Gly Gln Pro Gly Gly Leu Gly 100 105 110 Asn Asn Ile Tyr Gln His Arg Phe Asn Phe Phe Pro Glu Asn Pro Ala 115 120 125 Phe Ser Ala Trp Gly Thr Ser Gly Ser Gln Gly Gln Gln Thr Gln Ser 130 135 140 Ser Ala Tyr Gly Ser Ser Tyr Thr Tyr Pro Pro Ser Ser Leu Gly Gly 145 150 155 160 Thr Val Val Asp Gly Gln Pro Gly Phe His Ser Asp Thr Leu Ser Lys 165 170 175 Ala Pro Gly Met Asn Ser Leu Glu Gln Gly Met Val Gly Leu Lys Ile 180 185 190 Gly Asp Val Ser Ser Ser Ala Val Lys Thr Val Gly Ser Val Val Ser 195 200 205 Ser Val Ala Leu Thr Gly Val Leu Ser Gly Asn Gly Gly Thr Asn Val 210 215 220 Asn Met Pro Val Ser Lys Pro Thr Ser Trp Ala Ala Ile Ala Ser Lys 225 230 235 240 Pro Ala Lys Pro Gln Pro Lys Met Lys Thr Lys Ser Gly Pro Val Met 245 250 255 Gly Gly Gly Leu Pro Pro Pro Pro Ile Lys His Asn Met Asp Ile Gly 260 265 270 Thr Trp Asp Asn Lys Gly Pro Val Pro Lys Ala Pro Val Pro Gln Gln 275 280 285 Ala Pro Ser Pro Gln Ala Ala Pro Gln Pro Gln Gln Val Ala Gln Pro 290 295 300 Leu Pro Ala Gln Pro Pro Ala Leu Ala Gln Pro Gln Tyr Gln Ser Pro 305 310 315 320 Gln Gln Pro Pro Gln Thr Arg Trp Val Ala Pro Arg Asn Arg Asn Ala 325 330 335 Ala Phe Gly Gln Ser Gly Gly Ala Gly Ser Asp Ser Asn Ser Pro Gly 340 345 350 Asn Val Gln Pro Asn Ser Ala Pro Ser Val Glu Ser 355 360 <210> 16 <211> 90 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 16 Asp Ala Met Phe Gly Gln Pro Gly Ala Leu Gly Ser Thr Pro Phe Leu 1 5 10 15 Gly Gln His Gly Phe Asn Phe Phe Pro Ser Gly Ile Asp Phe Ser Ala 20 25 30 Trp Gly Asn Asn Ser Ser Gln Gly Gln Ser Thr Gln Ser Ser Gly Tyr 35 40 45 Ser Ser Asn Tyr Ala Tyr Ala Pro Ser Ser Leu Gly Gly Ala Met Ile 50 55 60 Asp Gly Gln Ser Ala Phe Ala Asn Glu Thr Leu Asn Lys Ala Pro Gly 65 70 75 80 Met Asn Thr Ile Asp Gln Gly Met Ala Ala 85 90 <210> 17 <211> 191 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 17 Met Ser Ala Ser Ser Leu Leu Glu Gln Arg Pro Lys Gly Gln Gly Asn 1 5 10 15 Lys Val Gln Asn Gly Ser Val His Gln Lys Asp Gly Leu Asn Asp Asp 20 25 30 Asp Phe Glu Pro Tyr Leu Ser Pro Gln Ala Arg Pro Asn Asn Ala Tyr 35 40 45 Thr Ala Met Ser Asp Ser Tyr Leu Pro Ser Tyr Tyr Ser Pro Ser Ile 50 55 60 Gly Phe Ser Tyr Ser Leu Gly Glu Ala Ala Trp Ser Thr Gly Gly Asp 65 70 75 80 Thr Ala Met Pro Tyr Leu Thr Ser Tyr Gly Gln Leu Ser Asn Gly Glu 85 90 95 Pro His Phe Leu Pro Asp Ala Met Phe Gly Gln Pro Gly Ala Leu Gly 100 105 110 Ser Thr Pro Phe Leu Gly Gln His Gly Phe Asn Phe Phe Pro Ser Gly 115 120 125 Ile Asp Phe Ser Ala Trp Gly Asn Asn Ser Ser Gln Gly Gln Ser Thr 130 135 140 Gln Ser Ser Gly Tyr Ser Ser Asn Tyr Ala Tyr Ala Pro Ser Ser Leu 145 150 155 160 Gly Gly Ala Met Ile Asp Gly Gln Ser Ala Phe Ala Asn Glu Thr Leu 165 170 175 Asn Lys Ala Pro Gly Met Asn Thr Ile Asp Gln Gly Met Ala Ala 180 185 190 <210> 18 <211> 73 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 18 Ala Asp Phe Glu Thr Asp Glu Ser Val Leu Met Arg Arg Gln Lys Gln 1 5 10 15 Ile Asn Tyr Gly Lys Asn Thr Ile Ala Tyr Asp Arg Tyr Ile Lys Glu 20 25 30 Val Pro Arg His Leu Arg Gln Pro Gly Ile His Pro Lys Thr Pro Asn 35 40 45 Lys Phe Lys Lys Tyr Ser Arg Arg Ser Trp Asp Gln Gln Ile Lys Leu 50 55 60 Trp Lys Val Ala Leu His Phe Trp Asp 65 70 <210> 19 <211> 76 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 19 Methionine, Arginine, Valine, Threonine, Leucine, Serine, Serine, Lysine, Proline, Glutamine, Alanine, Leucine, Alanine, Threonine, Proline, Asparagine 1 5 10 15 Lysine, Glutamic acid, Glutamic acid, Histidine, Glycine, Lysine, Arginine, Lysine, Lysine, Lysine, Glycine, Lysine, Glycine, Leucine, Glycine, Lysine 20 25 30 Lysine, Arginine, Aspartic acid, Proline, Cysteine, Leucine, Arginine, Lysine, Tyrosine, Lysine, Aspartic acid, Phenylalanine, Cysteine, Isoleucine, Histidine, Glycine 35 40 45 Glutamic acid, Cysteine, Lysine, Tyrosine, Valine, Lysine, Glutamic acid, Leucine, Arginine, Alanine, Proline, Serine, Cysteine, Isoleucine, Cysteine, Histidine 50 55 60 Proline, Glycine, Tyrosine, Histidine, Glycine, Glutamic acid, Arginine, Cysteine, Histidine, Glycine, Leucine, Serine 65 70 75 <210> 20 <211> 46 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 20 Methionine, Glycine, Isoleucine, Isoleucine, Asparagine, Threonine, Leucine, Glutamine, Lysine, Tyrosine, Tyrosine, Cysteine, Arginine, Valine, Arginine, Glycine 1 5 10 15 Glycine, Arginine, Cysteine, Alanine, Valine, Leucine, Serine, Cysteine, Leucine, Proline, Lysine, Glutamic acid, Glutamic acid, Glutamine, Isoleucine, Glycine 20 25 30 Lysine, Cysteine, Serine, Threonine, Arginine, Glycine, Arginine, Lysine, Cysteine, Cysteine, Arginine, Arginine, Lysine, Lysine 35 40 45 <210> 21 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 21 Gly Gly Ser Gly Gly Ser Gly Gly Ser 1 5 <210> 22 <211> 16 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 22 Ser Gly Ser Glu Thr Pro Gly Thr Ser Glu Ser Ala Thr Pro Glu Ser 1 5 10 15 <210> 23 <211> 4 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 23 Gly Gly Ser Gly 1 <210> 24 <211> 73 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 24 Glu Glu Glu Glu Lys Lys Lys Gln Gln Glu Glu Glu Ala Glu Arg Leu 1 5 10 15 Arg Arg Ile Gln Glu Glu Met Glu Lys Glu Arg Lys Arg Arg Glu Glu 20 25 30 Asp Glu Gln Arg Arg Arg Lys Glu Glu Glu Glu Arg Arg Met Lys Leu 35 40 45 Glu Met Glu Ala Lys Arg Lys Gln Glu Glu Glu Glu Arg Lys Lys Arg 50 55 60 Glu Asp Asp Glu Lys Arg Lys Lys Lys 65 70 <210> 25 <211> 5 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 25 Gly Ser Gly Gly Ser 1 5 <210> 26 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 26 ggccagatct gagcctggga gctctctggc c 31 <210> 27 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 27 tgacagccca catggcattc cacttatcac tggcatcctt 40 <210> 28 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 28 ccaaaggctc ttctcagagc caccca 26 <210> 29 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 29 gtgataagtg gaatgccatg 20 <210> 30 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 30 caggtcgact ctagactcga ggctagcgag ctcgtttaaa 40 <210> 31 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 31 cttggtgctc tccaccttcc gcaccacctc catgccctct 40 <210> 32 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 32 ccgatgcggt gggctcggtc ctgcgcttgc aggtcctggt 40 <210> 33 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 33 gcctccacca gctctctgac tgtaccccca gagacctcat 40 <210> 34 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 34 aagcatcttc aacaccctgt ctggtcttgg ctgaggtttc 40 <210> 35 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 35 cttcgcaccg cagcgcagcg cggctcagct cccggctcgt 40 <210> 36 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 36 ctagactcga ggctagcgag 20 <210> 37 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 37 cgactctaga ctcgaggcta gcgagctcgt 30 <210> 38 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 38 ggccctggcc cttcccctgg agccatgctg ggccctagcc 40 <210> 39 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 39 gcccaacccc atttaaccag aaccagctgc accagctcag 40 <210> 40 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 40 cctcccaagc cctggcctga aggacccatg gcgaatgctg 40 <210> 41 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 41 cgtcccaccc gccgcctcgc ccgtgatgcc accgcagacc 40 <210> 42 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 42 ggaggtggtg gtgtgcatgc ggagggacac agcgctggag 40 <210> 43 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 43 tcacaggcaa aatccagaag ctgaccaagg cagtggccac 40 <210> 44 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 44 catggctgaa gatgaggagg ggtaccgcaa gctcatcgac 40 <210> 45 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 45 ctctggacga gaccagccag atgagcgacc tcccggtgaa 40 <210> 46 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 46 cccaccctgc ccgtggagga gaagaagaag attccagatc 40 <210> 47 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 47 aatatggcgt gtcccaggcc cttgcacgtg gcctgcagtc 40 <210> 48 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 48 ctcatcacgt acctcatgga gcacaaacgc atcaatgggc 40 <210> 49 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 49 tggtgaaggt gtcttacaag ggatccccag cagcaagacg 40 <210> 50 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 50 accccgccgc ctgctgctga cgggcacacc gctgcagaac 40 <210> 51 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 51 cagtggttta acgcaccctt tgccatgacc ggggaaaagg 40 <210> 52 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 52 acgactcaag aaggaagtcg aggcccagtt gcccgaaaag 40 <210> 53 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 53 gtgctgctga ctgatggctc cgagaaggac aagaagggca 40 <210> 54 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 54 ggaaccacga aggcggagga ccggggcatg ctgctgaaaa 40 <210> 55 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 55 tccagtcggc agacactgtg atcatttttg acagcgactg 40 <210> 56 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 56 cgccagcggg cgtcaacccc gacttggagg agccacctct 40 <210> 57 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 57 gcggaggtgg agcggctgac ctgtgaggag gaggaggaga 40 <210> 58 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 58 tgatcaagta caaggacagc agcagtggac gtcagctcag 40 <210> 59 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 59 cttcaagaag ataaaggagc gcattcgcaa ccacaagtac 40 <210> 60 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 60 agggtcccga gccaagccgg tcgtgagtga cgatgacagt 40 <210> 61 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 61 tatttataca gcagagaagc tgtaggactg tttgtgactg 40 <210> 62 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 62 ggggaacaca cgatacctgt ttttcttttc cgttgctggc 40 <210> 63 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 63 ataggccagt gaattcgagc tcgaatatgg attacttggt agaacagcaa tctacgccgg 60 aagcataaag 70 <210> 64 <211> 173 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 64 ggccagtgaa ttcgagctcg gtacccgggg atcctctaga aatatggatt acttggtaga 60 acagcaatct actcgacctg caggcatgca agcttggcgt aatcatggtc atagctgttt 120 cctgtgttta tccgctcaca attccacaca acatacgagc cggaagcata aag 173 <210> 65 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 65 ggccagatct gagcctggga gctctctggc ccagccacca cccacagagc cgccaccaga 60 <210> 66 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 66 ggccagatct gagcctggga gctctctggc cctagattgc tgttctacca agtaatccat 60 <210> 67 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic primer <400> 67 gtctcctctg acttcaacag cg 22 <210> 68 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic primer <400> 68 accaccctgt tgctgtagcc aa 22 <210> 69 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic primer <400> 69 aacgcaggca aagacaccaa cg 22 <210> 70 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic primer <400> 70 tctgtcttgg tgctctccac ct 22 <210> 71 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic primer <400> 71 aggttacaac cgccaagaag c 21 <210> 72 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic primer <400> 72 atgagaatct cgcggatctt g 21 <210> 73 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic primer <400> 73 aacgcaggca aagacaccaa cg 22 <210> 74 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic primer <400> 74 tctgtcttgg tgctctccac ct 22 <210> 75 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic primer <400> 75 gcagcactac ttcttgacca cc 22 <210> 76 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic primer <400> 76 tctgctcctg agcattgacg tc 22 <210> 77 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic primer <400> 77 gaaacctcag ccaagaccag ac 22 <210> 78 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic primer <400> 78 ggcaatccca tacaaccctg ag 22 <210> 79 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic primer <400> 79 tgaggctgct ttcactatcc gc 22 <210> 80 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic primer <400> 80 gaggaaggtc ttggtggcaa tc 22 <210> 81 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic primer <400> 81 caaagacaag cacatcctcg cc 22 <210> 82 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic primer <400> 82 gccacatagt gcgtgttgag ca 22 <210> 83 <211> 43 <212> RNA <213> Homo sapiens <400> 83 ggcgucccuc ccgaagcugc gcgcucgguc gaacaggacg acc 43 <210> 84 <211> 6 <212> RNA <213> Homo sapiens <400> 84 ucccga 6 <210> 85 <211> 22 <212> RNA <213> Homo sapiens <400> 85 ggccgaaauc ccgaaugagg cc 22 <210> 86 <211> 21 <212> RNA <213> Homo sapiens <400> 86 ggaugccucc cgagugcauc c 21 <210> 87 <211> 446 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 87 Met Asp Asp Pro Ser Phe Leu Thr Gly Arg Ser Thr Tyr Ala Lys Arg 1 5 10 15 Arg Arg Ala Arg Arg Met Asn Val Cys Lys Cys Gly Ala Ile Leu His 20 25 30 Asn Asn Lys Asp Cys Arg Ser Ser Thr Ile Ser Gly His Lys Leu Asp 35 40 45 Arg Leu Arg Phe Val Lys Glu Gly Arg Val Ala Leu Glu Gly Glu Thr 50 55 60 Pro Val Tyr Arg Thr Trp Val Lys Trp Val Glu Thr Glu Tyr His Ile 65 70 75 80 Asn Ile Leu Glu Thr Ser Asp Asp Glu Glu Gly Gly Ser Gly Gly Ser 85 90 95 Gly Gly Ser Gly Gly Ser Gly Gly Ser Gly Gly Ser Gly Gly Ser Met Ala Val Pro 100 105 110 Glu Thr Arg Pro Asn His Thr Ile Tyr Ile Asn Asn Leu Asn Ser Lys 115 120 125 Ile Lys Lys Asp Glu Leu Lys Lys Ser Leu Tyr Ala Ile Phe Ser Gln 130 135 140 Phe Gly Gln Ile Leu Asp Ile Leu Val Pro Arg Gln Arg Thr Pro Arg 145 150 155 160 Gly Gln Ala Phe Val Ile Phe Lys Glu Val Ser Ser Ala Thr Asn Ala 165 170 175 Leu Arg Ser Met Gln Gly Phe Pro Phe Tyr Asp Lys Pro Met Arg Ile 180 185 190 Gln Tyr Ala Lys Thr Asp Lys Arg Ile Pro Ala Lys Met Lys Gly Thr 195 200 205 Phe Val Gly Ser Leu Gln Leu Pro Pro Leu Glu Arg Leu Thr Leu Gly 210 215 220 Gly Ser Gly Gly Ser Gly Gly Ser Gly Gly Ser Gly Gly Ser Gly Gly 225 230 235 240 Ser Met Glu Leu Glu Ile Arg Pro Leu Phe Leu Val Pro Asp Thr Asn 245 250 255 Gly Phe Ile Asp His Leu Ala Ser Leu Ala Arg Leu Leu Glu Ser Arg 260 265 270 Lys Tyr Ile Leu Val Val Pro Leu Ile Val Ile Asn Glu Leu Asp Gly 275 280 285 Leu Ala Lys Gly Gln Glu Thr Asp His Arg Ala Gly Gly Tyr Ala Arg 290 295 300 Val Val Gln Glu Lys Ala Arg Lys Ser Ile Glu Phe Leu Glu Gln Arg 305 310 315 320 Phe Glu Ser Arg Asp Ser Cys Leu Arg Ala Leu Thr Ser Arg Gly Asn 325 330 335 Glu Leu Glu Ser Ile Ala Phe Arg Ser Glu Asp Ile Thr Gly Gln Leu 340 345 350 Gly Asn Asn Ala Asp Leu Ile Leu Ser Cys Cys Leu His Tyr Cys Lys 355 360 365 Asp Lys Ala Lys Asp Phe Met Pro Ala Ser Lys Glu Glu Pro Ile Arg 370 375 380 Leu Leu Arg Glu Val Val Leu Leu Thr Asp Asp Arg Asn Leu Arg Val 385 390 395 400 Lys Ala Leu Thr Arg Asn Val Pro Val Arg Asp Ile Pro Ala Phe Leu 405 410 415 Thr Trp Ala Gln Val Gly Gly Ser Asp Tyr Lys Asp His Asp Gly Asp 420 425 430 Tyr Lys Asp His Asp Ile Asp Tyr Lys Asp Asp Asp Asp Lys 435 440 445 <210> 88 <211> 435 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 88 Met Asp Asp Pro Ser Phe Leu Thr Gly Arg Ser Thr Tyr Ala Lys Arg 1 5 10 15 Arg Arg Ala Arg Arg Met Asn Val Cys Lys Cys Gly Ala Ile Leu His 20 25 30 Asn Asn Lys Asp Cys Arg Ser Ser Thr Ile Ser Gly His Lys Leu Asp 35 40 45 Arg Leu Arg Phe Val Lys Glu Gly Arg Val Ala Leu Glu Gly Glu Thr 50 55 60 Pro Val Tyr Arg Thr Trp Val Lys Trp Val Glu Thr Glu Tyr His Ile 65 70 75 80 Asn Ile Leu Glu Thr Ser Asp Asp Glu Glu Gly Gly Ser Gly Gly Ser 85 90 95 Gly Gly Ser Gly Gly Ser Gly Gly Ser Gly Gly Ser Gly Gly Ser Met Ala Val Pro 100 105 110 Glu Thr Arg Pro Asn His Thr Ile Tyr Ile Asn Asn Leu Asn Ser Lys 115 120 125 Ile Lys Lys Asp Glu Leu Lys Lys Ser Leu Tyr Ala Ile Phe Ser Gln 130 135 140 Phe Gly Gln Ile Leu Asp Ile Leu Val Pro Arg Gln Arg Thr Pro Arg 145 150 155 160 Gly Gln Ala Phe Val Ile Phe Lys Glu Val Ser Ser Ala Thr Asn Ala 165 170 175 Leu Arg Ser Met Gln Gly Phe Pro Phe Tyr Asp Lys Pro Met Arg Ile 180 185 190 Gln Tyr Ala Lys Thr Asp Lys Arg Ile Pro Ala Lys Met Lys Gly Thr 195 200 205 Phe Val Gly Gly Ser Gly Gly Ser Gly Gly Ser Gly Gly Ser Gly Gly 210 215 220 Ser Gly Gly Ser Met Glu Leu Glu Ile Arg Pro Leu Phe Leu Val Pro 225 230 235 240 Asp Thr Asn Gly Phe Ile Asp His Leu Ala Ser Leu Ala Arg Leu Leu 245 250 255 Glu Ser Arg Lys Tyr Ile Leu Val Val Pro Leu Ile Val Ile Asn Glu 260 265 270 Leu Asp Gly Leu Ala Lys Gly Gln Glu Thr Asp His Arg Ala Gly Gly 275 280 285 Tyr Ala Arg Val Val Gln Glu Lys Ala Arg Lys Ser Ile Glu Phe Leu 290 295 300 Glu Gln Arg Phe Glu Ser Arg Asp Ser Cys Leu Arg Ala Leu Thr Ser 305 310 315 320 Arg Gly Asn Glu Leu Glu Ser Ile Ala Phe Arg Ser Glu Asp Ile Thr 325 330 335 Gly Gln Leu Gly Asn Asn Asp Asp Leu Ile Leu Ser Cys Cys Leu His 340 345 350 Tyr Cys Lys Asp Lys Ala Lys Asp Phe Met Pro Ala Ser Lys Glu Glu 355 360 365 Pro Ile Arg Leu Leu Arg Glu Val Val Leu Leu Thr Asp Asp Arg Asn 370 375 380 Leu Arg Val Lys Ala Leu Thr Arg Asn Val Pro Val Arg Asp Ile Pro 385 390 395 400 Ala Phe Leu Thr Trp Ala Gln Val Gly Lys Arg Pro Ala Ala Thr Lys 405 410 415 Lys Ala Gly Gln Ala Lys Lys Lys Lys Gly Ser Asp Tyr Lys Asp Asp 420 425 430 Asp Asp Lys 435 <210> 89 <211> 615 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 89 Met Asp Asp Pro Ser Phe Leu Thr Gly Arg Ser Thr Tyr Ala Lys Arg 1 5 10 15 Arg Arg Ala Arg Arg Met Asn Val Cys Lys Cys Gly Ala Ile Leu His 20 25 30 Asn Asn Lys Asp Cys Arg Ser Ser Thr Ile Ser Gly His Lys Leu Asp 35 40 45 Arg Leu Arg Phe Val Lys Glu Gly Arg Val Ala Leu Glu Gly Glu Thr 50 55 60 Pro Val Tyr Arg Thr Trp Val Lys Trp Val Glu Thr Glu Tyr His Ile 65 70 75 80 Asn Ile Leu Glu Thr Ser Asp Asp Glu Glu Gly Gly Ser Gly Gly Ser 85 90 95 Gly Gly Ser Gly Gly Ser Gly Gly Ser Gly Gly Ser Gly Gly Ser Met Ala Val Pro 100 105 110 Glu Thr Arg Pro Asn His Thr Ile Tyr Ile Asn Asn Leu Asn Ser Lys 115 120 125 Ile Lys Lys Asp Glu Leu Lys Lys Ser Leu Tyr Ala Ile Phe Ser Gln 130 135 140 Phe Gly Gln Ile Leu Asp Ile Leu Val Pro Arg Gln Arg Thr Pro Arg 145 150 155 160 Gly Gln Ala Phe Val Ile Phe Lys Glu Val Ser Ser Ala Thr Asn Ala 165 170 175 Leu Arg Ser Met Gln Gly Phe Pro Phe Tyr Asp Lys Pro Met Arg Ile 180 185 190 Gln Tyr Ala Lys Thr Asp Lys Arg Ile Pro Ala Lys Met Lys Gly Thr 195 200 205 Phe Val Gly Ser Leu Gln Leu Pro Pro Leu Glu Arg Leu Thr Leu Gly 210 215 220 Gly Ser Gly Gly Ser Gly Gly Ser Gly Gly Ser Gly Gly Ser Gly Gly 225 230 235 240 Ser Met Ser Ala Thr Ser Val Asp Thr Gln Arg Thr Lys Gly Gln Asp 245 250 255 Asn Lys Val Gln Asn Gly Ser Leu His Gln Lys Asp Thr Val His Asp 260 265 270 Asn Asp Phe Glu Pro Tyr Leu Thr Gly Gln Ser Asn Gln Ser Asn Ser 275 280 285 Tyr Pro Ser Met Ser Asp Pro Tyr Leu Ser Ser Tyr Tyr Pro Pro Ser 290 295 300 Ile Gly Phe Pro Tyr Ser Leu Asn Glu Ala Pro Trp Ser Thr Ala Gly 305 310 315 320 Asp Pro Pro Ile Pro Tyr Leu Thr Thr Tyr Gly Gln Leu Ser Asn Gly 325 330 335 Asp His His Phe Met His Asp Ala Val Phe Gly Gln Pro Gly Gly Leu 340 345 350 Gly Asn Asn Ile Tyr Gln His Arg Phe Asn Phe Phe Pro Glu Asn Pro 355 360 365 Ala Phe Ser Ala Trp Gly Thr Ser Gly Ser Gln Gly Gln Gln Thr Gln 370 375 380 Ser Ser Ala Tyr Gly Ser Ser Tyr Thr Tyr Pro Pro Ser Ser Leu Gly 385 390 395 400 Gly Thr Val Val Asp Gly Gln Pro Gly Phe His Ser Asp Thr Leu Ser 405 410 415 Lys Ala Pro Gly Met Asn Ser Leu Glu Gln Gly Met Val Gly Leu Lys 420 425 430 Ile Gly Asp Val Ser Ser Ser Ala Val Lys Thr Val Gly Ser Val Val 435 440 445 Ser Ser Val Ala Leu Thr Gly Val Leu Ser Gly Asn Gly Gly Thr Asn 450 455 460 Val Asn Met Pro Val Ser Lys Pro Thr Ser Trp Ala Ala Ile Ala Ser 465 470 475 480 Lys Pro Ala Lys Pro Gln Pro Lys Met Lys Thr Lys Ser Gly Pro Val 485 490 495 Met Gly Gly Gly Leu Pro Pro Pro Pro Ile Lys His Asn Met Asp Ile 500 505 510 Gly Thr Trp Asp Asn Lys Gly Pro Val Pro Lys Ala Pro Val Pro Gln 515 520 525 Gln Ala Pro Ser Pro Gln Ala Ala Pro Gln Pro Gln Gln Val Ala Gln 530 535 540 Pro Leu Pro Ala Gln Pro Pro Ala Leu Ala Gln Pro Gln Tyr Gln Ser 545 550 555 560 Pro Gln Gln Pro Pro Gln Thr Arg Trp Val Ala Pro Arg Asn Arg Asn 565 570 575 Ala Ala Phe Gly Gln Ser Gly Gly Ala Gly Ser Asp Ser Asn Ser Pro 580 585 590 Gly Asn Val Gln Pro Asn Ser Ala Pro Ser Val Glu Ser Gly Ser Asp 595 600 605 Tyr Lys Asp Asp Asp Asp Lys 610 615 <210> 90 <211> 341 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 90 Met Asp Asp Pro Ser Phe Leu Thr Gly Arg Ser Thr Tyr Ala Lys Arg 1 5 10 15 Arg Arg Ala Arg Arg Met Asn Val Cys Lys Cys Gly Ala Ile Leu His 20 25 30 Asn Asn Lys Asp Cys Arg Ser Ser Thr Ile Ser Gly His Lys Leu Asp 35 40 45 Arg Leu Arg Phe Val Lys Glu Gly Arg Val Ala Leu Glu Gly Glu Thr 50 55 60 Pro Val Tyr Arg Thr Trp Val Lys Trp Val Glu Thr Glu Tyr His Ile 65 70 75 80 Asn Ile Leu Glu Thr Ser Asp Asp Glu Glu Gly Gly Ser Gly Gly Ser 85 90 95 Gly Gly Ser Gly Gly Ser Gly Gly Ser Gly Gly Ser Gly Gly Ser Met Ala Val Pro 100 105 110 Glu Thr Arg Pro Asn His Thr Ile Tyr Ile Asn Asn Leu Asn Ser Lys 115 120 125 Ile Lys Lys Asp Glu Leu Lys Lys Ser Leu Tyr Ala Ile Phe Ser Gln 130 135 140 Phe Gly Gln Ile Leu Asp Ile Leu Val Pro Arg Gln Arg Thr Pro Arg 145 150 155 160 Gly Gln Ala Phe Val Ile Phe Lys Glu Val Ser Ser Ala Thr Asn Ala 165 170 175 Leu Arg Ser Met Gln Gly Phe Pro Phe Tyr Asp Lys Pro Met Arg Ile 180 185 190 Gln Tyr Ala Lys Thr Asp Lys Arg Ile Pro Ala Lys Met Lys Gly Thr 195 200 205 Phe Val Gly Ser Leu Gln Leu Pro Pro Leu Glu Arg Leu Thr Leu Gly 210 215 220 Gly Ser Gly Gly Ser Gly Gly Ser Gly Gly Ser Gly Gly Ser Gly Gly 225 230 235 240 Ser Asp Ala Met Phe Gly Gln Pro Gly Ala Leu Gly Ser Thr Pro Phe 245 250 255 Leu Gly Gln His Gly Phe Asn Phe Phe Pro Ser Gly Ile Asp Phe Ser 260 265 270 Ala Trp Gly Asn Asn Ser Ser Gln Gly Gln Ser Thr Gln Ser Ser Gly 275 280 285 Tyr Ser Ser Asn Tyr Ala Tyr Ala Pro Ser Ser Leu Gly Gly Ala Met 290 295 300 Ile Asp Gly Gln Ser Ala Phe Ala Asn Glu Thr Leu Asn Lys Ala Pro 305 310 315 320 Gly Met Asn Thr Ile Asp Gln Gly Met Ala Ala Gly Ser Asp Tyr Lys 325 330 335 Asp Asp Asp Asp Lys 340 <210> 91 <211> 442 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 91 Met Asp Asp Pro Ser Phe Leu Thr Gly Arg Ser Thr Tyr Ala Lys Arg 1 5 10 15 Arg Arg Ala Arg Arg Met Asn Val Cys Lys Cys Gly Ala Ile Leu His 20 25 30 Asn Asn Lys Asp Cys Arg Ser Ser Thr Ile Ser Gly His Lys Leu Asp 35 40 45 Arg Leu Arg Phe Val Lys Glu Gly Arg Val Ala Leu Glu Gly Glu Thr 50 55 60 Pro Val Tyr Arg Thr Trp Val Lys Trp Val Glu Thr Glu Tyr His Ile 65 70 75 80 Asn Ile Leu Glu Thr Ser Asp Asp Glu Glu Gly Gly Ser Gly Gly Ser 85 90 95 Gly Gly Ser Gly Gly Ser Gly Gly Ser Gly Gly Ser Met Ala Val Pro 100 105 110 Glu Thr Arg Pro Asn His Thr Ile Tyr Ile Asn Asn Leu Asn Ser Lys 115 120 125 Ile Lys Lys Asp Glu Leu Lys Lys Ser Leu Tyr Ala Ile Phe Ser Gln 130 135 140 Phe Gly Gln Ile Leu Asp Ile Leu Val Pro Arg Gln Arg Thr Pro Arg 145 150 155 160 Gly Gln Ala Phe Val Ile Phe Lys Glu Val Ser Ser Ala Thr Asn Ala 165 170 175 Leu Arg Ser Met Gln Gly Phe Pro Phe Tyr Asp Lys Pro Met Arg Ile 180 185 190 Gln Tyr Ala Lys Thr Asp Lys Arg Ile Pro Ala Lys Met Lys Gly Thr 195 200 205 Phe Val Gly Ser Leu Gln Leu Pro Pro Leu Glu Arg Leu Thr Leu Gly 210 215 220 Gly Ser Gly Gly Ser Gly Gly Ser Gly Gly Ser Gly Gly Ser Gly Gly 225 230 235 240 Ser Met Ser Ala Ser Ser Leu Leu Glu Gln Arg Pro Lys Gly Gln Gly 245 250 255 Asn Lys Val Gln Asn Gly Ser Val His Gln Lys Asp Gly Leu Asn Asp 260 265 270 Asp Asp Phe Glu Pro Tyr Leu Ser Pro Gln Ala Arg Pro Asn Asn Ala 275 280 285 Tyr Thr Ala Met Ser Asp Ser Tyr Leu Pro Ser Tyr Tyr Ser Pro Ser 290 295 300 Ile Gly Phe Ser Tyr Ser Leu Gly Glu Ala Ala Trp Ser Thr Gly Gly 305 310 315 320 Asp Thr Ala Met Pro Tyr Leu Thr Ser Tyr Gly Gln Leu Ser Asn Gly 325 330 335 Glu Pro His Phe Leu Pro Asp Ala Met Phe Gly Gln Pro Gly Ala Leu 340 345 350 Gly Ser Thr Pro Phe Leu Gly Gln His Gly Phe Asn Phe Phe Pro Ser 355 360 365 Gly Ile Asp Phe Ser Ala Trp Gly Asn Asn Ser Ser Gln Gly Gln Ser 370 375 380 Thr Gln Ser Ser Gly Tyr Ser Ser Asn Tyr Ala Tyr Ala Pro Ser Ser 385 390 395 400 Leu Gly Gly Ala Met Ile Asp Gly Gln Ser Ala Phe Ala Asn Glu Thr 405 410 415 Leu Asn Lys Ala Pro Gly Met Asn Thr Ile Asp Gln Gly Met Ala Ala 420 425 430 Gly Ser Asp Tyr Lys Asp Asp Asp Asp Lys 435 440 <210> 92 <211> 310 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 92 Met Asp Asp Pro Ser Phe Leu Thr Gly Arg Ser Thr Tyr Ala Lys Arg 1 5 10 15 Arg Arg Ala Arg Arg Met Asn Val Cys Lys Cys Gly Ala Ile Leu His 20 25 30 Asn Asn Lys Asp Cys Arg Ser Ser Thr Ile Ser Gly His Lys Leu Asp 35 40 45 Arg Leu Arg Phe Val Lys Glu Gly Arg Val Ala Leu Glu Gly Glu Thr 50 55 60 Pro Val Tyr Arg Thr Trp Val Lys Trp Val Glu Thr Glu Tyr His Ile 65 70 75 80 Asn Ile Leu Glu Thr Ser Asp Asp Glu Glu Gly Gly Ser Gly Gly Ser 85 90 95 Gly Gly Ser Gly Gly Ser Gly Gly Ser Gly Gly Ser Ala Asp Phe Glu 100 105 110 Thr Asp Glu Ser Val Leu Met Arg Arg Gln Lys Gln Ile Asn Tyr Gly 115 120 125 Lys Asn Thr Ile Ala Tyr Asp Arg Tyr Ile Lys Glu Val Pro Arg His 130 135 140 Leu Arg Gln Pro Gly Ile His Pro Lys Thr Pro Asn Lys Phe Lys Lys 145 150 155 160 Tyr Ser Arg Arg Ser Trp Asp Gln Gln Ile Lys Leu Trp Lys Val Ala 165 170 175 Leu His Phe Trp Asp Leu Gln Leu Pro Pro Leu Glu Arg Leu Thr Leu 180 185 190 Gly Gly Ser Gly Gly Ser Gly Gly Ser Gly Gly Ser Gly Gly Ser Gly 195 200 205 Gly Ser Asp Ala Met Phe Gly Gln Pro Gly Ala Leu Gly Ser Thr Pro 210 215 220 Phe Leu Gly Gln His Gly Phe Asn Phe Phe Pro Ser Gly Ile Asp Phe 225 230 235 240 Ser Ala Trp Gly Asn Asn Ser Ser Gln Gly Gln Ser Thr Gln Ser Ser 245 250 255 Gly Tyr Ser Ser Asn Tyr Ala Tyr Ala Pro Ser Ser Leu Gly Gly Ala 260 265 270 Met Ile Asp Gly Gln Ser Ala Phe Ala Asn Glu Thr Leu Asn Lys Ala 275 280 285 Pro Gly Met Asn Thr Ile Asp Gln Gly Met Ala Ala Gly Ser Asp Tyr 290 295 300 Lys Asp Asp Asp Asp Lys 305 310 <210> 93 <211> 411 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 93 Met Asp Asp Pro Ser Phe Leu Thr Gly Arg Ser Thr Tyr Ala Lys Arg 1 5 10 15 Arg Arg Ala Arg Arg Met Asn Val Cys Lys Cys Gly Ala Ile Leu His 20 25 30 Asn Asn Lys Asp Cys Arg Ser Ser Thr Ile Ser Gly His Lys Leu Asp 35 40 45 Arg Leu Arg Phe Val Lys Glu Gly Arg Val Ala Leu Glu Gly Glu Thr 50 55 60 Pro Val Tyr Arg Thr Trp Val Lys Trp Val Glu Thr Glu Tyr His Ile 65 70 75 80 Asn Ile Leu Glu Thr Ser Asp Asp Glu Glu Gly Gly Ser Gly Gly Ser 85 90 95 Gly Gly Ser Gly Gly Ser Gly Gly Ser Gly Gly Ser Ala Asp Phe Glu 100 105 110 Thr Asp Glu Ser Val Leu Met Arg Arg Gln Lys Gln Ile Asn Tyr Gly 115 120 125 Lys Asn Thr Ile Ala Tyr Asp Arg Tyr Ile Lys Glu Val Pro Arg His 130 135 140 Leu Arg Gln Pro Gly Ile His Pro Lys Thr Pro Asn Lys Phe Lys Lys 145 150 155 160 Tyr Ser Arg Arg Ser Trp Asp Gln Gln Ile Lys Leu Trp Lys Val Ala 165 170 175 Leu His Phe Trp Asp Leu Gln Leu Pro Pro Leu Glu Arg Leu Thr Leu 180 185 190 Gly Gly Ser Gly Gly Ser Gly Gly Ser Gly Gly Ser Gly Gly Ser Gly 195 200 205 Gly Ser Met Ser Ala Ser Ser Leu Leu Glu Gln Arg Pro Lys Gly Gln 210 215 220 Gly Asn Lys Val Gln Asn Gly Ser Val His Gln Lys Asp Gly Leu Asn 225 230 235 240 Asp Asp Asp Phe Glu Pro Tyr Leu Ser Pro Gln Ala Arg Pro Asn Asn 245 250 255 Ala Tyr Thr Ala Met Ser Asp Ser Tyr Leu Pro Ser Tyr Tyr Ser Pro 260 265 270 Ser Ile Gly Phe Ser Tyr Ser Leu Gly Glu Ala Ala Trp Ser Thr Gly 275 280 285 Gly Asp Thr Ala Met Pro Tyr Leu Thr Ser Tyr Gly Gln Leu Ser Asn 290 295 300 Gly Glu Pro His Phe Leu Pro Asp Ala Met Phe Gly Gln Pro Gly Ala 305 310 315 320 Leu Gly Ser Thr Pro Phe Leu Gly Gln His Gly Phe Asn Phe Phe Pro 325 330 335 Ser Gly Ile Asp Phe Ser Ala Trp Gly Asn Asn Ser Ser Gln Gly Gln 340 345 350 Ser Thr Gln Ser Ser Gly Tyr Ser Ser Asn Tyr Ala Tyr Ala Pro Ser 355 360 365 Ser Leu Gly Gly Ala Met Ile Asp Gly Gln Ser Ala Phe Ala Asn Glu 370 375 380 Thr Leu Asn Lys Ala Pro Gly Met Asn Thr Ile Asp Gln Gly Met Ala 385 390 395 400 Ala Gly Ser Asp Tyr Lys Asp Asp Asp Asp Lys 405 410 <210> 94 <211> 327 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 94 Met Arg Val Thr Leu Ser Ser Lys Pro Gln Ala Leu Ala Thr Pro Asn 1 5 10 15 Lys Glu Glu His Gly Lys Arg Lys Lys Lys Gly Lys Gly Leu Gly Lys 20 25 30 Lys Arg Asp Pro Cys Leu Arg Lys Tyr Lys Asp Phe Cys Ile His Gly 35 40 45 Glu Cys Lys Tyr Val Lys Glu Leu Arg Ala Pro Ser Cys Ile Cys His 50 55 60 Pro Gly Tyr His Gly Glu Arg Cys His Gly Leu Ser Gly Gly Ser Gly 65 70 75 80 Gly Ser Gly Gly Ser Gly Gly Ser Gly Gly Ser Gly Gly Ser Met Ala 85 90 95 Val Pro Glu Thr Arg Pro Asn His Thr Ile Tyr Ile Asn Asn Leu Asn 100 105 110 Ser Lys Ile Lys Lys Asp Glu Leu Lys Lys Ser Leu Tyr Ala Ile Phe 115 120 125 Ser Gln Phe Gly Gln Ile Leu Asp Ile Leu Val Pro Arg Gln Arg Thr 130 135 140 Pro Arg Gly Gln Ala Phe Val Ile Phe Lys Glu Val Ser Ser Ala Thr 145 150 155 160 Asn Ala Leu Arg Ser Met Gln Gly Phe Pro Phe Tyr Asp Lys Pro Met 165 170 175 Arg Ile Gln Tyr Ala Lys Thr Asp Lys Arg Ile Pro Ala Lys Met Lys 180 185 190 Gly Thr Phe Val Gly Ser Leu Gln Leu Pro Pro Leu Glu Arg Leu Thr 195 200 205 Leu Gly Gly Ser Gly Gly Ser Gly Gly Ser Gly Gly Ser Gly Gly Ser 210 215 220 Gly Gly Ser Asp Ala Met Phe Gly Gln Pro Gly Ala Leu Gly Ser Thr 225 230 235 240 Pro Phe Leu Gly Gln His Gly Phe Asn Phe Phe Pro Ser Gly Ile Asp 245 250 255 Phe Ser Ala Trp Gly Asn Asn Ser Ser Gln Gly Gln Ser Thr Gln Ser 260 265 270 Ser Gly Tyr Ser Ser Asn Tyr Ala Tyr Ala Pro Ser Ser Leu Gly Gly 275 280 285 Ala Met Ile Asp Gly Gln Ser Ala Phe Ala Asn Glu Thr Leu Asn Lys 290 295 300 Ala Pro Gly Met Asn Thr Ile Asp Gln Gly Met Ala Ala Gly Ser Asp 305 310 315 320 Tyr Lys Asp Asp Asp Asp Lys 325 <210> 95 <211> 428 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 95 Met Arg Val Thr Leu Ser Ser Lys Pro Gln Ala Leu Ala Thr Pro Asn 1 5 10 15 Lys Glu Glu His Gly Lys Arg Lys Lys Lys Gly Lys Gly Leu Gly Lys 20 25 30 Lys Arg Asp Pro Cys Leu Arg Lys Tyr Lys Asp Phe Cys Ile His Gly 35 40 45 Glu Cys Lys Tyr Val Lys Glu Leu Arg Ala Pro Ser Cys Ile Cys His 50 55 60 Pro Gly Tyr His Gly Glu Arg Cys His Gly Leu Ser Gly Gly Ser Gly 65 70 75 80 Gly Ser Gly Gly Ser Gly Gly Ser Gly Gly Ser Gly Gly Ser Met Ala 85 90 95 Val Pro Glu Thr Arg Pro Asn His Thr Ile Tyr Ile Asn Asn Leu Asn 100 105 110 Ser Lys Ile Lys Lys Asp Glu Leu Lys Lys Ser Leu Tyr Ala Ile Phe 115 120 125 Ser Gln Phe Gly Gln Ile Leu Asp Ile Leu Val Pro Arg Gln Arg Thr 130 135 140 Pro Arg Gly Gln Ala Phe Val Ile Phe Lys Glu Val Ser Ser Ala Thr 145 150 155 160 Asn Ala Leu Arg Ser Met Gln Gly Phe Pro Phe Tyr Asp Lys Pro Met 165 170 175 Arg Ile Gln Tyr Ala Lys Thr Asp Lys Arg Ile Pro Ala Lys Met Lys 180 185 190 Gly Thr Phe Val Gly Ser Leu Gln Leu Pro Pro Leu Glu Arg Leu Thr 195 200 205 Leu Gly Gly Ser Gly Gly Ser Gly Gly Ser Gly Gly Ser Gly Gly Ser 210 215 220 Gly Gly Ser Met Ser Ala Ser Ser Leu Leu Glu Gln Arg Pro Lys Gly 225 230 235 240 Gln Gly Asn Lys Val Gln Asn Gly Ser Val His Gln Lys Asp Gly Leu 245 250 255 Asn Asp Asp Asp Phe Glu Pro Tyr Leu Ser Pro Gln Ala Arg Pro Asn 260 265 270 Asn Ala Tyr Thr Ala Met Ser Asp Ser Tyr Leu Pro Ser Tyr Tyr Ser 275 280 285 Pro Ser Ile Gly Phe Ser Tyr Ser Leu Gly Glu Ala Ala Trp Ser Thr 290 295 300 Gly Gly Asp Thr Ala Met Pro Tyr Leu Thr Ser Tyr Gly Gln Leu Ser 305 310 315 320 Asn Gly Glu Pro His Phe Leu Pro Asp Ala Met Phe Gly Gln Pro Gly 325 330 335 Ala Leu Gly Ser Thr Pro Phe Leu Gly Gln His Gly Phe Asn Phe Phe 340 345 350 Pro Ser Gly Ile Asp Phe Ser Ala Trp Gly Asn Asn Ser Ser Gln Gly 355 360 365 Gln Ser Thr Gln Ser Ser Gly Tyr Ser Ser Asn Tyr Ala Tyr Ala Pro 370 375 380 Ser Ser Leu Gly Gly Ala Met Ile Asp Gly Gln Ser Ala Phe Ala Asn 385 390 395 400 Glu Thr Leu Asn Lys Ala Pro Gly Met Asn Thr Ile Asp Gln Gly Met 405 410 415 Ala Ala Gly Ser Asp Tyr Lys Asp Asp Asp Asp Lys 420 425 <210> 96 <211> 297 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 96 Met Gly Ile Ile Asn Thr Leu Gln Lys Tyr Tyr Cys Arg Val Arg Gly 1 5 10 15 Gly Arg Cys Ala Val Leu Ser Cys Leu Pro Lys Glu Glu Gln Ile Gly 20 25 30 Lys Cys Ser Thr Arg Gly Arg Lys Cys Cys Arg Arg Lys Lys Gly Gly 35 40 45 Ser Gly Gly Ser Gly Gly Ser Gly Gly Ser Gly Gly Ser Gly Gly Ser 50 55 60 Met Ala Val Pro Glu Thr Arg Pro Asn His Thr Ile Tyr Ile Asn Asn 65 70 75 80 Leu Asn Ser Lys Ile Lys Lys Asp Glu Leu Lys Lys Ser Leu Tyr Ala 85 90 95 Ile Phe Ser Gln Phe Gly Gln Ile Leu Asp Ile Leu Val Pro Arg Gln 100 105 110 Arg Thr Pro Arg Gly Gln Ala Phe Val Ile Phe Lys Glu Val Ser Ser 115 120 125 Ala Thr Asn Ala Leu Arg Ser Met Gln Gly Phe Pro Phe Tyr Asp Lys 130 135 140 Pro Met Arg Ile Gln Tyr Ala Lys Thr Asp Lys Arg Ile Pro Ala Lys 145 150 155 160 Met Lys Gly Thr Phe Val Gly Ser Leu Gln Leu Pro Pro Leu Glu Arg 165 170 175 Leu Thr Leu Gly Gly Ser Gly Gly Ser Gly Gly Ser Gly Gly Ser Gly 180 185 190 Gly Ser Gly Gly Ser Asp Ala Met Phe Gly Gln Pro Gly Ala Leu Gly 195 200 205 Ser Thr Pro Phe Leu Gly Gln His Gly Phe Asn Phe Phe Pro Ser Gly 210 215 220 Ile Asp Phe Ser Ala Trp Gly Asn Asn Ser Ser Gln Gly Gln Ser Thr 225 230 235 240 Gln Ser Ser Gly Tyr Ser Ser Asn Tyr Ala Tyr Ala ...

Claims

1. (i) an RNA hairpin-binding domain; (ii) an RNA targeting molecule comprising an RNA targeting region and at least one hairpin structure, wherein the hairpin structure specifically binds to (i); and (iii) RNA regulatory domain An RNA regulatory system comprising at least one of each of:

2. The system of claim 1, wherein the RNA hairpin binding domain and the RNA regulatory domain are operably linked.

3. 2. The system of claim 1, wherein parts (i), (ii) and / or (iii) are human or of human origin.

4. 4. The system of claim 2 or 3, wherein (i) and (iii) are operably linked through a peptide bond.

5. 4. The system of claim 2 or 3, wherein (i) and (iii) are operably linked through non-covalent interactions.

6. 6. The system of any one of claims 1 to 5, wherein the RNA regulatory domain is covalently linked to a first dimerization domain and the RNA hairpin binding domain is covalently linked to a second dimerization domain, wherein the first and second dimerization domains are capable of dimerizing to form a non-covalent or covalent linkage.

7. The system of claim 6, wherein dimerization is inducible.

8. The system of claim 7, wherein the dimerization comprises ligand-induced dimerization.

9. 9. The system of claim 8, wherein one of the first or second dimerization domains comprises PYR / PYR1-like (PYL1), the other of the first or second domain comprises ABA-insensitive 1 (ABI1), and the ligand comprises abscisic acid (ABA) or a derivative or fragment thereof.

10. The system of claim 8, wherein the first and / or second dimerization domain comprises FKBP12 and the ligand comprises FK1012 or a derivative or fragment thereof.

11. The system of claim 8, wherein one of the first or second dimerization domains comprises an FK506 binding protein (FKBP), the other of the first or second domain comprises an FKBP-Rap binding domain (Frb) of a mammalian Rap target mTOR, and the ligand comprises rapamycin (Rap) or a derivative or fragment thereof.

12. The system of any one of claims 1 to 11, wherein (ii) comprises at least two hairpin structures.

13. The system of any one of claims 1 to 12, wherein (ii) comprises one or more modified nucleotides.

14. The system of any one of claims 1 to 13, further comprising a stabilizer polypeptide, the stabilizer polypeptide comprising a cationic polypeptide that non-specifically binds to nucleic acids.

15. The system of claim 14, wherein the stabilizer polypeptide is of human origin.

16. 16. The system of any one of claims 1 to 15, having an overall size of less than 150 kDa.

17. The system of any one of claims 1 to 16, wherein (i) comprises U1A, SLBP, or a variant thereof.

18. The system of any one of claims 1 to 17, wherein (ii) comprises a TAR hairpin scaffold of SEQ ID NO:

1.

19. The system of any one of claims 1 to 18, wherein (ii) comprises a SLBP hairpin scaffold of SEQ ID NO:

2.

20. The system of any one of claims 1 to 19, wherein (ii) comprises a linker.

21. 21. The system of claim 20, wherein the linker is at least 5 amino acids.

22. 22. The system of any one of claims 1 to 21, wherein the RNA targeting region comprises at least 12 nucleotides.

23. 23. The system of any one of claims 1 to 22, wherein (iii) comprises a nuclease, a methylase, a demethylase, a translation activator, a translation repressor, a single-stranded RNA cleavage activity, a double-stranded RNA cleavage activity, or an RNA binding activity.

24. 24. The system of any one of claims 1 to 23, wherein (iii) comprises a Pin nuclease domain or an m6A leader protein or a portion thereof.

25. The system of claim 24, wherein (iii) comprises YTHDF1, YTHDF2, or ADAR.

26. The system of any one of claims 14 to 25, wherein the stabilizer protein comprises HBEGF, beta-defensin, or a variant or portion thereof.

27. The system of any one of claims 1 to 26, wherein the RNA targeting region of (ii) hybridizes to a target RNA in a prokaryotic or eukaryotic cell.

28. The system of any one of claims 1 to 27, wherein (i) and / or (iii) comprise one or more nuclear localization signals (NLS).

29. 29. The system of any one of claims 1-28, comprising at least two of each of (i), (ii), and (iii).

30. The system of any one of claims 1 to 29, wherein the RNA regulatory domain cleaves RNA, promotes RNA translation, inhibits RNA translation, or modifies the base sequence of the RNA.

31. (i) an RNA hairpin-binding domain; (ii) an RNA targeting molecule comprising an RNA targeting region and at least one hairpin structure, wherein the hairpin structure specifically binds to (i); and (iii) RNA regulatory domain One or more nucleic acid vectors comprising nucleotides encoding A vector system comprising:

32. 32. The vector system of claim 31 , wherein the RNA hairpin binding domain and the RNA regulatory domain are operably linked.

33. 32. The vector system of claim 31, further comprising a regulatory element operably linked to the nucleotides encoding (i), (ii), and / or (iii).

34. 34. The vector system of claim 31 or 33, wherein one or more nucleic acid vectors are optimized for expression in eukaryotic cells.

35. The vector system of any one of claims 31 to 34, wherein expression is constitutive or conditional.

36. The vector system of any one of claims 31 to 35, wherein (i), (ii), and (iii) are on a single vector.

37. The vector system of any one of claims 31 to 36, wherein one or more of the vectors is a viral vector.

38. The vector system of claims 31-37, wherein the one or more vectors comprise one or more retroviral, lentiviral, adenoviral, adeno-associated viral or herpes simplex viral vectors.

39. The vector system of any one of claims 31 to 36, wherein one or more of the vectors is a non-viral vector.

40. A conjugate comprising an RNA regulatory domain operably linked to an RNA targeting molecule, the RNA targeting molecule comprising an RNA targeting region and at least one hairpin structure.

41. 41. The conjugate of claim 40, wherein the RNA regulatory domain is of human origin.

42. 42. The conjugate of claim 40 or 41, wherein the RNA regulatory domain and the RNA targeting molecule are operably linked through a peptide bond.

43. The conjugate of any one of claims 40 to 42, wherein the polypeptide further comprises one or more linkers.

44. 42. The conjugate of claim 40 or 41, wherein the RNA regulatory domain and the RNA targeting molecule are operably linked through a non-covalent interaction.

45. 45. The conjugate of any one of claims 40 to 44, wherein the RNA regulatory domain is covalently linked to a first dimerization domain and the RNA targeting molecule is covalently linked to a second dimerization domain, wherein the first and second dimerization domains are capable of dimerizing to form a non-covalent or covalent linkage.

46. 46. ​​The conjugate of claim 45, wherein dimerization is inducible.

47. 47. The conjugate of claim 46, wherein the dimerization comprises ligand-induced dimerization.

48. 48. The conjugate of claim 47, wherein one of the first or second dimerization domains comprises PYR / PYR1-like (PYL1), the other of the first or second domain comprises ABA-insensitive 1 (ABI1), and the ligand comprises abscisic acid (ABA) or a derivative or fragment thereof.

49. 48. The conjugate of claim 47, wherein the first and / or second dimerization domain comprises FKBP12 and the ligand comprises FK1012 or a derivative or fragment thereof.

50. 48. The conjugate of claim 47, wherein one of the first or second dimerization domains comprises an FK506 binding protein (FKBP), the other of the first or second domain comprises an FKBP-Rap binding domain (Frb) of the mammalian Rap target mTOR, and the ligand comprises rapamycin (Rap) or a derivative or fragment thereof.

51. The conjugate of any one of claims 40 to 50, wherein the RNA targeting molecule comprises at least two hairpin structures.

52. The conjugate of any one of claims 40 to 51, wherein the RNA targeting molecule comprises one or more modified nucleotides.

53. The conjugate of any one of claims 40 to 52, wherein the RNA targeting molecule comprises a TAR hairpin scaffold of SEQ ID NO:

1.

54. The conjugate of any one of claims 40 to 53, wherein the RNA targeting molecule comprises a SLBP hairpin scaffold of SEQ ID NO:

2.

55. The conjugate of any one of claims 40 to 54, wherein the RNA targeting molecule comprises a linker.

56. 56. The conjugate of claim 55, wherein the linker comprises at least 5 amino acids.

57. The conjugate of any one of claims 40 to 56, wherein the RNA targeting region comprises at least 12 nucleotides.

58. 58. The conjugate of any one of claims 40-57, wherein the RNA regulatory domain comprises a nuclease, a methylase, a demethylase, a translation activator, a translation repressor, a single-stranded RNA cleavage activity, a double-stranded RNA cleavage activity, or an RNA binding activity.

59. 58. The conjugate of any one of claims 40 to 57, wherein the RNA regulatory domain comprises a Pin nuclease domain or an m6A leader protein or a portion thereof.

60. The conjugate of any one of claims 40 to 59, wherein the RNA regulatory domain comprises YTHDF1, YTHDF2, or ADAR.

61. The conjugate of any one of claims 40 to 60, wherein the RNA targeting region of the RNA targeting molecule hybridizes to a target RNA in a prokaryotic or eukaryotic cell.

62. The conjugate of any one of claims 40 to 61, comprising one or more nuclear localization signals (NLS).

63. The conjugate of any one of claims 40 to 62, wherein the RNA regulatory domain cleaves RNA, promotes RNA translation, inhibits RNA translation, or modifies the base sequence of the RNA.

64. A fusion protein comprising an RNA hairpin binding domain and an RNA regulatory domain.

65. A fusion protein comprising an RNA regulatory domain and a first dimerization domain.

66. A fusion protein comprising an RNA hairpin binding domain and a second dimerization domain.

67. 67. The fusion protein of claim 65 or 66, wherein dimerization of the first and / or second dimerization domain is inducible.

68. 68. The fusion protein of claim 67, wherein the dimerization comprises ligand-induced dimerization.

69. 69. The fusion protein of claim 68, wherein the first and second dimerization domains are selected from PYL1 and ABI1, and the ligand comprises ABA or a derivative or fragment thereof.

70. The fusion protein of claim 68, wherein the first and / or second dimerization domain comprises FKBP12 and the ligand comprises FK1012 or a derivative or fragment thereof.

71. 69. The fusion protein of claim 68, wherein the first and second dimerization domains are selected from FKBP and Frb, and the ligand comprises rapamycin or a derivative or fragment thereof.

72. The fusion protein of any one of claims 64 to 71, wherein the RNA hairpin binding domain and / or the RNA regulatory domain is of human origin.

73. 73. The fusion protein of any one of claims 64 to 72, which is less than 150 kDa.

74. The fusion protein of any one of claims 64 to 73, wherein the RNA hairpin binding domain comprises U1A, SLBP, or a variant or fragment thereof.

75. The fusion protein of any one of claims 64-74, wherein the RNA regulatory domain comprises a nuclease, a methylase, a demethylase, a translation activator, a translation repressor, a single-stranded RNA cleavage activity, a double-stranded RNA cleavage activity, or an RNA binding activity.

76. The fusion protein of claim 75, wherein the RNA regulatory domain comprises a Pin nuclease domain or an m6A leader protein, or a portion thereof.

77. The fusion protein of claim 76, wherein the RNA regulatory domain comprises YTHDF1 or YTHDF2.

78. The fusion protein of any one of claims 64 to 77, further comprising one or more nuclear localization signals (NLS).

79. The fusion protein of any one of claims 64-77, wherein the RNA regulatory domain cleaves RNA, promotes RNA translation, inhibits RNA translation, or modifies the base sequence of the RNA.

80. A nucleic acid encoding the fusion protein of any one of claims 64 to 79.

81. A delivery vehicle comprising the system of any one of claims 1 to 39, the conjugate of any one of claims 40 to 63, or the fusion protein of any one of claims 64 to 79.

82. 82. The delivery vehicle of claim 81, comprising liposome(s), particle(s), exosome(s), microvesicle(s), gene gun, or one or more nucleic acid vectors.

83. 13. A composition comprising a system according to any one of claims 1 to 39, a conjugate according to any one of claims 40 to 63, a fusion protein according to any one of claims 64 to 79, or a delivery vehicle according to any one of claims 81 to 82.

84. A cell comprising the system of any one of claims 1 to 39, the conjugate of any one of claims 40 to 63, the fusion protein of any one of claims 64 to 79, the delivery vehicle of any one of claims 81 to 82, or the composition of claim 83.

85. 1. A method of modulating at least one target RNA, comprising: Contacting a target RNA with a system according to any one of claims 1 to 39, a conjugate according to any one of claims 40 to 63, a fusion protein according to any one of claims 64 to 79, a delivery vehicle according to any one of claims 81 to 82, or a composition according to claim 83. A method comprising:

86. 86. The method of claim 85, wherein modulating at least one target RNA comprises cleavage, demethylation, methylation, translational activation, translational repression, promoting degradation, and / or binding to the RNA.

87. 87. The method of claim 85 or 86, wherein the target RNA is in a prokaryotic or eukaryotic cell.

88. 88. The method of claim 87, wherein the target RNA is in a human cell.

89. The method of claim 87 or 88, wherein the target RNA is in vitro or in vivo.

90. A cell or a progeny thereof comprising a modulated target RNA, wherein the target RNA has been modulated according to the method of any one of claims 85 to 89.

91. 91. A multicellular organism comprising one or more cells of claim 90.

92. 92. A plant or animal comprising one or more cells of claim 91.

93. A kit comprising the system of any one of claims 1 to 39, the conjugate of any one of claims 40 to 63, the fusion protein of any one of claims 64 to 79, the delivery vehicle of any one of claims 81 to 82, or the composition of claim 83.

94. 1. A method for modulating a target RNA in a subject, comprising: Administering a conjugate according to any one of claims 40 to 63, a fusion protein according to any one of claims 64 to 79, a delivery vehicle according to any one of claims 81 to 82, or a composition according to claim 83. A method comprising:

Images