Methods of treating WHSC1-overexpressing cancers by inhibiting SETD2

Abstract

To provide methods of treating WHSC1-overexpressing cancers by inhibiting SETD2.SOLUTION: The present disclosure relates to epigenetic-based cancer therapy, and the unexpected discovery that inhibiting SETD2, despite its functionality as a tumor suppressor, can be used to treat cancers. Additionally, the present disclosure relates to the unexpected discovery that inhibiting SETD2 can be used to treat cancers that overexpress WHSC1.SELECTED DRAWING: None

Description

Technical Field

[0001] Reference to Electronically Submitted Sequence Listing The content of the electronically submitted sequence listing in the ASCII text file (name: 3562_018PC04_Seqlisting_ST25.txt; size: 1,882 bytes; creation date: November 26, 2019) submitted together with this application is incorporated herein by reference in its entirety.

[0002] The present disclosure generally relates to the field of epigenetic-based cancer therapies. More specifically, the present disclosure relates to methods and pharmaceutical compositions for treating cancers that overexpress WHSC1, a histone methyltransferase, by inhibiting SETD2, a histone methyltransferase.

Background Art

[0003] Histone lysine methylation is a major chromatin regulatory mechanism that affects fundamental nuclear processes. The selective addition of methyl groups to specific amino acid sites on histones is controlled by the action of a family of enzymes known as histone methyltransferases (HMTs). The level of expression of a particular gene is affected by the presence or absence of one or more methyl groups at relevant histone sites. The specific effects of methyl groups at particular histone sites persist until the methyl groups are removed by histone demethylases or until the modified histones are replaced by nucleosome turnover. In a similar manner, other enzyme classes can decorate DNA and histones with other chemical species, and still other enzymes can remove these species and effect control of gene expression.

[0004] WHSC1 (also known as Wolf-Hirschhorn syndrome candidate gene 1, MMSET, NSD2, REIIBP, TRX5, and WHS) is an HMT located at cytogenetic band p16.3 (4p16.3) on chromosome 4. The major chromatin regulatory effect of WHSC1 is dimethylation of histone H3 at lysine 36 (H3K36me2), which activates transcription. Kuo, A.J. et al., Mol. Cell. 44:609-620 (2011). WHSC1 is overexpressed in numerous cancers compared to their normal counterparts and is associated with tumor invasiveness. Kassambara, A. et.al., Biochem. Biophys. Res.Comm. 379:840-845 (2009). In particular, WHSC1 has been shown to be highly overexpressed in t(4;14) multiple myeloma (MM), which has been associated with poor prognosis. Id.

[0005] SETD2 is another HMT located at cytogenetic band p21.31 (3p21.31) on chromosome 3. The acronym "SETD2" stands for Suppressor of variegation, Enhancer of zeste, and Trithorax domain containing 2. The SETD2 protein contains three conserved functional domains: (1) the triple tandem AWS-SET-PostSET domain; (2) the WW domain; and (3) the Set2-Rbp1 interaction ("SRI") domain. These three functional domains define the biological function of SETD2. See Li, J. et al., Oncotarget 7:50719-50734 (2016). SETD2 is thought to be the single human gene involved in the trimethylation of lysine 36 of histone H3 (H3K36me3) using dimethylated Lys-36 (H3K36me2) as a substrate. Edmunds, J.W. et a l., The EMBO Journal 27:406-420 (2008). Human SETD2 is also a putative tumor suppressor. Li, J. et al., Oncotarget 7:50719-50734 (2016). For example, inactivation of human SETD2 has been reported in renal cell carcinoma (RCC). Larkin, J., et al., Nature Reviews 9:147-155 (2012). Also, the expression level of SETD2 in breast cancer samples has been reported to be significantly lower than that in adjacent non-cancerous tissue (ANCT) samples. Newbold, R. F. and Mokbel, K., Anticancer Research 30:3309-3311 (2010). Furthermore, both allelic mutations and loss-of-function point mutations in SETD2 have been reported in patients with acute leukemia. Zhu, X. et al., Nature Genetics 46:287-293 (2014). Mutations in SETD2 have also been reported in pediatric high-grade gliomas. Fontebasso, A. M. et al., Acta Neuropathol. 125:659-669 (2013).

Prior Art Documents

Non-Patent Documents

[0006]

Non-Patent Document 1

Non-Patent Document 2

Non-Patent Document 3

Non-Patent Document 4

Non-Patent Document 5

Non-Patent Document 6

Non-Patent Document 7

Non-Patent Document 8

Summary of the Invention

Problems to be Solved by the Invention

[0007] Despite more than a century of intensive scientific and clinical investigation, curing cancer remains, to this day, still one of the greatest medical challenges. Cancer treatment has mainly relied on a combination of surgery, radiation therapy, and / or chemotherapy with cytotoxicity. While effective cancer therapies exist, suboptimal responses, recurrent-refractory diseases, and / or resistance to one or more therapeutic agents remain issues, particularly for certain subtypes of multiple myeloma (i.e., t(4;14) multiple myeloma). Thus, there is a medical need for more effective, safe, and long-lasting treatments for the treatment of all types of cancer.

Means for Solving the Problems

[0008] The present disclosure relates to an epigenetic-based cancer therapy and the unexpected discovery that inhibiting SETD2 can be used to treat cancer despite its function as a tumor suppressor. Further, the present disclosure relates to the unexpected discovery that cancer overexpressing WHSC1 can be treated using inhibition of SETD2.

[0009] In one aspect, the present disclosure is a method of treating cancer in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a SETD2 inhibitor, wherein the cancer overexpresses WHSC1.

[0010] In certain embodiments, the overexpression of WHSC1 by the cancer is determined prior to administering the SETD2 inhibitor.

[0011] In certain embodiments, the SETD2 inhibitor is a "substituted indole compound" as defined in the "Definitions" section of the detailed description.

[0012] In certain embodiments, the SETD2 inhibitor is a compound of Table 1 or a pharmaceutically acceptable salt thereof.

[0013] In certain embodiments, the SETD2 inhibitor is not a substituted indole compound.

[0014] In certain embodiments, the cancer that overexpresses WHSC1 is a blood cancer.

[0015] In certain embodiments, the blood cancer is selected from the group consisting of acute lymphoblastic leukemia (ALL), acute myeloid leukemia (AML), chronic lymphocytic leukemia (CLL), small lymphocytic lymphoma (SLL), multiple myeloma (MM), Hodgkin lymphoma (HL), non-Hodgkin lymphoma (NHL), mantle cell lymphoma (MCL), marginal zone B-cell lymphoma, splenic marginal zone lymphoma, follicular lymphoma (FL), Waldenström macroglobulinemia (WM), diffuse large B-cell lymphoma (DLBCL), marginal zone lymphoma (MZL), hairy cell leukemia (HCL), Burkitt lymphoma (BL), Richter transformation, acute eosinophilic leukemia, acute erythroleukemia, acute lymphoblastic leukemia, acute megakaryoblastic leukemia, acute monocytic leukemia, acute promyelocytic leukemia, acute myeloid leukemia, B-cell prolymphocytic leukemia, B-cell lymphoma, MALT lymphoma, precursor T-lymphoblastic lymphoma, T-cell lymphoma, mast cell leukemia, adult T-cell leukemia / lymphoma, aggressive NK-cell leukemia, and angioimmunoblastic T-cell lymphoma.

[0016] In certain embodiments, the blood cancer is multiple myeloma.

[0017] In certain embodiments, multiple myeloma contains a chromosomal translocation or a chromosomal deletion.

[0018] In certain embodiments, chromosome 14 is involved in the chromosomal translocation. In certain embodiments, the chromosomal translocation is a t(4;14) translocation. In certain embodiments, the chromosomal translocation is a non-t(4;14) translocation. In certain embodiments, the non-t(4;14) translocation is selected from the group consisting of t(14;16), t(11;14), t(14;20), t(8;14), and t(6;14) translocations.

[0019] In certain embodiments, multiple myeloma contains a deletion. In certain embodiments, the deletion is selected from the group consisting of del(17p) and del(13).

[0020] In certain embodiments, the cancer that overexpresses WHSC1 is a solid tumor.

[0021] In certain embodiments, the solid tumor is selected from the group consisting of esophageal cancer, renal cancer, gastric cancer, hepatocellular carcinoma, glioblastoma, central nervous system (CNS) cancer, soft tissue cancer, lung cancer, breast cancer, bladder / urinary tract cancer, head and neck cancer, melanoma, prostate cancer, testicular cancer, pancreatic cancer, skin cancer, endometrial cancer, ovarian cancer, colon cancer, and colorectal cancer.

[0022] In certain embodiments, the subject is a mammal. In certain embodiments, the subject is a human.

[0023] In certain embodiments, the SETD2 inhibitor is formulated for systemic or local administration. In certain embodiments, the SETD2 inhibitor is formulated for oral, nasal, intraperitoneal, or intratumoral administration. In certain embodiments, the SETD2 inhibitor is formulated for intravenous, intramuscular, or subcutaneous administration.

[0024] In one aspect, the present disclosure is directed to a method of inhibiting trimethylation of lysine 36 on histone H3 in a cell, the method comprising contacting the cell with a SETD2 inhibitor, wherein the cell overexpresses WHSC1.

[0025] In certain embodiments, the SETD2 inhibitor is a "substituted indole compound" as defined in the "Definitions" section of the detailed description.

[0026] In certain embodiments, the SETD2 inhibitor is a compound of Table 1 or a pharmaceutically acceptable salt thereof.

[0027] In certain embodiments, the SETD2 inhibitor is not a substituted indole compound.

[0028] In certain embodiments, inhibiting trimethylation of lysine 36 on histone H3 in the cell occurs in vitro. In certain embodiments, inhibiting trimethylation of lysine 36 on histone H3 in the cell occurs in vivo.

[0029] In certain embodiments, the cells are derived from a blood cancer. In certain embodiments, the blood cancer is selected from the group consisting of acute lymphoblastic leukemia (ALL), acute myeloid leukemia (AML), chronic lymphocytic leukemia (CLL), small lymphocytic lymphoma (SLL), multiple myeloma (MM), Hodgkin lymphoma (HL), non-Hodgkin lymphoma (NHL), mantle cell lymphoma (MCL), marginal zone B-cell lymphoma, splenic marginal zone lymphoma, follicular lymphoma (FL), Waldenström macroglobulinemia (WM), diffuse large B-cell lymphoma (DLBCL), marginal zone lymphoma (MZL), hairy cell leukemia (HCL), Burkitt lymphoma (BL), Richter transformation, acute eosinophilic leukemia, acute erythroleukemia, acute lymphoblastic leukemia, acute megakaryoblastic leukemia, acute monocytic leukemia, acute promyelocytic leukemia, acute myeloid leukemia, B-cell prolymphocytic leukemia, B-cell lymphoma, MALT lymphoma, precursor T-lymphoblastic lymphoma, T-cell lymphoma, mast cell leukemia, adult T-cell leukemia / lymphoma, aggressive NK-cell leukemia, and angioimmunoblastic T-cell lymphoma.

[0030] In certain embodiments, the blood cancer is multiple myeloma.

[0031] In certain embodiments, the multiple myeloma contains a chromosomal translocation or a chromosomal deletion.

[0032] In certain embodiments, chromosome 14 is involved in the chromosomal translocation. In certain embodiments, the chromosomal translocation is a t(4;14) translocation. In certain embodiments, the chromosomal translocation is a non-t(4;14) translocation. In certain embodiments, the non-t(4;14) translocation is selected from the group consisting of t(14;16), t(11;14), t(14;20), t(8;14), and t(6;14) translocations.

[0033] In certain embodiments, the multiple myeloma contains a deletion. In certain embodiments, the deletion is selected from the group consisting of del(17p) and del(13).

[0034] In certain embodiments, the cells are derived from a solid tumor.

[0035] In certain embodiments, the solid tumor is selected from the group consisting of esophageal cancer, renal cancer, gastric cancer, hepatocellular carcinoma, glioblastoma, central nervous system (CNS) cancer, soft tissue cancer, lung cancer, breast cancer, bladder / urinary tract cancer, head and neck cancer, melanoma, prostate cancer, testicular cancer, pancreatic cancer, skin cancer, endometrial cancer, ovarian cancer, colon cancer, and colorectal cancer.

[0036] In certain embodiments, the in vivo cells are in a mammal. In certain embodiments, the in vivo cells are in a human. In embodiments of the present invention, for example, the following items are provided. (Item 1) A method of treating cancer in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a SETD2 inhibitor, wherein the cancer overexpresses WHSC1. (Item 2) The method according to item 1, wherein the overexpression of WHSC1 by the cancer is determined before administering the SETD2 inhibitor. (Item 3) The method according to item 1 or 2, wherein the SETD2 inhibitor is a substituted indole compound. (Item 4) The method according to item 3, wherein the SETD2 inhibitor is a compound of Table 1 or a pharmaceutically acceptable salt thereof. (Item 5) The method according to item 1 or 2, wherein the SETD2 inhibitor is not a substituted indole compound. (Item 6) The method according to any one of items 1 to 5, wherein the cancer overexpressing WHSC1 is a blood cancer. (Item 7) The blood cancer is selected from the group consisting of acute lymphoblastic leukemia (ALL), acute myeloid leukemia (AML), chronic lymphocytic leukemia (CLL), small lymphocytic lymphoma (SLL), multiple myeloma (MM), Hodgkin lymphoma (HL), non-Hodgkin lymphoma (NHL), mantle cell lymphoma (MCL), marginal zone B-cell lymphoma, splenic marginal zone lymphoma, follicular lymphoma (FL), Waldenström macroglobulinemia (WM), diffuse large B-cell lymphoma (DLBCL), marginal zone lymphoma (MZL), hairy cell leukemia (HCL), Burkitt lymphoma (BL), Richter transformation, acute eosinophilic leukemia, acute erythroleukemia, acute lymphoblastic leukemia, acute megakaryoblastic leukemia, acute monocytic leukemia, acute promyelocytic leukemia, acute myeloid leukemia, B-cell prolymphocytic leukemia, B-cell lymphoma, MALT lymphoma, precursor T-lymphoblastic lymphoma, T-cell lymphoma, mast cell leukemia, adult T-cell leukemia / lymphoma, aggressive NK-cell leukemia, and angioimmunoblastic T-cell lymphoma, the method according to item 6. (Item 8) The blood cancer is multiple myeloma, the method according to item 7. (Item 9) The multiple myeloma contains a chromosomal translocation or chromosomal deletion, the method according to item 8. (Item 10) The multiple myeloma contains a chromosomal translocation, the method according to item 9. (Item 11) The chromosomal translocation involves chromosome 14, the method according to item 10. (Item 12) The chromosomal translocation is a t(4;14) translocation, the method according to item 11. (Item 13) The chromosomal translocation is a non-t(4;14) translocation, the method according to item 12. (Item 14) The non-t(4;14) translocation is selected from the group consisting of t(14;16), t(11;14), t(14;20), t(8;14), and t(6;14) translocations, the method according to item 13. (Item 15) The multiple myeloma is the method according to item 9, which contains chromosomal deletions. (Item 16) The deletion is the method according to item 15, which is selected from the group consisting of del(17p) and del(13). (Item 17) The cancer that overexpresses WHSC1 is a solid tumor, and it is the method according to any one of items 1 to 5. (Item 18) The solid tumor is selected from the group consisting of esophageal cancer, renal cancer, gastric cancer, hepatocellular carcinoma, glioblastoma, central nervous system (CNS) cancer, soft tissue cancer, lung cancer, breast cancer, bladder / urinary tract cancer, head and neck cancer, melanoma, prostate cancer, testicular cancer, pancreatic cancer, skin cancer, endometrial cancer, ovarian cancer, colon cancer, and colorectal cancer, and it is the method according to item 17. (Item 19) The subject is a mammal, and it is the method according to any one of items 1 to 18. (Item 20) The subject is a human, and it is the method according to any one of items 1 to 18. (Item 21) The compound is formulated for systemic or local administration, and it is the method according to any one of items 1 to 20. (Item 22) The compound is formulated for oral, nasal, intraperitoneal, or intratumoral administration, and it is the method according to any one of items 1 to 20. (Item 23) The compound is formulated for intravenous, intramuscular, or subcutaneous administration, and it is the method according to any one of items 1 to 20. (Item 24) A method for inhibiting trimethylation of lysine 36 on histone H3 (H3K36me3) in cells, which includes contacting the cells with a SETD2 inhibitor, and the cells Overexpress WHSC1. (Item 25) The SETD2 inhibitor is a substituted indole compound, and it is the method according to item 24. (Item 26) The method according to item 25, wherein the SETD2 inhibitor is a compound shown in Table 1 or a pharmaceutically acceptable salt thereof. (Item 27) The method according to item 24, wherein the SETD2 inhibitor is not a substituted indole compound. (Item 28) The method according to any one of items 24 to 27, wherein inhibiting trimethylation of lysine 36 on histone H3 in cells occurs in vitro. (Item 29) The method according to any one of items 24 to 27, wherein inhibiting trimethylation of lysine 36 on histone H3 in cells occurs in vivo. (Item 30) The method according to any one of items 24 to 29, wherein the cells are derived from hematological cancer. (Item 31) The method according to item 30, wherein the hematological cancer is selected from the group consisting of acute lymphoblastic leukemia (ALL), acute myeloid leukemia (AML), chronic lymphocytic leukemia (CLL), small lymphocytic lymphoma (SLL), multiple myeloma (MM), Hodgkin lymphoma (HL), non-Hodgkin lymphoma (NHL), mantle cell lymphoma (MCL), marginal zone B-cell lymphoma, splenic marginal zone lymphoma, follicular lymphoma (FL), Waldenström macroglobulinemia (WM), diffuse large B-cell lymphoma (DLBCL), marginal zone lymphoma (MZL), hairy cell leukemia (HCL), Burkitt lymphoma (BL), Richter transformation, acute eosinophilic leukemia, acute erythroleukemia, acute lymphoblastic leukemia, acute megakaryoblastic leukemia, acute monocytic leukemia, acute promyelocytic leukemia, acute myeloid leukemia, B-cell prolymphocytic leukemia, B-cell lymphoma, MALT lymphoma, precursor T-lymphoblastic lymphoma, T-cell lymphoma, mast cell leukemia, adult T-cell leukemia / lymphoma, aggressive NK-cell leukemia, and angioimmunoblastic T-cell lymphoma. (Item 32) The method according to item 31, wherein the hematological cancer is multiple myeloma. (Item 33) The method according to item 32, wherein the multiple myeloma contains a chromosomal translocation or chromosomal deletion. (Item 34) The multiple myeloma is the method according to item 33, which contains a chromosomal translocation. (Item 35) The method according to item 34, wherein the chromosomal translocation involves chromosome 14. (Item 36) The method according to item 34, wherein the chromosomal translocation is a t(4;14) translocation. (Item 37) The method according to item 34, wherein the chromosomal translocation is a non-t(4;14) translocation. (Item 38) The method according to item 37, wherein the non-t(4;14) translocation is selected from the group consisting of t(14;16), t(11;14), t(14;20), t(8;14), and t(6;14) translocations. (Item 39) The multiple myeloma is the method according to item 33, which contains a deletion. (Item 40) The method according to item 39, wherein the deletion is selected from the group consisting of del(17p) and del(13). (Item 41) The method according to item 24, wherein the cell is derived from a solid tumor. (Item 42) The method according to item 41, wherein the solid tumor is selected from the group consisting of esophageal cancer, renal cancer, gastric cancer, hepatocellular carcinoma, glioblastoma, central nervous system (CNS) cancer, soft tissue cancer, lung cancer, breast cancer, bladder / urinary tract cancer, head and neck cancer, melanoma, prostate cancer, testicular cancer, pancreatic cancer, skin cancer, endometrial cancer, ovarian cancer, colon cancer, and colorectal cancer. (Item 43) The method according to any one of items 29 to 42, wherein the in vivo cell is in a mammal. (Item 44) The method according to any one of items 29 to 42, wherein the in vivo cell is in a human.

Brief Description of the Drawings

[0037]

Figure 1

Figure 2-1

Figure 2-2

Figure 3-1

Figure 3-2

Figure 4-1

Figure 4-2

Figure 5-1

Figure 5-2

Figure 5-3

Figure 6-1

Figure 6-2

Figure 6-3

Figure 7-1

Figure 7-2

Figure 7-3

Mode for Carrying Out the Invention

[0038] Definitions To facilitate understanding of the present invention, several terms and phrases are defined below.

[0039] Open-ended terms such as "comprising," "comprises," "containing," "contains," etc. mean "including." These non-restrictive transitional phrases are used to introduce non-restrictive lists of elements, method steps, etc. that do not exclude additional unrecited elements or method steps. When an embodiment is described herein with the phrase "including," other similar embodiments are always provided with respect to "consisting of" and / or "consisting essentially of."

[0040] As used in this disclosure and the claims, the singular forms "a", "an", and "the" include the plural unless the context clearly dictates otherwise. For example, "cell" includes a single cell and multiple cells, including mixtures thereof.

[0041] As used herein, the term "substituted indole compound" refers to the compounds disclosed in International Application PCT / US Patent Application Publication No. 2019 / 046569, filed on August 14, 2019, as well as pharmaceutically acceptable salts and solvates thereof. Accordingly, in one embodiment, the substituted indole compound has the formula I:

Chemical formula

[0042] In another embodiment, the substituted indole compound is a compound having the formula I (wherein, R1a is selected from the group consisting of halogen, C1-C6 alkyl, C1-C6 alkoxy, C3-C8 cycloalkyl, (hydroxy)C 1~6 alkyl and (C3-C6 cycloalkyl)C 1~6 a lkyl; R 1b , R 1c and R 1d are each independently selected from the group consisting of hydrogen, halogen, C1-C6 alkyl, C2-C6 alkenyl, (hydroxy)C1-C6 alkyl and C1-C6 alkoxy; R 1e is selected from the group consisting of hydrogen and C1-C6 alkyl; G 1 is optionally substituted C6-C 10 aryl, optionally substituted 5- to 10-membered heteroaryl, optionally substituted 3- to 10-membered heterocycle, optionally substituted C3-C8 cycloalkyl, (C6-C 10 aryl)C1-C6 alkyl, (5- to 10-membered heteroaryl)C1-C6 alkyl, (3- to 10-membered heterocycle)C1-C6 alkyl, (amino)(C6-C 10 aryl)C1-C6 alkyl, (5- to 14-membered heteroaryl)(C6-C 10 aryl)C1-C6 alkyl, (5- to 10-membered heteroaryl)(3- to 10-membered heterocycle)C1-C6 alkyl, (5- to 10-membered heteroaryl)(carboxamide)C1-C6 alkyl, (5- to 10-membered heteroaryl)(C3-C6 cycloalkyl)C1-C6 alkyl, (C6-C 10 aryl)(alkoxycarbonyl)C1-C6 alkyl, (C3-C6 cycloalkyl)C1-C6 alkyl, (5- to 10-membered heteroaryl)(amino)C1-C6 alkyl, (C3-C6 cycloalkyl)(alkoxycarbonyl)C1-C6 alkyl, (5- to 14-membered heteroaryl)(alkoxycarbonyl)C1-C6 alkyl, (3- to 14-membered heterocycle)(C3-C8 cycloalkyl)C1-C6 alkyl, (C 6~10 aryl)(C3-C8 cycloalkyl)C1-C6 alkyl, (C6-C10 Aryl)(hydroxy)C1-C6 alkyl, (C3-C6 cycloalkyl)(hydroxy)C1-C6 alkyl, (hydroxy)C1-C6 alkyl, optionally substituted C1-C6 alkyl, (C6-C 10 Aryl)(C1-C6 haloalkyl)C1-C6 alkyl, (C3-C6 cycloalkyl)(C1-C6 haloalkyl)C1-C6 alkyl, (hydroxy)(C1-C6 haloalkyl)C1-C6 alkyl; and (alkoxycarbonyl)(C1-C6 haloalkyl)C1-C6 alkyl selected from the group consisting of; and G 2 is selected from the group consisting of hydrogen and C1-C6 alkyl; or G 1 and G 2 together with the nitrogen atom to which they are attached form an optionally substituted 5- to 10-membered heterocycle) or a pharmaceutically acceptable salt or solvate thereof.

[0043] In another embodiment, the substituted indole compound is a compound having the formula I (wherein R 1a is selected from the group consisting of halogen, C1-C3 alkyl, C1-C3 alkoxy, C3-C6 cycloalkyl, (hydroxy)C 1~4 alkyl and (C3-C6 cycloalkyl)C 1~4 alkyl; R 1b , R 1c and R 1d are each independently selected from the group consisting of hydrogen, halogen, C1-C3 alkyl, C2-C4 alkenyl, (hydroxy)C1-C4 alkyl and C1-C3 alkoxy; R 1e is selected from the group consisting of hydrogen and C1-C3 alkyl; G 1 is optionally substituted C6-C 10Aryl, optionally substituted 5- to 10-membered heteroaryl, optionally substituted 3- to 10-membered heterocycle, optionally substituted C3-C8 cycloalkyl, (C6-C 10 aryl)C1-C4 alkyl, (5- to 10-membered heteroaryl)C1-C6 alkyl, (3- to 10-membered heterocycle)C1-C4 alkyl, (amino)(C6-C 10 aryl)C1-C6 alkyl, (5- to 14-membered heteroaryl)(C6-C 10 aryl)C1-C4 alkyl, (5- to 10-membered heteroaryl)(3- to 10-membered heterocycle)C1-C4 alkyl, (5- to 10-membered heteroaryl)(carboxamide)C1-C4 alkyl, (5- to 10-membered heteroaryl)(C3-C6 cycloalkyl)C1-C4 alkyl, (C6-C 10 aryl)(alkoxycarbonyl)C1-C4 alkyl, (C3-C6 cycloalkyl)C1-C4 alkyl, (5- to 10-membered heteroaryl)(amino)C1-C4 alkyl, (C3-C6 cycloalkyl )(alkoxycarbonyl)C1-C4 alkyl, (5- to 14-membered heteroaryl)(alkoxycarbonyl)C1-C4 alkyl, (3- to 14-membered heterocycle)(C3-C6 cycloalkyl)C1-C4 alkyl, (C 6~10 aryl)(C3-C6 cycloalkyl)C1-C4 alkyl, (C6-C 10 aryl)(hydroxy)C1-C4 alkyl, (C3-C6 cycloalkyl)(hydroxy)C1-C4 alkyl, (hydroxy)C1-C4 alkyl, optionally substituted C1-C4 alkyl, (C6-C 10 aryl)(C1-C4 haloalkyl)C1-C4 alkyl, (C3-C6 cycloalkyl)(C1-C4 haloalkyl)C1-C4 alkyl, (hydroxy)(C1-C4 haloalkyl)C1-C4 alkyl and (alkoxycarbonyl)(C1-C4 haloalkyl)C1-C4 alkyl selected from the group consisting of; and G 2 is selected from the group consisting of hydrogen and C1-C4 alkyl; or G 1 and G 2which, together with the nitrogen atom to which they are attached, form an optionally substituted 5- to 10-membered heterocycle) or a pharmaceutically acceptable salt or solvate thereof.

[0044] In another embodiment, the substituted indole compound is a compound having formula I, wherein

Chemical formula

[0045] In another embodiment, the substituted indole compound is a compound having formula I, wherein Q 1 and Q 2 is -C(H)=) or a pharmaceutically acceptable salt or solvate thereof.

[0046] In another embodiment, the substituted indole compound is a compound having formula I, wherein Q 3 is -C(R 1d )=; and R 1d is selected from the group consisting of hydrogen and halo) or a pharmaceutically acceptable salt or solvate thereof.

[0047] In another embodiment, the substituted indole compound is a compound having formula I, wherein R 1e is hydrogen) or a pharmaceutically acceptable salt or solvate thereof.

[0048] In another embodiment, the substituted indole compound is a compound having formula I, wherein R 1a is C1-C3 alkyl) or a pharmaceutically acceptable salt or solvate thereof.

[0049] In another embodiment, the substituted indole compound is a compound having formula I, wherein G 2 is hydrogen) or a pharmaceutically acceptable salt or solvate thereof.

[0050] In another embodiment, the substituted indole compound is of formula II: [Chemical formula] (wherein R 1d and G 1 are as defined in relation to formula I) and is a compound having the same or a pharmaceutically acceptable salt or solvate thereof.

[0051] In another embodiment, the substituted indole compound is a compound having formula I or II (wherein R 1d is selected from the group consisting of hydrogen and fluoro) or a pharmaceutically acceptable salt or solvate thereof.

[0052] In another embodiment, the substituted indole compound is of formula II-A: [Chemical formula] (wherein G 1 is as defined in relation to formula II) and is a compound having the same or a pharmaceutically acceptable salt or solvate thereof.

[0053] In another embodiment, the substituted indole compound is a compound having formula I, II or II-A (wherein G 1 is optionally substituted C6-C 10 aryl, optionally substituted 5- to 9-membered heteroaryl, optionally substituted 3- to 10-membered heterocycle, optionally substituted C6-C8 cycloalkyl, (5- to 9-membered heteroaryl)C1-C6 alkyl, (5- to 9-membered heteroaryl)(C 6~10 aryl)C1-C4 alkyl, (5- to 9-membered heteroarylheteroaryl)(C3-C6 cycloalkyl)C1-C4 alkyl and (C3-C6 cycloalkyl)C1-C4 alkyl selected from the group consisting of) or a pharmaceutically acceptable salt or solvate thereof.

[0054] In another embodiment, the substituted indole compound is of formula III: [Chemical formula] (wherein, A 1 is selected from the group consisting of -N= and -C(R 2a )); R 2a is selected from the group consisting of hydrogen, alkyl, halogen, and haloalkyl; R 2b is optionally substituted alkyl, optionally substituted heterocycle, optionally substituted cycloalkyl, optionally substituted heteroaryl, optionally substituted aryl, (carboxamide)alkyl, -OR 10c , amino, (heterocycle)alkyl, (amino)alkyl, (hydroxy)alkyl, carboxamide, (heteroaryl)alkyl, -S(=O)R 9b , -S(=O)2R 9b and -C(=O)R 9c selected from the group consisting of; A 2 is selected from the group consisting of -N= and -C(R 2c )); R 2c is selected from the group consisting of hydrogen, alkyl, halogen, and haloalkyl; R 2d is selected from the group consisting of hydrogen, alkyl, halogen, cyano, and haloalkyl; R 2e is selected from the group consisting of hydrogen, alkyl, halogen, and haloalkyl; R 9b is selected from the group consisting of amino, alkyl, optionally substituted cycloalkyl, optionally substituted aryl, optionally substituted heterocycle, and optionally substituted heteroaryl; R 9c is selected from the group consisting of amino, alkyl, optionally substituted cycloalkyl, optionally substituted aryl, optionally substituted heterocycle, and optionally substituted heteroaryl; and R 10c is selected from the group consisting of alkyl, (hydroxy)alkyl, and (amino)alkyl; and and R 1d is as defined in relation to formula I) is a compound having the same or a pharmaceutically acceptable salt or solvate thereof.

[0055] In another embodiment, the substituted indole compound is of formula III-A:

Chemical formula

[0056] In another embodiment, the substituted indole compound is a compound having formula III or formula III-A (wherein R 2a is selected from the group consisting of hydrogen, C1-C4 alkyl, halogen, and C1-C4 haloalkyl; R 2b is (A) an unsubstituted 4- to 10-membered heterocycle; (B) (i) -N(R 3a )C(=O)R 4a ; (ii) -NR 5a R 5b ; (iii) an unsubstituted 4- to 10-membered heterocycle; (iv) hydroxy, -NR 5c R 5d , C1-C4 alkyl, C1-C6 alkoxy, -C(R 6a )(R 6b )C(=O)NR 5e R 5f , -C(=O)R 4b, a substituted 4- to 10-membered heterocycle having one, two or three substituents independently selected from the group consisting of (hydroxy)C1-C4 alkyl and halo; (v) unsubstituted C3-C6 cycloalkyl; (vi) (hydroxy)C1-C4 alkyl; (vii) C1-C6 alkyl; (viii) -C(=O)NR 5g R 5h ; (ix) halo; (x) -C(=O)R 4c ; (xi) C1-C6 haloalkyl; (xii) hydroxy; (xiii) (amino)C1-C4 alkyl; (xiv) (C1-C4 alkoxy)C1-C4 alkyl; (xv) -S(=O)2R 9a ; (xvi) (3- to 8-membered heterocycle)C1-C4 alkyl; (xvii) C1-C6 alkoxy; (xviii) (C3-C6 cycloalkyl)C 1~4 alkyl; (xix) (C 6~10 aryl)C1-C4 alkyl; and (xxii) -OR 10b a substituted 4- to 10-membered heterocycle having one, two, three or four substituents independently selected from the group consisting of; (C) unsubstituted C3-C8 cycloalkyl; (D) (i) unsubstituted 4- to 10-membered heterocycle; (ii) a substituted 4- to 10-membered heterocycle having one or two substituents independently selected from the group consisting of amino and C1-C4 alkyl; (iii) unsubstituted 5- or 6-membered heteroaryl; (iv) a substituted 5- or 6-membered heteroaryl having one, two or three substituents independently selected from the group consisting of halo, C1-C4 alkyl, (3- to 8-membered heterocycle)alkyl, hydroxy and amino; (v) -NR 5i R 5j ; (vi) cyano; (vii) -N(R 3d )C(=O)R 4f ; (viii) hydroxy; and (ix) a substituted C3-C8 cycloalkyl having one, two, three or four substituents independently selected from the group consisting of C1-C4 alkyl; (E) unsubstituted 5- to 10-membered heteroaryl; (F) (i) halo; (ii) C1-C4 alkyl; (C1-C4 alkoxy)C1-C4 alkyl; (hydroxy)C1-C4 alkyl; C3-C6 cycloalkyl; (amino)C1-C4 alkyl; unsubstituted C3-C6 cycloalkyl; -NR 5g R 5h selected independently from the group consisting of 1, 2, 3 or 4 substituents of substituted C3-C6 cycloalkyl; unsubstituted 4- to 14-membered heterocycle; 1 or 2 substituents selected independently from the group consisting of hydroxy, amino and C1-C4 alkyl of substituted 4- to 14-membered heterocycle; -NR 5q R 5r ; and (ix) substituted 5- to 10-membered heteroaryl having 1, 2, 3 or 4 substituents selected independently from the group consisting of (3- to 8-membered heterocycle)C1-C4 alkyl; (G) unsubstituted C6-C 10 aryl; (H) (i) halo; (ii) C1-C4 alkyl; (iii) -CH2N(H)S(=O)2R 8 ; (iv) (5- to 9-membered heteroaryl)C1-C4 alkyl; (v) -OR 10a ; (vi) -N(R 3b )C(=O)R 4b ; (vii) (amino)C1-C4 alkyl; and (viii) (hydroxy)C1-C4 alkyl of substituted C6-C 10 aryl having 1, 2, 3 or 4 substituents selected independently from the group consisting of; (I) (carboxamide)C1-C4 alkyl; (J) -OR 10c ; (K) -NR 5o R 5p ; (L) (3- to 8-membered heterocycle)C1-C4 alkyl; (M) (amino)C1-C4 alkyl; (N) (hydroxy)C1-C4 alkyl; (O) -C(=O)NR 5s R 5t ; (P) (5- to 9-membered heteroaryl)C1-C4 alkyl; and (Q)-S(=O)2R 9b selected from the group consisting of; R 2c is selected from the group consisting of hydrogen, C1-C4 alkyl, halogen and C1-C4 haloalkyl; R 2d is selected from the group consisting of hydrogen, C1-C4 alkyl, halogen, cyano and C1-C4 haloalkyl; R 2e is selected from the group consisting of hydrogen, C1-C4 alkyl, halogen and C1-C4 haloalkyl; R 3a R 3b R 3c and R 3d are each independently selected from the group consisting of hydrogen, C1-C4 alkyl, optionally substituted C3-C6 cycloalkyl and optionally substituted 4-14 membered heterocycle; R 4a R 4b R 4c R 4d R 4e and R 4f is C1-C6 alkyl; C1-C6 haloalkyl; C3-C6 cycloalkyl; C1-C6 alkoxy; (C1-C4 alkoxy)C1-C4 alkyl; (C 6~10 aryl)C1-C4 alkyl; (5-9 membered heteroaryl)C1-C4 alkyl; (amino)C1-C4 alkyl; (hydroxy)C1-C4 alkyl; (cyano)C1-C4 alkyl; unsubstituted 4-14 membered heterocycle; substitution 4-14 membered heterocycle having one or two substituents independently selected from the group consisting of halogen and C1-C4 alkyl; unsubstituted C6-C 10 aryl; substitution C6-C having one, two, three or four substituents independently selected from the group consisting of halogen and C1-C4 alkyl 10 aryl; unsubstituted 5- or 6-membered heteroaryl; and substitution 5- or 6-membered heteroaryl having one, two, three or four substituents independently selected from the group consisting of halogen and C1-C4 alkyl, each independently selected from the group consisting of; R 5aand R 5b is independently selected from the group consisting of hydrogen; C1-C4 alkyl; C1-C4 haloalkyl; (hydroxy)C1-C4 alkyl; (amino)C1-C4 alkyl; (C1-C4 alkoxy)C1-C4 alkyl; (5-9 membered heteroaryl)C1-C4 alkyl; unsubstituted 5- or 6-membered heteroaryl; substituted 5- or 6-membered heteroaryl having one or two substituents independently selected from the group consisting of halo and C1-C4 alkyl; unsubstituted 4-14 membered heterocycle; and substituted 4-14 membered heterocycle having one or two substituents independently selected from the group consisting of hydroxy, amino and C1-C4 alkyl; R 5c and R 5d is independently selected from the group consisting of hydrogen; C1-C4 alkyl; C1-C4 haloalkyl; (hydroxy)C1-C4 alkyl; (amino)C1-C4 alkyl; (C1-C4 alkoxy)C1-C4 alkyl; (5-9 membered heteroaryl)C1-C4 alkyl; unsubstituted 5- or 6-membered heteroaryl; substituted 5- or 6-membered heteroaryl having one or two substituents independently selected from the group consisting of halo and C1-C4 alkyl; unsubstituted 4-14 membered heterocycle; and substituted 4-14 membered heterocycle having one or two substituents independently selected from the group consisting of hydroxy, amino and C1-C4 alkyl; or R 5c and R 5d together with the nitrogen atom to which they are attached form an optionally substituted 4-14 membered heterocycle; R 5e and R 5fis independently selected from the group consisting of hydrogen; C1-C4 alkyl; C1-C4 haloalkyl; (hydroxy)C1-C4 alkyl; (amino)C1-C4 alkyl; (C1-C4 alkoxy)C1-C4 alkyl; (5-9 membered heteroaryl)C1-C4 alkyl; unsubstituted 5- or 6-membered heteroaryl; substituted 5- or 6-membered heteroaryl having one or two substituents independently selected from the group consisting of halo and C1-C4 alkyl; unsubstituted 4-14 membered heterocycle; and substituted 4-14 membered heterocycle having one or two substituents independently selected from the group consisting of hydroxy, amino and C1-C4 alkyl; or R 5e and R 5f together with the nitrogen atom to which they are attached form an optionally substituted 4-14 membered heterocycle; R 5g and R 5h is independently selected from the group consisting of hydrogen; C1-C4 alkyl; C1-C4 haloalkyl; (hydroxy)C1-C4 alkyl; (amino)C1-C4 alkyl; (C1-C4 alkoxy)C1-C4 alkyl; (5-9 membered heteroaryl)C1-C4 alkyl; unsubstituted 5- or 6-membered heteroaryl; substituted 5- or 6-membered heteroaryl having one or two substituents independently selected from the group consisting of halo and C1-C4 alkyl; unsubstituted 4-14 membered heterocycle; and substituted 4-14 membered heterocycle having one or two substituents independently selected from the group consisting of hydroxy, amino and C1-C4 alkyl; or R 5g and R 5h together with the nitrogen atom to which they are attached form an optionally substituted 4-14 membered heterocycle; R 5i and R 5jis independently selected from the group consisting of hydrogen; C1-C4 alkyl; C1-C4 haloalkyl; (hydroxy)C1-C4 alkyl; (amino)C1-C4 alkyl; (C1-C4 alkoxy)C1-C4 alkyl; (5-9 membered heteroaryl)C1-C4 alkyl; unsubstituted 5- or 6-membered heteroaryl; substituted 5- or 6-membered heteroaryl having one or two substituents independently selected from the group consisting of halo and C1-C4 alkyl; unsubstituted 4-14 membered heterocycle; and substituted 4-14 membered heterocycle having one or two substituents independently selected from the group consisting of hydroxy, amino and C1-C4 alkyl; or R 5i and R 5j together with the nitrogen atom to which they are attached form an optionally substituted 4-14 membered heterocycle; R 5k and R 5l is independently selected from the group consisting of hydrogen; C1-C4 alkyl; C1-C4 haloalkyl; (hydroxy)C1-C4 alkyl; (amino)C1-C4 alkyl; (C1-C4 alkoxy)C1-C4 alkyl; (5-9 membered heteroaryl)C1-C4 alkyl; unsubstituted 5- or 6-membered heteroaryl; substituted 5- or 6-membered heteroaryl having one or two substituents independently selected from the group consisting of halo and C1-C4 alkyl; unsubstituted 4-14 membered heterocycle; and substituted 4-14 membered heterocycle having one or two substituents independently selected from the group consisting of hydroxy, amino and C1-C4 alkyl; or R 5k and R 5l together with the nitrogen atom to which they are attached form an optionally substituted 4-14 membered heterocycle; R 5m and R 5nis independently selected from the group consisting of hydrogen; C1-C4 alkyl; C1-C4 haloalkyl; (hydroxy)C1-C4 alkyl; (amino)C1-C4 alkyl; (C1-C4 alkoxy)C1-C4 alkyl; (5-9 membered heteroaryl)C1-C4 alkyl; unsubstituted 5- or 6-membered heteroaryl; substituted 5- or 6-membered heteroaryl having one or two substituents independently selected from the group consisting of halo and C1-C4 alkyl; unsubstituted 4-14 membered heterocycle; and substituted 4-14 membered heterocycle having one or two substituents independently selected from the group consisting of hydroxy, amino and C1-C4 alkyl; or R 5m and R 5n together with the nitrogen atom to which they are attached form an optionally substituted 4-14 membered heterocycle; R 5o and R 5p is independently selected from the group consisting of hydrogen; C1-C4 alkyl; C1-C4 haloalkyl; (hydroxy)C1-C4 alkyl; (amino)C1-C4 alkyl; (C1-C4 alkoxy)C1-C4 alkyl; (5-9 membered heteroaryl)C1-C4 alkyl; unsubstituted 5- or 6-membered heteroaryl; substituted 5- or 6-membered heteroaryl having one or two substituents independently selected from the group consisting of halo and C1-C4 alkyl; unsubstituted 4-14 membered heterocycle; and substituted 4-14 membered heterocycle having one or two substituents independently selected from the group consisting of hydroxy, amino and C1-C4 alkyl; or R 5o and R 5p together with the nitrogen atom to which they are attached form an optionally substituted 4-14 membered heterocycle; R 5q and R 5ris independently selected from the group consisting of hydrogen; C1-C4 alkyl; C1-C4 haloalkyl; (hydroxy)C1-C4 alkyl; (amino)C1-C4 alkyl; (C1-C4 alkoxy)C1-C4 alkyl; (5-9 membered heteroaryl)C1-C4 alkyl; unsubstituted 5- or 6-membered heteroaryl; substituted 5- or 6-membered heteroaryl having one or two substituents independently selected from the group consisting of halo and C1-C4 alkyl; unsubstituted 4-14 membered heterocycle; and substituted 4-14 membered heterocycle having one or two substituents independently selected from the group consisting of hydroxy, amino and C1-C4 alkyl; R 5s and R 5t is independently selected from the group consisting of hydrogen; C1-C4 alkyl; C1-C4 haloalkyl; (hydroxy)C1-C4 alkyl; (amino)C1-C4 alkyl; (C1-C4 alkoxy)C1-C4 alkyl; (5-9 membered heteroaryl)C1-C4 alkyl; unsubstituted 5- or 6-membered heteroaryl; substituted 5- or 6-membered heteroaryl having one or two substituents independently selected from the group consisting of halo and C1-C4 alkyl; unsubstituted 4-14 membered heterocycle; and substituted 4-14 membered heterocycle having one or two substituents independently selected from the group consisting of hydroxy, amino and C1-C4 alkyl; R 6a 、R 6b 、R 6c and R 6d is independently selected from the group consisting of hydrogen and C1-C4 alkyl; R 8 is C1-C6 alkyl; R 9a is selected from the group consisting of C1-C6 alkyl; unsubstituted C3-C8 cycloalkyl; and substituted C3-C8 cycloalkyl having one or two substituents independently selected from the group consisting of halo, C1-C4 alkyl, amino and (amino)C1-C4 alkyl; R 9b is selected from the group consisting of C1-C6 alkyl and amino; R 10ais selected from the group consisting of alkyl, (hydroxy)C1-C4 alkyl, and (amino)C1-C4 alkyl; R 10b is (amino)C1-C4 alkyl; and R 10c is (amino)C1-C4 alkyl) or a pharmaceutically acceptable salt or solvate thereof.

[0057] In another embodiment, the substituted indole compound is a compound having formula III or formula III-A, wherein R 2b is an optionally substituted 3- to 10-membered heterocyclic ring linked to the remainder of the molecule via a nitrogen atom, for example, R 2b is

Chemical formula

[0058] In another embodiment, the substituted indole compound is a compound having formula III or formula III-A (wherein R 2b is

Chemical formula

[0059] In another embodiment, the substituted indole compound is a compound having formula III or formula III-A, wherein R 2b is

Chemical formula

Chemical formula

[0060] In another embodiment, the substituted indole compound is a compound having formula III or formula III-A, wherein R 2b is R 2b -1, R 2b -1A, R 2b -1B, R 2b -1C or R 2b -1D) or a pharmaceutically acceptable salt or solvate thereof. In another embodiment, R a1 is -N(R 3a )C(=O)R 4a is. In another embodiment, R a1 is -NR 5a R 5b is. In another embodiment, R a1 is -NR 5a R 5b is, and R 5a and R 5b are independently selected from the group consisting of hydrogen and C1-C4 alkyl. In another embodiment, R a1 is an optionally substituted 4- to 10-membered heterocycle.

[0061] In another embodiment, the substituted indole compound is a compound having formula III or formula III-A, wherein R2b is R 2b -2, R 2b -2A or R 2b -2b) or a pharmaceutically acceptable salt or solvate thereof. In another embodiment, R b1 is C1-C4 alkyl.

[0062] In another embodiment, the substituted indole compound is a compound having formula III or formula III-A, wherein R 2b is R 2b -3, R 2b -3A or R 2b -3B) or a pharmaceutically acceptable salt or solvate thereof. In another embodiment, R c1 is selected from the group consisting of C1-C4 alkyl, C3-C6 cycloalkyl and -C(=O)R 4c . In another embodiment, R c2 and R c3 are each hydrogen. In another embodiment, R c2 and R c3 together with the carbon atom to which they are attached form a C(=O) group . In another embodiment, R c4 is hydrogen. In another embodiment, m is 1.

[0063] In another embodiment, the substituted indole compound is a compound having formula III or formula III-A, wherein R 2b is R 2b -4) or a pharmaceutically acceptable salt or solvate thereof. In another embodiment, R d1 is C(=O)R 4c . In another embodiment, R d2 and R d3 are each hydrogen or fluoro.

[0064] In another embodiment, the substituted indole compound is a compound having formula III or formula III-A, wherein R 2b is R 2b -5, R 2b -5A or R 2bis -5B) or a pharmaceutically acceptable salt or solvate thereof. In another embodiment, R e1 is -C(=O)R 4c .

[0065] In another embodiment, the substituted indole compound is a compound having formula III or formula III-A, wherein R 2b is R 2b -6, R 2b -6A or R 2b -6B) or a pharmaceutically acceptable salt or solvate thereof. In another embodiment, R f1 is C(=O)R 4c .

[0066] In another embodiment, the substituted indole compound is a compound having formula III or formula III-A, wherein R 2b is R 2b -7) or a pharmaceutically acceptable salt or solvate thereof. In another embodiment, R g1 is C(=O)R 4c .

[0067] In another embodiment, the substituted indole compound is a compound having formula III or formula III-A, wherein R 2b is R 2b -8, R 2b -8A, R 2b -8B, R 2b -8C or R 2b -8D) or a pharmaceutically acceptable salt or solvate thereof. In another embodiment, R h1 is -C(=O)R 4c . In another embodiment, R h2 is selected from the group consisting of hydrogen and C1-C3 alkyl. In another embodiment, R h3 is hydrogen.

[0068] In another embodiment, the substituted indole compound is a compound having formula III or formula III-A, wherein R 2b is R 2b -9) or a pharmaceutically acceptable salt or solvate thereof.

[0069] In another embodiment, the substituted indole compound is a compound having formula III or formula III-A, wherein R 2b is R 2b -10, R 2b -10A, R 2b -10B, R 2b -10C and R 2b -10d, selected from the group consisting of), or a pharmaceutically acceptable salt or solvate thereof.

[0070] In another embodiment, the substituted indole compound is a compound having formula III or formula III-A, wherein R 2b is R 2b -11, R 2b -11A and R 2b -11B, selected from the group consisting of), or a pharmaceutically acceptable salt or solvate thereof.

[0071] In another embodiment, the substituted indole compound is a compound having formula III or formula III-A, wherein R 2b is R 2b -12), or a pharmaceutically acceptable salt or solvate thereof. In another embodiment, R j1 is -C(=O)R 4c .

[0072] In another embodiment, the substituted indole compound is a compound having formula III or formula III-A, wherein R 2b is R 2b -13, R 2b -13A, R 2b -13B, R 2b -13C, R 2b -13D, R 2b -13E and R 2b -13F, selected from the group consisting of), or a pharmaceutically acceptable salt or solvate thereof.

[0073] In another embodiment, the substituted indole compound is a compound having formula III or formula III-A, wherein R 2b is R 2bis -14) or a pharmaceutically acceptable salt or solvate thereof.

[0074] In another embodiment, the substituted indole compound is a compound having formula III or formula III-A, wherein R 2b is R 2b -15) or a pharmaceutically acceptable salt or solvate thereof.

[0075] In another embodiment, the substituted indole compound is a compound having formula III or formula III-A, wherein R 2b is R 2b -16, R 2b -16A and R 2b -16B) or a pharmaceutically acceptable salt or solvate thereof. In another embodiment, R n3 is -C(=O)R 4c as defined herein.

[0076] In another embodiment, the substituted indole compound is a compound having formula III or formula III-A, wherein R 2b is R 2b -17) or a pharmaceutically acceptable salt or solvate thereof.

[0077] In another embodiment, the substituted indole compound is a compound having formula III or formula III-A, wherein R 2b is R 2b -18) or a pharmaceutically acceptable salt or solvate thereof.

[0078] In another embodiment, the substituted indole compound is a compound having formula III or formula III-A, wherein R 2b is R 2b -19) or a pharmaceutically acceptable salt or solvate thereof.

[0079] In another embodiment, the substituted indole compound is a compound having formula III or formula III-A, wherein R 2b is R 2bis -20) or a pharmaceutically acceptable salt or solvate thereof.

[0080] In another embodiment, the substituted indole compound is a compound having the formula III or formula III-A, wherein R 2b is R 2b -21, R 2b -21A and R 2b -21B) or a pharmaceutically acceptable salt or solvate thereof.

[0081] In another embodiment, the substituted indole compound is a compound having the formula III, wherein R 2b is R 2b -22, R 2b -22A and R 2b -22B) or a pharmaceutically acceptable salt or solvate thereof.

[0082] In another embodiment, the substituted indole compound is a compound having the formula III or formula III-A, wherein R 2b is R 2b -23) or a pharmaceutically acceptable salt or solvate thereof.

[0083] In another embodiment, the substituted indole compound is a compound having the formula III or formula III-A, wherein R 2b is R 2b -24) or a pharmaceutically acceptable salt or solvate thereof.

[0084] In another embodiment, the substituted indole compound is a compound having the formula III or formula III-A, wherein R 2b is R 2b -25) or a pharmaceutically acceptable salt or solvate thereof.

[0085] In another embodiment, the substituted indole compound is a compound having the formula III or formula III-A wherein R 2b is R 2b -26, R 2b-26A and R 2b selected from the group consisting of -26B) or a pharmaceutically acceptable salt or solvate thereof.

[0086] In another embodiment, the substituted indole compound is a compound having formula III or formula III-A, wherein R 2b is R 2b -27, R 2b -27A and R 2b selected from the group consisting of -27B) or a pharmaceutically acceptable salt or solvate thereof.

[0087] In another embodiment, the substituted indole compound is a compound having formula III or formula III-A, wherein R 2b is R 2b -28, R 2b -28A and R 2b selected from the group consisting of -28B) or a pharmaceutically acceptable salt or solvate thereof.

[0088] In another embodiment, the substituted indole compound is a compound having formula III or formula III-A, wherein R 2b is R 2b -29) or a pharmaceutically acceptable salt or solvate thereof.

[0089] In another embodiment, the substituted indole compound is a compound having formula III or formula III-A, wherein R 2b is R 2b -30, R 2b -30A or R 2b -30B) or a pharmaceutically acceptable salt or solvate thereof.

[0090] In another embodiment, the substituted indole compound is a compound having formula III or formula III-A, wherein R 2b is any one or more of the R 11a groups provided in relation to formula IV, see below) or a pharmaceutically acceptable salt or solvate thereof.

[0091] In another embodiment, the substituted indole compound is a compound having Formula III or Formula III-A, wherein R 4c is C1-C4 alkyl), or a pharmaceutically acceptable salt or solvate thereof.

[0092] In another embodiment, the substituted indole compound is a compound having Formula III or Formula III-A, wherein R 2d is selected from the group consisting of hydrogen, fluoro, and chloro), or a pharmaceutically acceptable salt or solvate thereof.

[0093] In another embodiment, the substituted indole compound is a compound having Formula III or Formula III-A, wherein R 2d is hydrogen), or a pharmaceutically acceptable salt or solvate thereof.

[0094] In another embodiment, the substituted indole compound is a compound having Formula III in any of the embodiments described above, wherein A 1 and A 2 are -C(H)=; R 2e is hydrogen; and R 2d is selected from the group consisting of hydrogen and halogen), or a pharmaceutically acceptable salt or solvate thereof.

[0095] In another embodiment, the substituted indole compound is a compound having Formula III or Formula III-A, wherein R 2d is fluoro), or a pharmaceutically acceptable salt or solvate thereof.

[0096] In another embodiment, the substituted indole compound has Formula IV:

Chemical formula

[0097] In another embodiment, the substituted indole compound is a compound having formula IV (wherein Z 4 is selected from the group consisting of -O- and -CH2-; or Z 4 is non-existent) or a pharmaceutically acceptable salt or solvate thereof.

[0098] In another embodiment, the substituted indole compound is a compound having formula IV (wherein, Z 4 is selected from the group consisting of -O- and -CH2-; or Z4 is non-existent; Z 5 is selected from the group consisting of -CH2- and -CH2CH2-; R 13c is selected from the group consisting of alkyl, haloalkyl, alkoxy, (alkoxy)alkyl, (hydroxy)alkyl, (cyano)alkyl, optionally substituted aryl, optionally substituted heteroaryl, optionally substituted cycloalkyl and optionally substituted heterocycle, and R 1d is as defined in relation to formula I) or a pharmaceutically acceptable salt or solvate thereof.

[0099] In another embodiment, the substituted indole compound is of formula IV-A:

Chemical formula

[0100] In another embodiment, the substituted indole compound is of formula IV-B:

Chemical formula

[0101] In another embodiment, the substituted indole compound is of formula IV-C:

Chemical formula

[0102] In another embodiment, the substituted indole compound is of formula IV-D:

Chemical formula

[0103] In another embodiment, the substituted indole compound is a compound having any one of formulas IV, IV-A, IV-B, IV-C or IV-D (wherein R 11a is independently selected from the group consisting of (A) an unsubstituted 4- to 14-membered heterocycle; (B) -N(R 12a )C(=O)R 13a ; -C(=O)R 13b ; C1-C4 alkyl; (C1-C4 alkoxy)C1-C4 alkyl; (hydroxy)C1-C4 alkyl; C1-C4 haloalkyl; amino; hydroxy; -N(R 12a )S(=O)2R 24 ; -S(=O)2R 24 ; an unsubstituted C3-C6 cycloalkyl; a substituted C3-C6 cycloalkyl having one or two substituents independently selected from the group consisting of halo, hydroxy, C1-C4 alkyl, amino and (amino)C1-C4 alkyl; an unsubstituted 4- to 14-membered heterocycle; and a substituted 4- to 14-membered heterocycle having one or two substituents independently selected from the group consisting of amino, hydroxy and C1-C4 alkyl; (C) an unsubstituted 5- to 10-membered heteroaryl; (D) one, two or three substituents independently selected from the group consisting of halo, C1-C4 alkyl and (amino)alkyl A substituted 5- or 6-membered heteroaryl having 1, 2, 3 or 4 substituents; (E) C1-C6 alkyl; and (F) -N(R 12b )C(=O)R 13c selected from the group consisting of; R 12a and R 12b are each independently selected from the group consisting of hydrogen, C1-C4 alkyl, (C1-C4 alkoxy)C1-C4 alkyl and (hydroxy)C1-C4 alkyl; R 13a 、R 13b and R 13c are C1-C6 alkyl; C1-C6 haloalkyl; unsubstituted C3-C6 cycloalkyl; C1-C6 alkoxy; (C1-C4 alkoxy)C1-C4 alkyl; (hydroxy)C1-C4 alkyl; (cyano)alkyl; unsubstituted C6-C 10 aryl; substituted C6-C having 1, 2, 3 or 4 substituents independently selected from the group consisting of halo, amino, hydroxy and C1-C4 alkyl 10 aryl; unsubstituted 5- or 6-membered heteroaryl; substituted 5- or 6-membered heteroaryl having 1, 2, 3 or 4 substituents independently selected from the group consisting of halo, amino, hydroxy and C1-C4 alkyl; unsubstituted 4- to 14-membered heterocycle; substituted 4- to 14-membered heterocycle having 1 or 2 substituents independently selected from the group consisting of amino, hydroxy and C1-C4 alkyl; amino; (amino)alkyl; (C3-C6 cycloalkyl)oxy; and (4- to 8-membered heterocycle)oxy, each independently selected from the group consisting of; and R 24 is selected from the group consisting of C1-C4 alkyl and (hydroxy)C1-C4 alkyl) is.

[0104] In another embodiment, the substituted indole compound is a compound having formula IV, IV-A, IV-B, IV-C or IV-D, wherein Z 4 is -C(R 28a )(R 28b )-; and R 28a and R 28bis independently selected from the group consisting of hydrogen, C1-C4 alkyl, and fluoro), or a pharmaceutically acceptable salt or solvate thereof.

[0105] In another embodiment, the substituted indole compound is a compound having formula IV, IV-A, IV-B, IV-C, or IV-D, wherein Z 4 is -C(R 28a )(R 28b )-; R 28a is hydrogen; and R 28b is selected from the group consisting of C1-C4 alkyl and fluoro), or a pharmaceutically acceptable salt or solvate thereof.

[0106] In another embodiment, the substituted indole compound is a compound having formula IV, IV-A, IV-B, IV-C, or IV-D, wherein Z 4 is -C(R 28a )(R 28b ); and R 28a and R 28b are independently C1-C4 alkyl), or a pharmaceutically acceptable salt or solvate thereof.

[0107] In another embodiment, the substituted indole compound is a compound having formula IV, IV-A, IV-B, IV-C, or IV-D, wherein Z 4 is selected from the group consisting of -O-, -CH2-, and -N(R 23 ), or Z 4 is absent), or a pharmaceutically acceptable salt or solvate thereof.

[0108] In another embodiment, the substituted indole compound is a compound having any one of formula IV, IV-A, IV-B, IV-C, or IV-D, wherein Z 4 is -CH2-), or a pharmaceutically acceptable salt or solvate thereof.

[0109] In another embodiment, the substituted indole compound is a compound having any one of formula IV, IV-A, IV-B, IV-C, or IV-D, wherein R11a is an optionally substituted 3- to 10-membered heterocyclic ring linked to the remainder of the molecule through a nitrogen atom, for example, R 11a is

Chemical formula

[0110] In another embodiment, the substituted indole compound is a compound having any one of Formula IV, IV-A, IV-B, IV-C or IV-D (wherein R 11a is

Chemical formula

[0111] In another embodiment, the substituted indole compound is a compound having any one of Formulas IV, IV-A, IV-B, IV-C or IV-D (wherein R 11a is

Chem.

Chem.

[0112] In another embodiment, the substituted indole compound is a compound having any one of Formulas IV, IV-A, IV-B, IV-C or IV-D, wherein R 11a is

Chemical formula

Chemical formula

[0113] In another embodiment, the substituted indole compound is a compound having any one of Formulas IV, IV-A, IV-B, IV-C or IV-D, wherein R 11a is an unsubstituted 4-14 membered heterocycle; -N(R 12a )C(=O)R 13a , -C(=O)R 13bA substituted 4- to 14-membered heterocycle having one or two substituents independently selected from the group consisting of C1-C4 alkyl; unsubstituted 5- to 10-membered heteroaryl; and a substituted 5- or 6-membered heteroaryl having one or two substituents independently selected from the group consisting of halo and C1-C4 alkyl), or a pharmaceutically acceptable salt or solvate thereof.

[0114] In another embodiment, the substituted indole compound is a compound having any one of Formulas IV, IV-A, IV-B, IV-C or IV-D (wherein R 11a is

Chemical formula

[0115] In another embodiment, R 12a is selected from the group consisting of hydrogen and C1-C3 alkyl; R 13a is C1-C4 alkyl; and R 13b is C1-C4 alkyl, or a pharmaceutically acceptable salt or solvate thereof. In another embodiment, R 12a is selected from the group consisting of hydrogen and methyl; R 13a is methyl; and R 13b is methyl, or a pharmaceutically acceptable salt or solvate thereof.

[0116] In another embodiment, the substituted indole compound is a compound having any one of Formulas IV, IV-A, IV-B, IV-C or IV-D (wherein R 11a is any one or more of the R 2b groups provided in connection with Formula III, see above), or a pharmaceutically acceptable salt or solvate thereof.

[0117] In another embodiment, the substituted indole compound is a compound having any one of Formulas IV, IV-A, IV-B, IV-C or IV-D (wherein, R 11a is [Chemical formula] selected from the group consisting of, and R a1 R a2 R a3 R a4 、 R a5 R b1 R c1 R c2 R c3 R c4 m, R d1 R d2 R d3 R e1 R f1 R g1 R h1 R h2 R h3 R h4 R i1 Z 1 R j1 R k1 R k2 r, Z 2 R n3 R o1 R o2 R o3 R p1 、 Z 3 、 R r1 、 R s1 R t1 R u1 R v1 R w1 R x1 R y1 and R z1 are as defined in relation to formula III) or a pharmaceutically acceptable salt or solvate thereof.

[0118] In another embodiment, the substituted indole compound is a compound having any one of formula IV, IV-A, IV-B, IV-C or IV-D (wherein, R11a is selected from the group consisting of [Chem.] [Chem.] and, and R a1 、R a5 、R b1 、R e1 、R f1 、R h1 、R h2 、R h3 、R k1 、R n3 、R s1 、R t1 、R w1 、R x1 and R y1 is as defined in relation to formula III) or a pharmaceutically acceptable salt or solvate thereof.

[0119] In another embodiment, the substituted indole compound is a compound having any one of formulas IV, IV-A, IV-B, IV-C or IV-D (wherein R 11a is R 11a -1, R 11a -1A, R 11a -1B, R 11a -1C or R 11a -1D) or a pharmaceutically acceptable salt or solvate thereof. In another embodiment, R a1 is -N(R 3a )C(=O)R 4a . In another embodiment, R a1 is -NR 5a R 5b . In another embodiment, R a1 is -NR 5a R 5b , and R 5a and R 5b are independently selected from the group consisting of hydrogen and C1-C4 alkyl. In another embodiment, R a1 is an optionally substituted 4- to 10-membered heterocycle.

[0120] In another embodiment, the substituted indole compound is a compound having any one of Formulas IV, IV-A, IV-B, IV-C or IV-D (wherein R 11a is R 11a -2, R 11a -2A or R 11a -2b) or a pharmaceutically acceptable salt or solvate thereof. In another embodiment, R b1 is C1-C4 alkyl.

[0121] In another embodiment, the substituted indole compound is a compound having any one of Formulas IV, IV-A, IV-B, IV-C or IV-D (wherein R 11a is R 11a -3, R 11a -3A or R 11a -3B) or a pharmaceutically acceptable salt or solvate thereof. In another embodiment, R c1 is selected from the group consisting of C1-C4 alkyl, C3-C6 cycloalkyl and -C(=O)R 4c . In another embodiment, R c2 and R c3 are each hydrogen. In another embodiment, R c2 and R c3 together with the carbon atom to which they are attached form a C(=O) group. In another embodiment, R c4 is hydrogen. In another embodiment, m is 1.

[0122] In another embodiment, the substituted indole compound is a compound having any one of Formulas IV, IV-A, IV-B, IV-C or IV-D (wherein R 11a is R 11a -4) or a pharmaceutically acceptable salt or solvate thereof. In another embodiment, R d1 is C(=O)R 4c . In another embodiment, R d2 and R d3 are each hydrogen or fluoro ro.

[0123] In another embodiment, the substituted indole compound is a compound having any one of formulas IV, IV-A, IV-B, IV-C or IV-D (R 11a is R 11a -5, R 11a -5A or R 11a -5B) or a pharmaceutically acceptable salt or solvate thereof. In another embodiment, R e1 is -C(=O)R 4c .

[0124] In another embodiment, the substituted indole compound is a compound having any one of formulas IV, IV-A, IV-B, IV-C or IV-D (wherein R 11a is R 11a -6, R 11a -6A or R 11a -6B) or a pharmaceutically acceptable salt or solvate thereof. In another embodiment, R f1 is C(=O)R 4c .

[0125] In another embodiment, the substituted indole compound is a compound having any one of formulas IV, IV-A, IV-B, IV-C or IV-D (wherein R 11a is R 11a -7) or a pharmaceutically acceptable salt or solvate thereof. In another embodiment, R g1 is C(=O)R 4c .

[0126] In another embodiment, the substituted indole compound is a compound having any one of formulas IV, IV-A, IV-B, IV-C or IV-D (wherein R 11a is R 11a -8, R 11a -8A, R 11a -8B, R 11a -8C or R 11a -8D) or a pharmaceutically acceptable salt or solvate thereof. In another embodiment, R h1 is -C(=O)R 4c . In another embodiment, R h2is selected from the group consisting of hydrogen and C1-C3 alkyl. In another embodiment, R h3 is hydrogen.

[0127] In another embodiment, the substituted indole compound is a compound having any one of Formulas IV, IV-A, IV-B, IV-C or IV-D, wherein R 11a is R 11a -9) or a pharmaceutically acceptable salt or solvate thereof.

[0128] In another embodiment, the substituted indole compound is a compound having any one of Formulas IV, IV-A, IV-B, IV-C or IV-D, wherein R 11a is R 11a -10, R 11a -10A, R 11a -10B, R 11a -10C and R 11a -10d) or a pharmaceutically acceptable salt or solvate thereof.

[0129] In another embodiment, the substituted indole compound is a compound having any one of Formulas IV, IV-A, IV-B, IV-C or IV-D, wherein R 11a is R 11a -11, R 11a -11A and R 11a -11B) or a pharmaceutically acceptable salt or solvate thereof.

[0130] In another embodiment, the substituted indole compound is a compound having any one of Formulas IV, IV-A, IV-B, IV-C or IV-D, wherein R 11a is R 11a -12) or a pharmaceutically acceptable salt or solvate thereof. In another embodiment, R j1 is -C(=O)R 4c is.

[0131] In another embodiment, the substituted indole compound is a compound having any one of formulas IV, IV-A, IV-B, IV-C or IV-D, wherein R 11a is R 11a -13, R 11a -13A, R 11a -13B, R 11a -13C, R 11a -13D, R 11a -13E and R 11a -13F, selected from the group consisting of) or a pharmaceutically acceptable salt or solvate thereof.

[0132] In another embodiment, the substituted indole compound is a compound having any one of formulas IV, IV-A, IV-B, IV-C or IV-D, wherein R 11a is R 11a -14) or a pharmaceutically acceptable salt or solvate thereof.

[0133] In another embodiment, the substituted indole compound is a compound having any one of formulas IV, IV-A, IV-B, IV-C or IV-D, wherein R 11a is R 11a -15) or a pharmaceutically acceptable salt or solvate thereof.

[0134] In another embodiment, the substituted indole compound is a compound having any one of formulas IV, IV-A, IV-B, IV-C or IV-D, wherein R 11a is R 11a -16, R 11a -16A and R 11a -16B, selected from the group consisting of) or a pharmaceutically acceptable salt or solvate thereof. In another embodiment, R n3 is -C(=O)R 4c wherein.

[0135] In another embodiment, the substituted indole compound is a compound having any one of formulas IV, IV-A, IV-B, IV-C or IV-D, wherein R 11a is R 11ais -17) or a pharmaceutically acceptable salt or solvate thereof.

[0136] In another embodiment, the substituted indole compound is a compound having any one of Formulas IV, IV-A, IV-B, IV-C or IV-D, wherein R 11a is R 11a -18) or a pharmaceutically acceptable salt or solvate thereof.

[0137] In another embodiment, the substituted indole compound is a compound having any one of Formulas IV, IV-A, IV-B, IV-C or IV-D, wherein R 11a is R 11a -19) or a pharmaceutically acceptable salt or solvate thereof.

[0138] In another embodiment, the substituted indole compound is a compound having any one of Formulas IV, IV-A, IV-B, IV-C or IV-D, wherein R 11a is R 11a -20) or a pharmaceutically acceptable salt or solvate thereof.

[0139] In another embodiment, the substituted indole compound is a compound having any one of Formulas IV, IV-A, IV-B, IV-C or IV-D, wherein R 11a is R 11a -21, R 11a -21A and R 11a -21B) or a pharmaceutically acceptable salt or solvate thereof.

[0140] In another embodiment, the substituted indole compound is a compound having any one of Formulas IV, IV-A, IV-B, IV-C or IV-D, wherein R 11a is R 11a -22, R 11a -22A and R 11a -22B) or a pharmaceutically acceptable salt or solvate thereof.

[0141] In another embodiment, the substituted indole compound is a compound having any one of Formulas IV, IV-A, IV-B, IV-C or IV-D, wherein R 11a is R 11a -23) or a pharmaceutically acceptable salt or solvate thereof.

[0142] In another embodiment, the substituted indole compound is a compound having any one of Formulas IV, IV-A, IV-B, IV-C or IV-D, wherein R 11a is R 11a -24) or a pharmaceutically acceptable salt or solvate thereof.

[0143] In another embodiment, the substituted indole compound is a compound having any one of Formulas IV, IV-A, IV-B, IV-C or IV-D, wherein R 11a is R 11a -25) or a pharmaceutically acceptable salt or solvate thereof.

[0144] In another embodiment, the substituted indole compound is a compound having any one of Formulas IV, IV-A, IV-B, IV-C or IV-D, wherein R 11a is R 11a -26, R 11a -26A and R 11a -26B) or a pharmaceutically acceptable salt or solvate thereof.

[0145] In another embodiment, the substituted indole compound is a compound having any one of Formulas IV, IV-A, IV-B, IV-C or IV-D, wherein R 11a is R 11a -27, R 11a -27A and R 11a -27B) or a pharmaceutically acceptable salt or solvate thereof.

[0146] In another embodiment, the substituted indole compound is a compound having any one of Formulas IV, IV-A, IV-B, IV-C or IV-D, wherein R 11a is R11a -28, R 11a -28A and R 11a selected from the group consisting of -28B) or a pharmaceutically acceptable salt or solvate thereof.

[0147] In another embodiment, the substituted indole compound is a compound having any one of formulas IV, IV-A, IV-B, IV-C or IV-D, wherein R 11a is R 11a -29) or a pharmaceutically acceptable salt or solvate thereof.

[0148] In another embodiment, the substituted indole compound is a compound having any one of formulas IV, IV-A, IV-B, IV-C or IV-D, wherein R 11a is R 11a -30, R 11a -30A or R 11a -30B) or a pharmaceutically acceptable salt or solvate thereof.

[0149] In another embodiment, the substituted indole compound is a compound having any one of formulas IV-A, IV-B, IV-C or IV-D (wherein Z 4 is -CH2-; R 11a is

Chemical formula

[0150] In another embodiment, the substituted indole compound is a compound having any one of Formulas IV-A, IV-B, IV-C or IV-D (wherein Z 4 is -CH2-; R 11a is

Chemical formula

[0151] In another embodiment, the substituted indole compound is of Formula V:

Chemical formula

[0152] In another embodiment, the substituted indole compound is of Formula V-A:

Chemical formula

[0153] In another embodiment, the substituted indole compound is of formula V-B: [Chemical formula] (wherein, R 1d , R 14a , R 14d and p are as defined in relation to formula V) is a compound having the same or a pharmaceutically acceptable salt or solvate thereof.

[0154] In another embodiment, the substituted indole compound is a compound having any one of formulas V, V-A or V-B (wherein, R 14a is (A) unsubstituted 5- to 10-membered heteroaryl; (B) (i) halo; (ii) C1-C4 alkyl; (iii) C1-C4 alkoxy; (iv) (3- to 8-membered heterocyclo)C1-C4 alkyl; (v) (5- to 9-membered heteroaryl)C1-C4 alkyl; (vi) -C(=O)NR 15a R 15b ; (vii) unsubstituted 5- to 10-membered heteroaryl; (viii) halo, C1-C4 alkyl, (3- to 8-membered heterocyclo)C1-C4 alkyl, 5- to 9-membered heteroaryl and -NR 15e R 15f ; (ix) -OR 16 ; (x) unsubstituted C3-C6 cycloalkyl; (xi) C1-C4 alkyl and -N(R 17a )C(=O)R 18aA substituted C3-C6 cycloalkyl having 1, 2, 3 or 4 substituents independently selected from the group consisting of; (xii) cyano; (xiii) unsubstituted 4- to 14-membered heterocycle; (xiv) C1-C4 alkyl, a substituted 4- to 14-membered heterocycle having 1 or 2 substituents independently selected from the group consisting of (5- to 9-membered heteroaryl)C1-C4 alkyl; (xv) (carboxy)C1-C4 alkyl; (xvi) (carboxamide)C1-C4 alkyl; and (xvii) a substituted 5- or 10-membered heteroaryl having 1, 2, 3 or 4 substituents independently selected from the group consisting of carboxy; and (C) selected from the group consisting of C1-C6 alkyl; R 14b is (A) unsubstituted 5- to 10-membered heteroaryl; (B) a substituted 5- or 10-membered heteroaryl having 1, 2, 3 or 4 substituents independently selected from the group consisting of halo, C1-C4 alkyl and (C3-C6 cycloalkyl)C1-C4 alkyl; (C) unsubstituted C6-C 10 aryl; (D) a substituted C6-C 10 aryl having 1, 2, 3 or 4 substituents independently selected from the group consisting of halo, C1-C4 alkyl and (3- to 8-membered heterocycle)C1-C4 alkyl; (E) unsubstituted 4- to 14-membered heterocycle; (F) a substituted 4- to 14-membered heterocycle having 1, 2, 3 or 4 substituents independently selected from the group consisting of hydroxy, amino and C1-C4 alkyl; (G) -C(=O)N R 15c R 15d ; (H) unsubstituted C3-C6 cycloalkyl; and (I) selected from the group consisting of C1-C6 alkyl; p is 0, 1, 2 or 3; R 15a and R 15b are (A) hydrogen; (B) C1-C6 alkyl; (C) C1-C6 haloalkyl; (D) (C1-C4 alkoxy)C1-C4 alkyl; (E) (hydroxy)C1-C4 alkyl; (F) (cyano)alkyl; (G) unsubstituted C6-C 10Aryl; a substituted C6-C having one, two, three or four substituents independently selected from the group consisting of (H) halo, amino, hydroxy and C1-C4 alkyl 10 Aryl; (I) unsubstituted 5- or 6-membered heteroaryl; (J) substituted 5- or 6-membered heteroaryl having one, two, three or four substituents independently selected from the group consisting of halo, amino, hydroxy and C1-C4 alkyl; (K) unsubstituted 4- to 14-membered heterocycle; (L) substituted 4- to 14-membered heterocycle having one or two substituents independently selected from the group consisting of amino, hydroxy and C1-C4 alkyl; (M) unsubstituted C3-C8 cycloalkyl; and (N) C1-C6 alkyl and -NR 15g R 15h selected independently from the group consisting of substituted C3-C8 cycloalkyl having one, two, three or four substituents; or R 15a and R 15b together with the nitrogen atom to which they are attached form an optionally substituted 4- to 14-membered heterocycle; R 15c and R 15d are (A) hydrogen; (B) C1-C6 alkyl; (C) C1-C6 haloalkyl; (D) (C1-C4 alkoxy)C1-C4 alkyl; (E) (hydroxy)C1-C4 alkyl; (F) (cyano)alkyl; (G) unsubstituted C6-C 10 Aryl; a substituted C6-C having one, two, three or four substituents independently selected from the group consisting of (H) halo, amino, hydroxy and C1-C4 alkyl 10 Aryl; (I) unsubstituted 5- or 6-membered heteroaryl; (J) substituted 5- or 6-membered heteroaryl having one, two, three or four substituents independently selected from the group consisting of halo, amino, hydroxy and C1-C4 alkyl; (K) unsubstituted 4- to 14-membered heterocycle; (L) substituted 4- to 14-membered heterocycle having one or two substituents independently selected from the group consisting of amino, hydroxy and C1-C4 alkyl; (M) unsubstituted C3-C8 cycloalkyl; and (N) C1-C6 alkyl and -NR 15g R 15hSelected independently from the group consisting of 1, 2, 3 or 4 substituents independently selected from the group consisting of substituted C3-C8 cycloalkyl; or R 15c and R 15d together with the nitrogen atom to which they are attached form an optionally substituted 4- to 14-membered heterocycle; R 15e and R 15f are (A) hydrogen; (B) C1-C6 alkyl; (C) C1-C6 haloalkyl; (D) (C1-C4 alkoxy)C1-C4 alkyl; (E) (hydroxy)C1-C4 alkyl; (F) (cyano)alkyl; (G) unsubstituted C6-C 10 aryl; (H) substituted C6-C having 1, 2, 3 or 4 substituents independently selected from the group consisting of halo, amino, hydroxy and C1-C4 alkyl 10 aryl; (I) unsubstituted 5- or 6-membered heteroaryl; (J) substituted 5- or 6-membered heteroaryl having 1, 2, 3 or 4 substituents independently selected from the group consisting of halo, amino, hydroxy and C1-C4 alkyl; (K) unsubstituted 4- to 14-membered heterocycle; (L) substituted 4- to 14-membered heterocycle having 1 or 2 substituents independently selected from the group consisting of amino, hydroxy and C1-C4 alkyl; (M) unsubstituted C3-C8 cycloalkyl; and (N) C1-C6 alkyl and -NR 15g R 15h Selected independently from the group consisting of 1, 2, 3 or 4 substituents independently selected from the group consisting of substituted C3-C8 cycloalkyl; or R 15e and R 15f together with the nitrogen atom to which they are attached form an optionally substituted 4- to 14-membered heterocycle; R 15g and R 15h are (A) hydrogen; (B) C1-C6 alkyl; (C) C1-C6 haloalkyl; (D) C1-C6 alkoxy; (E) (C1-C4 alkoxy)C1-C4 alkyl; (F) (hydroxy)C1-C4 alkyl; (G) (cyano)alkyl; (H) unsubstituted C6-C10 Aryl; a substituted C6-C having one, two, three or four substituents independently selected from the group consisting of halo, amino, hydroxy and C1-C4 alkyl 10 Aryl; (J) unsubstituted 5- or 6-membered heteroaryl; (K) substituted 5- or 6-membered heteroaryl having one, two, three or four substituents independently selected from the group consisting of halo, amino, hydroxy and C1-C4 alkyl; (L) unsubstituted 4- to 14-membered heterocycle; (M) substituted 4- to 14-membered heterocycle having one or two substituents independently selected from the group consisting of amino, hydroxy and C1-C4 alkyl; (N) unsubstituted C3-C8 cycloalkyl; and (O) C1-C6 alkyl and -NR 15g R 15h Selected independently from the group consisting of substituted C3-C8 cycloalkyl having one, two, three or four substituents independently selected from the group consisting of; or R 15g And R 15g Together with the nitrogen atom to which they are attached, form an optionally substituted 4- to 14-membered heterocycle; R 16 Is (amino)(hydroxy)C1-C4 alkyl; R 17a Is selected from the group consisting of hydrogen and C1-C4 alkyl; R 18a Is (A) C1-C6 alkyl; (B) C1-C6 haloalkyl; (C) C1-C6 alkoxy; (D) (C1-C4 alkoxy)C1-C4 alkyl; (E) (hydroxy)C1-C4 alkyl; (F) (cyano)alkyl; (G) unsubstituted C6-C 10 Aryl; (H) a substituted C6-C having one, two, three or four substituents independently selected from the group consisting of halo, amino, hydroxy and C1-C4 alkyl 10Aryl; (I) unsubstituted 5- or 6-membered heteroaryl; (J) substituted 5- or 6-membered heteroaryl having 1, 2, 3, or 4 substituents independently selected from the group consisting of halo, amino, hydroxy, and C1-C4 alkyl; (K) unsubstituted 4- to 14-membered heterocycle; (L) substituted 4- to 14-membered heterocycle having 1 or 2 substituents independently selected from the group consisting of amino, hydroxy, and C1-C4 alkyl; (M) unsubstituted C3-C8 cycloalkyl; and (N) substituted C3-C8 cycloalkyl having 1, 2, 3, or 4 substituents independently selected from the group consisting of amino, hydroxy, and C1-C4 alkyl, selected from the group consisting of) or a pharmaceutically acceptable salt or solvate thereof.

[0155] In another embodiment, the substituted indole compound is a compound having any one of Formulas V, V-A, or V-B, wherein R 14a is unsubstituted 5- to 10-membered heteroaryl; and C1-C4 alkyl; C1-C4 alkoxy; (3- to 8-membered heterocycle)C1-C4 alkyl; (5- to 9-membered heteroaryl)C1-C4 alkyl; -C(=O)NR 15a R 15b substituted 5- or 10-membered heteroaryl having 1, 2, or 3 substituents independently selected from the group consisting of; unsubstituted 5- to 10-membered heteroaryl; halo, C1-C4 alkyl, (3- to 8-membered heterocycle)C1-C4 alkyl, 5- to 9-membered heteroaryl, and -NR 15e R 15f substituted 5- or 10-membered heteroaryl having 1, 2, or 3 substituents independently selected from the group consisting of; unsubstituted C3-C6 cycloalkyl; and C1-C4 alkyl and -N(R 17a )C(=O)R 18a substituted C3-C6 cycloalkyl having 1, 2, or 3 substituents independently selected from the group consisting of, selected from the group consisting of) or a pharmaceutically acceptable salt or solvate thereof.

[0156] In another embodiment, the substituted indole compound is a compound having any one of Formulas V, V-A, or V-B, wherein R14a is a substituted pyridyl having one, two or three substituents independently selected from the group consisting of C1-C4 alkyl; C1-C4 alkoxy; (3-8 membered heterocyclo)C1-C4 alkyl; (5-9 membered heteroaryl)C1-C4 alkyl; -C(=O)NR 15a R 15b ; a substituted 5-10 membered heteroaryl having one, two or three substituents independently selected from the group consisting of halo, C1-C4 alkyl, (3-8 membered heterocyclo)C1-C4 alkyl, 5-9 membered heteroaryl and -NR 15e R 15f ; a substituted 5-10 membered heteroaryl having one, two or three substituents independently selected from the group consisting of ; an unsubstituted C3-C6 cycloalkyl; and a substituted C3-C6 cycloalkyl having one, two or three substituents independently selected from the group consisting of C1-C4 alkyl and -N(R 17a )C(=O)R 18a ), or a pharmaceutically acceptable salt or solvate thereof.

[0157] In another embodiment, the substituted indole compound is a compound having any one of Formulas V, V-A or V-B, wherein R 14b is an unsubstituted 5-10 membered heteroaryl; a substituted 5-10 membered heteroaryl having one or two substituents independently selected from the group consisting of C1-C4 alkyl and (C3-C6 cycloalkyl)C1-C4 alkyl; an unsubstituted C6-C 10 aryl; a substituted C6-C 10 aryl having one or two substituents independently selected from the group consisting of C1-C4 alkyl and (3-8 membered heterocyclo)C1-C4 alkyl; an unsubstituted 4-14 membered heterocyclo; a substituted 4-14 membered heterocyclo having one or two substituents independently selected from the group consisting of hydroxy, amino and C1-C4 alkyl; and an unsubstituted C3-C6 cycloalkyl), or a pharmaceutically acceptable salt or solvate thereof.

[0158] In another embodiment, the substituted indole compound is a compound having any one of Formulas V, V-A or V-B, wherein R 14bis unsubstituted 5- or 6-membered heteroaryl; substituted 5- or 6-membered heteroaryl having one or two substituents independently selected from the group consisting of C1-C4 alkyl and (C3-C6 cycloalkyl)C1-C4 alkyl; unsubstituted phenyl; substituted phenyl having one or two substituents independently selected from the group consisting of C1-C4 alkyl and (3-8-membered heterocyclo)C1-C4 alkyl; and unsubstituted C3-C6 cycloalkyl) or a pharmaceutically acceptable salt or solvate thereof.

[0159] In another embodiment, the substituted indole compound is a compound having any one of Formulas V, V-A or V-B (wherein p is 0) or a pharmaceutically acceptable salt or solvate thereof.

[0160] In another embodiment, the substituted indole compound is a compound having any one of Formulas V, V-A or V-B (wherein p is 1) or a pharmaceutically acceptable salt or solvate thereof.

[0161] In another embodiment, the substituted indole compound has the formula VI:

Chemical formula

[0162] In another embodiment, the substituted indole compound is a compound having the formula VI (wherein q is 1).

[0163] In another embodiment, the substituted indole compound is of formula VII: [Chemical formula] (wherein, R 11b is selected from the group consisting of C1-C4 alkyl, halo and C1-C4 haloalkyl; and R 1d and R 11a are as defined in relation to formula IV) is a compound having the same or a pharmaceutically acceptable salt or solvate thereof.

[0164] In another embodiment, the substituted indole compound is of formula VII-A: [Chemical formula] (wherein R 1d 、R 11a and R 11b are as defined in relation to formula VII) is a compound having the same or a pharmaceutically acceptable salt or solvate thereof.

[0165] In another embodiment, the substituted indole compound is of formula VII-B: [Chemical formula] (wherein R 1d 、R 11a and R 11b are as defined in relation to formula VII) is a compound having the same or a pharmaceutically acceptable salt or solvate thereof.

[0166] In another embodiment, the substituted indole compound is of formula VII-C: [Chemical formula] (wherein R 1d 、R 11a and R 11b are as defined in relation to formula VII) ru) is a compound having the following formula or a pharmaceutically acceptable salt or solvate thereof.

[0167] In another embodiment, the substituted indole compound has the formula VII-D:

Chemical formula

[0168] In another embodiment, the substituted indole compound has the formula VII-E:

Chemical formula

[0169] In another embodiment, the substituted indole compound has the formula VII-F:

Chemical formula

[0170] In another embodiment, the substituted indole compound has the formula VII-G:

Chemical formula

[0171] In another embodiment, the substituted indole compound is of formula VII-H:

Chemical formula

[0172] In another embodiment, the substituted indole compound is of formula VIII:

Chemical formula

[0173] In another embodiment, the substituted indole compound is of formula VIII-A:

Chemical formula

[0174] In another embodiment, the substituted indole compound is of formula VIII-B:

Chemical formula

[0175] In another embodiment, the substituted indole compound is a compound according to Embodiments 1 to 73 as follows.

[0176] Embodiment 1. Formula I:

Chemical formula

Chemical formula

[0177] Embodiment 2. R 1a is selected from the group consisting of halogen, C1-C6 alkyl, C1-C6 alkoxy, C3-C8 cycloalkyl, (hydroxy)C 1~6 alkyl and (C3-C6 cycloalkyl)C 1~6 alkyl; R 1b , R 1c and R 1dis independently selected from the group consisting of hydrogen, halogen, C1-C6 alkyl, C2-C6 alkenyl, (hydroxy)C1-C6 alkyl, and C1-C6 alkoxy; R 1e is selected from the group consisting of hydrogen and C1-C6 alkyl; G 1 is optionally substituted C6-C 10 aryl; optionally substituted 5- to 10-membered heteroaryl; optionally substituted 3- to 10-membered heterocycle; optionally substituted C3-C8 cycloalkyl; (C6-C 10 aryl)C1-C6 alkyl; (5- to 10-membered heteroaryl)C1-C6 alkyl; (3- to 10-membered heterocycle)C1-C6 alkyl; (amino)(C6-C 10 aryl)C1-C6 alkyl; (5- to 14-membered heteroaryl)(C6-C 10 aryl)C1-C6 alkyl; (5- to 10-membered heteroaryl)(3- to 10-membered heterocycle)C1-C6 alkyl; (5- to 10-membered heteroaryl)(carboxamide)C1-C6 alkyl; (5- to 10-membered heteroaryl)(C3-C6 cycloalkyl)C1-C6 alkyl; (C6-C 10 aryl)(alkoxycarbonyl)C1-C6 alkyl; (C3-C6 cycloalkyl)C1-C6 alkyl; (5- to 10-membered heteroaryl)(amino)C1-C6 alkyl; (C3-C6 cycloalkyl)(alkoxycarbonyl)C1-C6 alkyl; (5- to 14-membered heteroaryl)(alkoxycarbonyl)C1-C6 alkyl; (3- to 14-membered heterocycle)(C3-C8 cycloalkyl)C1-C6 alkyl; (C 6~10 aryl)(C3-C8 cycloalkyl)C1-C6 alkyl; (C6-C 10 aryl)(hydroxy)C1-C6 alkyl; (C3-C6 cycloalkyl)(hydroxy)C1-C6 alkyl; (hydroxy)C1-C6 alkyl; optionally substituted C1-C6 alkyl; (C6-C 10Selected from the group consisting of aryl)(C1-C6 haloalkyl)C1-C6 alkyl; (C3-C6 cycloalkyl)(C1-C6 haloalkyl)C1-C6 alkyl; (hydroxy)(C1-C6 haloalkyl)C1-C6 alkyl; and (alkoxycarbonyl)(C1-C6 haloalkyl)C1-C6 alkyl; and G 2 is selected from the group consisting of hydrogen and C1-C6 alkyl; or G 1 and G 2 together with the nitrogen atom to which they are attached form an optionally substituted 5- to 10-membered heterocycle, a compound of Embodiment 1 or a pharmaceutically acceptable salt or solvate thereof.

[0178] Embodiment 3.R 1a is selected from the group consisting of halogen, C1-C3 alkyl, C1-C3 alkoxy, C3-C6 cycloalkyl, (hydroxy)C 1~4 alkyl and (C3-C6 cycloalkyl)C 1~4 alkyl; R 1b 、R 1c and R 1d are each independently selected from the group consisting of hydrogen, halogen, C1-C3 alkyl, C2-C4 alkenyl, (hydroxy)C1-C4 alkyl and C1-C3 alkoxy; R 1e is selected from the group consisting of hydrogen and C1-C3 alkyl; G 1 is an optionally substituted C6-C 10 aryl; an optionally substituted 5 - to 10-membered heteroaryl; an optionally substituted 3- to 10-membered heterocycle; an optionally substituted C3-C8 cycloalkyl; (C6-C 10 aryl)C1-C4 alkyl; (5- to 10-membered heteroaryl)C1-C6 alkyl; (3- to 10-membered heterocycle)C1-C4 alkyl; (amino)(C6-C 10 aryl)C1-C6 alkyl; (5- to 14-membered heteroaryl)(C6-C 10Aryl)C1-C4 alkyl; (5-10 membered heteroaryl)(3-10 membered heterocyclo)C1-C4 alkyl; (5-10 membered heteroaryl)(carboxamide)C1-C4 alkyl; (5-10 membered heteroaryl)(C3-C6 cycloalkyl)C1-C4 alkyl; (C6-C 10 Aryl)(alkoxycarbonyl)C1-C4 alkyl; (C3-C6 cycloalkyl)C1-C4 alkyl; (5-10 membered heteroaryl)(amino)C1-C4 alkyl; (C3-C6 cycloalkyl)(alkoxycarbonyl)C1-C4 alkyl; (5-14 membered heteroaryl)(alkoxycarbonyl)C1-C4 alkyl; (3-14 membered heterocyclo)(C3-C6 cycloalkyl)C1-C4 alkyl; (C 6~10 Aryl)(C3-C6 cycloalkyl)C1-C4 alkyl; (C6-C 10 Aryl)(hydroxy)C1-C4 alkyl; (C3-C6 cycloalkyl)(hydroxy)C1-C4 alkyl; (hydroxy)C1-C4 alkyl; optionally substituted C1-C4 alkyl; (C6-C 10 Aryl)(C1-C4 haloalkyl)C1-C4 alkyl; (C3-C6 cycloalkyl)(C1-C4 haloalkyl)C1-C4 alkyl; (hydroxy)(C1-C4 haloalkyl)C1-C4 alkyl; and (alkoxycarbonyl)(C1-C4 haloalkyl)C1-C4 alkyl selected from the group consisting of; and G 2 is selected from the group consisting of hydrogen and C1-C4 alkyl; or G 1 and G 2 together with the nitrogen atom to which they are attached form an optionally substituted 5-10 membered heterocycle, a compound of Embodiment 2 or a pharmaceutically acceptable salt or solvate thereof.

[0179] Embodiment 4.

Chemical formula

[0180] Embodiment 5.Q 1 and Q 2 is a compound of any one of Embodiments 1 to 4 or a pharmaceutically acceptable salt or solvate thereof, which is -C(H)=

[0181] Embodiment 6.Q 3 is -C(R 1d )=; and R 1d is a compound of any one of Embodiments 1 to 4 or a pharmaceutically acceptable salt or solvate thereof, which is selected from the group consisting of hydrogen and halo

[0182] Embodiment 7.R 1e is hydrogen, a compound of any one of Embodiments 1 to 6 or a pharmaceutically acceptable salt or solvate thereof

[0183] Embodiment 8.R 1a is C1-C3 alkyl, a compound of any one of Embodiments 1 to 7 or a pharmaceutically acceptable salt or solvate thereof

[0184] Embodiment 9.G 2 is hydrogen, a compound of any one of Embodiments 1 to 8 or a pharmaceutically acceptable salt or solvate thereof

[0185] Embodiment 10. Formula II:

Chemical formula

[0186] Embodiment 11.R 1d is selected from the group consisting of hydrogen and fluoro, a compound of Embodiment 10 or a pharmaceutically acceptable salt or solvate thereof

[0187] Embodiment 12. Formula II-A:

Chemical formula

[0188] Embodiment 13.G 1 is optionally substituted C6-C 10 aryl; optionally substituted 5- to 9-membered heteroaryl; optionally substituted 3- to 10-membered heterocycle; optionally substituted C6-C8 cycloalkyl; (5- to 9-membered heteroaryl)C1-C6 alkyl; (5- to 9-membered heteroaryl)(C 6~10 aryl)C1-C4 alkyl; (5- to 9-membered heteroarylheteroaryl)(C3-C6 cycloalkyl)C1-C4 alkyl; and (C3-C6 cycloalkyl)C1-C4 alkyl, being a compound of any one of Embodiments 10 to 12 or a pharmaceutically acceptable salt or solvate thereof.

[0189] Embodiment 14. Formula III: [Chemical formula] (wherein, A 1 is selected from the group consisting of -N= and -C(R 2a )); R 2a is selected from the group consisting of hydrogen, alkyl, halogen and haloalkyl; R 2b is optionally substituted alkyl, optionally substituted heterocycle, optionally substituted cycloalkyl, optionally substituted heteroaryl, optionally substituted aryl, (carboxamide)alkyl, -OR 10c , amino, (heterocycle)alkyl, (amino)alkyl, (hydroxy)alkyl, carboxamide, (heteroaryl)alkyl, -S(=O)R 9b , -S(=O)2R 9b and -C(=O)R 9c selected from the group consisting of; A 2 is -N= and -C(R 2c) is selected from the group consisting of; R 2c is selected from the group consisting of hydrogen, alkyl, halogen, and haloalkyl; R 2d is selected from the group consisting of hydrogen, alkyl, halogen, cyano, and haloalkyl ; R 2e is selected from the group consisting of hydrogen, alkyl, halogen, and haloalkyl; R 9b is selected from the group consisting of amino, alkyl, optionally substituted cycloalkyl, optionally substituted aryl, optionally substituted heterocycle, and optionally substituted heteroaryl; R 9c is selected from the group consisting of amino, alkyl, optionally substituted cycloalkyl, optionally substituted aryl, optionally substituted heterocycle, and optionally substituted heteroaryl; and R 10c is selected from the group consisting of alkyl, (hydroxy)alkyl, and (amino)alkyl) of the compound of Embodiment 13 or a pharmaceutically acceptable salt or solvate thereof.

[0190] Embodiment 15. Formula III-A:

Chemical formula

[0191] Embodiment 16. R 2a is selected from the group consisting of hydrogen, C1-C4 alkyl, halogen, and C1-C4 haloalkyl; R 2b is (A) Unsubstituted 4- to 10-membered heterocycle; (B) (i) -N(R 3a )C(=O)R 4a ; (ii) -NR 5a R 5b;(iii) unsubstituted 4- to 10-membered heterocycles; (iv) hydroxy, -NR 5c R 5d , C1-C4 alkyl, C1-C6 alkoxy, -C(R 6a )(R 6b )C(=O)NR 5e R 5f , -C(=O)R 4b , a substituted 4- to 10-membered heterocycle having one, two or three substituents independently selected from the group consisting of hydroxy, C1-C4 alkyl, C1-C6 alkoxy, -C(R 5g R 5h ), (hydroxy)C1-C4 alkyl and halo; (v) unsubstituted C3-C6 cycloalkyl; (vi) (hydroxy)C1-C4 alkyl; (vii) C1-C6 alkyl; (viii) -C(=O)NR 4c R 9a ; (ix) halo; (x) -C(=O)R 1~4 ; (xi) C1-C6 haloalkyl; (xii) hydroxy; (xiii) (amino)C1-C4 alkyl; (xiv) (C1-C4 alkoxy)C1-C4 alkyl; (xv) -S(=O)2R 6~10 ; (xvi) (3- to 8-membered heterocycle)C1-C4 alkyl; (xvii) C1-C6 alkoxy; (xviii) (C3-C6 cycloalkyl)C 10b alkyl; (xix) (C (C) unsubstituted C3-C8 cycloalkyl; (D) (i) unsubstituted 4- to 10-membered heterocycles; (ii) a substituted 4- to 10-membered heterocycle having one or two substituents independently selected from the group consisting of amino and C1-C4 alkyl; (iii) unsubstituted 5- or 6-membered heteroaryl; (iv) a substituted 5- or 6-membered heteroaryl having one, two or three substituents independently selected from the group consisting of halo, C1-C4 alkyl, (3- to 8-membered heterocycle)alkyl, hydroxy and amino; (v) -NR 5i R 5j ; (vi) cyano; (vii) -N(R 3d )C(=O)R 4f; (viii) hydroxy; and (ix) substituted C3-C8 cycloalkyl having one, two, three or four substituents independently selected from the group consisting of C1-C4 alkyl; (E) unsubstituted 5- to 10-membered heteroaryl; (F) (i) halo; (ii) C1-C4 alkyl; (iii) (C1-C4 alkoxy)C1-C4 alkyl; (iv) (hydroxy)C1-C4 alkyl; (v) C3-C6 cycloalkyl; (vi) (amino)C1-C4 alkyl; (vii) unsubstituted C3-C6 cycloalkyl; (viii) -NR 5g R 5h substituted C3-C6 cycloalkyl having one, two, three or four substituents independently selected from the group consisting of; (xi) unsubstituted 4- to 14-membered heterocycle; (xii) substituted 4- to 14-membered heterocycle having one or two substituents independently selected from the group consisting of hydroxy, amino and C1-C4 alkyl; (xiii) -NR 5q R 5r ; and (ix) substituted 5- to 10-membered heteroaryl having one, two, three or four substituents independently selected from the group consisting of (3- to 8-membered heterocycle)C1-C4 alkyl; (G) unsubstituted C6-C 10 aryl; (H) (i) halo; (ii) C1-C4 alkyl; (iii) -CH2N(H)S(=O)2R 8 ; (iv) (5- to 9-membered heteroaryl)C1-C4 alkyl; (v) -OR 10a ; (vi) -N(R 3b )C(=O)R 4b ; (vii) (amino)C1-C4 alkyl; and (viii) substituted C6-C 10 aryl having one, two, three or four substituents independently selected from the group consisting of (hydroxy)C1-C4 alkyl; (I) (carboxamide)C1-C4 alkyl; (J) -OR 10c ; (K) -NR 5o R 5p ; (L) (3- to 8-membered heterocycle)C1-C4 alkyl; (M) (amino) C1-C4 alkyl; (N)(hydroxy)C1-C4 alkyl; (O)-C(=O)NR 5s R 5t ; (P) (5-9 membered heteroaryl)C1-C4 alkyl; and (Q)-S(=O)2R 9b selected from the group consisting of; R 2c is selected from the group consisting of hydrogen, C1-C4 alkyl, halogen, and C1-C4 haloalkyl; R 2d is selected from the group consisting of hydrogen, C1-C4 alkyl, halogen, cyano, and C1-C4 haloalkyl; R 2e is selected from the group consisting of hydrogen, C1-C4 alkyl, halogen, and C1-C4 haloalkyl; R 3a , R 3b , R 3c and R 3d are each independently selected from the group consisting of hydrogen, C1-C4 alkyl, optionally substituted C3-C6 cycloalkyl, and optionally substituted 4-14 membered heterocyclo; R 4a , R 4b , R 4c , R 4d , R 4e and R 4f is C1-C6 alkyl; C1-C6 haloalkyl; C3-C6 cycloalkyl; C1-C6 alkoxy; (C1-C4 alkoxy)C1-C4 alkyl; (C 6~10 (aryl)C1-C4 alkyl; (5-9 membered heteroaryl)C1-C4 alkyl; (amino)C1-C4 alkyl; (hydroxy)C1-C4 alkyl; (cyano)C1-C4 alkyl; unsubstituted 4-14 membered heterocyclo; substituted 4-14 membered heterocyclo having one or two substituents independently selected from the group consisting of halo and C1-C4 alkyl; unsubstituted C6-C 10Substituted C6-C having one, two, three or four substituents independently selected from the group consisting of aryl; halo and C1-C4 alkyl 10 Each independently selected from the group consisting of aryl; unsubstituted 5- or 6-membered heteroaryl; and substituted 5- or 6-membered heteroaryl having one, two, three or four substituents independently selected from the group consisting of halo and C1-C4 alkyl; R 5a and R 5b are each independently selected from hydrogen; C1-C4 alkyl; C1-C4 haloalkyl; (hydroxy)C1-C4 alkyl; (amino)C1-C4 alkyl; (C1-C4 alkoxy)C1-C4 alkyl; (5-9-membered heteroaryl)C1-C4 alkyl; unsubstituted 5- or 6-membered heteroaryl; substituted 5- or 6-membered heteroaryl having one or are two substituents selected from substituted 5- or 6-membered heteroaryl; unsubstituted 4- to 14-membered heterocycle; and substituted 4- to 14-membered heterocycle having one or two substituents independently selected from the group consisting of hydroxy, amino and C1-C4 alkyl; R 5c and R 5d are each independently selected from hydrogen; C1-C4 alkyl; C1-C4 haloalkyl; (hydroxy)C1-C4 alkyl; (amino)C1-C4 alkyl; (C1-C4 alkoxy)C1-C4 alkyl; (5-9-membered heteroaryl)C1-C4 alkyl; unsubstituted 5- or 6-membered heteroaryl; substituted 5- or 6-membered heteroaryl having one or two substituents independently selected from the group consisting of halo and C1-C4 alkyl; unsubstituted 4- to 14-membered heterocycle; and substituted 4- to 14-membered heterocycle having one or two substituents independently selected from the group consisting of hydroxy, amino and C1-C4 alkyl, or R 5c and R 5d together with the nitrogen atom to which they are attached form an optionally substituted 4- to 14-membered heterocycle; R 5e and R 5fis independently selected from the group consisting of hydrogen; C1-C4 alkyl; C1-C4 haloalkyl; (hydroxy)C1-C4 alkyl; (amino)C1-C4 alkyl; (C1-C4 alkoxy)C1-C4 alkyl; (5-9 membered heteroaryl)C1-C4 alkyl; unsubstituted 5- or 6-membered heteroaryl; substituted 5- or 6-membered heteroaryl having one or two substituents independently selected from the group consisting of halo and C1-C4 alkyl; unsubstituted 4-14 membered heterocycle; and substituted 4-14 membered heterocycle having one or two substituents independently selected from the group consisting of hydroxy, amino and C1-C4 alkyl; or R 5e and R 5f together with the nitrogen atom to which they are attached form an optionally substituted 4-14 membered heterocycle; R 5g and R 5h is independently selected from the group consisting of hydrogen; C1-C4 alkyl; C1-C4 haloalkyl; (hydroxy)C1-C4 alkyl; (amino)C1-C4 alkyl; (C1-C4 alkoxy)C1-C4 alkyl; (5-9 membered heteroaryl)C1-C4 alkyl; unsubstituted 5- or 6-membered heteroaryl; substituted 5- or 6-membered heteroaryl having one or two substituents independently selected from the group consisting of halo and C1-C4 alkyl; unsubstituted 4-14 membered heterocycle; and substituted 4-14 membered heterocycle having one or two substituents independently selected from the group consisting of hydroxy, amino and C1-C4 alkyl; or R 5g and R 5h together with the nitrogen atom to which they are attached form an optionally substituted 4-14 membered heterocycle; R 5i and R 5jis independently selected from the group consisting of hydrogen; C1-C4 alkyl; C1-C4 haloalkyl; (hydroxy)C1-C4 alkyl; (amino)C1-C4 alkyl; (C1-C4 alkoxy)C1-C4 alkyl; (5-9 membered heteroaryl)C1-C4 alkyl; unsubstituted 5- or 6-membered heteroaryl; substituted 5- or 6-membered heteroaryl having one or two substituents independently selected from the group consisting of halo and C1-C4 alkyl; unsubstituted 4-14 membered heterocycle; and substituted 4-14 membered heterocycle having one or two substituents independently selected from the group consisting of hydroxy, amino and C1-C4 alkyl; or R 5i and R 5j together with the nitrogen atom to which they are attached form an optionally substituted 4-14 membered heterocycle; R 5k and R 5l is independently selected from the group consisting of hydrogen; C1-C4 alkyl; C1-C4 haloalkyl; (hydroxy)C1-C4 alkyl; (amino)C1-C4 alkyl; (C1-C4 alkoxy)C1-C4 alkyl; (5-9 membered heteroaryl)C1-C4 alkyl; unsubstituted 5- or 6-membered heteroaryl; substituted 5- or 6-membered heteroaryl having one or two substituents independently selected from the group consisting of halo and C1-C4 alkyl; unsubstituted 4-14 membered heterocycle; and is independently selected from the group consisting of substituted 4-14 membered heterocycles having one or two substituents; or R 5k and R 5l together with the nitrogen atom to which they are attached form an optionally substituted 4-14 membered heterocycle; R 5m and R 5nis independently selected from the group consisting of hydrogen; C1-C4 alkyl; C1-C4 haloalkyl; (hydroxy)C1-C4 alkyl; (amino)C1-C4 alkyl; (C1-C4 alkoxy)C1-C4 alkyl; (5-9 membered heteroaryl)C1-C4 alkyl; unsubstituted 5- or 6-membered heteroaryl; substituted 5- or 6-membered heteroaryl having one or two substituents independently selected from the group consisting of halo and C1-C4 alkyl; unsubstituted 4-14 membered heterocycle; and substituted 4-14 membered heterocycle having one or two substituents independently selected from the group consisting of hydroxy, amino and C1-C4 alkyl; or R 5m and R 5n together with the nitrogen atom to which they are attached form an optionally substituted 4-14 membered heterocycle; R 5o and R 5p is independently selected from the group consisting of hydrogen; C1-C4 alkyl; C1-C4 haloalkyl; (hydroxy)C1-C4 alkyl; (amino)C1-C4 alkyl; (C1-C4 alkoxy)C1-C4 alkyl; (5-9 membered heteroaryl)C1-C4 alkyl; unsubstituted 5- or 6-membered heteroaryl; substituted 5- or 6-membered heteroaryl having one or two substituents independently selected from the group consisting of halo and C1-C4 alkyl; unsubstituted 4-14 membered heterocycle; and substituted 4-14 membered heterocycle having one or two substituents independently selected from the group consisting of hydroxy, amino and C1-C4 alkyl; or R 5o and R 5p together with the nitrogen atom to which they are attached form an optionally substituted 4-14 membered heterocycle; R 5q and R 5ris independently selected from the group consisting of hydrogen; C1-C4 alkyl; C1-C4 haloalkyl; (hydroxy)C1-C4 alkyl; (amino)C1-C4 alkyl; (C1-C4 alkoxy)C1-C4 alkyl; (5-9 membered heteroaryl)C1-C4 alkyl; unsubstituted 5- or 6-membered heteroaryl; substituted 5- or 6-membered heteroaryl having one or two substituents independently selected from the group consisting of halo and C1-C4 alkyl; unsubstituted 4-14 membered heterocycle; and substituted 4-14 membered heterocycle having one or two substituents independently selected from the group consisting of hydroxy, amino and C1-C4 alkyl; R 5s and R 5t is independently selected from the group consisting of hydrogen; C1-C4 alkyl; C1-C4 haloalkyl; (hydroxy)C1-C4 alkyl; (amino)C1-C4 alkyl; (C1-C4 alkoxy)C1-C4 alkyl; (5-9 membered heteroaryl)C1-C4 alkyl; unsubstituted 5- or 6-membered heteroaryl; substituted 5- or 6-membered heteroaryl having one or two substituents independently selected from the group consisting of halo and C1-C4 alkyl; unsubstituted 4-14 membered heterocycle; and substituted 4-14 membered heterocycle having one or two substituents independently selected from the group consisting of hydroxy, amino and C1-C4 alkyl; R 6a 、R 6b 、R 6c and R 6d is independently selected from the group consisting of hydrogen and C1-C4 alkyl; R 8 is C1-C6 alkyl; R 9a is selected from the group consisting of C1-C6 alkyl; unsubstituted C3-C8 cycloalkyl; and substituted C3-C8 cycloalkyl having one or two substituents independently selected from the group consisting of halo, C1-C4 alkyl, amino and (amino)C1-C4 alkyl; R 9b is selected from the group consisting of C1-C6 alkyl and amino; R 10ais selected from the group consisting of alkyl, (hydroxy)C1-C4 alkyl, and (amino)C1-C4 alkyl; R 10b is (amino)C1-C4 alkyl; and R 10c is (amino)C1-C4 alkyl, a compound of Embodiment 14 or 15 or a pharmaceutically acceptable salt or solvate thereof.

[0192] Embodiment 17.A 1 and A 2 is -C(H)=; R 2e is hydrogen; and R 2d is selected from the group consisting of hydrogen and halogen, a compound of any one of Embodiments 14-16 or a pharmaceutically acceptable salt or solvate thereof.

[0193] Embodiment 18.R 2b is

Chemical formula

[0194] Embodiment 19. R 2b is

Chemical formula

Chemical formula

[0195] Embodiment 20. R 2b is R 2b -1A, R 2b -1B, R 2b -1C and R 2b -1D, which is a compound of Embodiment 19 or a pharmaceutically acceptable salt or solvate thereof, which is selected from the group consisting of

[0196] Embodiment 21. R 2b is R 2b -2A and R 2b -2B, which is selected from the group consisting of; and R b1 is C1-C4 alkyl, which is a compound of Embodiment 19 or a pharmaceutically acceptable salt or solvate thereof.

[0197] Embodiment 22. R 2b is R 2b -5A and R 2b -5B, which is selected from the group consisting of; and R e1 is -C(=O)R 4c is a compound of Embodiment 19 or a pharmaceutically acceptable salt or solvate thereof.

[0198] Embodiment 23. R 2b is R 2b -6A and R 2bselected from the group consisting of -6B; and R f1 is -C(=O)R 4c The compound of Embodiment 19 or a pharmaceutically acceptable salt or solvate thereof.

[0199] Embodiment 24. R 2b is R 2b -10A, R 2b -10B, R 2b -10C and R 2b -10d, the compound of Embodiment 19 or a pharmaceutically acceptable salt or solvate thereof.

[0200] Embodiment 25. R 2b is R 2b -11A and R 2b -11B, the compound of Embodiment 19 or a pharmaceutically acceptable salt or solvate thereof.

[0201] Embodiment 26. R 2b is R 2b -4; R d1 is -C(=O)R 4c ; and R d2 and R d3 are each hydrogen or fluoro, the compound of Embodiment 18 or a pharmaceutically acceptable salt or solvate thereof.

[0202] Embodiment 27. R 2b is R 2b -3; R c1 is selected from the group consisting of C1-C4 alkyl, C3-C6 cycloalkyl and -C(=O)R 4c ; R c2 and R c3 are each hydrogen; or R c2 and R c3 together with the carbon atom to which they are attached form a C(=O) group; R c4 is hydrogen; and m is the compound of Embodiment 18, or a pharmaceutically acceptable salt or solvate thereof, which is 1.

[0203] Embodiment 28. R 2b is R 2b -8; and R h1 is -C(=O)R 4c and R h2 is selected from the group consisting of hydrogen and C1-C3 alkyl, which is the compound of Embodiment 18, or a pharmaceutically acceptable salt or solvate thereof.

[0204] Embodiment 29. R 2b is R 2b -12; and R j1 is -C(=O)R 4c which is the compound of Embodiment 18, or a pharmaceutically acceptable salt or solvate thereof.

[0205] Embodiment 30. R 4c is C1-C4 alkyl, which is the compound of any one of Embodiments 18, 19, 22, 23, or 26-29, or a pharmaceutically acceptable salt or solvate thereof.

[0206] Embodiment 31. R 2d is selected from the group consisting of hydrogen, fluoro, and chloro, which is the compound of any one of Embodiments 14-30, or a pharmaceutically acceptable salt or solvate thereof.

[0207] Embodiment 32. Formula IV:

Chemical formula

[0208] Embodiment 33. Formula IV-A:

Chemical formula

[0209] Embodiment 34. Formula IV-B:

Chemical formula

[0210] Embodiment 35. Formula IV-C:

Chemical formula

[0211] Embodiment 36. Formula IV-D: [Chemical Formula] The compound of Embodiment 32 or a pharmaceutically acceptable salt or solvate thereof.

[0212] Embodiment 37. R 11a is (A) an unsubstituted 4- to 14-membered heterocycle; (B) (i) -N(R 12a )C(=O)R 13a ; (ii) -C(=O)R 13b ; (iii) C1-C4 alkyl; (iv) (C1-C4 alkoxy)C1-C4 alkyl; (v) (hydroxy)C1-C4 alkyl; (vi) C1-C4 haloalkyl; (vii) amino; (vii) hydroxy; (viii) -N(R 12a )S(=O)2R 24 ; (ix) -S(=O)2R 24 ; (x) unsubstituted C3-C6 cycloalkyl; (xi) substituted C3-C6 cycloalkyl having one or two substituents independently selected from the group consisting of halo, hydroxy, C1-C4 alkyl, amino, and (amino)C1-C4 alkyl; (xii) unsubstituted 4- to 14-membered heterocycle; and substituted 4- to 14-membered heterocycle having one or two substituents independently selected from the group consisting of amino, hydroxy, and C1-C4 alkyl; (xiii) -C(=N-R 60 )R 61 ; and (xiv) -C(=C-NO2)R 64 substituted 4- to 14-membered heterocycle having one, two, or three substituents independently selected from the group consisting of; (C) unsubstituted 5- to 10-membered heteroaryl; (D) A substituted 5- or 6-membered heteroaryl having one, two, three, or four substituents independently selected from the group consisting of halo and C1-C4 alkyl; (E) C1-C6 alkyl; and (F) -N(R 12b )C(=O)R 13c selected from the group consisting of; R 12a and R 12b are each independently selected from the group consisting of hydrogen, C1-C4 alkyl, (C1-C4 alkoxy)C1-C4 alkyl, and (hydroxy)C1-C4 alkyl; R 13a , R 13b and R 13c are (A) C1-C6 alkyl; (B) C1-C6 haloalkyl; (C) unsubstituted C3-C6 cycloalkyl; (D) C1-C6 alkoxy; (E) (C1-C4 alkoxy)C1-C4 alkyl; (F) (hydroxy)C1-C4 alkyl; (G) (cyano)alkyl; (H) unsubstituted C6-C 10 aryl; (I) a substituted C6-C 10 aryl having one, two, three, or four substituents independently selected from the group consisting of halo, amino, hydroxy, and C1-C4 alkyl; (J) unsubstituted 5- or 6-membered heteroaryl; (K) a substituted 5- or 6-membered heteroaryl having one, two, three, or four substituents independently selected from the group consisting of halo, amino, hydroxy, and C1-C4 alkyl; (L) unsubstituted 4- to 14-membered heterocycle; (M) a substituted 4- to 14-membered heterocycle having one or two substituents independently selected from the group consisting of amino, hydroxy, and C1-C4 alkyl; (N) amino; (O) (amino)alkyl; (P) (C3-C6 cycloalkyl)oxy; and (Q) (4- to 8-membered heterocycle)oxy, each independently selected from the group consisting of; and R 24 is selected from the group consisting of C1-C4 alkyl and (hydroxy)C1-C4 alkyl; R 60 is cyano, nitro, hydroxy, C1-C6 alkoxy, -C(=O)R 62 and -S(=O)2R62 selected from the group consisting of; R 61 is C1-C6 alkyl, C3-C6 cycloalkyl and -NR 63a R 63b selected from the group consisting of; R 62 is C1-C6 alkyl, C3-C6 cycloalkyl and -NR 63a R 63b selected from the group consisting of; R 63a is selected from the group consisting of hydrogen, C1-C6 alkyl and C3-C6 cycloalkyl; R 63b is selected from the group consisting of hydrogen, C1-C6 alkyl and C3-C6 cycloalkyl; or R 63a and R 63b together with the nitrogen atom to which they are attached form an optionally substituted 4- to 6-membered heterocycle; R 64 is C1-C6 alkyl, C3-C6 cycloalkyl and -NR 63c R 63d selected from the group consisting of; R 63c is selected from the group consisting of hydrogen, C1-C6 alkyl and C3-C6 cycloalkyl; R 63d is selected from the group consisting of hydrogen, C1-C6 alkyl and C3-C6 cycloalkyl; or R 63c and R 63d together with the nitrogen atom to which they are attached form an optionally substituted 4- to 6-membered heterocycle, a compound according to any one of embodiments 32 to 36 or a pharmaceutically acceptable salt or solvate thereof.

[0213] Embodiment 38. R 11a is

Chemical formula

[0214] Embodiment 39. R 11a is

Chemical formula

Chemical formula

[0215] Embodiment 40.R 11a is

Chemical formula

Chemical formula

[0216] Embodiment 41. R 11a is

Chemical Structure

[0217] Embodiment 42. Z 4 is -CH2-, the compound of any one of Embodiments 32 to 41 or a pharmaceutically acceptable salt or solvate thereof.

[0218] Embodiment 43. R 11a is an unsubstituted 4- to 14-membered heterocycle; a substituted 4- to 14-membered heterocycle having one or two substituents independently selected from the group consisting of -N(R 12a )C(=O)R 13a , -C(=O)R 13b and C1-C4 alkyl; an unsubstituted 5- to 10-membered heteroaryl; and a substituted 5- or 6-membered heteroaryl having one or two substituents independently selected from the group consisting of halo and C1-C4 alkyl, the compound of any one of Embodiments 32 to 38 or 42 or a pharmaceutically acceptable salt or solvate thereof.

[0219] Embodiment 44. R 11a is

Chemical Structure

[0220] Embodiment 45. R 12ais selected from the group consisting of hydrogen and C1-C3 alkyl; R 13a is C1-C4 alkyl; and R 13b is C1-C4 alkyl, a compound of Embodiment 44 or a pharmaceutically acceptable salt or solvate thereof.

[0221] Embodiment 46. R 12a is selected from the group consisting of hydrogen and methyl; R 13a is methyl; and R 13b is methyl, a compound of Embodiment 45 or a pharmaceutically acceptable salt or solvate thereof.

[0222] Embodiment 47. Formula V:

Chemical formula

[0223] Embodiment 48. Formula V-A:

Chemical formula

[0224] Embodiment 49. Formula V-B:

Chemical formula

[0225] Embodiment 50.R 14a is (A) unsubstituted 5- to 10-membered heteroaryl; (B) (i) halo; (ii) C1-C4 alkyl; (iii) C1-C4 alkoxy; (iv) (3- to 8-membered heterocyclo)C1-C4 alkyl; (v) (5- to 9-membered heteroaryl)C1-C4 alkyl; (vi) -C(=O)NR 15a R 15b ; (vii) unsubstituted 5- to 10-membered heteroaryl; (viii) halo, C1-C4 alkyl, (3- to 8-membered heterocyclo)C1-C4 alkyl, 5- to 9-membered heteroaryl and -NR 15e R 15f selected independently from the group consisting of one, two or three substituents of a substituted 5- to 10-membered heteroaryl; (ix) -OR 16 ; (x) unsubstituted C3-C6 cycloalkyl; (xi) C1-C4 alkyl and -N(R 17a )C(=O)R 18a selected independently from the group consisting of one, two, three or four substituents of a substituted C3-C6 cycloalkyl; (xii) cyano; (xiii) unsubstituted 4- to 14-membered heterocycle; (xiv) one or two substituents selected independently from the group consisting of C1-C4 alkyl, (5- to 9-membered heteroaryl)C1-C4 alkyl of a substituted 4- to 14-membered heterocycle; (xv) (carboxy)C1-C4 alkyl; (xvi) (carboxamide)C1-C4 alkyl; and (xvii) one, two, three or four substituents selected independently from the group consisting of carboxy of a substituted 5- to 10-membered heteroaryl; and (C) C1-C6 alkyl selected from the group consisting of; R 14b is (A) unsubstituted 5- to 10-membered heteroaryl; (B) A substituted 5- or 10-membered heteroaryl having one, two, three or four substituents independently selected from the group consisting of halo, C1-C4 alkyl and (C3-C6 cycloalkyl)C1-C4 alkyl; (C) Unsubstituted C6-C 10 aryl; (D) A substituted C6-C 10 aryl having one, two, three or four substituents independently selected from the group consisting of halo, C1-C4 alkyl and (3-8-membered heterocyclo)C1-C4 alkyl; (E) Unsubstituted 4- to 14-membered heterocyclo; (F) A substituted 4- to 14-membered heterocyclo having one, two, three or four substituents independently selected from the group consisting of hydroxy, amino and C1-C4 alkyl; (G) -C(=O)NR 15c R 15d ; (H) Unsubstituted C3-C6 cycloalkyl; and (I) C1-C6 alkyl selected from the group consisting of; p is 0, 1, 2 or 3; R 15a and R 15b are (A) hydrogen; (B) C1-C6 alkyl; (C) C1-C6 haloalkyl; (D) (C1-C4 alkoxy)C1-C4 alkyl; (E) (hydroxy)C1-C4 alkyl; (F) (cyano)alkyl; (G) unsubstituted C6-C 10 aryl; (H) A substituted C6-C 10 aryl having one, two, three or four substituents independently selected from the group consisting of halo, amino, hydroxy and C1-C4 alkyl; (I) Unsub a 5- or 6-membered heteroaryl; (J) a substituted 5- or 6-membered heteroaryl having 1, 2, 3 or 4 substituents independently selected from the group consisting of halo, amino, hydroxy and C1-C4 alkyl; (K) an unsubstituted 4- to 14-membered heterocycle; (L) a substituted 4- to 14-membered heterocycle having 1 or 2 substituents independently selected from the group consisting of amino, hydroxy and C1-C4 alkyl; (M) an unsubstituted C3-C8 cycloalkyl; and (N) a C1-C6 alkyl and -NR 15g R 15h is independently selected from the group consisting of a substituted C3-C8 cycloalkyl having 1, 2, 3 or 4 substituents independently selected from the group consisting of; or R 15a and R 15b together with the nitrogen atom to which they are attached form an optionally substituted 4- to 14-membered heterocycle; R 15c and R 15d are (A) hydrogen; (B) C1-C6 alkyl; (C) C1-C6 haloalkyl; (D) (C1-C4 alkoxy)C1-C4 alkyl; (E) (hydroxy)C1-C4 alkyl; (F) (cyano)alkyl; (G) an unsubstituted C6-C 10 aryl; (H) a substituted C6-C 10 aryl having 1, 2, 3 or 4 substituents independently selected from the group consisting of halo, amino, hydroxy and C1-C4 alkyl; (I) an unsubstituted 5- or 6-membered heteroaryl; (J) a substituted 5- or 6-membered heteroaryl having 1, 2, 3 or 4 substituents independently selected from the group consisting of halo, amino, hydroxy and C1-C4 alkyl; (K) an unsubstituted 4- to 14-membered heterocycle; (L) a substituted 4- to 14-membered heterocycle having 1 or 2 substituents independently selected from the group consisting of amino, hydroxy and C1-C4 alkyl; (M) an unsubstituted C3-C8 cycloalkyl; and (N) a C1-C6 alkyl and -NR 15g R 15h is independently selected from the group consisting of a substituted C3-C8 cycloalkyl having 1, 2, 3 or 4 substituents independently selected from the group consisting of; or R 15c and R15d together with the nitrogen atom to which they are attached form an optionally substituted 4- to 14-membered heterocycle; R 15e and R 15f are independently selected from the group consisting of (A) hydrogen, (B) C1-C6 alkyl; (C) C1-C6 haloalkyl; (D) (C1-C4 alkoxy)C1-C4 alkyl; (E) (hydroxy)C1-C4 alkyl; (F) (cyano)alkyl; (G) unsubstituted C6-C 10 aryl, (G’) halo, amino, hydroxy and C1-C4 alkyl having one, two, three or four substituents independently selected from the group consisting of; substituted C6-C 10 aryl; (I) unsubstituted 5- or 6-membered heteroaryl; (J) substituted 5- or 6-membered heteroaryl having one, two, three or four substituents independently selected from the group consisting of halo, amino, hydroxy and C1-C4 alkyl; (K) unsubstituted 4- to 14-membered heterocycle; (L) substituted 4- to 14-membered heterocycle having one or two substituents independently selected from the group consisting of amino, hydroxy and C1-C4 alkyl; (M) unsubstituted C3-C8 cycloalkyl; and (N) C1-C6 alkyl and -NR 15g R 15h selected independently from the group consisting of substituted C3-C8 cycloalkyl having one, two, three or four substituents; or R 15e and R 15f together with the nitrogen atom to which they are attached form an optionally substituted 4- to 14-membered heterocycle; R 15g and R 15h are independently selected from the group consisting of (A) hydrogen; (B) C1-C6 alkyl; (C) C1-C6 haloalkyl; (D) C1-C6 alkoxy; (E) (C1-C4 alkoxy)C1-C4 alkyl; (F) (hydroxy)C1-C4 alkyl; (G) (cyano)alkyl; (H) unsubstituted C6-C 10 aryl; (I) substituted C6-C having one, two, three or four substituents independently selected from the group consisting of halo, amino, hydroxy and C1-C4 alkyl; 10Aryl; (J) unsubstituted 5- or 6-membered heteroaryl; (K) substituted 5- or 6-membered heteroaryl having 1, 2, 3 or 4 substituents independently selected from the group consisting of halo, amino, hydroxy and C1-C4 alkyl; (L) unsubstituted 4- to 14-membered heterocycle; (M) substituted 4- to 14-membered heterocycle having 1 or 2 substituents independently selected from the group consisting of amino, hydroxy and C1-C4 alkyl; (N) unsubstituted C3-C 8 cycloalkyl; and (O) C1-C6 alkyl and -NR 15g R 15h selected independently from the group consisting of substituted C3-C8 cycloalkyl having 1, 2, 3 or 4 substituents independently selected from the group consisting of; or R 15g and R 15g together with the nitrogen atom to which they are attached form an optionally substituted 4- to 14-membered heterocycle; R 16 is (amino)(hydroxy)C1-C4 alkyl; R 17a is selected from the group consisting of hydrogen and C1-C4 alkyl; R 18a is (A) C1-C6 alkyl; (B) C1-C6 haloalkyl; (C) C1-C6 alkoxy; (D) (C1-C4 alkoxy)C1-C4 alkyl; (E) (hydroxy)C1-C4 alkyl; (F) (cyano)alkyl; (G) unsubstituted C6-C 10 aryl; (H) substituted C6-C having 1, 2, 3 or 4 substituents independently selected from the group consisting of halo, amino, hydroxy and C1-C4 alkyl 10Aryl; (I) unsubstituted 5- or 6-membered heteroaryl; (J) substituted 5- or 6-membered heteroaryl having 1, 2, 3 or 4 substituents independently selected from the group consisting of halo, amino, hydroxy and C1-C4 alkyl; (K) unsubstituted 4- to 14-membered heterocycle; (L) substituted 4- to 14-membered heterocycle having 1 or 2 substituents independently selected from the group consisting of amino, hydroxy and C1-C4 alkyl; (M) unsubstituted C3-C8 cycloalkyl; and (N) substituted C3-C8 cycloalkyl having 1, 2, 3 or 4 substituents independently selected from the group consisting of amino, hydroxy and C1-C4 alkyl, a compound of any one of embodiments 47-49 or a pharmaceutically acceptable salt or solvate thereof.

[0226] Embodiment 51.R 14a is unsubstituted 5- to 10-membered heteroaryl; and C1-C4 alkyl; C1-C4 alkoxy; (3- to 8-membered heterocycle)C1-C4 alkyl; (5- to 9-membered heteroaryl)C1-C4 alkyl; -C(=O)NR 15a R 15b substituted 5- to 10-membered heteroaryl having 1, 2 or 3 substituents independently selected from the group consisting of; unsubstituted 5- to 10-membered heteroaryl; halo, C1-C4 alkyl, (3- to 8-membered heterocycle)C1-C4 alkyl, 5- to 9-membered heteroaryl and -NR 15e R 15f substituted 5- to 10-membered heteroaryl having 1, 2 or 3 substituents independently selected from the group consisting of; unsubstituted C3-C6 cycloalkyl; and C1-C4 alkyl and -N(R 17a )C(=O)R 18a substituted C3-C6 cycloalkyl having 1, 2 or 3 substituents independently selected from the group consisting of, a compound of any one of embodiments 47-50 or a pharmaceutically acceptable salt or solvate thereof.

[0227] Embodiment 52.R 14ais C1-C4 alkyl; C1-C4 alkoxy; (3- to 8-membered heterocyclo)C1-C4 alkyl; (5- to 9-membered heteroaryl)C1-C4 alkyl; -C(=O)NR 15a R 15b A substituted pyridyl having one, two or three substituents independently selected from the group consisting of; unsubstituted 5- to 10-membered heteroaryl; halo, C1-C4 alkyl, (3- to 8-membered heterocyclo)C1-C4 alkyl, 5- to 9-membered heteroaryl and -NR 15e R 15f A substituted 5- to 10-membered heteroaryl having one, two or three substituents independently selected from the group consisting of; unsubstituted C3-C6 cycloalkyl; and C1-C4 alkyl and -N(R 17a )C(=O)R 18a A substituted C3-C6 cycloalkyl having one, two or three substituents independently selected from the group consisting of, a compound of any one of embodiments 47 to 51 or a pharmaceutically acceptable salt or solvate thereof.

[0228] Embodiment 53. R 14b is unsubstituted 5- to 10-membered heteroaryl; substituted 5- to 10-membered heteroaryl having one or two substituents independently selected from the group consisting of C1-C4 alkyl and (C3-C6 cycloalkyl)C1-C4 alkyl; unsubstituted C6-C 10 aryl; substituted C6-C 10 aryl having one or two substituents independently selected from the group consisting of C1-C4 alkyl and (3- to 8-membered heterocyclo)C1-C4 alkyl; unsubstituted 4 - to 14-membered heterocyclo; substituted 4- to 14-membered heterocyclo having one or two substituents independently selected from the group consisting of hydroxy, amino and C1-C4 alkyl; and unsubstituted C3-C6 cycloalkyl, a compound of any one of embodiments 47 to 52 or a pharmaceutically acceptable salt or solvate thereof.

[0229] Embodiment 54. R 14bis a compound of any one of Embodiments 47 to 53 or a pharmaceutically acceptable salt or solvate thereof, which is selected from the group consisting of unsubstituted 5- or 6-membered heteroaryl; substituted 5- or 6-membered heteroaryl having one or two substituents independently selected from the group consisting of C1-C4 alkyl and (C3-C6 cycloalkyl)C1-C4 alkyl; unsubstituted phenyl; substituted phenyl having one or two substituents independently selected from the group consisting of C1-C4 alkyl and (3-8-membered heterocyclo)C1-C4 alkyl; and unsubstituted C3-C6 cycloalkyl.

[0230] In Embodiment 55.p, it is 0, and it is a compound of any one of Embodiments 47 to 54 or a pharmaceutically acceptable salt or solvate thereof.

[0231] In Embodiment 56.p, it is 1, and it is a compound of any one of Embodiments 47 to 54 or a pharmaceutically acceptable salt or solvate thereof.

[0232] In Embodiment 57. Formula VI:

Chemical formula

[0233] In Embodiment 58. Formula VII:

Chemical formula

[0234] Embodiment 59. Formula VII-A:

Chemical formula

[0235] Embodiment 60. Formula VII-B:

Chemical formula

[0236] Embodiment 61. Formula VII-C:

Chemical formula

[0237] Embodiment 62. Formula VII-D:

Chemical formula

[0238] Embodiment 63. Formula VII-E:

Chemical formula

[0239] Embodiment 64. Formula VII-F:

Chemical formula

[0240] Embodiment 65. Formula VII-G:

Chemical formula

[0241] Embodiment 66. Formula VII-H:

Chemical formula

[0242] Embodiment 67. Formula VIII:

Chemical formula

[0243] Embodiment 68. Formula VIII-A:

Chemical formula

[0244] Embodiment 69. Formula VIII-B:

Chemical formula

[0245] Embodiment 70.R 1d is fluoro, any one of Embodiments 1 to 11 or 13 to 69 or a compound or a pharmaceutically acceptable salt or solvate thereof.

[0246] Embodiment 71. The compound of Embodiment 1 or a pharmaceutically acceptable salt or solvate thereof, selected from any one or more of the compounds in Table 1.

[0247] [Table 1-1]

[0248] [Table 1-2]

[0249] [Table 1-3]

[0250] [Table 1-4]

[0251] [Table 1-5]

[0252] [Table 1-6]

[0253] [Table 1-7]

[0254]

Table 1-8

[0255]

Table 1-9

[0256]

Table 1-10

[0257]

Table 1-11

[0258]

Table 1-12

[0259]

Table 1-13

[0260]

Table 1-14

[0261]

Table 1-15

[0262]

Table 1-16

[0263]

Table 1-17

[0264]

Table 1-18

[0265]

Table 1-19

[0266]

Table 1-20

[0267]

Table 1-21

[0268]

Table 1-22

[0269]

Table 1-23

[0270]

Table 1-24

[0271]

Table 1-25

[0272]

Table 1-26

[0273]

Table 1-27

[0274]

Table 1-28

[0275]

Table 1-29

[0276]

Table 1-30

[0277]

Table 1-31

[0278]

Table 1-32

[0279]

Table 1-33

[0280]

Table 1-34

[0281]

Table 1-35

[0282]

Table 1-36

[0283]

Table 1-37

[0284]

Table 1-38

[0285]

Table 1-39

[0286]

Table 1-40

[0287]

Table 1-41

[0288]

Table 1-42

[0289]

Table 1-43

[0290]

Table 1-44

[0291]

Table 1-45

[0292]

Table 1-46

[0293]

Table 1-47

[0294]

Table 1-48

[0295]

Table 1-49

[0296]

Table 1-50

[0297]

Table 1-51

[0298]

Table 1-52

[0299]

Table 1-53

[0300]

Table 1-54

[0301]

Table 1-55

[0302]

Table 1-56

[0303]

Table 1-57

[0304]

Table 1-58

[0305]

Table 1-59

[0306]

Table 1-60

[0307]

Table 1-61

[0308]

Table 1-62

[0309]

Table 1-63

[0310]

Table 1-64

[0311]

Table 1-65

[0312]

Table 1-66

[0313]

Table 1-67

[0314]

Table 1-68

[0315]

Table 1-69

[0316]

Table 1-70

[0317]

Table 1-71

[0318]

Table 1-72

[0319]

Table 1-73

[0320]

Table 1-74

[0321]

Table 1-75

[0322]

Table 1-76

[0323]

Table 1-77

[0324]

Table 1-78

[0325]

Table 1-79

[0326]

Table 1-80

[0327]

Table 1-81

[0328]

Table 1-82

[0329]

Table 1-83

[0330]

Table 1-84

[0331]

Table 1-85

[0332]

Table 1-86

[0333]

Table 1-87

[0334]

Table 1-88

[0335]

Table 1-89

[0336]

Table 1-90

[0337]

Table 1-91

[0338]

Table 1-92

[0339]

Table 1-93

[0340]

Table 1-94

[0341]

Table 1-95

[0342]

Table 1-96

[0343]

Table 1-97

[0344]

Table 1-98

[0345]

Table 1-99

[0346]

Table 1-100

[0347]

Table 1-101

[0348]

Table 1-102

[0349]

Table 1-103

[0350] Embodiment 72. A compound of Embodiment 71 or a pharmaceutically acceptable salt or solvate thereof, selected from the group consisting of compound numbers 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 824, 828, 839, 870, 922, 930, 942, 995, 1007, 1025, 1043, 1044, 1045, 1048, 1051, 1055, 1070, 1078, 1083, 1097, 1117, 1138, 1180, 1184 and 1192.

[0351] Embodiment 73. A compound of Embodiment 73 or a pharmaceutically acceptable salt or solvate thereof, selected from the group consisting of compound numbers 15, 922, 930, 942, 1055, 1070, 1117, 1180, 1184 and 1192.

[0352] The term "SETD2" (also known as SET domain-containing 2, huntingtin-interacting protein B, lysine N-methyltransferase 3A, huntingtin yeast partner B, EC 2.1.1.43, P231HBP, HIP-1, HIF-1, KMT3A, HYPB, SET2, histone-lysine N-methyltransferase SETD2, huntingtin-interacting protein 1, huntingtin-interacting protein 1, SET domain-containing protein 2, KIAA1732, HSPC069, HBP231, HSET2, HIF1, and LLS) refers to native histone methyltransferase SETD2, unless otherwise indicated. "Human SETD2" refers to native human histone methyltransferase SETD2. "SETD2" encompasses full-length unprocessed SETD2 and any form of SETD2 resulting from intracellular processing. This term also includes naturally occurring variants of SETD2, such as splice variants, allelic variants, and isoforms. SETD2 can be isolated from various sources, such as human tissue types or other animal tissue types, or prepared by recombinant or synthetic methods. Examples of the human gene sequences encoding SETD2 or the SETD2 polypeptide sequence include, but are not limited to, NCBI Gene ID 29072, HGNC:18420, and SETD2 transcript variant 1, mRNA-NCBI reference sequence: NM_014159.6. The human gene encoding SETD2 is located on the short arm of chromosome 3. The term "SETD2" as used herein generally refers to the gene encoding human SETD2, while other mammalian forms of SETD2 are also contemplated.

[0353] As used herein, "functional domain of SETD2" refers to one of three conserved functional domains of SETD2 that are thought to define the biological function of SETD2. These functional domains are: (1) a triple AWS-SET-PostSET domain; (2) a WW domain; and (3) a Set2-Rbp1 interaction ("SRI") domain (Li, J. et al., Oncotarget 7:50719-50734 (2016)), which can be described as follows.

[0354] AWS-SET-PostSET domain. Without being bound by theory, the human SET domain is thought to be a 130-amino acid motif that is evolutionarily conserved from yeast to mammals and is also found in some bacteria and viruses. The SET domain typically exists as part of a multi-domain moiety adjacent to the AWS (associated with SET) and PostSET domains. In general, SET domain-containing proteins transfer one or more methyl groups from S-adenosyl-L-methionine to the amino group of a lysine or arginine residue of histone or other proteins. This transfer is thought to be determined by the adjacent AWS and PostSET regions, which contain several conserved cysteine residues. In contrast to other methyltransferases, SET domain-containing methyltransferases have an α-sheet structure that promotes multiple rounds of methylation without substrate dissociation.

[0355] WW domain. The "WW domain" is composed of two Refers to the presence of the conserved tryptophan (W) residue. Binding assays indicate that the WW domain preferentially binds to proline-rich segments, mediates protein-protein interactions, and is involved in various molecular processes. Without being bound by theory, the WW domain is thought to recognize motifs such as proline-proline-x-tyrosine (PPxY), phospho-serine-proline (p-SP), or phospho-threonine-proline (p-ST) and mediate protein binding. Aberrant expression of WW domain-containing genes has been associated with diseases such as HD, Alzheimer's disease, and multiple cancer subtypes. Without being bound by theory, the WW domain in the C-terminal region of SETD2 is thought to interact with huntingtin protein via its proline-rich segment and also potentially interact with TP53, regardless of the length of the HD-related polyglutamine tract. SETD2 contains a proline-rich stretch preceding the WW domain. This proline-rich stretch functions as an intramolecular WW interaction domain that can block the interaction of the WW domain of SETD2 with proline-rich stretches of huntingtin and possibly other proteins as well.

[0356] SRI domain. Without being bound by theory, the Set2Rpb1 interaction ("SRI") domain is thought to interact with the highly phosphorylated C-terminal domain (CTD) of Rpb1, the largest subunit of RNA Pol II. Also without being bound by theory, in humans, the major C-terminal domain docking site of RNA Pol II is thought to be located in helices 1 and 2 of SETD2. This domain is thought to direct the activity of SETD2 towards actively transcribed genes.

[0357] As used herein, the term "WHSC1" (also known as Wolf-Hirschhorn syndrome candidate gene 1, MMSET, NSD2, REIIBP, TRX5, and WHS) refers to a histone methyltransferase enzyme located at the chromosome 4p16.3 locus. WHSC1 is significantly overexpressed in multiple cancer types compared to their normal counterparts. Furthermore, WHSC1 is associated with tumor invasiveness or prognosis in many types of these cancers. Kassambara, A. et al., Biochem. Biophys. Res. Commun. 379:840-845 (2009). See also Hudlebusch H.R. et al., Clin Cancer Res. 17:2919-2933 (2011). Chromosomal translocations occur in a subset of multiple myelomas, and the 4p16.3 locus of WHSC1 is fused to the 14q32 locus, and WHSC1 is significantly overexpressed. This translocation is commonly known as t(4;14) and is described in further detail below.

[0358] As used herein, the term "overexpression" means expression at a level that exceeds what is present in normal cells or cells in a different phenotypic situation (e.g., of a WHSC1 polynucleotide or polypeptide). In one embodiment, WHSC1 expression is differently present (e.g., overexpressed) in a subject in one phenotypic situation, e.g., a subject having a blood cancer, compared to a subject in another phenotypic situation, e.g., a subject having a normal, non-diseased condition or a cancer without overexpression of WHSC1. The comparison can be made by statistical analysis of numerical measurements of expression or by visual inspection of experimental results.

[0359] As used herein, the term "subject" refers to any animal (e.g., a mammal) including, but not limited to, a human, non-human primate, rodent, etc., that is the recipient of a particular treatment. Typically, the terms "subject" and "patient" are used interchangeably herein in reference to a human subject.

[0360] The terms "tumor" and "neoplasm" refer to any mass of tissue resulting from excessive cell growth or proliferation, whether benign (non-cancerous), pre-cancerous or malignant (cancerous), including lesions in situ. Yes.

[0361] The terms "cancer", "cancerous" or "malignant tumor" are used interchangeably and refer to a physiological condition in mammals (i.e., humans) characterized by the growth or proliferation of cells that are not controlled or regulated. Examples of cancers include, for example, carcinomas, lymphomas, blastomas, sarcomas, myelomas and leukemias. Non-limiting examples of cancer types that can be treated with the methods and pharmaceutical compositions of the present disclosure include esophageal cancer, renal cancer, gastric cancer, hepatocellular carcinoma, glioblastoma, central nervous system (CNS) cancer, soft tissue cancer, lung cancer, breast cancer, bladder / urinary tract cancer, head and neck cancer, prostate cancer, testicular cancer, melanoma, blood cancer, multiple myeloma, pancreatic cancer, colorectal cancer, skin cancer, endometrial cancer, ovarian cancer, colon cancer and colorectal cancer.

[0362] The term "recurrent" cancer in a patient refers to a patient who has previously achieved a complete or partial remission but shows evidence of disease progression after a period of six months or more. The term "refractory" cancer in a patient refers to a patient who has experienced treatment failure or disease progression within six months of the last anti-cancer treatment.

[0363] Tumors that "do not respond" or "respond inadequately" to treatment (e.g., by a particular chemotherapy regimen) do not show a statistically significant improvement in response to that treatment or grow as treatment continues when compared to no treatment or treatment with a placebo in a recognized animal model or human clinical trial.

[0364] The terms "multiple myeloma" or "MM" refer to a heterogeneous plasma cell disorder / hematologic cancer characterized by multiple molecularly defined subtypes, each with variable clinicopathologic features and disease outcomes. MM is also known as "plasma cell myeloma" or "PCM". The American Cancer Society estimates that in 2019 in the United States, approximately 32,000 new cases will be diagnosed and approximately 13,000 deaths will occur. Genetic abnormalities in MM include, for example, chromosomal translocations, deletions, duplications, copy number variations from DNA gain or loss (e.g., hyperdiploidy, gain of 1q, loss of 1p, loss of chromosome 13 / 13q, loss of 17p) and gene mutations. Prideaux, S.M. et al., Advances in Hematology Volume 2014:1-16 (2014).

[0365] Chromosomal translocations are early events in the pathogenesis of MM, followed later by secondary changes. The term "chromosomal translocation" refers to a genetic abnormality by which genetic material from one chromosome is transferred (in most cases) to a different location on a non-homologous chromosome. Translocations can be classified into two major categories (reciprocal (or balanced) and non-reciprocal). In the more typical "reciprocal translocation", genetic material is exchanged between two non-homologous chromosomes. In non-reciprocal translocations, there is a one-way transfer of genetic material from one chromosome to another.

[0366] In approximately 40-50% of patients with multiple myeloma, translocations occur between the immunoglobulin heavy chain alleles at chromosome 14q32 and various partner chromosomes. Pawlyn, C. et al., Nat. Rev. Cancer 17:543-556 (2017). Translocations of oncogenes to this region can lead to increased expression of those genes and contribute to disease initiation, disease progression, and resistance to treatment. Several chromosomal translocations have been identified in patients with multiple myeloma, including t(4;14), t(14;16), t(14;20), t(8;14), t(11;14), and t(6;14), although t(11;14) and t(6;14) have been reported as neutral translocations. See Kalff and Spencer, Blood Cancer Journal 2:e89 (2012).

[0367] As used herein, the term "t(4;14) multiple myeloma" or "t(4;14) M" "M" refers to a subset of MM with a translocation between chromosomes 4 and 14. The t(4;14) translocation is associated with the upregulation of fibroblast growth factor receptor 3 (FGFR3) and WHSC1. More specifically, in t(4:14) MM, a chromosomal translocation occurs, and the 4p16.3 locus of WHSC1 is fused to the 14q32 locus. The result of t(4;14) in multiple myeloma is that the WHSC1 gene is placed under the transcriptional regulation of the immunoglobulin heavy chain (IgH) promoter / enhancer region. This leads to a large upregulation and overexpression of WHSC1 (Chesi et al., Blood 92:3025 - 3034 (1998)). The overexpression of WHSC1 results in an overall increase in the dimethylation of histone H3 at lysine 36 (H3K36me2). (Kuo et al., Mol. Cell 44:609 - 620 (2011)). WHSC1 is now recognized as a driving mechanism in t(4;14) pathogenesis. Similar to WHSC1, SETD2 utilizes H3K36me2 catalyzed by WHSC1 as its substrate to methylate H3K36 by adding a third methyl group (H3K36me3, trimethylation). SETD2 is the only known HMT that can catalyze H3K36 trimethylation.

[0368] (As shown in the following examples) Based on the sensitivity of t(4;14) multiple myeloma cell lines to SETD2 inhibition, the oncogenic function resulting from the increase in H3K36me2 driven by WHSC1 overexpression in t(4;14) MM may also require the ability of SETD2 to add additional methyl groups. In other words, SETD2 inhibition in t(4;14) multiple myeloma cells is determined by the overexpression of WHSC1. Thus, without being bound by theory, the abnormal H3K36me2 driven by WHSC1 overexpression in t(4;14) MM presents additional substrate for trimethylation, which is thought to result in oncogenic dependence on SETD2.

[0369] The term "non-t(4;14) multiple myeloma" or "non-t(4;14) MM" refers to a subset of MM in which chromosomal translocations exist other than t(4;14). For example, the translocations in "non-t(4;14) multiple myeloma" include, for example, t(14;16), t(14;20), t(8;14), t(11;14), and t(6;14).

[0370] The term "pharmaceutical formulation" refers to a preparation that is in a form that enables the biological activity of the active ingredient to be effective and that does not contain additional components that are unacceptable and toxic to the subject to whom the formulation is administered. Such a formulation may be sterile.

[0371] The term "therapeutically effective amount" refers to the amount of a therapeutic agent (e.g., a small molecule inhibitor of SETD2) that is effective to "treat" a disease or disorder in a subject or mammal. In the case of cancer, a therapeutically effective amount of the agent reduces the number of cancer cells, reduces the proliferation of cancer cells, reduces the tumor size, inhibits (i.e., delays to some extent and, in some embodiments, stops) the invasion of cancer cells into peripheral organs, inhibits (i.e., delays to some extent and, in some embodiments, stops) tumor metastasis, inhibits tumor growth to some extent, and / or reduces one or more of the symptoms associated with cancer. See the definition of "treating" herein. To the extent the agent can prevent growth and / or kill existing cancer cells, this can be cytostatic and / or cytotoxic.

[0372] Terms such as "treating", "treatment", "treat", "having a therapeutic effect", "alleviating", "alleviate", or "delaying progression" refer to both 1) a therapeutic means of curing, eradicating, delaying, reducing the symptoms of, and / or stopping the progression of a diagnosed pathological disorder, such as cancer; and 2) a preventive or prophylactic measure for preventing and / or delaying the occurrence of cancer. Thus, those in need of treatment include those who already have the disorder; those who are prone to having the disorder; and those in whom the disorder is to be prevented. In certain embodiments, the patient has the following When indicating one or more of the notations, the subject is "treated" without problems for cancer by the methods of the present disclosure: reduction of cachexia, increase in survival time, extension of the time to tumor progression, reduction of tumor mass, reduction of tumor volume and / or extension of the time to tumor metastasis, time to tumor recurrence or progressive disease, tumor response, complete response (CR), partial response (PR), stable disease, progression-free survival (PFS), overall survival (OS) (each measured according to the standards set by the National Cancer Institute and the US Food and Drug Administration (FDA) for the approval of new drugs). Johnson See et al, J. Clin. Oncol. 21:1404-1411 (2003). In some embodiments, "treatment effect" also includes reduction of toxicity or adverse side effects and / or improvement of tolerance, as defined above.

[0373] "Administering" refers to the physical introduction of a SETD2 inhibitor as described herein to a subject using any of a variety of methods and delivery systems known to those of skill in the art. Routes of administration include oral, mucosal, topical, intravenous, intramuscular, subcutaneous, intraperitoneal, spinal or other parenteral routes of administration, such as by injection or infusion. As used herein, the phrase "parenteral administration" means, but is not limited to, intravenous, intramuscular, intraarterial, intrathecal, intra-lymphatic, intralesional, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subepidermal, intraarticular, subcapsular, intrathecal, intraspinal, epidural and intrasternal injection and infusion and administration methods including in vivo electroporation. Administering can be carried out, for example, once, multiple times and / or over one or more extended periods of time.

[0374] In the present disclosure, all numbers indicating amounts, ratios, and physical properties of materials and / or uses are understood to be modified by the word "about" unless otherwise indicated. The term "about", when referring to a number or numerical range, means that the recited number or range is an approximation, e.g., within the range of experimental variability (or within the range of statistical experimental error), such that the number or numerical range can vary, for example, by 1% to 15% of the recited number or numerical range.

[0375] SETD2 inhibitor The present disclosure provides a method for treating cancer that overexpresses WHSC1 by inhibiting SETD2, a histone methyltransferase. The present disclosure relates to the unexpected discovery that inhibiting SETD2 can be used to treat cancer that overexpresses WHSC1, another histone methyltransferase, despite its known functional role as a tumor suppressor. In certain embodiments, the present disclosure relates to the use of a SETD2 inhibitor to treat t(4;14) multiple myeloma (MM). Treatment includes, inter alia, administering a therapeutically effective amount of an inhibitor of SETD2 to a subject in need thereof and treating the cancer.

[0376] As used herein, "inhibitor of SETD2" or "SETD2 inhibitor" refers to any molecule or compound that modulates, e.g., downregulates, the activity of human SETD2. For example, a SETD2 inhibitor can inhibit the histone methyltransferase activity of SETD2. For example, a SETD2 inhibitor can have a biochemical 50% inhibitory concentration (IC 50 ) of about 1 nM to about 10,000 nM, about 1 nM to about 1,000 nM, about 1 nM to about 500 nM, about 1 nM to about 100 nM, about 1 nM to about 50 nM, or about 1 nM to about 10 nM with respect to SETD2 in a purified enzyme assay.

[0377] In some embodiments, "downregulating (or inhibiting) the activity of human SETD2" refers to inhibiting the trimethylation of lysine 36 of histone 3.

[0378] In some embodiments, the SETD2 inhibitor used in the methods of the present disclosure selectively targets and downregulates one or more activities of SETD2 and is a small molecule (i.e., a molecule having a molecular weight of less than about 1,500 g / mol, e.g., about 100 g / mol to about 1,500 g / mol ) compound.

[0379] In some embodiments, the small molecule inhibitor of SETD2 is a "substituted indole compound" as defined in the "Definitions" section of the detailed description.

[0380] In some embodiments, the SETD2 inhibitor is a compound of Table 1 or a pharmaceutically acceptable salt thereof.

[0381] In some embodiments, the SETD2 inhibitor is not a substituted indole compound. In some embodiments, the SETD2 inhibitor is a sinefungin derivative. Sinefungin is an analog of S-adenosylmethionine (SAM). In some embodiments, the sinefungin analog is N-alkyl (methyl, ethyl, propyl, benzyl) sinefungin. In some embodiments, the N-alkyl sinefungin is N-propyl sinefungin (Pr-SNF) or N-benzyl sinefungin (Bn-SNF). The synthesis of sinefungin derivatives and their inhibition profiles against human methyltransferase SETD2 are described in Zheng, W. et al., J. Am. Chem. Soc. 134:18004-18014 (2012), which is incorporated herein by reference in its entirety.

[0382] In some embodiments, the SETD2 inhibitor is a compound from traditional Chinese medicine (TCM), such as coniserine, coniferyl ferulate, and 1-O-cis-feruloyl-3-O-trans-p-coumaroyl glycerol (FOC). See Chang, Y.L. et al., SAR and QSAR in Environmental Research 27:589-608 (2016), which is incorporated by reference in its entirety. Coniserine is isolated from the alcohol extract of Comiselinum vaginatum Thell. Coniferyl ferulate can be isolated from Angelica sinensis, Poria cocos (Schw.) Wolf, and Notopterygium forbesii. FOC is isolated from the rhizome of Sparganium stoloniferum. Id.

[0383] In some embodiments, the SETD2 inhibitor can be, for example, a polypeptide, DNA, or RNA. An inhibitor of SETD2 can include, consist essentially of, or consist of, for example, a molecule that specifically binds to the SETD2 polypeptide, a molecule that specifically binds to a ligand of the SETD2 polypeptide, an antiserum produced against the SETD2 polypeptide, a soluble SETD2 polypeptide, or an extracellular domain of the SETD2 polypeptide.

[0384] In some embodiments, the SETD2 inhibitor can also be, for example, an antibody that specifically binds to the SETD2 polypeptide or an antigen-binding fragment of an antibody that specifically binds to the SETD2 polypeptide. In some embodiments, the antibody is a polyclonal antibody, a monoclonal antibody, a mouse antibody, a human antibody, a humanized antibody, or a chimeric antibody. Monoclonal and polyclonal anti-SETD2 antibodies are commercially available, for example, from Thermo Fisher Scientific and Millipore Sigma. In some embodiments, the antigen-binding fragment is a Fab, Fab’, F(ab’)2, Fv, scFv, sdFv fragment, VH domain or VL domain.

[0385] In some embodiments, the SETD2 inhibitor hybridizes to a nucleotide sequence encoding a SETD2 polypeptide, such as RNAi, miRNA, siRNA, shRNA, antisense RNA, antisense DNA, decoy molecule, decoy DNA, double-stranded D NA, single-stranded DNA, complexed DNA, encapsulated DNA, viral DNA, plasmid DNA, naked RNA, encapsulated RNA, viral RNA, double-stranded RNA, a molecule capable of causing RNA interference or a combination thereof.

[0386] Downregulation of SETD2 can also be achieved by gene editing techniques. In some embodiments, the SETD2 inhibitor can be, for example, a clustered regularly interspaced short palindromic repeat (CRISPR)-Cas9 system. The CRISPR-Cas9 system has been described in the literature with applications in cancer biology and can include, for example, Cas9 nuclease and single guide RNA (sgRNA). See Sanchez-Rivera, F. J. and Jacks, T., “Applications of the CRISPR-Cas9 System in Cancer Biology,” Nat Rev Cancer 15:387-395 (2015); Chen, S. et al., “CRISPR-Cas9: from Genome Editing to Cancer Research,” Int. J. Biol. Sci. 12:1427-1436 (2016). For example, an sgRNA that targets the SETD2 gene together with Cas9 nuclease can be administered to a subject, resulting in the removal of a specific sequence of the SETD2 gene and resulting in downregulated SETD2 activity (i.e., inhibition of trimethylation of lysine 36 of histone H3). In particular, the SET, AWS, PS, SRI, or WW domain can be targeted with CRISPR-Cas9 for removal. Non-limiting examples of the CRISPR-Cas9 system include sgRNA target sequence number 1 having the sequence AGCACCAGTAACAGAGCCAG (SEQ ID NO: 7), sgRNA target sequence number 2 having the sequence GACTGTGAACGGACAACTGA (SEQ ID NO: 8), and Cas9 mRNA. In some embodiments, the sgRNA and Cas9 mRNA can be contained in separate vectors, respectively. In some embodiments, both sgRNAs can be contained in a first vector and Cas9 mRNA can be contained in a second vector. In some embodiments, the sgRNA and Cas9 mRNA can all be contained in a single vector. Those skilled in the art are aware of the reagents and methods for formulating the CRISPR-Cas9 system for administration to a subject in need thereof.

[0387] In addition to CRISPR-Cas9-based systems, other alternative CRISPR-based systems, such as the CRISPR / Cpf1 system of the bacterium Francisella novicida, can be used to inhibit SETD2. See Zetsche, B. et al., Cell 163:759-771 (2015); Fonfara, I et al., Nature 532:517-521 (2016).

[0388] In addition to CRISPR-based systems, other gene editing technologies, such as zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and engineered homing meganucleases, can also be used to inhibit SETD2. See, for example, Maeder, M.L. and Gersbach, C.A., “Genome-editing Technologies for Gene and Cell Therapy,” Mol. Ther. 24:430-446 (2016); Gaj, T. et al., “ZFN, TALEN, and CRISPR / Cas-based methods for genome engineering,” Trends Biotechnol 31:397-405 (2013); Perez-Pinera, P. et al., “Advances in targeted genome editing,” Curr Opin Chem Biol 16:268-277 (2012).

[0389] In one embodiment, the SETD2 inhibitor is a target nucleic acid encoding a SETD2 polypeptide An antisense nucleic acid or oligonucleotide that is wholly or partially complementary to (DNA or RNA) and can hybridize to a target nucleic acid (DNA or RNA) encoding a SETD2 polypeptide. For example, the antisense nucleic acid or oligonucleotide can be complementary to the 5' or 3' untranslated region, or can overlap with the translation initiation codon (5' untranslated and translated regions) of at least one nucleic acid molecule encoding SETD2. As a non-limiting example, the antisense oligonucleotide can be targeted to hybridize to the following regions: mRNA cap region, translation initiation site; translation termination site; transcription initiation site; transcription termination site; polyadenylation signal; 3' untranslated region; 5' untranslated region; 5' coding region, central coding region; 3' coding region: DNA replication initiation and elongation sites.

[0390] In some embodiments, an oligonucleotide that binds to a double-stranded nucleic acid (i.e., DNA:DNA or DNA:RNA) and forms a stable triple helix or triplex nucleic acid can be constructed. Such triplex oligonucleotides can inhibit the transcription and / or expression of the nucleic acid encoding SETD2. Triplex oligonucleotides are constructed using the base pairing rules of triple helix formation.

[0391] In a further embodiment, an oligonucleotide containing a moiety having a non-naturally occurring portion can be used in the method. Thus, the oligonucleotide can have an altered sugar moiety or sugar-sugar linkage. Exemplary among these are phosphorothioates and other sulfur-containing species known in the art. In a preferred embodiment, at least one of the phosphodiester bonds of the oligonucleotide is replaced with a structure that functions to enhance the ability of the composition to penetrate into the region of the cell where the RNA whose activity is to be modulated is located. Such substitutions preferably include phosphorothioate bonds, methylphosphonate bonds or short-chain alkyl or cycloalkyl structures.

[0392] In other embodiments, the phosphodiester linkage is replaced with a structure that is simultaneously substantially non-ionic and achiral or a structure that is chiral and enantiomerically specific. One of ordinary skill in the art can select other linkages for use in the disclosed methods, including the inverted terminal nucleotides.

[0393] Oligonucleotides can also include species that contain at least some modified base forms. Thus, purines and pyrimidines other than those normally found in nature can be used. Similarly, modifications on the furanosyl portion of the nucleotide subunit can also be affected. Examples of such modifications are 2'-O-alkyl- and 2'-halogen-substituted nucleotides. Some non-limiting examples of modifications at the 2'-position of the sugar moiety include OH, SH, SCH3, F, OCH3, OCN, O(CH2), NH2, and O(CH2)nCH3, where n is from 1 to about 10. Such oligonucleotides are functionally interchangeable with natural oligonucleotides or synthetic oligonucleotides (having one or more differences from the natural structure). All such analogs are included in this way as long as they function effectively to hybridize with at least one nucleic acid molecule encoding SETD2 and inhibit its function.

[0394] An "isolated" polypeptide, antibody, polynucleotide, vector, cell, or composition is a polypeptide, antibody, polynucleotide, vector, cell, or composition in a form not found in nature. Isolated polypeptides, antibodies, polynucleotides, vectors, cells, or compositions include those that are purified to the extent that they are no longer in their natural form. In some embodiments, an isolated antibody, polynucleotide, vector, cell, or composition is substantially pure. As used herein, "substantially pure" refers to a material that is at least 50% pure (i.e., free of contaminants), at least 90 % pure, at least 95% pure, at least 98% pure, or at least 99% pure.

[0395] "Polynucleotide" or "nucleic acid", as used interchangeably herein, refers to a polymer of nucleotides of any length, including both DNA and RNA. Nucleotides can be deoxyribonucleotides, ribonucleotides, modified nucleotides or bases and / or their analogs or any substrate that can be incorporated into a polymer by DNA or RNA polymerase. Polynucleotides can include modified nucleotides, such as methylated nucleotides and their analogs. When present, modifications to the nucleotide structure can be imparted either before or after assembly of the polymer. The nucleotide sequence can be interrupted by non-nucleotide components.

[0396] The terms "polypeptide", "peptide" and "protein" are used interchangeably herein and refer to a polymer of amino acids of any length. The polymer can be linear or branched, can include modified amino acids, and can be interrupted by non-amino acids. These terms also encompass amino acid polymers that are modified, either naturally or by intervention; for example, disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation or any other manipulation or modification, such as conjugation with a labeling component. Also included within this definition are polypeptides containing, for example, one or more analogs of an amino acid (including, for example, non-natural amino acids, etc.) and other modifications known in the art. Since the polypeptides of the present disclosure are antibody-based, in certain embodiments, it is understood that the polypeptide can occur as a single chain or an associated chain.

[0397] The terms "identical" or "identity" percent, in relation to two or more nucleic acids or polypeptides, refer to two or more sequences or subsequences that are the same or have a specified percentage of the same nucleotide or amino acid residues when compared and aligned for maximum correspondence (introducing gaps if necessary) without considering any conservative amino acid substitutions as part of sequence identity. The percent identity can be measured using sequence comparison software or algorithms or by visual inspection.

[0398] A variety of algorithms and software that can be used to obtain an alignment of amino acid or nucleotide sequences are known in the art. One such non-limiting example of a sequence alignment algorithm is described in Karlin et al., Proc. Natl. Acad. Sci. 87:2264-2268 (1990), modified in Karlin et al., Proc. Natl. Acad. Sci. 90:5873-5877 (1993), and is the algorithm incorporated into the NBLAST and XBLAST programs (Altschul et al., Nucleic Acids Res. 25:3389-3402 (1991)). In certain embodiments, gapped BLAST can be used as described in Altschul et al., Nucleic Acids Res. 25:3389-3402 (1997). BLAST-2, WU-BLAST-2 (Altschul et al., Methods in Enzymology 266:460-480 (1996)), ALIGN, ALIGN-2 (Genentech, South San Francisco, California) or Megalign (DNASTAR) are additional publicly available software programs that can be used to align sequences. In certain embodiments, the percent identity between two nucleotide sequences is determined using the GAP program in the GCG software (e.g., using the NWSgapdna.CMP matrix and gap weights of 40, 50, 60, 70 or 90 and length weights of 1, 2, 3, 4, 5 or 6). In certain alternative embodiments, the percent identity between two amino acid sequences can be determined using the GAP program (J. Mol. Biol. 48:444-453 (1970)) incorporated into the GCG software package (e.g., using the Blossum62 matrix or the PAM250 matrix, and gap weights of 16, 14, 12, 10, 8, 6 or 4, and length weights of 1, 2, 3, 4, 5).

[0399] Alternatively, in certain embodiments, the percent identity between nucleotide or amino acid sequences is determined using the algorithm of Myers and Miller (CABIOS, 4:11-17 (1989)). For example, the percent identity can be determined using the ALIGN program (version 2.0) and PAM120 with a residue table, a gap length penalty of 12, and a gap penalty of 4. Appropriate parameters for maximum alignment by a particular alignment software can be determined by one of ordinary skill in the art. In certain embodiments, the default parameters of the alignment software are used. In certain embodiments, the percent identity "X" between a first amino acid sequence and a second amino acid sequence is calculated as 100×(Y / Z), where Y is the number of amino acid residues scored as exact matches in the alignment of the first and second sequences (aligned by visual inspection or by a particular sequence alignment program), and Z is the total number of residues in the second sequence. If the length of the first sequence is longer than the second sequence, the percent identity between the first sequence and the second sequence is greater than the percent identity between the second sequence and the first sequence.

[0400] As a non-limiting example, whether any particular polynucleotide has a particular percent sequence identity to a reference sequence (e.g., at least 80% identical, at least 85% identical, at least 90% identical, and in some embodiments at least 95%, 96%, 97%, 98% or 99% identical) can, in certain embodiments, be determined using the Bestfit program (Wisconsin Sequence Analysis Package, Version 8 for Unix®, Genetics Computer Group, University Research Park, 575 Science Drive, Madison, WI 53711). Bestfit uses the local homology algorithm of Smith and Waterman, Advances in Applied Mathematics 2:482-489 (1981) to find the best segment of homology between two sequences. When using Bestfit or any other sequence alignment program to determine whether a particular sequence is, for example, 95% identical to a reference sequence according to the present disclosure, the parameters are set such that the percent identity is calculated over the full length of the reference nucleotide sequence and gaps in homology up to 5% of the total number of nucleotides in the reference sequence are allowed.

[0401] In some embodiments, two nucleic acids or polypeptides described herein are substantially identical, which means that when they are compared and aligned for maximum correspondence, using, in some embodiments, a sequence comparison algorithm or by visual inspection, they have at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, and in some embodiments at least 95%, 96%, 97%, 98%, 99% nucleotide or amino acid residue identity. In certain embodiments, the identity exists over a region of the sequence that is at least about 10, about 20, about 40 - 60 residues or any integer value in between, or a region longer than 60 - 80 residues, at least about 90 - 100 residues, or the sequences are substantially identical over the full length of the sequences being compared, e.g., the coding region of a nucleotide sequence.

[0402] Instead, expression vectors derived from retroviruses, adenoviruses, herpes or vaccinia viruses or plasmids of various bacteria can be used for the delivery of nucleotide sequences to target organs, tissues or cell populations. Using methods well known to those skilled in the art, recombinant vectors can be constructed that express nucleic acid sequences complementary to the nucleic acid sequences encoding the human SETD2 polypeptide. RNA interference (RNAi) is a post-transcriptional gene expression silencing process induced by miRNA or dsRNA (short interfering RNA; siRNA) and has been used to modulate gene expression. RNAi can be used to inhibit SETD2 in the therapeutic methods described herein. Generally, RNAi is performed by contacting cells with double-stranded siRNA or short hairpin RNA (shRNA). However, manipulation of extracellular RNA is time-consuming due to the sensitivity of RNA to degradation. Thus, deoxyribonucleic acid (DNA) compositions encoding short interfering RNA (siRNA) molecules or intermediate siRNA molecules (e.g., shRNA) containing one strand of siRNA are also encompassed herein. Accordingly, the present application provides an isolated DNA molecule that, when a component of siRNA, contains an expressible template nucleotide sequence of at least about 16 nucleotides encoding an intermediate siRNA that mediates RNA interference (RNAi) of a target RNA. The present application further relates to the use of RNA interference (RNAi) to modulate the expression of nucleic acid molecules encoding SETD2 in target cells. Therapeutic applications are not limited to a particular mechanism of action, while RNAi involves the degradation of messenger RNA (e.g., mRNA of the SETD2 gene) by the RNA-induced silencing complex (RISC) and can prevent the translation of the transcribed target mRNA. Alternatively, this can also involve the methylation of genomic DNA, which interrupts the transcription of the target gene. The suppression of gene expression brought about by RNAi can be transient or more stable and rather persistent.

[0403] ​

[0404] Short interfering RNA (siRNA) can also be used in this method as a SETD2 inhibitor. siRNA refers to any nucleic acid molecule capable of mediating RNA interference (RNAi) or gene expression inhibition. For example, siRNA can be a double-stranded RNA molecule about 10 to about 30 nucleotides in length, and its name is derived from their ability to specifically interfere with protein expression (e.g., SETD2 protein expression). In one embodiment, the siRNA of the present disclosure is 12 to 28 nucleotides in length, more preferably 15 to 25 nucleotides in length, even more preferably 19 to 23 nucleotides in length, and most preferably 21 to 23 nucleotides in length. Thus, preferred siRNAs are 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28 nucleotides in length. As used herein, siRNA molecules need not be limited to those that contain only RNA, but further include chemically modified nucleotides and non-nucleotides. siRNA can be designed to reduce the expression of SETD2 in target cells by RNA interference. siRNA can include a sense region and an antisense region, where the antisense region includes a sequence complementary to the mRNA sequence for the nucleic acid molecule encoding SETD2, and the sense region includes a sequence complementary to the antisense sequence of the gene's mRNA. siRNA molecules can be assembled from two nucleic acid fragments, one fragment including the sense region of the siRNA molecule and the second fragment including the antisense region. The sense region and the antisense region can be connected via a linker molecule or covalently. The linker molecule can be a polynucleotide linker or a non-polynucleotide linker.

[0405] In one embodiment, the SETD2 inhibitor is a human SETD2 siRNA selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO: 4. UAAAGGAGGUAUAUCGAAU (SEQ ID NO: 1) GAGAGGUACUCGAUCAUAA (SEQ ID NO: 2) GCUCAGAGUUAACGUUUGA (SEQ ID NO: 3) CCAAAGAUUCAGACAUAUA (SEQ ID NO: 4)

[0406] A ribozyme (also from ribonucleic acid enzymes called RNA enzymes or catalytic RNAs) is an RNA molecule that catalyzes chemical reactions. Some ribozymes can play important roles as therapeutic agents, as enzymes that target defined RNA sequences, as biosensors, and for uses in functional genomics and gene discovery. Ribozymes can be genetically engineered to specifically cleave transcripts of genes from nucleic acid molecules encoding SETD2, the expression of which is desirably downregulated.

[0407] Delivery of a gene or genetic material to a cell (encoding a sequence that partially or wholly reduces the expression of SETD2) is the first step in the gene therapy treatment of any disorder. A number of delivery methods are well known to those skilled in the art. Preferably, the nucleic acid is administered for in vivo or ex vivo gene therapy use. Non-viral vector delivery systems include DNA plasmids, naked nucleic acids, and delivery vehicles such as nucleic acids complexed with liposomes. Viral vector delivery systems include DNA and RNA viruses that have episomal genomes or integrated genomes after delivery to cells.

[0408] The use of virus-based RNAs or DNAs for nucleic acid delivery utilizes highly evolved processes for targeting viruses to specific cells in the body and transporting the viral payload to the cell nucleus. Viral vectors can be administered directly to patients (in vivo), or they can be used to treat cells and modified cells in vitro and then administered to patients (ex vivo). Normal virus-based systems for nucleic acid delivery can include vectors of retroviruses, lentiviruses, adenoviruses, adeno-associated viruses, and herpes simplex viruses for gene transfer. Viral vectors are currently the most efficient and versatile method of gene transfer in target cells and tissues. Integration into the host genome is possible with retroviral, lentiviral, and adeno-associated virus gene transfer methods and often results in long-term expression of the inserted transgene. Furthermore, high transduction efficiencies have been observed in many different cell types and target tissues.

[0409] In applications where transient expression of nucleic acids is preferred, adenovirus-based systems are typically used. Adenovirus-based vectors can enable very high transduction efficiencies in many cell types and do not require cell division. High titers and expression levels have been obtained with such vectors. This vector can be produced in large quantities in a relatively simple system. For example, adeno-associated virus ("AAV") vectors are also used to transduce cells with target nucleic acids in in vitro production of nucleic acids and peptides and for gene therapy procedures in vivo and ex vivo.

[0410] Recombinant adeno-associated virus vectors (rAAV) are promising alternative gene delivery systems based on defective and non-pathogenic parvovirus adeno-associated virus type 2. All vectors are derived from plasmids that retain only the 145 bp inverted terminal repeats of AAV adjacent to the transgene expression cassette. Efficient gene transfer and stable transgene delivery by integration into the genome of transduced cells are important features of this vector system.

[0411] Replication-deficient recombinant adenoviral vectors (Ad) are primarily used in transient expression gene therapy because they can be produced at high titers and readily infect several different cell types. Most adenoviral vectors are engineered such that a transgene replaces the Ad E1a, E1b, and E3 genes. The replication-deficient vectors are subsequently propagated into human 293 cells, which supply the missing gene functions in trans. Ad vectors are also found in non-dividing differentiated cells, such as liver, kidney, and muscle tissue. Ad vectors can transduce multiple types of tissues in vivo, including the endothelial cell line, ... and the adenocarcinoma of the ovarian tumor. Conventional Ad vectors have a large carrying capacity.

[0412] In many gene therapy applications, it is desirable for gene therapy vectors to be delivered with a high degree of specificity to a particular tissue type, such as glial cells.Viral vectors are typically modified to have specificity for a given cell type by expressing a ligand as a fusion protein with a viral coat protein on the outer surface of the virus.The ligand is selected to have affinity for a receptor known to be present on the cell type of interest.

[0413] Gene therapy vectors can be delivered in vivo by administration to an individual subject, typically by systemic administration (e.g., intravenous, intratumoral, intraperitoneal, intramuscular, subcutaneous or intracranial injection) or local application. Alternatively, vectors can be delivered ex vivo to cells, such as cells explanted from an individual patient (e.g., lymphocytes, bone marrow aspirates and tissue biopsies) or universal donor hematopoietic stem cells, followed by reimplantation of the cells into the subject, usually after selection for cells that have incorporated the vector.

[0414] In one embodiment, the stem cells are used in ex vivo procedures for cell transfection and gene therapy. The advantages of using stem cells are that they can differentiate in vitro into other cell types or can be introduced into a mammal (e.g., the cell donor) that can engraft in a suitable location (e.g., in the bone marrow). Methods are known for differentiating CD34+ cells in vitro into clinically important immune cell types using cytokines such as GM-CSF, IFN-γ, and TNF-α.

[0415] The stem cells are isolated for transduction and differentiation using known methods. For example, the stem cells can be isolated from bone marrow cells by panning the bone marrow cells with antibodies that bind unwanted cells such as CD4+ and CD8+ (T cells), CD45+ (pan B cells), GR-1 (granulocytes), and lad (differentiated antigen-presenting cells).

[0416] Administration of SETD2 inhibitor Suitable methods for administering the SETD2 inhibitors described herein are based on the nature of the inhibitor (i.e., small molecule, DNA, RNA, protein, antibody) and are well known to those of skill in the art. The SETD2 inhibitors described herein can be administered orally, parenterally, subcutaneously, intravenously, intramuscularly, intraperitoneally, transdermally, intrathecally, intranasally, transmucosally, intratumorally, rectally, intravaginally or orally, or by inhalation. For example, intravenous injection such as infusion, intramuscular injection, intraperitoneal injection, subcutaneous injection, suppository, enema, oral enteric-coated tablets, etc. can be selected, and the administration method can be selected as needed depending on the age and condition of the patient. The SETD2 inhibitors described herein can be administered systemically (e.g., by intravenous injection) or locally (e.g., intrathecally, intratumorally or into lymph nodes).

[0417] The appropriate dosage of the SETD2 inhibitor of the present disclosure is determined by the discretion of the physician performing the treatment, depending on several factors such as the type of cancer being treated, the severity, course, and stage of the cancer, the responsiveness of the cancer, previous treatments, the patient's medical history, and the like. In some embodiments, the dosage of the SETD2 inhibitor is from about 0.01 mg / kg to about 1000 mg / kg body weight. In some embodiments, the dosage of the SETD2 inhibitor is from about 1 mg / kg to about 500 mg / kg body weight. In some embodiments, the dosage of the SETD2 inhibitor is from about 0.1 mg / day to about 50 g / day; from about 0.1 mg / day to about 25 g / day; from about 0.1 mg / day to about 10 g / day; from about 0.1 mg / day to about 3 g / day; or from about 0.1 mg / day to about 1 g / day. Alternatively, the dosage of the SETD2 inhibitor ranges from 1 to 2000 mg per patient, preferably from 100 to 1000 mg.

[0418] In some embodiments, the SETD2 inhibitor can be administered over a series of treatments that last for one or several days to several months, or until a cure is effected or a reduction in the disease state is achieved (e.g., a reduction in tumor size).

[0419] In some embodiments, the SETD2 inhibitor described herein can be administered one or more times per day, per week, per month, or per year. In certain embodiments, the SETD2 inhibitor is administered once a day, once every two days, once every three days, or once every four days. In certain embodiments, the SETD2 inhibitor is administered twice a day, three times a day, or four times a day. In certain embodiments, the SETD2 inhibitor is administered once a week. In certain embodiments, the SETD2 inhibitor is administered once every two weeks. In certain embodiments, the SETD2 inhibitor is administered once every three weeks. In some embodiments, the SETD2 inhibitor is administered once a month.

[0420] In some embodiments, the SETD2 inhibitors described herein can be administered at an initial higher "loading" dose, followed by one or more lower doses. In some embodiments, the frequency of administration can also vary. In some embodiments, the dosing regimen can include administering an initial dose, followed by additional doses (or "maintenance" doses) two times a day, once a day, once every two days, once every three days, or once a week. For example, the dosing regimen can include an initial loading dose, followed by a daily maintenance dose, e.g., one-half of the initial dose. Or the dosing regimen can include an initial loading dose, followed by a maintenance dose, e.g., one-half of the initial dose, administered every other day. Or the dosing regimen can include three initial doses over three days, followed by a maintenance dose, e.g., the same amount, administered every other day.

[0421] One of ordinary skill in the art will recognize that the dosage, route of administration, and frequency of administration administered will vary depending on the circumstances of the particular subject being treated and taking into account factors such as the age, sex, health, and weight of the recipient, the condition or disorder being treated, the severity of the disorder, the type of concurrent treatment (if any), and the nature of the desired effect.

[0422] One of ordinary skill in the art will also recognize that the dosage and / or frequency of administration of the SETD2 inhibitor can vary (decrease or increase) during the course of treatment or between different phases of treatment (i.e., treatment or maintenance) based on the patient's clinical response, side effects, etc.

[0423] Pharmaceutical composition The SETD2 inhibitors used in the methods described herein can be formulated into pharmaceutical compositions suitable for administration to a subject in need thereof (i.e., a subject suffering from a cancer that overexpresses WHSC1). As used herein, "pharmaceutical composition" refers to a preparation of one or more agents (e.g., SETD2 inhibitors) as described herein, or a physiologically acceptable salt or prodrug thereof, with other chemical components including, but not limited to, pharmaceutically acceptable carriers, additives, lubricants, buffers, antibacterial agents, fillers (e.g., mannitol), antioxidants (e.g., ascorbic acid or sodium bisulfite), etc. The purpose of the pharmaceutical composition is to facilitate the administration of the agent to the subject.

[0424] Terms such as "pharmaceutically acceptable carrier", "additive", and "adjuvant" and "physiologically acceptable vehicle" are understood to refer to an acceptable carrier or adjuvant that can be administered to a patient together with the SETD2 inhibitors described herein and that does not destroy or inhibit their pharmacological activity. Pharmaceutically acceptable additives, as used herein, include, but are not limited to, any solvent, dispersion medium, or other liquid vehicle, dispersing or suspending aid, excipient, granulating and / or dispersing agent, surfactant, isotonic agent, thickening or emulsifying agent, preservative, binding agent, lubricant or oil, colorant, sweetening or flavoring agent, stabilizer, antioxidant, antimicrobial or antifungal agent, weight osmolarity regulator, pH adjuster, buffer, chelating agent, cryoprotectant, and / or filler. Various additives for formulating pharmaceutical compositions and techniques for preparing compositions are well known in the art (see Remington: The Science and Practice of Pharmacy, 21 st Edition, A.R. Gennaro (Lippincott, Williams & Wilkins, Baltimore, MD, 2006, which is incorporated herein by reference in its entirety).

[0425] Exemplary excipients include, but are not limited to, calcium carbonate or sodium carbonate, calcium phosphate, calcium hydrogen phosphate, sodium phosphate, lactose, sucrose, cellulose, microcrystalline cellulose, kaolin, mannitol, sorbitol, etc., and / or combinations thereof.

[0426] Exemplary granulating agents and / or dispersing agents include, but are not limited to, starch, pregelatinized starch or microcrystalline starch, alginic acid, guar gum, agar, poly(vinyl-pyrrolidone), (povidone), cross-linked poly(vinyl-pyrrolidone) (crospovidone), cellulose, methylcellulose, carboxymethylcellulose, cross-linked sodium carboxymethylcellulose (croscarmellose), magnesium aluminum silicate (VEEGUM®), sodium lauryl sulfate, etc., and / or combinations thereof.

[0427] Exemplary surfactants and / or emulsifiers include, but are not limited to, natural emulsifiers (e.g., acacia, agar, alginic acid, sodium alginate, tragacanth, condurango, cholesterol, xanthan, pectin, gelatin, egg yolk, casein, lanolin, cholesterol, wax and lecithin), sorbitan fatty acid esters (e.g., polyoxyethylene sorbitan monooleate [TWEEN®80], sorbitan monopalmitate [SPAN®40], glyceryl monooleate, polyoxyethylene ester, polyethylene glycol fatty acid ester (e.g., CREMOPHOR®), polyoxyethylene ether (e.g., polyoxyethylene lauryl ether [BRIJ®30]), PLUORINC®F68, poloxamer®188, etc.) and / or combinations thereof.

[0428] Exemplary binders include, but are not limited to, starch, gelatin, sugars (e.g., sucrose, glucose, dextrose, dextrin, molasses, lactose, lactitol, mannitol), amino acids (e.g., glycine), natural and synthetic gums (e.g., acacia, sodium alginate), ethyl cellulose, hydroxyethyl cellulose, hydroxypropyl methyl cellulose, etc., as well as combinations thereof.

[0429] Exemplary antioxidants include, but are not limited to, alpha tocopherol, ascorbic acid, ascorbyl palmitate, benzyl alcohol, butylated hydroxyanisole, m-cresol, methionine, butylated hydroxytoluene, monothioglycerol, sodium or potassium metabisulfite, propionic acid, propyl gallate, sodium ascorbate, etc., and combinations thereof.

[0430] Exemplary chelating agents include, but are not limited to, ethylenediaminetetraacetic acid (EDTA), citric acid monohydrate, disodium edetate, fumaric acid, malic acid, phosphoric acid, sodium edetate, tartaric acid, trisodium edetate, etc., and combinations thereof.

[0431] Exemplary antimicrobial or antifungal agents include, but are not limited to, benzalkonium chloride, benzethonium chloride, methyl paraben, ethyl paraben, propyl paraben, butyl paraben, benzoic acid, hydroxybenzoic acid, potassium or sodium benzoate, potassium or sodium sorbate, sodium propionate, sorbic acid, etc., and combinations thereof.

[0432] Exemplary preservatives include, but are not limited to, vitamin A, vitamin C, vitamin E, beta carotene, citric acid, ascorbic acid, butylated hydroxyanisole, ethylenediamine, sodium lauryl sulfate (SLS), sodium laureth sulfate (SLES), etc., and combinations thereof.

[0433] Exemplary buffers for controlling pH can include, but are not limited to, sodium phosphate, sodium citrate, sodium succinate, histidine (or histidine-HCl), sodium malate, sodium carbonate, etc., and / or combinations thereof.

[0434] Exemplary lubricants can include, but are not limited to, magnesium stearate, calcium stearate, stearic acid, silica, talc, malt, hydrogenated vegetable oil, polyethylene glycol, sodium benzoate, sodium lauryl sulfate or magnesium lauryl sulfate, etc., and combinations thereof.

[0435] The pharmaceutical compositions or formulations described herein may contain a cryoprotectant that stabilizes the polynucleotides described herein during freezing. Exemplary cryoprotectants can include, but are not limited to, mannitol, sucrose, trehalose, lactose, glycerol, dextrose, etc., and combinations thereof.

[0436] Administration of the SETD2 inhibitors of the present disclosure is by any of the routes commonly used to introduce molecules into ultimate contact with tumor cells. The pharmaceutical compositions containing the SETD2 inhibitors can be administered by any suitable method, such as parenterally, intracerebroventricularly, orally, topically, rectally, vaginally, nasally, buccally intraorally or via an implanted reservoir. As used herein, the term "parenteral" includes subcutaneous, intravenous, intramuscular, intraarticular, intrasynovial, intrasternal, intrathecal, intrahepatic, intralesional and intracranial injection or infusion techniques.

[0437] Parenteral formulations can be a single bolus dose, an infusion or a loading bolus dose followed by a maintenance dose. These compositions can be administered at specific fixed intervals or variable intervals, such as twice a week or once a week. In some embodiments, the SETD2 inhibitor is administered intravenously.

[0438] In certain embodiments, the pharmaceutical composition can be administered orally in an acceptable dosage form, such as, for example, capsules, tablets, aqueous suspensions or solutions. In certain embodiments, the pharmaceutical composition can also be administered by nasal aerosol or inhalation. Such compositions can be prepared as solutions in saline using benzyl alcohol or other suitable preservatives, absorption promoters to enhance bioavailability and / or other conventional solubilizing or dispersing agents.

[0439] One of ordinary skill in the art will understand that the specific dosage and treatment regimen for any particular patient will depend on a variety of factors, including the specific therapeutic agent being used, the age, weight, general health, sex and diet of the patient, the time of administration, the excretion rate, drug combinations, and the severity of the particular disease being treated. The determination of such factors by a treating healthcare provider is within the scope of ordinary skill in the art. The amount will also depend on the individual patient being treated, the route of administration, the type of formulation, the characteristics of the compound being used, the severity of the disease and the desired effect. The amount to be used can be determined by pharmacological and pharmacokinetic principles well known in the art. can be.

[0440] Method for treating cancer overexpressing WHSC1 In one aspect, the present disclosure provides a method for treating cancer overexpressing WHSC1 in a subject by administering to the subject in need thereof a therapeutically effective amount of a SETD2 inhibitor, such as any of those described herein.

[0441] In some embodiments, the SETD2 inhibitor is a substituted indole compound as defined in the "Definitions" section of the detailed description.

[0442] In some embodiments, the SETD2 inhibitor is a compound of Table 1 or a pharmaceutically acceptable salt thereof.

[0443] In some embodiments, the SETD2 inhibitor is not a substituted indole compound. For example, the SETD2 inhibitor can be a sinefungin derivative selected from the group consisting of N-propylsinefungin and N-benzylsinefungin or any other SETD2 described herein.

[0444] In some embodiments, the overexpression of WHSC1 by the cancer is determined prior to administration of the SETD2 inhibitor. One of ordinary skill in the art can determine the expression and overexpression of WHSC1 using any of a number of methods known and generally available in the art. Examples include, but are not limited to, PCR (polymerase chain reaction) or RT-PCR, flow cytometry, Northern blot, Western blot, ELISA (enzyme-linked immunosorbent assay), RIA (radioimmunoassay), gene chip analysis of RNA expression, immunohistochemistry or immunofluorescence. See, for example, Slagle et al., Cancer 83:1401 (1998). Certain embodiments include methods by which WHSC1 RNA expression (transcription) is determined. Other embodiments of the disclosure include methods by which WHSC1 protein expression in a biological sample (i.e., tumor tissue) is determined. See, for example, Harlow et al., Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, (1988); Ausubel et al., Current Protocols in Molecular Biology, John See Wiley & Sons, New York 3rd Edition, (1995); Kamel and Al-Amodi, Genomics Proteomics Bioinformatics 15:220-235 (2017). For Northern blot or RT-PCR analysis, RNA is isolated from tumor tissue samples using ribonuclease-free techniques. WHSC1 protein expression in tumor samples can be measured using standard immunohistochemistry and immunostaining techniques. See, for example, Hudlebusch, H.R. et al., Clinical Cancer Research 17:2919-2933 (2011).

[0445] For example, if the mean or median expression level of WHSC1 is calculated to be statistically significant, the expression levels measured between different phenotypic situations can be considered different. General tests for statistical significance include, among others, t-tests, ANOVA, Kruskal-Wallis, Wilcoxon, Mann-Whitney, microarray significance analysis, odds ratios, and the like. Biomarkers (e.g., WHSC1) alone or in combination provide a measure of the relative likelihood that a subject belongs to one or another phenotypic situation. Thus, they are useful, among other things, as markers for a disease and as indicators of the likelihood that a particular therapeutic treatment regimen will result in a beneficial patient outcome.

[0446] In one embodiment of the present disclosure, a biological sample is obtained from a patient and the biological sample is assayed for determination of WHSC1 expression or mutation status.

[0447] In another embodiment of the present disclosure, Northern blot analysis of WHSC1 transcription in tumor cell samples is performed. Northern analysis is a standard method for the detection and / or quantification of mRNA levels in a sample. First, RNA is isolated from the sample to be assayed using Northern blot analysis. In the analysis, the RNA sample is first separated by size by electrophoresis in an agarose gel under denaturing conditions. The RNA is then transferred to a membrane, cross-linked, and hybridized with a labeled probe. Typically, Northern hybridization involves the in vitro polymerization of radiolabeled or non-isotopically labeled DNA or the production of oligonucleotides as hybridization probes. Typically, the membrane holding the RNA sample is prehybridized or blocked prior to probe hybridization to prevent the probe from coating the membrane and to reduce non-specific background signals. After hybridization, typically, the unhybridized probe is removed by washing with a buffer that is changed several times. The stringency of the washing and hybridization conditions can be designed, selected, and implemented by those skilled in the art. Detection is achieved using a probe labeled to a detectable extent and an appropriate detection method. Radiolabeled and non-radiolabeled probes and their use are well known in the art. The presence and / or relative level of WHSC1 expression can be quantified, for example, using densitometry.

[0448] In another embodiment, the WHSC1 expression and / or mutation status is determined using RT-PCR. RT-PCR enables the detection of the progress of PCR amplification of a target gene in real time. The design of primers and probes required to detect the expression and / or mutation status of WHSC1 is within the skill of those in the art. Using RT-PCR, the level of RNA encoding WHSC1 in a tumor tissue sample can be determined. In one embodiment of the present disclosure, RNA from a biological sample is isolated under ribonuclease-free conditions and then converted to DNA by treatment with reverse transcriptase. Methods for reverse transcriptase conversion of RNA to DNA are well known in the art. Descriptions of PCR are provided in the following references: Mullis et al., Cold Spring Harbor Symp. Quant. Biol. 51:263 (1986); European Patent No. 50,424; European Patent No. 84,796; European Patent No. 258,017; European Patent No. 237,362; European Patent No. 201,184; U.S. Patent No. 4,683,202; No. 4,582,788; No. 4,683,194.

[0449] RT-PCR probes are determined by the 5'-3' nuclease activity of DNA polymerase used for PCR, which hydrolyzes oligonucleotides hybridized to the target unit replication sequence (WHSC1 gene). RT-PCR probes are oligonucleotides having a fluorescent reporter dye attached to the 5' end and a quencher moiety (or vice versa) coupled to the 3' end. These probes are designed to hybridize to the internal region of the PCR product. In the unhybridized state, the proximity of the fluorescent and quenching molecules prevents detection of the fluorescent signal from the probe. During PCR amplification, when the polymerase replicates the template to which the RT-PCR probe binds, the 5'-3' nuclease activity of the polymerase cleaves the probe. This decouples the fluorescent and quenching dyes and FRET no longer occurs. Thus, fluorescence increases in each cycle in a manner proportional to the amount of probe cleavage. The fluorescent signal emitted from the reaction can be measured or tracked over time using commercially available equipment and conventional techniques.

[0450] In another embodiment of the present disclosure, the expression of the protein encoded by WHSC1 is detected by Western blot analysis. Western blot (also known as immunoblot) is a method for protein detection in a given sample of tissue homogenate or extract. This uses gel electrophoresis to separate denatured proteins by mass. The proteins are then transferred from the gel onto a membrane (e.g., nitrocellulose or polyvinylidene fluoride (PVDF)), which are detected using a primary antibody that specifically binds to the protein. The bound antibody can then be detected by a secondary antibody conjugated to a detectable label (e.g., biotin, horseradish peroxidase or alkaline phosphatase). Detection of the secondary label signal indicates the presence of the protein.

[0451] In another embodiment of the present disclosure, the expression of the protein encoded by WHSC1 is detected by an enzyme-linked immunosorbent assay (ELISA). In one embodiment of the present disclosure, "sandwich ELISA" involves coating a plate with a capture antibody; adding a sample (where any antigen present binds to the capture antibody); adding a detection antibody that also binds the antigen; adding an enzyme-linked secondary antibody that binds the detection antibody; and adding a substrate that is converted by the enzyme on the secondary antibody into a detectable form. Detection of the signal from the secondary antibody indicates the presence of the WHSC1 antigen protein.

[0452] Multiple types of cancer that overexpress WHSC1 can be treated by the disclosed methods and pharmaceutical compositions. In some embodiments, the cancer is adrenocortical carcinoma, alveolar cell carcinoma, acoustic neuroma, acral lentiginous melanoma, acrospiroma, adenocarcinoma, adenoid cystic carcinoma, adenoma, adenomatoid odontogenic tumor, adenosquamous carcinoma, adipose tissue neoplasm, adrenocortical carcinoma, AIDS-related lymphoma, alveolar rhabdomyosarcoma, alveolar soft part sarcoma (honeycomb soft part sarcoma), ameloblastic fibroma, anaplastic large cell lymphoma, anaplastic thyroid carcinoma, angioleiomyolipoma, angiosarcoma, astrocytoma, atypical teratoid / rhabdoid tumor, basal cell carcinoma, biliary tract cancer, bladder cancer, blastoma, bone cancer, breast cancer, brain cancer, carcinoma, carcinoma in situ, carcinosarcoma, cartilage tissue tumor, cementoma, chondrosarcoma, chordoma, choriocarcinoma, choroid plexus papilloma, clear cell sarcoma of the kidney, craniopharyngioma, cutaneous T-cell lymphoma, cervical cancer, colorectal cancer, Degos disease, desmoplastic small round cell tumor, embryonal dysplastic neuroepithelial tumor, embryonal carcinoma, fetal carcinoma, endocrine gland neoplasm, endodermal sinus tumor, esophageal cancer, fibrosarcoma, follicular lymphoma, follicular thyroid carcinoma, ganglioneuroma, gastrointestinal cancer, germ cell tumor, gestational choriocarcinoma, giant cell fibroblastoma, giant cell tumor of bone, glioma, glioblastoma, gliosarcoma, gliomatosis cerebri, glucagonoma, gonadoblastoma, granulosa cell tumor, male germ cell tumor, gallbladder cancer, gastric cancer, hemangioblastoma, head and neck cancer, hemangiopericytoma, hepatoblastoma, hepatocellular carcinoma, hepatosplenic T-cell lymphoma, infiltrating lobular carcinoma, intestinal cancer, kidney cancer, laryngeal cancer, malignant melanoma, lethal midline carcinoma, leukemia, Leydig cell tumor, liposarcoma, lung cancer, lymphangioma, lymphangiosarcoma, lymphoepithelioma, liver cancer, small cell lung cancer, non-small cell lung cancer, malignant fibrous histiocytoma, malignant peripheral nerve sheath tumor, malignant triton tumor, mediastinal germ cell tumor, medullary carcinoma of the breast, medullary thyroid carcinoma, medulloblastoma, melanoma, meningioma, Merkel cell carcinoma, mesothelioma, metastatic urothelial carcinoma, müllerian duct mixed tumor, mucinous tumor, muscle tissue neoplasm, myxoid polypoid tumor, myxoid liposarcoma, myxoma, myxosarcoma, nasopharyngeal cancer, neurilemmoma, neuroblastoma, neurofibroma, neuroma, nodular melanoma, ocular cancer, oligodendroglioma, oligodendrosarcoma, oncocytoma, optic nerve sheath meningioma, optic nerve tumor, oral cancer, osteosarcoma, ovarian cancer, papillary thyroid carcinoma, paraganglioma, pineoblastoma, pineocytoma, pituitary cell tumor, pituitary adenoma, pituitary tumor, plasmacytoma, polyembryoma, primary central nervous system lymphoma, primary effusion lymphoma, primary peritoneal carcinoma, prostate cancer, pancreatic cancer, pharyngeal cancer, peritoneal pseudomyxoma.Renal cell carcinoma, renal medullary carcinoma, retinoblastoma, rhabdomyoma, rhabdomyosarcoma, rectal cancer, sarcoma, schwannomatosis, seminoma, Sertoli cell tumor, sex cord-gonadal stromal tumor, skin cancer, small cell carcinoma, soft tissue sarcoma, somatostatinoma, spinal cord tumor, squamous cell carcinoma, synovial sarcoma, small intestine cancer, squamous cell carcinoma, gastric cancer, testicular cancer, thyroid cancer, transitional cell carcinoma, laryngeal cancer, urachal carcinoma, urogenital cancer, urothelial cancer, choroidal melanoma, uterine cancer, verrucous carcinoma, visual pathway glioma, vulvar cancer, vaginal cancer, Warthin tumor, Wilms tumor, squamous cell carcinoma of the head and neck, adenocarcinoma, squamous cell carcinoma of the esophagus, gastric gland, It is selected from the group consisting of cancer, adenocarcinoma of the colon, hepatocellular carcinoma, cholangiocarcinoma of the biliary tract, adenocarcinoma of the gallbladder, adenocarcinoma of the pancreas, intraductal adenocarcinoma of the breast, adenocarcinoma of the breast, adenocarcinoma of the lung, squamous cell carcinoma of the lung, transitional cell carcinoma of the bladder, squamous cell carcinoma of the bladder, squamous cell carcinoma of the cervix, adenocarcinoma of the cervix, endometrial cancer, squamous cell carcinoma of the penis and squamous cell carcinoma of the skin.

[0453] In some embodiments, the cancer is esophageal cancer, kidney cancer, gastric cancer, hepatocellular carcinoma, glioblastoma, central nervous system (CNS) cancer, soft tissue cancer, lung cancer, breast cancer, bladder / urinary tract cancer, head and neck cancer, melanoma, prostate cancer, testicular cancer, blood cancer, pancreatic cancer, skin cancer, endometrial cancer, ovarian cancer, colon cancer or colorectal cancer.

[0454] In some embodiments, the cancer is a blood cancer that overexpresses WHSC1 and is selected from the group consisting of acute lymphoblastic leukemia (ALL), acute myeloid leukemia (AML), chronic lymphocytic leukemia (CLL), small lymphocytic lymphoma (SLL), multiple myeloma (MM), Hodgkin lymphoma (HL), non-Hodgkin lymphoma (NHL), mantle cell lymphoma (MCL), marginal zone B-cell lymphoma, splenic marginal zone lymphoma, follicular lymphoma (FL), Waldenström macroglobulinemia (WM), diffuse large B-cell lymphoma (DLBCL), marginal zone lymphoma (MZL), hairy cell leukemia (HCL), Burkitt lymphoma (BL), Richter transformation, acute eosinophilic leukemia, acute erythroleukemia, acute lymphoblastic leukemia, acute megakaryoblastic leukemia, acute monocytic leukemia, acute promyelocytic leukemia, acute myeloid leukemia, B-cell prolymphocytic leukemia, B-cell lymphoma, MALT lymphoma, precursor T-lymphoblastic lymphoma, T-cell lymphoma, mast cell leukemia, adult T-cell leukemia / lymphoma, aggressive NK-cell leukemia, and angioimmunoblastic T-cell lymphoma.

[0455] In some embodiments, the blood cancer that overexpresses WHSC1 is selected from the group consisting of acute lymphoblastic leukemia (ALL), acute myeloid leukemia (AML), chronic lymphocytic leukemia (CLL), small lymphocytic lymphoma (SLL), multiple myeloma (MM), non-Hodgkin lymphoma (NHL), mantle cell lymphoma (MCL), follicular lymphoma (FL), Waldenström macroglobulinemia (WM), diffuse large B-cell lymphoma (DLBCL), marginal zone lymphoma (MZL) including extranodal and nodular MZL, hairy cell leukemia (HCL), Burkitt lymphoma (BL), and Richter transformation.

[0456] In some embodiments, the blood cancer that overexpresses WHSC1 is multiple myeloma.

[0457] In some embodiments, the blood cancer that overexpresses WHSC1 is t(4;14) multiple myeloma as described herein.

[0458] In some embodiments, blood cancers that overexpress WHSC1 are non-t(4;14) multiple myelomas, such as t(14;16), t(11;14), t(14;20), t(8;14), and t(6;14) as described herein. In some embodiments, non-t(4;14) multiple myeloma cells do not overexpress WHSC1 but still respond to SETD2 inhibition. This is shown in the examples below.

[0459] In some embodiments, the cancer is refractory to conventional chemotherapy.

[0460] In some embodiments, the cancer is recurrent.

[0461] In some embodiments, treatment by the methods described herein can be continued indefinitely (i.e., as maintenance therapy). In some embodiments, treatment by the methods described herein can continue up to about 18 weeks, up to about 17 weeks, up to about 16 weeks, up to about 15 weeks, up to about 14 weeks, up to about 13 weeks, or up to about 12 weeks. In some embodiments, the treatment continues for about 12 weeks. In some embodiments, treatment by the methods described herein can continue for about 1 week to about 52 weeks, about 1 week to about 26 weeks, about 1 week to about 12 weeks, about 1 week to about 6 weeks, about 6 weeks to about 52 weeks, about 6 weeks to about 26 weeks, or about 12 weeks to about 52 weeks. In some embodiments, treatment by the methods described herein can continue for more than 52 weeks.

[0462] Method for inhibiting trimethylation of lysine 36 on histone H3 in cells In one aspect, the disclosure provides a method for inhibiting trimethylation of lysine 36 on histone H3 (H3K36me3) in cells that overexpress WHSC1, the method comprising contacting the cells with a SETD2 inhibitor as described herein.

[0463] In some embodiments, the overexpression of WHSC1 by the cancer is determined prior to administration of the SETD2 inhibitor.

[0464] In some embodiments, the SETD2 inhibitor is a substituted indole compound as defined in the "Definitions" section of the detailed description.

[0465] In some embodiments, the SETD2 inhibitor is a compound of Table 1 or a pharmaceutically acceptable salt thereof.

[0466] In some embodiments, the SETD2 inhibitor is not a substituted indole compound. For example, the SETD2 inhibitor can be a sinapine derivative selected from the group consisting of N-propylsinapine and N-benzylsinapine or any other SETD2 inhibitor described herein.

[0467] In some embodiments, inhibiting trimethylation of lysine 36 on histone H3 in cells occurs in vitro. In some embodiments, inhibiting trimethylation of lysine 36 on histone H3 in cells occurs in vivo. In some embodiments, the cells in vivo are in a mammal. In some embodiments, the cells in vivo are in a human.

[0468] In some embodiments, the cells are derived from blood cancer. In some embodiments, the blood cancer is selected from the group consisting of acute lymphoblastic leukemia (ALL), acute myeloid leukemia (AML), chronic lymphocytic leukemia (CLL), small lymphocytic lymphoma (SLL), multiple myeloma (MM), Hodgkin lymphoma (HL), non-Hodgkin lymphoma (NHL), mantle cell lymphoma (MCL), marginal zone B-cell lymphoma, splenic marginal zone lymphoma, follicular lymphoma (FL), Waldenström macroglobulinemia (WM), diffuse large B-cell lymphoma (DLBCL), marginal zone lymphoma (MZL), hairy cell leukemia (HCL), Burkitt lymphoma (BL), Richter transformation, acute eosinophilic leukemia, acute erythroleukemia, acute lymphoblastic leukemia, acute megakaryoblastic leukemia, acute monocytic leukemia, acute promyelocytic leukemia, acute myeloid leukemia, B-cell prolymphocytic leukemia, B-cell lymphoma, MALT lymphoma, precursor T-lymphoblastic lymphoma, T-cell lymphoma, mast cell leukemia, adult T-cell leukemia / lymphoma, aggressive NK-cell leukemia, and angioimmunoblastic T-cell lymphoma.

[0469] In some embodiments, the blood cancer is multiple myeloma.

[0470] In some embodiments, the multiple myeloma contains a chromosomal translocation or chromosomal deletion.

[0471] In some embodiments, the multiple myeloma contains a chromosomal translocation.

[0472] In some embodiments, chromosome 14 is involved in the chromosomal translocation.

[0473] In some embodiments, the chromosomal translocation is a t(4;14) translocation. In the t(4;14) translocation, MM cells overexpress WHSC1.

[0474] In some embodiments, the chromosomal translocation is a non-t(4;14) translocation. In some embodiments, the non-t(4;14) translocation is selected from the group consisting of t(14;16), t(11;14), t(14;20), t(8;14), and t(6;14) translocations. In some embodiments, the non-t(4;14) MM cells do not overexpress WHSC1, but the SETD2 inhibitor can inhibit trimethylation of lysine 36 on histone H3 (H3K36me3) in the cells.

[0475] In some embodiments, multiple myeloma contains deletions. In some embodiments, the deletions are selected from the group consisting of del(17p) and del(13).

[0476] In some embodiments, the cells are derived from solid tumors. In some embodiments, the solid tumors are selected from the group consisting of esophageal cancer, renal cancer, gastric cancer, hepatocellular carcinoma, glioblastoma, central nervous system (CNS) cancer, soft tissue cancer, lung cancer, breast cancer, bladder / urinary tract cancer, head and neck cancer, melanoma, prostate cancer, testicular cancer, pancreatic cancer, skin cancer, endometrial cancer, ovarian cancer, colon cancer, and colorectal cancer.

[0477] The present invention is further illustrated by the following examples, which should not be construed as further limiting. The contents of all patent and non-patent references cited throughout this application are hereby incorporated by reference in their entirety into this specification.

Examples

[0478] Example 1: The small molecule SETD2 inhibitor exhibits potent anti-proliferative activity in t(4;14) multiple myeloma The t(4;14) chromosomal translocation is found in 15% of newly diagnosed multiple myeloma (MM) patients and is associated with high risk and poor prognosis. t(4;14) MM cells are known to overexpress WHSC1, a histone methyltransferase (HMT), which results in deregulation of gene expression by increased dimethylation of histone H3 at lysine 36 (H3K36me2). Another HMT, SETD2, is the only enzyme capable of performing trimethylation of H3K36 (H3K36me3). Since t(4;14) MM overexpresses WHSC1 and results in ubiquitous 3K36me2 (dimethylation), this example evaluates whether t(4;14) MM is dependent on H3K36me3 catalyzed by SETD2. Also, in this example, a panel of MM cell lines (with and without the t(4;14) translocation) was tested against a small molecule inhibitor of SETD2. The t(4;14) multiple myeloma cell lines showed a substantial loss of proliferation / survival ability in response to compound number 15, a SETD2 inhibitor, compared to non-t(4;14). Finally, this example shows robust tumor growth regression by compound number 15 in the KMS11 t(4;14) xenograft model, indicating that SETD2 is a viable therapeutic target in t(4;14) MM.

[0479] Materials and Methods Tissue Culture and Cell Lines The cell lines used in this example were obtained from the sources below and cultured under conditions specified by their respective cell banks. A549 (CCL-185), MM.1R (CRL-2975), MM.1S (CRL-2974), NCI-H929 (CRL -9068), U266B1 (TIB-196), and RPMI-8226 (CCL-155) were obtained from ATCC (Manassas, VA, USA). KMS-12-BM (ACC-551), LP-1 (ACC-41), OPM-2 (ACC-50), EJM (ACC-560), MOLP-2 (ACC-607), MOLP-8 (ACC-569), AMO-1 (ACC-538), L363 (ACC-49), SK-MM-2 (ACC-430), SK-MM-1 (ACC-758) were obtained from DSMZ (Braunschweig, Germany). KMS-28-BM (JCRB1192), KMS-26 (JCRB1187), KMS-34 (JCRB1195), KMS-11 (JCRB1179), Delta-47 (JCRB1344), KMM-1 (JCRB1180) were obtained from JCRB (Osaka, Japan), and PCM6 (RCB1460) was obtained from RIKEN (Tsukuba, Japan). All cells were maintained in a humidified incubator set at 37°C and 5% CO2.

[0480] Western blot analysis Whole cell lysates were prepared using 1×NP40 buffer (ThermoFisher Scientific, FNN0021) supplemented with 1 mM PMSF and Halt™ Protease Inhibitor Cocktail (ThermoFisher Scientific, 78440). Cells were pelleted, washed with ice-cold 1×PBS, resuspended in ice-cold NP40 buffer, incubated on ice for 30 minutes, and then sonicated (Amplitude 30% / 5 seconds × 1). Lysates were centrifuged at 13,200 rpm for 10 minutes at 4°C and normalized for protein concentration using the Pierce BCA Protein Assay Kit (ThermoFisher Scientific, 23225). 25 micrograms of lysate were resolved on a 4–12% Bis-Tris protein gel (ThermoFisher Scientific, WG1402BOX) and transferred using iBlot (program 3–7 minutes, nitrocellulose transfer stack). Blots were probed overnight (O / N) with the following primary antibodies in Odyssey Blocking Buffer (LI-COR Biosciences, 927-40000) containing 0.1% Tween® 20 (v / v): rabbit anti-tri-methyl-histone H3 (Lys36) (D5A7) antibody (Cell Signaling Technology, 4909S, 1:1,000 dilution), rabbit anti-di-methyl-histone H3 (Lys36) (C75H12) antibody (Cell Signaling Technology, 2901S, 1:1,000 dilution), and mouse anti-histone H3 (Cell Signaling Technology, 3638S, 1:20,000 dilution). Membranes were probed for 1 hour with IRDye800CW donkey anti-rabbit IgG (LI-COR Biosciences, 926-32213, 1:20,000 dilution) and IRDye680RD donkey anti-mouse IgG (LI-COR Biosciences, 926-68072, 1:20,000 dilution) secondary antibodies. Blots were imaged using the Odyssey Imaging System (LICOR Biosciences).

[0481] Individual sgRNA CRISPR infections The lentivirus, a single expression system containing Cas9 and sgRNA for all targets, was purchased from Cellecta, Inc. The sequences for the sgRNAs are as follows: WHSC1-1 sgRNA-CCCATTCACTGTCCACTTGA (SEQ ID NO: 5) and WHSC1-2 sgRNA-CCCTCAAGTGGACAGTGAAT (SEQ ID NO: 6). On day 0, cells were seeded at a density of 17,500 cells / cm 2 in a 100 mm culture dish containing 10 mL of complete medium and incubated at 37 °C with 5% CO2 for 24 hours. After 24 hours, the cells were infected with the sgRNA at an MOI of 3 in the presence of 5 μg / mL of polybrene (Millipore, number TR-1003-G). The viral medium was removed 24 hours after infection, and selection with puromycin (1 μg / mL) was started 48 hours after infection. The infected cells were cultured for 30 days under puromycin selection.

[0482] Intracellular Western assay A549 cells were maintained in growth medium (F12K supplemented with 10% v / v heat-inactivated fetal bovine serum and 100 units / mL penicillin-streptomycin) and cultured at 37 °C under 5% CO2. Compounds were added directly to poly-D-lysine-coated 384-well culture plates. Cells were seeded in assay medium at a density of 80,000 cells / mL (4,000 cells / well) and added to the plates at a volume of 50 μL per well. The plates were left standing on the bench top for 20 minutes to allow the cells to settle on the bottom of the wells. The plates were incubated at 37 °C, 5% CO2 for 3 days. After 3 days of incubation, the medium was removed from the plates and the cells were permeabilized with ice-cold 100% methanol. The plates were incubated for 30 minutes and then washed with 1× PBS-Tween® 20 (0.5%). Next, the plates were blocked with Odyssey blocking buffer (LI-COR Biosciences, 927-40000) for 1 hour at room temperature. The blocking buffer was removed and 20 μL of primary antibody (rabbit anti-tri-methyl histone H3 (Lys36) (D5A7) antibody, Cell Signaling Technology, 4909S, 1:1,000 dilution) per well in Odyssey buffer with 0.1% Tween® 20 (v / v) was added and the plates were incubated overnight (16 hours) at 4 °C. The plates were washed with 1× PBS-Tween® 20 (0.5%) and then 20 μL of secondary antibody (IRDye800CW goat anti-rabbit IgG (H+L), LI-COR Biosciences, 926-32211, 1:500 dilution), (DRAQ5 antibody, Cell Signaling Technology, 4048L, 1:1000 dilution) per well in Odyssey buffer with 0.1% Tween® 20 (v / v) was added and incubated for 1 hour at room temperature. The plates were washed first with 1× PBS-Tween® 20 (0.5%) and then with water. The plates were imaged on an Odyssey Imaging System (LI-COR Biosciences) using both the 700 nm and 800 nm channels.The ratio for each well was calculated by dividing the 800 nm (H3K36me3) value by the 700 nm (DRAQ5) value. The percent inhibition values were then calculated using the mean of the test sample ratio and the positive and negative control ratios.

[0483] In vitro Long-Term Proliferation (LTP) Assay The long-term proliferation assay plating density for each suspension cell line was determined based on the growth curve (measured by calcein AM cell viability) and density over a 4-day time course. On day 0, cells were seeded in triplicate in 96-well plates and left untreated, treated with DMSO, or treated with compound number 15 starting at 10 μM and decreasing in 3-fold dilutions. Plates were read on Acumen on days 0, 4, 7, 11, and 14 using calcein AM (Invitrogen, C3099). Cells from each treatment were counted and re-seeded in triplicate in 96-well plates at the initial seeding density on days 4, 7, and 11. The re-seeded cells were re-treated with the compound using the same dilution scheme as above. The mean of the triplicates was used to plot the growth over time and calculate the IC 50 values.

[0484] Dose Range Finding Study All procedures related to the handling, care, and treatment of animals in this study were conducted in accordance with the guidelines approved by the Institutional Animal Care and Use Committee of Pharmaron, Beijing, China and according to the guidance of the Association for Assessment and Accreditation of Laboratory Animal Care.

[0485] 6 - 8 - week - old NOD SCID mice were purchased from Beijing HFK Bioscience Co., Ltd. The mice were housed in polycarbonate cages maintained at a temperature of (22 + / - 3°C) and a relative humidity of 40 - 70%. The animals had free access to sterile drinking water and irradiated - sterilized dry granular food throughout the study. The mice were randomly assigned to dose groups based on body weight so that each treatment group had the same average body weight. The compound or vehicle was administered by oral gavage at the indicated doses (n = 4, 0.5% NaCMC + 0.1% Tween® - 80 in aqueous vehicle; n = 7 for the dose group of compound number 15) twice a day (every 12 hours) or once a day. Each dose was delivered at a volume of 10 mL / kg. Body weight was measured daily for 7 days, and the mice were evaluated for abnormal clinical signs. For pharmacokinetic analysis, plasma samples were collected from the dose groups at specific time points throughout the 7 - day study and biochemical analysis was performed.

[0486] Xenograft study KMS11 xenograft KMS11 cells were collected during exponential growth phase and mixed in RPMI - 1640:Matrigel at a 1:1 ratio. NOD SCID mice received 7 1 × 10 3 cells (0.1 mL of cell suspension) subcutaneously in the right flank. Seven days later, mice bearing tumors of 85 - 150 mm 3Sorted into treatment groups with mean tumor volume (n = 10 mice per group). Compound number 15 or vehicle (0.5% NaCMC + 0.1% Tween®-80 (v / v) in water) was administered by oral gavage at the indicated doses twice a day (every 12 hours) or once a day. Each dose was delivered at a volume of 10 mL / kg and adjusted for the last recorded weight of each individual animal. The maximum treatment length was 28 days. Tumor volume (twice a week) and body weight (daily) were recorded throughout the experiment. On day 7 or 28 of the study, mice were sampled in a pre-specified manner. Sampling included terminal retro-orbital bleeding and full-volume blood collection by cardiac puncture under CO2 anesthesia at the end. Blood samples were processed for plasma with K2-EDTA as an anticoagulant and PBMCs were isolated. Samples were frozen at -80 °C and stored until analysis. Tumors were collected from designated mice under ribonuclease-free conditions and snap-frozen in liquid nitrogen. Bone marrow was flushed from the femurs using 1× PBS, filtered through a 40 µm nylon strainer, and snap-frozen. Histones were extracted from tumors, bone marrow, and PBMCs as previously described. See Daigle et al. Cancer Cell 20:53-65 (2011).

[0487] MM.1S xenograft CB17 SCID mice were seeded subcutaneously in the right flank with MM.1S tumor cells (5 × 10 6 ) in 0.2 mL of PBS (50:50) mixed with Matrigel. 3 After 18 days, mice bearing tumors of 100 - 150 mm 3Sorted into treatment groups with mean tumor volume (n = 10 mice per group). Compound number 15 or vehicle (0.5% NaCMC + 0.1% Tween®-80 (v / v) in water) was administered by oral gavage at the indicated doses twice daily (every 12 hours). Each dose was delivered at a volume of 10 mL / kg and adjusted for the last recorded weight of the individual animal. The maximum treatment length was 23 days. Tumor volume and body weight were recorded twice weekly throughout the experiment. On day 18 or 41 during the study, samples were collected from the mice in a pre-specified manner. Sample collection included terminal retro-orbital bleeding and full volume blood collection by terminal cardiac puncture under CO2 anesthesia. Blood samples were processed for plasma with K2-EDTA as an anticoagulant and PBMCs were isolated. Samples were frozen at -80 °C and stored until analysis. Tumors were collected from the indicated mice under ribonuclease-free conditions and snap frozen in liquid nitrogen. Bone marrow was flushed from the femurs using 1× PBS, filtered through a 40um nylon strainer, and snap frozen. Histones were extracted from tumors, bone marrow, and PBMCs as previously described in Daigle et al., Cancer Cell 20:53-65 (2011) was performed

[0488] Fluorescence-based ELISA assay (fluorescent immunoassay (FIA) detection of anti-histone H3 tri-methyl K36) The histone concentration was determined using the Pierce BCA Protein Assay Kit (ThermoFisher Scientific, 23225). Histones were prepared in coating buffer and added directly to high-binding 96-well plates. The plates were left at 4 °C overnight to allow histone adhesion. The next morning, the coating buffer with histones was discarded, and 100 μL of primary antibody solution in Odyssey buffer with 0.1% Tween® 20 (v / v), (anti-histone H3 tri-methyl K36 (Epigentek, 4042-050, 1:100 dilution) and total histone H3 (Cell Signaling Technology, 14269, 1:500 dilution) were added to the plates and incubated for 1 h. The plates were washed three times with 1× PBS-Tween® 20 (0.5%) wash buffer. Next, 100 μL of secondary solution antibody in Odyssey buffer with 0.1% Tween® 20 (v / v), IRDye800CW donkey anti-rabbit IgG (H+L) antibody (LI-COR Biosciences, 926-32213, 1:200 dilution) and donkey anti-mouse IgG (H+L) Alexa Fluor680 conjugate (Life Technologies, A10038, 1:1000 dilution) were added to each well and incubated for 1 h at room temperature in the dark. The plates were washed three times with 1× PBS-Tween® 20 (0.5%) wash buffer and then each well was filled with 100 μL of 1× PBS-Tween® 20 (0.5%) to avoid direct exposure to light as much as possible. The plates were imaged on an Odyssey Imaging System (LI-COR Biosciences) using both the 700 nm and 800 nm channels. The average ratio value for each test sample was calculated by dividing the 800 nm (H3K36me3) value by the 700 nm value (total H3) and used to determine the percentage of H3K36me3 from the vehicle.

[0489] Results Small molecule inhibition of SETD2 is enhanced in t(4;14) cell lines It was hypothesized that the dependence of t(4;14) on the catalytic activity of WHSC1 actually reflects the subsequent dependence on SETD2 activity. To test this, compound number 15, a small molecule inhibitor of SETD2, was utilized to investigate the effect of SETD2 inhibition in the context of multiple myeloma. A panel of 22 human myeloma cell lines was examined for phenotypic effects upon treatment with this compound. These cell lines, representing a broad range of MM translocations, were subjected to a long-term proliferation assay over a 14-day period to evaluate the anti-proliferative effect (Figure 1A). Compound number 15 showed higher activity in the t(4;14) subset of MM.

[0490] To further examine the effect of SETD2 inhibition in the t(4;14) setting, the MM cell line KMS34 was selected for a follow-up assay. Compound number 15 inhibited the growth of the KMS-34 line in vitro in a dose-dependent manner with an IC 50 of 80 nM (Figure 2A). Furthermore, H3K36me3 was reduced upon treatment with compound number 15, while H3K36me2 remained unchanged (Figure 2B). To confirm that the activity of compound number 15 was on target, the inventors compared it to three less active enantiomers from the same chemical lineage. Compound number 15 showed biochemical activity against the SETD2 protein as well as reduction of methyl marks and growth defects, while none of the less active enantiomers showed activity by these measures (Figure 2C). Structure-activity relationship (SAR) was further tested with a panel of 17 compounds having a range of biochemical potencies, showing a direct correlation between H3K36me3 inhibition and growth effects in vitro (Figure 2D). In summary, small molecule inhibition of SETD2 was shown to inhibit proliferation in a dose-dependent manner in the t(4;14) MM lines and that this effect was on target.

[0491] In some embodiments, the response to SETD2 inhibition in t(4;14) MM is determined by WHSC1 overexpression Given the enhanced SETD2 inhibition in cell lines containing the t(4;14) translocation, efforts have been made to understand the relationship between WHSC1 overexpression and SETD2 inhibition. Two isogenic variants of the previously characterized KMS11 cells, TKO and NTKO, were subjected to a long-term growth assay. NTKO cells express only the translocated WHSC1 allele. In contrast, TKO cells express only the non-translocated allele of WHSC1. As a result, NTKO cells overexpress WHSC1, while TKO cells lack WHSC1 overexpression driven by the t(4;14) translocation. After 14 days of treatment with compound number 15, both the parental and NTKO lines expressing the translocated allele showed growth inhibition with IC 50 of 360 nM and 361 nM, respectively. Conversely, the TKO line expressing only the non-translocated allele showed no proliferative effect in response to compound number 15 (Figure 3A). Evaluation of the methylation mark revealed that H3K36me3 was reduced in a dose-responsive manner with an IC 50 of 150 - 250 nM for all variants. Furthermore, evaluation of the H3K36me2 methylation mark confirmed that only the parental and NTKO lines had elevated levels of H3K36me2 and showed WHSC1 overexpression (Figures 3B, 3C). These results suggest that SETD2 sensitivity in t(4;14) MM is determined by WHSC1 overexpression.

[0492] Furthermore, CRISPR knockout of WHSC1 was used to further investigate the dependence on WHSC1 overexpression for sensitivity to SETD2 inhibition in the t(4;14) MM cell line. Based on their sensitivity to SETD2 inhibition, two t(4;14) MM cell lines were selected. KMS-34 cells were sensitive to SETD2 inhibition with an IC 50 of 80 nM. In contrast, KMS-28-BM cells had an IC 50was insensitive to SETD2 inhibition (Figure 1A). KMS-28-BM cells were potentially driven by other mechanisms, such as low cyclin D2 expression and KRAS mutations, and were hypothesized to be insensitive to SETD2 inhibition because they were not dependent on WHSC1 overexpression driven by t(4;14) for survival. If true, knockout of WHSC1 would not affect the growth or viability of these cells. Conversely, considering their sensitivity to SETD2 inhibition, KMS-34 cells were expected to be sensitive to loss of WHSC1.

[0493] To test these theories, both cell lines were subjected to CRISPR knockout of WHSC1, and growth and genotype were monitored over a 4-week period. Knockout of WHSC1 in KMS-28-BM cells had no effect on proliferation. In contrast, in the KMS-34 cell line, a significant decrease in proliferation was observed in the system targeted by WHSC1 (Figure 4A).

[0494] Genotypic analysis of the knockout lines over time showed that more than 50% of KMS-28-BM had out-of-frame mutations, suggesting that the cells survived with loss of WHSC1. Conversely, KMS-34 genotyping showed the largest out-of-frame population 12 days after infection, after which positive selection for the wild-type population occurred (Figure 4B), indicating loss of cells with WHSC1 knockout and growth of cells maintaining WHSC1 overexpression. Collectively, these results suggest that sensitivity to SETD2 inhibition in t(4;14) MM is associated with dependence on WHSC1 overexpression.

[0495] Compound number 15 was tolerated in vivo at 10-fold the IC 50 dose in vitro and To determine the dose for in vivo efficacy studies, a dose range finding (DRF) study was conducted in the KMS11 xenograft model. The in vitro IC 50 of compound number 15 for KMS11 cells was used as a benchmark for selecting the doses used in the DRF. The pharmacokinetics in NOD SCID mice following oral administration of compound number 15 showed that drug levels exceeding 10-fold of the KMS11 proliferation IC 50 in mice could be maintained up to 12 hours by BID or QD dosing (Figure 3A). No weight loss was observed at 62.5 and 125 mg / kg BID when compared to the vehicle control (Figure 3B). Furthermore, modulation of the H3K36me3 methyl mark in untreated bone marrow showed a substantial reduction in H3K36me3 levels in response to compound number 15 treatment (Figure 3C). Collectively, these results indicate that compound number 15, a SETD2 inhibitor, is very well tolerated at effective concentrations in NOD SCID mice and demonstrates target engagement of the pharmacodynamic mark in vivo.

[0496] SETD2 inhibition results in robust tumor regression in the t(4;14) MM xenograft model To determine whether the growth inhibitory effect of SETD2 inhibition observed in cell culture can be translated to in vivo studies, the effect of treatment with Compound No. 15 on the KMS11 xenograft model was investigated. The study was conducted in NOD SCID mice bearing subcutaneous KMS11 tumors. Mice were orally administered Compound No. 15 or vehicle control for 28 days. Compound No. 15 showed robust tumor regression in a dose-dependent manner with up to 99% maximum tumor inhibition at the top three doses (Figure 6A). Compound No. 15 was well tolerated with minimal effects on body weight (BW) at 31.25 mg / kg (28 days BID) and 62.5 mg / kg (28 days BID). On the other hand, 125 mg / kg (18 days BID, 7 days BID (3D - 4D+)) and 175 mg / kg (11 days BID, 14 days BID (3D - 4D+)) were less well tolerated and required dosing holidays after 18 and 11 days of continuous dosing, respectively (Figure 6B). Fluorescence-based ELISA analysis of H3K36me3 in histones isolated from tumors collected on day 28 showed complete reduction of the methyl mark at all doses (Figure 6C). Compound No. 15 was extremely well tolerated and showed strong antitumor activity in the KMS11t(4;14) multiple myeloma xenograft model with complete removal of the H3K36me3 methyl mark at all observed doses.

[0497] SETD2 inhibition results in tumor regression in non - t(4;14) MM xenograft models SETD2 inhibition clearly resulted in growth inhibition of the t(4;14) MM cell line, while the inventors also observed a response in non - t(4;14) cell lines. Given these results, Compound No. 15 was tested in the non - t(4;14) MM xenograft model MM.1S. This cell line had an IC of 3 uM in a long - term cell growth assay compared to an IC of 382 nM for the KMS11 cell line 50 as compared to 50was about one tenth less sensitive (Figure 1A). The study was conducted in CB17 SCID mice bearing subcutaneous MM.1S tumors. Compound number 15 or vehicle control was administered twice daily for 23 days by gavage. Compound number 15 showed tumor inhibition in a dose-dependent manner with the maximum inhibition seen in the upper dose group (62.5 mg / kg - 85% TGI) (Figure 7A). The compound was well tolerated at all doses with minimal change in body weight after 23 consecutive days of dosing (Figure 7B). A dose-dependent decrease in the H3K36me3 methyl mark was seen in MM.1S tumor samples (Figure 7C). As expected based on the cellular LTP assay, the MM.1S xenograft model responded to treatment with compound number 15, but to a lesser extent than the KMS11 xenograft model. Tumor growth inhibition up to 85% was seen after treatment, while almost complete tumor regression was seen in the KMS11 model. This suggests that SETD2 inhibition is probably most effective in the t(4;14) subset of MM, but that other MM subtypes are also affected, albeit to a lesser extent.

[0498] The present invention has been described above using functional structural blocks that illustrate the implementation of specific functions and their relationships. The boundaries of these functional structural blocks have been arbitrarily defined herein for the sake of explanation. Alternative boundaries can be defined as long as the specific functions and their relationships are appropriately performed.

[0499] The above description of specific embodiments fully reveals the overall nature of the present invention, which enables others to readily modify and / or adapt various applications of such specific embodiments within the scope of the technology in the art without undue experimentation and without departing from the general concept of the present invention. Accordingly, such adapted and modified forms are intended to be within the meaning and scope of equivalents of the disclosed embodiments, based on the teachings and guidance presented herein. It should be understood that the syntax or terminology herein is for the purpose of description and not for the purpose of limitation, as the syntax or terminology herein is to be interpreted by those skilled in the art in light of the teachings and guidance. All patents and published materials described herein indicate the level of those skilled in the art to which this disclosure pertains. All patents and published materials are incorporated herein by reference to the same extent as if each individual published material were specifically and individually indicated to be incorporated by reference.

Claims

**Claim 1**: A composition for treating cancer in a subject in need thereof, said composition comprising a SETD2 inhibitor, wherein said cancer overexpresses WHSC1, and said SETD2 inhibitor has the formula I: 【Chemical 101】 [wherein, R1a is selected from the group consisting of halogen, alkyl, alkoxy, cycloalkyl, (hydroxy)alkyl, and (cycloalkyl)alkyl; Q1 is selected from the group consisting of -C(R1b)= and -N=; Q2 is selected from the group consisting of -C(R1c)= and -N=; Q3 is selected from the group consisting of -C(R1d)= and -N=; provided that at least one of Q1, Q2, or Q3 is -C(R1b)=, -C(R1c)=, or -C(R1d)=, respectively; R1b, R1c, and R1d are each independently selected from the group consisting of hydrogen, halogen, alkyl, alkenyl, (hydroxy)alkyl, and alkoxy; R1e is selected from the group consisting of hydrogen, halogen, alkyl, cycloalkyl, (hydroxy)alkyl, and (cycloalkyl)alkyl; 【Chemical 102】 is a single bond or a double bond; G1 is selected from the group consisting of aryl optionally substituted, heteroaryl optionally substituted, heterocycle optionally substituted, cycloalkyl optionally substituted, (aryl)alkyl, (heteroaryl)alkyl, (heterocycle)alkyl, (amino)(aryl)alkyl, (heteroaryl)(aryl)alkyl, (heteroaryl)(heterocycle)alkyl, (heteroaryl)(carboxamide)alkyl, (heteroaryl)(cycloalkyl)alkyl, (aryl)(alkoxycarbonyl)alkyl, (cycloalkyl)alkyl, (heteroaryl)(amino)alkyl, (cycloalkyl)(alkoxycarbonyl)alkyl, (heteroaryl)(alkoxycarbonyl)alkyl, (heterocycle)(cycloalkyl)alkyl, (aryl)(cycloalkyl)alkyl, (aryl)(hydroxy)alkyl, (cycloalkyl)(hydroxy)alkyl, (hydroxy)alkyl, alkyl optionally substituted, (aryl)(haloalkyl)alkyl, (cycloalkyl)(haloalkyl)alkyl, (hydroxy)(haloalkyl)alkyl and (alkoxycarbonyl)(haloalkyl)alkyl; and G2 is selected from the group consisting of hydrogen and alkyl; or G1 and G2 together with the nitrogen atom to which they are attached form a heterocycle optionally substituted] is a compound having the same or a pharmaceutically acceptable salt thereof; provided that the compound is not the following compound: 【Chemical 103】 or a pharmaceutically acceptable salt thereof, composition.

2. The composition according to claim 1, wherein the overexpression of WHSC1 by the cancer is determined before administration of the composition.

3. The composition according to claim 1 or 2, wherein the cancer overexpressing WHSC1 is a blood cancer. **Claim 4**: The composition according to claim 3, wherein the blood cancer is selected from the group consisting of acute lymphoblastic leukemia (ALL), acute myeloid leukemia (AML), chronic lymphocytic leukemia (CLL), small lymphocytic lymphoma (SLL), multiple myeloma (MM), Hodgkin lymphoma (HL), non-Hodgkin lymphoma (NHL), mantle cell lymphoma (MCL), marginal zone B-cell lymphoma, splenic marginal zone lymphoma, follicular lymphoma (FL), Waldenström macroglobulinemia (WM), diffuse large B-cell lymphoma (DLBCL), marginal zone lymphoma (MZL), hairy cell leukemia (HCL), Burkitt lymphoma (BL), Richter transformation, acute eosinophilic leukemia, acute erythroleukemia, acute lymphoblastic leukemia, acute megakaryoblastic leukemia, acute monocytic leukemia, acute promyelocytic leukemia, acute myeloid leukemia, B-cell prolymphocytic leukemia, B-cell lymphoma, MALT lymphoma, precursor T-lymphoblastic lymphoma, T-cell lymphoma, mast cell leukemia, adult T-cell leukemia / lymphoma, aggressive NK-cell leukemia, and angioimmunoblastic T-cell lymphoma. **Claim 5**: The composition according to claim 4, wherein the blood cancer is multiple myeloma. **Claim 6**: The composition according to claim 5, wherein the multiple myeloma contains a chromosomal translocation or chromosomal deletion. **Claim 7**: The composition according to claim 6, wherein the multiple myeloma contains a chromosomal translocation. **Claim 8**: The composition according to claim 7, wherein the chromosomal translocation is a t(4;14) translocation. **Claim 9**: The composition according to claim 7, wherein the chromosomal translocation is a non-t(4;14) translocation. **Claim 10**: The composition according to claim 9, wherein the non-t(4;14) translocation is selected from the group consisting of t(14;16), t(11;14), t(14;20), t(8;14), and t(6;14) translocations. **Claim 11**: The composition according to claim 6, wherein the multiple myeloma contains a chromosomal deletion. **Claim 12**: The composition according to claim 11, wherein the chromosomal deletion is selected from the group consisting of del(17p) and del(13). **Claim 13**: The composition according to claim 1 or 2, wherein the cancer overexpressing WHSC1 is a solid tumor. **Claim 14**: The composition according to claim 13, wherein the solid tumor is selected from the group consisting of esophageal cancer, renal cancer, gastric cancer, hepatocellular carcinoma, glioblastoma, central nervous system (CNS) cancer, soft tissue cancer, lung cancer, breast cancer, bladder / urinary tract cancer, head and neck cancer, melanoma, prostate cancer, testicular cancer, pancreatic cancer, skin cancer, endometrial cancer, ovarian cancer, colon cancer, and colorectal cancer. **Claim 15**: The composition according to any one of claims 1 to 14, wherein the subject is a human. **Claim 16**: The composition according to any one of claims 1 to 15, wherein the compound is formulated for systemic or local administration. **Claim 17**: The composition according to any one of claims 1 to 15, wherein the compound is formulated for oral, nasal, intraperitoneal, or intratumoral administration. **Claim 18**: The composition according to any one of claims 1 to 15, wherein the compound is formulated for intravenous, intramuscular, or subcutaneous administration. **Claim 19**: The SETD2 inhibitor is of formula II: 【Chemical 104】 [wherein, R1d is fluoro] or a pharmaceutically acceptable salt thereof, and the composition according to any one of claims 1 to 18. **Claim 20**: The SETD2 inhibitor is of formula IV: 【Chemical 105】 [wherein, R1d is fluoro; Z4 is selected from the group consisting of -O-, -C(R28a)(R28b)-, and -N(R23)-; or Z4 is absent; Z5 is selected from the group consisting of -CH2- and -CH2CH2-; R11a is selected from the group consisting of optionally substituted alkyl, optionally substituted heterocycle, optionally substituted heteroaryl, and -N(R12b)C(=O)R13c; R12b is selected from the group consisting of hydrogen, alkyl, cycloalkyl, and heterocycle, (C1-C4 alkoxy)C1-C4 alkyl, and (hydroxy)C1-C4 alkyl; R13c is selected from the group consisting of alkyl, haloalkyl, alkoxy, (alkoxy)alkyl, (hydroxy)alkyl, (cyano)alkyl, optionally substituted aryl, optionally substituted heteroaryl, optionally substituted cycloalkyl, optionally substituted heterocycle, amino, (amino)alkyl, (C3-C6 cycloalkyl)oxy, and (4-8 membered heterocycle)oxy. R23 is selected from the group consisting of hydrogen and C1-C4 alkyl; R28a and R28b are independently selected from the group consisting of hydrogen, alkyl, and halo; The composition according to any one of claims 1 to 19, which is a compound of [] or a pharmaceutically acceptable salt thereof. **Claim 21** The SETD2 inhibitor is of formula IV-A: 【Chemical 106】 The composition according to claim 20, which is a compound of [] or a pharmaceutically acceptable salt thereof. **Claim 22** The SETD2 inhibitor is: 【Chemical 107-1】 【Chemical 107-2】 【Chemical 107-3】 【Chemical 107-4】 【Chemical 107-5】 【Chemical 107-6】 【Chemical 107-7】 【Chemical 107-8】 【Chemical 107-9】 【Chemical 107-10】 【Chemical 107-11】 【Chemical 107-12】 【Chemical 107-13】 【Chemical 107-14】 【Chemical 107-15】 【Chemical 107-16】 【Chemical 107-17】 【Chemical 107-18】 【Chemical 107-19】 【Chemical 107-20】 【Chemical 107-21】 【Chemical 107-22】 【Chemical 107-23】 【Chemical 107-24】 【Chemical 107-25】 【Chemical 107-26】 【Chemical 107-27】 【Chemical 107-28】 【Chemical 107-29】 【Chemical 107-30】 【Chemical 107-31】 【Chemical 107-32】 【Chemical 107-33】 【Chemical 107-34】 【Chemical 107-35】 【Chemical 107-36】 【Chemical 107-37】 【Chemical 107-38】 【Chemical 107-39】 【Chemical 107-40】 【Chemical 107-41】 【Chemical 107-42】 【Chemical 107-43】 【Chemical 107-44】 【Chemical 107-45】 【Chemical 107-46】 【Chemical 107-47】 【Chemical 107-48】 【Chemical 107-49】 【Chemical 107-50】 【Chemical 107-51】 【Chemical 107-52】 【Chemical 107-53】 【Chemical 107-54】 【Chemical 107-55】 【Chemical 107-56】 【Chemical 107-57】 【Chemical 107-58】 【Chemical 107-59】 【Chemical 107-60】 【Chemical 107-61】 ​ 【Chemical 107-63】 【Chemical 107-64】 【Chemical 107-65】 【Chemical 107-66】 【Chemical 107-67】 【Chemical 107-68】 【Chemical 107-69】 【Chemical 107-70】 【Chemical 107-71】 [Chemical 107-72] 【Chemical 107-73】 【Chemical 107-74】 【Chemical 107-75】 【Chemical 107-76】 【Chemical 107-77】 【Chemical 107-78】 【Chemical 107-79】 【Chemical 107-80】 【Chemical 107-81】 [[Chemical 107-82]] 【Chemical 107-83】 【Chemical 107-84】 【Chemical 107-85】 【Chemical 107-86】 【Chemical 107-87】 【Chemical 107-88】 【Chemical 107-89】 【Chemical 107-90】 【Chemical 107-91】 【Chemical 107-92】 【Chemical 107-93】 【Chemical 107-94】 【Chemical 107-95】 【Chemical 107-96】 【Chemical 107-97】 【Chemical 107-98】 【Chemical 107-99】 【Chemical 107-100】 【Chemical 107-101】 【Chemical 107-102】 【Chemical 107-103】 The composition according to any one of claims 1 to 21, which is selected from the group consisting of [] or a pharmaceutically acceptable salt thereof. **Claim 23** A composition for inhibiting trimethylation of lysine 36 on histone H3 (H3K36me3) in a cell, the composition comprising a SETD2 inhibitor, wherein the cell is contacted with the SETD2 inhibitor, wherein the cell overexpresses WHSC1, and the SETD2 inhibitor is of formula I: 【Chemical 108】 [Wherein, R1a is selected from the group consisting of halogen, alkyl, alkoxy, cycloalkyl, (hydroxy)alkyl, and (cycloalkyl)alkyl; Q1 is selected from the group consisting of -C(R1b)= and -N=; Q2 is selected from the group consisting of -C(R1c)= and -N=; Q3 is selected from the group consisting of -C(R1d)= and -N=; provided that at least one of Q1, Q2, or Q3 is -C(R1b)=, -C(R1c)=, or -C(R1d)=, respectively; R1b, R1c, and R1d are each independently selected from the group consisting of hydrogen, halogen, alkyl, alkenyl, (hydroxy)alkyl, and alkoxy; R1e is selected from the group consisting of hydrogen, halogen, alkyl, cycloalkyl, (hydroxy)alkyl, and (cycloalkyl)alkyl; 【Chemical 109】 is a single bond or a double bond; G1 is selected from the group consisting of aryl optionally substituted, heteroaryl optionally substituted, heterocycle optionally substituted, cycloalkyl optionally substituted, (aryl)alkyl, (heteroaryl)alkyl, (heterocycle)alkyl, (amino)(aryl)alkyl, (heteroaryl)(aryl)alkyl, (heteroaryl)(heterocycle)alkyl, (heteroaryl)(carboxamide)alkyl, (heteroaryl)(cycloalkyl)alkyl, (aryl)(alkoxycarbonyl)alkyl, (cycloalkyl)alkyl, (heteroaryl)(amino)alkyl, (cycloalkyl)(alkoxycarbonyl)alkyl, (heteroaryl)(alkoxycarbonyl)alkyl, (heterocycle)(cycloalkyl)alkyl, (aryl)(cycloalkyl)alkyl, (aryl)(hydroxy)alkyl, (cycloalkyl)(hydroxy)alkyl, (hydroxy)alkyl, alkyl optionally substituted, (aryl)(haloalkyl)alkyl, (cycloalkyl)(haloalkyl)alkyl, (hydroxy)(haloalkyl)alkyl, and (alkoxycarbonyl)(haloalkyl)alkyl; and G2 is selected from the group consisting of hydrogen and alkyl; or G1 and G2 together with the nitrogen atom to which they are attached form a heterocycle optionally substituted] a compound having the same or a pharmaceutically acceptable salt thereof, provided that the compound is not the following compound: 【Chemical Formula 110】 or a pharmaceutically acceptable salt thereof, a composition. **Claim 24**: The composition according to claim 23, wherein inhibiting trimethylation of lysine 36 on histone H3 in cells occurs in vitro. **Claim 25**: The composition according to claim 23, wherein inhibiting trimethylation of lysine 36 on histone H3 in cells occurs in vivo. **Claim 26**: The composition according to any one of claims 23 to 25, wherein the cells are derived from blood cancer. **Claim 27**: The composition according to claim 26, wherein the blood cancer is selected from the group consisting of acute lymphoblastic leukemia (ALL), acute myeloid leukemia (AML), chronic lymphocytic leukemia (CLL), small lymphocytic lymphoma (SLL), multiple myeloma (MM), Hodgkin lymphoma (HL), non-Hodgkin lymphoma (NHL), mantle cell lymphoma (MCL), marginal zone B-cell lymphoma, splenic marginal zone lymphoma, follicular lymphoma (FL), Waldenström macroglobulinemia (WM), diffuse large B-cell lymphoma (DLBCL), marginal zone lymphoma (MZL), hairy cell leukemia (HCL), Burkitt lymphoma (BL), Richter transformation, acute eosinophilic leukemia, acute erythroleukemia, acute lymphoblastic leukemia, acute megakaryoblastic leukemia, acute monocytic leukemia, acute promyelocytic leukemia, acute myeloid leukemia, B-cell prolymphocytic leukemia, B-cell lymphoma, MALT lymphoma, precursor T-lymphoblastic lymphoma, T-cell lymphoma, mast cell leukemia, adult T-cell leukemia / lymphoma, aggressive NK-cell leukemia, and angioimmunoblastic T-cell lymphoma. **Claim 28**: The composition according to claim 27, wherein the blood cancer is multiple myeloma. **Claim 29**: The composition according to claim 28, wherein the multiple myeloma contains a chromosomal translocation or chromosomal deletion. **Claim 30**: The composition according to claim 29, wherein the multiple myeloma contains a chromosomal translocation. **Claim 31**: The composition according to claim 30, wherein the chromosomal translocation is a t(4;14) translocation. **Claim 32**: The composition according to claim 30, wherein the chromosomal translocation is a non-t(4;14) translocation. **Claim 33**: The composition according to claim 32, wherein the non-t(4;14) translocation is selected from the group consisting of t(14;16), t(11;14), t(14;20), t(8;14), and t(6;14) translocations. **Claim 34**: The composition according to claim 29, wherein the multiple myeloma contains a chromosomal deletion. **Claim 35**: The composition according to claim 34, wherein the chromosomal deletion is selected from the group consisting of del(17p) and del(13). **Claim 36**: The composition according to any one of claims 23 to 25, wherein the cells are derived from solid tumors. **Claim 37**: The composition according to claim 36, wherein the solid tumor is selected from the group consisting of esophageal cancer, renal cancer, gastric cancer, hepatocellular carcinoma, glioblastoma, central nervous system (CNS) cancer, soft tissue cancer, lung cancer, breast cancer, bladder / urinary tract cancer, head and neck cancer, melanoma, prostate cancer, testicular cancer, pancreatic cancer, skin cancer, endometrial cancer, ovarian cancer, colon cancer, and colorectal cancer. **Claim 38**: The composition according to any one of claims 25 to 37, wherein the cells in vivo are in a human. **Claim 39**: The SETD2 inhibitor is of formula II: 【Chemical 111】 wherein R1d is fluoro or a pharmaceutically acceptable salt thereof, and the composition according to any one of claims 23 to 38. **Claim 40**: The SETD2 inhibitor is of formula IV: 【Chemical 112】 wherein R1d is fluoro; Z4 is selected from the group consisting of -O-, -C(R28a)(R28b)-, and -N(R23)-; or Z4 is absent; Z5 is selected from the group consisting of -CH2- and -CH2CH2-; R11a is selected from the group consisting of optionally substituted alkyl, optionally substituted heterocycle, optionally substituted heteroaryl, and -N(R12b)C(=O)R13c; R12b is selected from the group consisting of hydrogen, alkyl, cycloalkyl, and heterocycle, (C1-C4 alkoxy)C1-C4 alkyl, and (hydroxy)C1-C4 alkyl; R13c is selected from the group consisting of alkyl, haloalkyl, alkoxy, (alkoxy)alkyl, (hydroxy)alkyl, (cyano)alkyl, optionally substituted aryl, optionally substituted heteroaryl, optionally substituted cycloalkyl, optionally substituted heterocycle, amino, (amino)alkyl, (C3-C6 cycloalkyl)oxy, and (4-8 membered heterocycle)oxy; R23 is selected from the group consisting of hydrogen and C1-C4 alkyl; R28a and R28b are independently selected from the group consisting of hydrogen, alkyl, and halo] or a pharmaceutically acceptable salt thereof, and the composition according to any one of claims 23 to 39. **Claim 41**: The SETD2 inhibitor is of formula IV-A: 【Chemical 113】 The composition according to claim 40, which is a compound of or a pharmaceutically acceptable salt thereof.

42. The SETD2 inhibitor is: 【Chemical 114-1】 【Chemical 114-2】 【Chemical 114-3】 【Chemical Formula 114-4】 【Chemical 114-5】 【Chemical 114-6】 【Chemical 114-7】 【Chemical 114-8】 [[Chemical 114-9]] [[Chemical 114-10]] 【Chemical 114-11】 【Chemical 114-12】 【Chemical 114-13】 【Chemical 114-14】 【Chemical 114-15】 【Chemical 114-16】 【Chemical 114-17】 [[Chemical 114-18]] 【Chemical 114-19】 ​ 【Chemical 114-21】 【Chemical 114-22】 [[Chemical 114-23]] 【Chemical 114-24】 【Chemical 114-25】 【Chemical 114-26】 【Chemical 114-27】 【Chemical 114-28】 【Chemical 114-29】 【Chemical 114-30】 【Chemical 114-31】 【Chemical 114-32】 【Chemical 114-33】 【Chemical 114-34】 【Chemical 114-35】 【Chemical 114-36】 【Chemical 114-37】 【Chemical 114-38】 [[Chemical 114-39]] 【Chemical 114-40】 【Chemical 114-41】 【Chemical 114-42】 【Chemical 114-43】 【Chemical 114-44】 【Chemical 114-45】 【Chemical 114-46】 【Chemical 114-47】 [[Chemical 114-48]] 【Chemical 114-49】 【Chemical 114-50】 【Chemical Formula 114-51】 【Chemical 114-52】 【Chemical 114-53】 [[Chemical 114-54]] 【Chemical 114-55】 【Chemical 114-56】 【Chemical 114-57】 【Chemical 114-58】 [[Chemical 114-59]] 【Chemical 114-60】 【Chemical 114-61】 [[Chemical 114-62]] 【Chemical 114-63】 【Chemical 114-64】 【Chemical 114-65】 【Chemical 114-66】 【Chemical 114-67】 【Chemical 114-68】 【Chemical 114-69】 【Chemical 114-70】 【Chemical 114-71】 ​ [[Chemical 114-73]] [[Chemical 114-74]] 【Chemical 114-75】 【Chemical 114-76】 【Chemical 114-77】 【Chemical 114-78】 【Chemical 114-79】 【Chemical 114-80】 【Chemical 114-81】 【Chemical 114-82】 【Chemical 114-83】 【Chemical 114-84】 【Chemical 114-85】 【Chemical 114-86】 【Chemical 114-87】 【Chemical 114-88】 【Chemical 114-89】 【Chemical 114-90】 【Chemical 114-91】 【Chemical 114-92】 【Chemical 114 - 93】 【Chemical 114-94】 【Chemical 114-95】 【Chemical 114-96】 【Chemical 114-97】 【Chemical 114-98】 【Chemical 114-99】 【Chemical 114-100】 【Chemical 114-101】 [[Chemical 114-102]] 【Chemical 114-103】 The composition according to any one of claims 23 to 41, which is selected from the group consisting of or a pharmaceutically acceptable salt thereof.

Images