Particle encapsulation method, microwell device and target substance detection method
The particle encapsulation method using a microwell device with a base plate and wiping member ensures uniform particle distribution and sealing, addressing encapsulation challenges and reducing contamination, thereby improving measurement efficiency.
Patent Information
- Application Number
- JP2025018577
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-03-18
- Filing Date
- 2025-02-06
- Publication Date
- 2025-10-01
AI Technical Summary
Existing methods for encapsulating particles in microwells face challenges in achieving uniform distribution and sealing, leading to reduced measurement efficiency and increased contamination risks.
A particle encapsulation method involving a microwell device with a base plate and wiping member, where a dispersion medium is introduced, filled, and sealed by sliding the wiping member to remove excess medium, ensuring uniform encapsulation and preventing contamination.
The method enables efficient, uniform particle encapsulation in microwells, reducing contamination and measurement time, and enhancing signal quality.
Smart Images

Figure 2025143198000001_ABST
Abstract
Description
[Technical Field]
[0001] The present invention relates to a particle encapsulation method, a microwell device, and a target substance detection method. [Background technology]
[0002] Single-molecule measurement is a known method for performing various measurements by converting biomolecules such as proteins into identifiable forms and then observing them. Several techniques for performing single-molecule measurement are known.
[0003] Patent Document 1 discloses a technique for encapsulating particles in microwells using a configuration in which a partition and a top plate are provided on a microwell array to form a flow channel, and an inlet and an outlet are further provided on the top plate. In Patent Document 1, when particles are placed in the microwells, a hydrophilic liquid medium containing particles that have captured a target substance is introduced from the inlet through the flow channel. Furthermore, when sealing the microwells, a hydrophobic liquid medium is introduced from the inlet through the flow channel in the same way, and unnecessary excess hydrophilic liquid medium is pushed out.
[0004] Furthermore, Non-Patent Document 1 discloses a technique for encapsulating particles in microwells by rolling a roller multiple times while pressing it against adhesive tape placed over the microwells. In Non-Patent Document 1, a partition wall is formed on a microwell array using Kapton tape, and a hydrophilic liquid medium containing particles is directly introduced into the microwells. Subsequently, adhesive tape is placed to bridge the partition wall, and a roller is pressed and rolled multiple times over the tape to push out the excess hydrophilic liquid medium, sealing the microwells. [Prior art documents] [Patent documents]
[0005] [Patent Document 1] International Publication No. 2012 / 121310 [Non-patent literature]
[0006] [Non-Patent Document 1] H. Yaginuma et al.,Lab on a Chip,2022,22, 2001-2010 Summary of the Invention [Problem to be solved by the invention]
[0007] The techniques described in Patent Document 1 and Non-Patent Document 1 both have the problem that it is difficult to uniformly encapsulate particles in microwells.
[0008] Therefore, an object of the present invention is to provide a simple particle encapsulation method that can encapsulate particles uniformly in microwells. [Means for solving the problem]
[0009] In order to solve the above problems, a particle encapsulation method according to one aspect of the present invention comprises: a preparation step of preparing a microwell device comprising a base plate having an array of a plurality of microwells provided on its upper surface, and a wiping member; an introduction step of introducing a dispersion medium containing test particles into the array; a filling step of filling the microwells with the test particles; a removal step of removing the dispersion medium outside the microwells; a sealing step of sealing the microwells with a sealing medium; and The removing step is characterized by including sliding the wiping member in a first direction while in contact with the upper surface of the base plate, thereby moving the dispersion medium out of the array.
[0010] Furthermore, a microwell device according to another aspect of the present invention comprises: A base plate having an array of a plurality of microwells on its upper surface, and a wiping member, the microwell is a well for containing test particles dispersed in a dispersion medium; The wiping member is configured to be able to move the dispersion medium outside the microwells out of the array by sliding it in a first direction while in contact with the upper surface of the base plate.
[0011] Furthermore, a target substance detection method according to another aspect of the present invention comprises: a reaction step of reacting the test particles, which specifically capture the target substance, with the target substance; a particle encapsulation step of performing the particle encapsulation method according to one aspect of the present invention using the test particles after the reaction step; a detection step of detecting test particles that have captured the target substance among the test particles contained in each of the microwells after the particle encapsulation step; The present invention is characterized by having the following: [Effects of the Invention]
[0012] According to the present invention, it is possible to provide a simple particle encapsulation method that can encapsulate particles uniformly in microwells. [Brief explanation of the drawings]
[0013] [Figure 1] FIG. 1 is an exploded perspective view showing an example of the configuration of a microwell device. [Figure 2] FIG. 1 is a perspective view showing an example of the configuration of a microwell device. [Figure 3] 1A to 1C are schematic diagrams illustrating steps of a particle encapsulation method. [Figure 4] FIG. 1 is an exploded perspective view showing an example of the configuration of a microwell device. [Figure 5] FIG. 1 is a perspective view showing an example of the configuration of a microwell device. [Figure 6] 1A to 1C are schematic diagrams illustrating steps of a particle encapsulation method. [Figure 7]FIG. 1 is a perspective view showing an example of the configuration of a microwell device. [Figure 8] FIG. 1 is a perspective view showing an example of the configuration of a microwell device. [Figure 9] FIG. 1 is a perspective view showing an example of the configuration of a microwell device. DETAILED DESCRIPTION OF THE INVENTION
[0014] The present invention will be described in detail below with reference to preferred embodiments. The technology of Patent Document 1 requires precise control of the injection speed of the particle-containing hydrophilic liquid medium to uniformly fill the microwells with particles. Furthermore, when injecting the hydrophobic liquid medium, the hydrophobic liquid medium is continuously introduced through the injection port, which can introduce air bubbles into the hydrophobic liquid medium. Furthermore, it is difficult to uniformly extrude the entire hydrophilic liquid medium and seal it uniformly. In particular, when the microwell array has a large area, it becomes even more difficult to uniformly push the liquid through the wide channel.
[0015] Furthermore, the technology described in Non-Patent Document 1 requires the application of so-called window film installation techniques performed by professional craftsmen, making it difficult to uniformly seal the microwells without leaving any air bubbles in the adhesive tape. Furthermore, there is no process for removing particles that have not entered the microwells, so the microwells are sealed with adhesive tape in a state where particles that have not entered the microwells remain. This can make it difficult to ensure an effective observation range for detection.
[0016] In other words, the techniques described in Patent Document 1 and Non-Patent Document 1 require appropriate techniques for proper operation. Insufficient techniques can result in uneven particle encapsulation in the microwells, a reduced number of particle-encapsulated microwells, or the introduction of air bubbles during sealing. This can result in a reduced signal during measurement, increased noise, and ultimately a longer measurement time. Furthermore, the surplus hydrophilic liquid medium that is extruded can contaminate testing equipment equipped with the microwell device, resulting in increased maintenance work for the user.
[0017] The present inventors have conducted extensive research to solve the problems in the prior art, and as a result have achieved the particle encapsulation method according to the present invention, which will be described in detail below. The particle encapsulation method according to the present invention comprises a preparation step, an introduction step, a filling step, a removal step, and a sealing step. The preparation step is a step of preparing a microwell device including a base plate having an array of multiple microwells on its upper surface and a wiping member. The introduction step is a step of introducing a dispersion medium containing test particles into the array. The filling step is a step of filling the microwells with the test particles. The removal step is a step of removing the dispersion medium outside the microwells. The sealing step is a step of sealing the microwells with a sealing medium. The removal step further includes sliding the wiping member in a first direction while in contact with the upper surface of the base plate, thereby moving the dispersion medium outside the array.
[0018] The particle encapsulation method according to the present invention makes it possible to shorten the time until measurement, increase the signal during measurement, and further reduce the possibility of contamination of the testing device.
[0019] Hereinafter, each configuration of the present invention will be described in detail using exemplary embodiments of the present invention with reference to the drawings. Note that in the drawings, similar or corresponding elements are designated by the same reference numerals, and their description may be omitted or simplified.
[0020] <Microwell device> First, specific structural examples of microwell devices that can be used in the particle encapsulation method of the present invention are shown in Figures 1, 2, 4, 5, and 7 to 9. Figures 2, 5, 7 to 9 are perspective views showing the overall structures of microwell devices 10 to 50. Also, Figure 1 is an exploded perspective view of microwell device 10 shown in Figure 2, and Figure 4 is an exploded perspective view of microwell device 20 shown in Figure 5.
[0021] The microwell device according to the present invention comprises a base plate 11 having an array 14 made up of a plurality of microwells 13 formed on an upper surface 11a thereof, and a wiping member 12.
[0022] The microwells 13 are wells for accommodating the test particles 18a dispersed in the dispersion medium 18b. A specific method for accommodating the test particles 18a dispersed in the dispersion medium 18b in the microwells 13 will be described later with reference to FIGS.
[0023] The wiping member 12 is configured to be able to move the dispersion medium 18b outside the microwells 13 out of the array 14 by sliding it in a first direction A while in contact with the upper surface 11a of the base plate 11.
[0024] Preferably, the microwell device according to the present invention further comprises a partition member 15. Here, partition member 15 is configured so as to be able to be provided in contact with upper surface 11a of base plate 11, and has at least a first portion 151 extending in first direction A outside array 14 on upper surface 11a of base plate 11. Thus, partition member 15 is configured to impede the flow of dispersion medium 18b in second direction B perpendicular to first direction A on upper surface 11a of base plate 11.
[0025] The partition member 15 preferably has two first portions 151 disposed on either side of the array 14, and at least one second portion 152 connecting the ends of the two first portions 151 and extending in the second direction B. Furthermore, the wiping member 12 is preferably configured to be used in a state in which it is placed between the two first portions 151 so that it can sandwich the array 14 together with the second portion 152. As a result, a dispersion medium 18b containing test particles 18a can be introduced into a first region 16 sandwiched between the first surface 12a of the wiping member 12 and the second portion 152, as will be described later in detail. Alternatively, a sealing medium 19 can be introduced into a second region 17 sandwiched between the second surface 12b of the wiping member 12 and the second portion 152. Here, the first surface 12a of the wiping member 12 is a surface configured to come into contact with the dispersion medium 18b in the removal step and move the dispersion medium 18b. The second surface 12b of the wiping member 12 is a surface configured to come into contact with the sealing medium 19 in the sealing step and move the sealing medium 19. When the dispersion medium 18b or the sealing medium 19 is moved using the wiping member 12, the flow of excess dispersion medium 18b or sealing medium 19 that has passed over the array 14 can be blocked by the second portion 152.
[0026] That is, by having the microwell device include the partition member 15 having the above-described configuration, it is possible to effectively prevent the test apparatus from being contaminated by excess dispersion medium 18b or sealing medium 19 that has flowed out of the microwell device. Furthermore, by having the microwell device include the partition member 15, it is possible to prevent dispersion medium 18b introduced onto array 14 from flowing out to areas outside array 14, and it is also possible to improve the efficiency of filling test particles 18a into microwells 13.
[0027] The partition member 15 preferably has two second portions 152, one of which connects one end of each of the two first portions 151, and the other of which connects the other end of each of the two first portions 151. This makes it possible to block the flow of both the dispersion medium 18b and the sealing medium 19 in the extrusion direction.
[0028] In the microwell device 10 shown in Figures 1 and 2, the wiping member 12 and the partition member 15 are configured to be independent of each other and their relative positions are variable. However, the wiping member 12 and the partition member 15 may be configured as a single unit, as in the microwell devices 20 to 50 shown in Figures 4, 5, and 7 to 9.
[0029] In addition, in the microwell devices 10, 20, 40, and 50 shown in Figures 1, 2, 4, 5, 8, and 9, the base plate 11 and the partition member 15 are configured to be in contact with each other at rectangular flat surfaces formed by the outlines of the base plate 11 and the partition member 15, respectively. However, the overall shape of the microwell device according to the present invention is not limited to this, and may be, for example, a disk shape, such as the microwell device 30 shown in FIG. 7. In the microwell device 30 shown in FIG. 7, the wiping member 12 rotates relative to the base plate 11 about an axis 31, thereby moving the dispersion medium 18b outside the microwells 13 out of the array 14. That is, in the microwell device 30 shown in FIG. 7, the direction in which the wiping member 12 rotates when moving the dispersion medium 18b outside the microwells 13 out of the array 14 is the first direction A. In the present invention, if the trajectory of the first direction A along which the wiping member 12 slides when moving the dispersion medium 18b outside the microwells 13 out of the array 14 is not linear, the direction perpendicular to the tangent to the trajectory of the first direction A is defined as the second direction B. That is, in the case of the microwell device 30 shown in Figure 7, when the trajectory traced by the first direction A is an arc centered on the axis 31, the radial direction of the circle centered on the axis 31 becomes the second direction B as shown in Figure 7.
[0030] <Particle encapsulation method> Next, each step of the particle encapsulation method according to the present invention using the microwell device described above will be described with reference to Figures 3 and 6. Figure 3 is a cross-sectional view taken along the first direction A, showing the arrangement of each element in each step of the particle encapsulation method using the microwell device 10 shown in Figures 1 and 2. Figure 6 is a cross-sectional view taken along the first direction A, showing the arrangement of each element in each step of the particle encapsulation method using the microwell device 20 shown in Figures 4 and 5. Note that in Figures 3 and 6, the first portion 151 of the partition member 15 is omitted in order to clearly show the wiping member 12 and the dispersion medium 18b and sealing medium 19 moved thereby.
[0031] First, an example of carrying out the particle encapsulation method according to the present invention using the microwell device 10 shown in FIGS. 1 and 2 will be described with reference to FIG.
[0032] (preparation process) First, in the preparation step, the microwell device 10 shown in FIGS. 1 and 2 is prepared.
[0033] (Introduction process) Subsequently, in the introduction step, a dispersion medium 18b containing test particles 18a is introduced into the array 14. The introduction of the dispersion medium 18b containing the test particles 18a into the array 14 may be achieved by dropping the dispersion medium 18b containing the test particles 18a directly onto the array 14 using, for example, a pipette. Alternatively, first, dispersion medium 18b containing test particles 18a is introduced into an area of upper surface 11a of base plate 11 where array 14 is not formed. Subsequently, wiping member 12 is slid in contact with upper surface 11a of base plate 11 to move dispersion medium 18b containing test particles 18a onto array 14.
[0034] Specifically, for example, when the microwell device 10 shown in FIGS. 1 and 2 is prepared in the preparation step, the wiping member 12 is first placed at a position sufficiently distant from the array 14 as shown in FIG. 3(a). Next, as shown in FIG. 3(b), a dispersion medium 18b containing test particles 18a is introduced into the first region 16 between the first surface 12a of the wiping member 12 and the second portion 152. At this time, the position on the upper surface 11a of the base plate 11 where the dispersion medium 18b containing the test particles 18a is introduced is set between the array 14 and the first surface 12a. Thereafter, while maintaining the wiping member 12 in contact with the upper surface 11a of the base plate 11, the wiping member 12 is slid in the first direction A toward the array 14, and the dispersion medium 18b containing the test particles 18a is introduced onto the array 14 as shown in FIG. 3(c).
[0035] In the introduction step, the dispersion medium 18b containing the test particles 18a is preferably introduced to such an extent that it covers the entire array 14. When the dispersion medium 18b containing the test particles 18a is introduced to such an extent that it covers the entire array 14, the dispersion medium 18b containing the test particles 18a may flow and spread to areas on the base plate 11 other than the array 14. This may reduce the efficiency with which the test particles 18a are filled into the microwells 13 or may cause damage or contamination of the test device. For this reason, it is preferable to provide the base plate 11 with, for example, a partition or groove, or to instead make the areas corresponding to the partition or groove specifically hydrophilic or hydrophobic to impart similar functions.
[0036] In the particle encapsulation method according to the present invention, the dispersion medium 18b containing the test particles 18a is introduced into the array 14 as one large mass, rather than as a flow. This operation can be performed by simply dropping the dispersion medium 18b containing the test particles 18a onto the array 14, or by simply sliding the wiping member 12 after introducing the dispersion medium 18b containing the test particles 18a onto the base plate 11, so that the test particles 18a can be easily and uniformly introduced into the microwells 13.
[0037] (filling process) Next, in the filling step, test particles 18a are filled into the microwells 13. Specifically, as shown in Fig. 3(d), the test particles 18a in the dispersion medium 18b are stored in the microwells 13 by natural sedimentation or magnetic force.
[0038] In order to fill the microwells 13 with the test particles 18a contained in the dispersion medium 18b filled on the array 14, natural sedimentation using the weight of the test particles 18a can be achieved, but vibration or centrifugal force may also be used in combination to further increase the filling rate.
[0039] If the test particles 18a are magnetic, a magnetic field can also be used. However, if the magnetic field response of the magnetic test particles 18a is too high, if the strength of the applied magnetic field is too high, or if the magnetic field is applied for too long, the magnetic field may align the test particles 18a in the height direction along the magnetic field lines. As a result, there is a concern that the filling rate of the test particles 18a may decrease. Therefore, the strength and application time of the applied magnetic field must be optimized. Furthermore, even if the magnetic field causes the test particles 18a to align in the height direction along the magnetic field lines, it is preferable to loosen the test particles 18a and prevent a decrease in the filling rate by weakening the applied magnetic field or by providing a period when no magnetic field is applied.
[0040] Furthermore, in order to more efficiently fill the microwells 13 with the test particles 18a, it is preferable to also perform a degassing operation. The degassing operation forcibly exchanges gas and liquid between the air in the microwells 13 and the dispersion medium 18b containing the test particles 18a, thereby creating an environment in which the microwells 13 are efficiently filled with the test particles 18a. A suitable degassing method is, for example, leaving the base plate 11 having the array 14 or the entire microwell device 10 in a reduced pressure environment. Specifically, for example, the base plate 11 having the array 14 or the entire microwell device 10 may be left in a reduced pressure desiccator at approximately 0.1 atmospheres for approximately 30 seconds.
[0041] In order to improve the accuracy of testing when the test particles 18a sealed in the microwells 13 by the particle sealing method of the present invention are subjected to testing, it is preferable that, in the filling process, each microwell 13 is filled with an average of one test particle 18a.
[0042] (Removal process) Next, in the removal step, the dispersion medium 18b outside the microwells 13 is removed. Specifically, the wiping member 12 is again slid in the first direction A while being in contact with the base plate 11 so that the first surface 12a, which is the surface of the wiping member 12 that comes into contact with the dispersion medium 18b, passes over the array 14. This moves the dispersion medium 18b outside the microwells 13 to a position sufficiently far from the array 14, as shown in Figure 3(e).
[0043] If not all of the test particles 18a in the dispersion medium 18b introduced into the array 14 fill the microwells 13, then both the test particles 18a and the dispersion medium 18b for the test particles 18a will be present on the array 14. Also, if all of the test particles 18a in the dispersion medium 18b introduced into the array 14 fill the microwells 13, then the dispersion medium 18b for the test particles 18a will be present on the array 14. The dispersion medium 18b outside the microwells 13 refers to both of these.
[0044] Dispersion medium 18b outside microwells 13 is removed by sliding wiping member 12 over base plate 11 and moving it to an area of base plate 11 where arrays 14 are not formed. At this time, if test particles 18a in dispersion medium 18b have settled on base plate 11 where there are no microwells 13 in array 14, it is expected that test particles 18a will be moved and enter microwells 13 during the removal process, which can also improve the filling rate.
[0045] Furthermore, if a degassing operation is also performed, fine air bubbles that have risen to the surface from within the microwells 13 during the removal process are also removed. In the prior art, a method may be used in which a liquid sealing medium is used to flush out the dispersion medium 18b containing the test particles 18a using a flow cell when fine air bubbles are present after the degassing operation. In this case, a flow that avoids the air bubbles may occur, preventing the dispersion medium 18b from being flushed out evenly, resulting in the microwells 13 not being sealed evenly. Furthermore, if the liquid sealing medium is flowed forcefully or in large quantities to push out the air bubbles, there is a concern that the testing device may be contaminated by the dispersion medium 18b or sealing medium 19 that has leaked out of the microwell device 10.
[0046] However, in the particle encapsulation method according to the present invention, the dispersion medium 18b is removed from the array 14 as one large mass rather than as a flow by sliding the wiping member 12. This operation is also simple: after introducing the dispersion medium 18b into the array 14 and filling the microwells 13 with the test particles 18a, the wiping member 12 is simply slid, allowing the dispersion medium 18b to be removed easily and evenly. It is also possible to prevent air bubbles from being mixed in when sealing the microwells.
[0047] When test particles 18a are filled using a magnetic field, as mentioned above, depending on the magnetic field response of the test particles 18a and the strength or duration of the applied magnetic field, the test particles 18a may align vertically along the magnetic field lines. If a sliding operation is performed in this state, the test particles 18a may easily get trapped between the cover plate and the base plate, which may interfere with the liquid medium removal process or the sealing process described below. Therefore, it is preferable to weaken the magnetic field applied before the sliding operation, or to not apply a magnetic field at all.
[0048] (Sealing process) Next, in the sealing step, the microwells 13 are sealed with a sealing medium 19. Specifically, as shown in FIG. 3(e), the sealing medium 19 is first introduced into the second region 17 between the second surface 12b of the wiping member 12 and the second portion 152 of the partition member 15. At this time, the position on the upper surface 11a of the base plate 11 where the sealing medium 19 is introduced is set between the array 14 and the second surface 12b. Next, the wiping member 12 is slid in the direction opposite to the first direction A, i.e., toward the array 14, while in contact with the upper surface 11a of the base plate 11, so that the sealing medium 19 moves onto the microwells 13 and seals them, as shown in FIG. 3(f). That is, in the example shown in the microwell device 10, the first surface 12a where the wiping member 12 abuts against the dispersion medium 18b and the second surface 12b where the wiping member 12 abuts against the sealing medium 19 are different surfaces.
[0049] In the sealing step, for example, if the sealing medium 19 is a liquid, the sealing medium 19 may first be dropped directly onto the array 14 using a pipette or the like. Alternatively, as described above, the sealing medium 19 may be introduced into an area on the base plate 11 where the array 14 is not formed, and then moved onto the array 14 by the wiping member 12. This forms a layer of the sealing medium 19 on the microwells 13, sealing the microwells 13. Thereafter, as shown in FIG. 3(g), the wiping member 12 is further gently slid to move the sealing medium 19 introduced onto the array 14 to an area on the base plate 11 where the array 14 is not formed. At this time, care is taken not to press the wiping member 12 too hard against the base plate 11. This allows a thin film of the sealing medium 19 to be formed on the microwells 13, thereby sealing the microwells 13.
[0050] When the sealing medium 19 is a solid such as a cover glass, the microwells 13 can also be sealed by covering the array 14 with the sealing medium 19. In this case, the sealing medium 19 may be lowered from above the array 14 to cover it, or may be moved onto the array 14 by sliding it on a base plate to cover it.
[0051] The sealing step may also be a combination of two operations, such as sealing once with a liquid sealing medium 19 and then sealing again with a solid sealing medium 19 .
[0052] Next, an example of carrying out the particle encapsulation method according to the present invention using the microwell device 20 shown in FIGS. 4 and 5 will be described with reference to FIG.
[0053] (preparation process) First, in a preparation step, the microwell device 20 shown in FIGS. 4 and 5 is prepared.
[0054] (Introduction process) Next, as shown in Fig. 6(a), the wiping member 12 is placed on the upper surface 11a of the base plate 11 so that the first region 16 sandwiched between the second portion and the first surface 12a of the wiping member 12 does not overlap with the array 14. Next, as shown in Fig. 6(b), a dispersion medium 18b containing test particles 18a is introduced into the first region 16. Next, as shown in Fig. 6(c), the wiping member 12 is slid in the first direction A while maintaining contact with the upper surface 11a of the base plate 11 so that the first region 16 covers the array 14, and the dispersion medium 18b is introduced into the array 14.
[0055] (filling process) Next, as shown in FIG. 6(d), the test particles 18a in the dispersion medium 18b are placed in the microwells 13 by natural sedimentation or by using magnetic force.
[0056] (Removal process) As shown in FIG. 6( c ) or 6 ( d ), with the wiping member 12 positioned so that the first region 16 covers the array 14 , a sealing medium 19 is introduced into the second region 17 . Then, the wiping member 12 is again slid in the first direction A while still in contact with the base plate 11, and the dispersion medium 18b introduced into the first region 16 is moved to a region on the base plate 11 where the array 14 is not formed, as shown in Figure 6(e). This removes the dispersion medium 18b outside the microwells 13. At the same time, the sealing medium 19 introduced into the second region 17 is also moved (Figure 6(e)).
[0057] If the wiping member 12 also functions as a sealing medium 19 at this stage to seal the microwell 13, the removal process and the sealing process will be performed simultaneously, and the sealed test particle 18a can be subjected to testing or measurement.
[0058] (Sealing process) From the state shown in Figure 6(e), the wiping member 12 continues to slide in the first direction A while maintaining contact with the base plate 11. Then, as shown in Figure 6(f), the wiping member 12 is positioned so that the sealing medium 19 introduced into the second region 17 covers the array 14. This allows the microwells 13 to be sealed with the sealing medium 19 (Figure 6(f)).
[0059] The wiping member 12 continues to slide in the first direction A while maintaining contact with the base plate 11. As a result, as shown in FIG. 6(g), the wiping member 12 is used to move and remove excess sealing medium 19 on the array 14 to an area on the base plate 11 where the array 14 is not provided. Thereafter, as shown in FIG. 6(g), the microwells 13 may be sealed by both the thin layer of sealing medium 19 and the bottom surface of the wiping member 12. Alternatively, the wiping member 12 may be further slid in the first direction A to a position away from the top of the array 14, and the microwells 13 may be sealed by the sealing medium 19 alone.
[0060] In this way, by sliding the wiping member 12, the array 14 can be moved by, for example, 1 cm. 2Even when the microwell 13 has a large area exceeding 18, the test particles 18a can be sealed in the microwell 13 easily, uniformly, and with high efficiency.
[0061] 6, all four steps, namely, the introducing step, filling step, sealing step, and removing step, are performed by sliding the wiping member 12, but this is not limited to this. If one or more of the above four steps, including the removing step, can be performed by sliding the wiping member 12, particles can be encapsulated more easily than before.
[0062] In addition, the introduction step may be performed when the wiping member 12 is in the position shown in Figure 6(c) relative to the base plate 11 instead of Figure 6(b), in which case the introduction step does not include the sliding operation of the wiping member 12.
[0063] Furthermore, although an example has been described in which the sealing medium 19 is introduced into the second region 17 when the wiping member 12 is in the position shown in FIG. 6(c) relative to the base plate 11, the present invention is not limited to this. For example, if the base plate 11 is present below the second region 17 in the position shown in FIG. 6(b), the sealing medium 19 may be introduced into the second region 17 in this position. Furthermore, as described above, the introducing step may be performed when the wiping member 12 is in the position shown in FIG. 6(c) relative to the base plate 11, and the sealing medium 19 may be introduced into the second region 17 at the same time. Furthermore, the sealing medium 19 may be introduced into the second region 17 when the wiping member 12 and the base plate 11 are in the position shown in FIG. 6(e) or 6(f).
[0064] Next, each element of the present invention will be further described. (base plate) The material constituting the base plate is preferably selected from cycloolefin polymer, cycloolefin copolymer, silicon, glass, ABS resin, polycarbonate resin, acrylic resin, polyvinyl chloride, polystyrene resin, polyethylene resin, polypropylene resin, polyvinyl acetate, PET (polyethylene terephthalate), PEN (polyethylene naphthalate), etc. Considering that the test particles sealed in the microwells provided in the base plate will be inspected or measured after sealing, the base plate is preferably made of a light-transmitting material. Furthermore, the material constituting the base plate is preferably one that does not have autofluorescence, and further considering the processability for forming a microwell array, it is more preferable to select cycloolefin polymer, cycloolefin copolymer, or acrylic resin.
[0065] The base plate is composed of an area where an array of microwells is formed and a flat area where nothing is formed. Furthermore, a hydrophilic liquid is often preferably used as a dispersion medium for the test particles. Therefore, it is preferable to subject at least the area where the array is formed to hydrophilic treatment in order to improve the filling rate of the test particles into the microwells formed in the base plate.
[0066] As described above, the inclusion of a partition member in a microwell device can improve the filling rate of test particles into the microwells and prevent contamination of the test device. However, if the microwell device does not include a partition member, it is preferable to perform a chemical treatment to make the base plate hydrophilic or hydrophobic, or a physical treatment such as providing a groove, at the location on the base plate where the partition member can be provided.
[0067] (Wiping member and partition member) The wiping member is configured to be able to move the dispersion medium outside the microwells out of the array by sliding it in a first direction while in contact with the upper surface of the base plate as described above.
[0068] The width of the first surface, where the wiping member contacts the dispersion medium of the test particles, in the second direction is preferably larger than the width of the array in the second direction. Here, the second direction is a direction perpendicular to the first direction, which is the direction in which the wiping member is slid in the removal step. This allows the removal step to be performed with a single sliding operation.
[0069] The wiping member functions as a wiper by sliding on the base plate, and at least the removal step out of the four steps of the introduction step, filling step, sealing step, and removal step is performed by this sliding operation.
[0070] The wiping member is slid while applying force in the direction that presses it against the base plate. Therefore, to allow the wiping member to slide smoothly without getting caught on the base plate, it is preferable that the edge of the third surface of the wiping member that comes into contact with the base plate be rounded to an appropriate radius.
[0071] In addition, in order to slide the wiping member and the base plate while keeping them in close contact with each other, like when a film is applied with water, a medium (a water-soluble medium or a hydrophobic medium) may be applied between the wiping member and the base plate to improve the slipperiness. For example, the same medium as the dispersion medium of the test particles or the sealing medium can be used as the medium for improving the slipperiness.
[0072] The wiping member can have partitions, for example, as in the microwell device 50 shown in FIG. 9 , to test multiple samples or multiple items in a single array. Here, the partitions function to divide the microwells constituting the array into two or more groups. That is, the wiping member 12 can have one or more first partitions 51 extending from the first surface 12 a in a first direction A and configured to prevent movement of the dispersion medium 18 b in a second direction B perpendicular to the first direction A. The wiping member 12 can also have one or more second partitions 52 extending from the second surface 12 b in the first direction A and configured to prevent movement of the sealing medium 19 in the second direction B. Note that the second partitions 52 are preferably located at the same position as the first partitions 51 relative to the wiping member 12 in the second direction B. That is, the first partitions 51 and the second partitions 52 preferably follow the same trajectory when the wiping member 12 slides over the base plate 11.
[0073] 9, the first region 16 sandwiched between the first surface 12a and the second portion 152 is divided into two third regions 16a, 16b defined by the first partition 51 and the first surface 12a. Therefore, when using the microwell device 50, the introducing step can include introducing a dispersion medium 18b containing test particles 18a into the third regions 16a, 16b.
[0074] 9, second region 17, sandwiched between second surface 12b and second portion 152, is divided into two fourth regions 17a, 17b defined by second partition 52 and second surface 12b. Therefore, when microwell device 50 is used, the sealing step can include introducing sealing medium 19 into fourth regions 17a, 17b.
[0075] By providing the wiping member with the first and second partitions, it is possible to perform multiple specimens and multiple tests when the array is large enough. Also, different sealing media can be introduced and used for each of the fourth regions separated by the second partitions.
[0076] As mentioned when explaining the particle encapsulation method using microwell device 20 with reference to Figure 6, wiping member 12 may also function as sealing medium 19. That is, third surface 12c of wiping member 12 that contacts base plate 11 may have a sealing surface large enough to cover array 14. In this case, the sealing step can include, for example, placing wiping member 12 at a position relative to base plate 11, for example, as shown in Figure 6(e), and covering array 14 with the sealing surface.
[0077] Furthermore, for example, if the base plate 11 is made of a light-transmitting material and the sealing surface is coated with metal, then when the microwells 13 are sealed with the coated surface of the third surface of the wiping member 12, it is possible to suitably carry out an optical test. Specifically, for example, the emitted light from within the microwells 13 is reflected by the metal surface that coats the sealing surface, thereby increasing the efficiency of emitting light and improving detection sensitivity.
[0078] Furthermore, if the sealing surface is coated with metal by vapor deposition, the adhesion between the metal and the substrate (sealing surface) is weak, raising the concern that the deposited thin metal film may peel off during the sliding of the wiping member 12. Therefore, rather than the sealing surface provided on the third surface 12c where the wiping member 12 directly contacts the base plate 11, the fourth surface of the wiping member 12 opposite the third surface 12c may be coated with metal. That is, the fourth surface 12d of the wiping member 12 opposite the third surface 12c that contacts the base plate 11 may have a metal-coated surface facing the sealing surface and large enough to cover the sealing surface. In this case, the microwells 13 are sealed by covering the array 14 with the sealing surface during the sealing process. Furthermore, although light cannot be directly reflected within the thickness range of the wiping member 12, the light extraction efficiency can be increased compared to when the wiping member 12 does not have a metal-coated surface.
[0079] The wiping member is preferably configured to be used together with a partition member having two first portions and to be connected to each of the two first portions. This allows the area formed by the first surface of the wiping member and the first portion of the partition member to be completely separated from the area formed by the second surface of the wiping member and the first portion of the partition member by sandwiching the wiping member itself. This eliminates concerns about the dispersion medium and the sealing medium mixing with each other, making operation easier.
[0080] In the microwell device according to the present invention, when a structure having the function of a partition member is not provided on the upper surface 11a of the base plate 11, it is preferable that the microwell device has a partition member.
[0081] The partition member has at least a first portion extending in a first direction configured to obstruct the flow of the dispersion medium in a second direction, and the length of the first portion in the first direction is preferably longer than the length of the array in the first direction.
[0082] 1, 2, 4, 5, 7 to 9 show an example in which the shape of the partition member 15 is defined by a first portion 151 extending linearly in a first direction A in which the wiping member 12 slides and a second portion 152 extending linearly in a second direction B perpendicular to the first direction. However, the shape of the partition member 15 is not limited thereto. That is, the partition member 15 only needs to have a structure that functions as a wall to prevent the dispersion medium 18b or the sealing medium 19 from flowing out of the array 14 and contaminating the testing device, and the shape of the structure that functions as the wall is not particularly limited. For example, the shapes of the first region 16 and the second region 17 are also not particularly limited, and the outlines may be square or round. In particular, it is preferable that the first region 16 and the second region 17 have an area sufficient to completely cover the array when they overlap with the array.
[0083] The partition member may be composed of multiple members, but is preferably composed of a single member in consideration of cost and structural complexity.Furthermore, it is more preferable that the partition member and the wiping member are integrated into a single member.
[0084] The microwell device 20 shown in FIGS. 4 and 5 is an example of a microwell device in which the partition member and wiping member are formed as a single member. In the microwell device 20, the partition member and wiping member are integrally formed as a single member, and holes (first region 16 and second region 17) are formed through the member. In the microwell device 20, the walls in the sliding direction of the inner walls of the holes function as the first surface 12a and the second surface 12b. In the example shown in FIG. 4, the square holes are formed as the inner walls of the holes. In FIG. 4, two holes are formed in the member: a hole serving as the first region 16 for introducing the dispersion medium 18b containing the test particles 18a, and a hole serving as the second region 17 for introducing the sealing medium 19. However, this is not limited to this. For example, a single hole may be formed in the member to reduce the difficulty of processing. The microwell device 40 shown in FIG. 8 is an example of a single hole formed in a single member in which the partition member and wiping member are integrally formed as a single member. The wiping member 12 (partition member 15) of the microwell device 40 has a shape similar to that of the wiping member 12 (partition member 15) shown in Figures 4 and 5, with the second portion that forms the wall on the first direction A side of one of the holes removed.
[0085] The wall-functioning structures, such as the first and second portions of the partition member, preferably have a height sufficient to prevent the dispersion medium containing test particles or the sealing medium from overflowing when the dispersion medium or the sealing medium in liquid form is introduced. If the wall-functioning structures of the partition member have a sufficient height, when the first and second regions are closed spaces, the dispersion medium or the sealing medium can be contained in these regions, eliminating concerns about the dispersion medium or the sealing medium spreading over time or due to vibration. Furthermore, when the microwell device is tilted, the dispersion medium or the sealing medium in the first and second regions can be prevented from spilling out.
[0086] Considering that the wiping member and the partition member come into contact with the dispersion medium containing the test particles and the sealing medium, it is preferable to select a material that does not contain components that will dissolve in the solvent contained in the dispersion medium or the sealing medium. Specific materials for the wiping member and the partition member can be selected from the materials listed in the description of the base plate, for example.
[0087] (Microwells and Arrays) To form an array of microwells, a known manufacturing method such as photolithography, microinjection molding, or nanoimprinting can be selected. There are no particular limitations on the shape of the outline of the entire array, and it may be square or round. As mentioned above, when multiple specimens or multiple tests are performed, a square shape is preferred because each step in the particle encapsulation method can be efficiently performed by sliding the wiping member.
[0088] The shape of the microwells constituting the array is not particularly limited, but from the standpoint of ease of processing, a cylindrical, conical, truncated conical, etc. For example, a truncated conical shape is more preferable in consideration of the likelihood of defects in the microwells occurring due to the mold coming into contact with the substrate when removed from the mold, and the ease of entry of test particles.
[0089] The minimum diameter and depth of the microwell opening are equal to or greater than the diameter of the test particle. Each microwell may contain one or more test particles, but if a large number of test particles are placed in each microwell, the total number of particles required will increase, increasing the testing cost and possibly requiring ingenuity to improve detection accuracy. Therefore, the number of test particles placed in each microwell is preferably between 1 and 4, and more preferably 1. For this reason, the maximum length and depth of the opening diameter of the microwell are preferably 1.0 to less than 2.0 times the average particle diameter of the test particles. Furthermore, the maximum length of the opening diameter of the microwell is more preferably 1.5 to less than 2.0 times the average particle diameter of the test particles. Specifically, for example, the minimum diameter of the microwell is 1.5 μm to less than 10 μm. Specifically, for example, the depth of the microwell is 1.0 μm to less than 10 μm.
[0090] If the distance between microwells in the array is too close, it becomes difficult to separate signals during observation and processing itself. However, if they are too far apart, the number of signals that can be obtained from the same microwell array area decreases. Therefore, it is preferable that the distance between the centers of the microwells be between 5 μm and 15 μm.
[0091] (test particle) The test particles preferably have an average particle size of 1 μm or more and 5 μm or less. This allows for efficient filling of the microwells and high-density arrays. The average particle size here refers to a value measured using electron microscopy or dynamic light scattering.
[0092] The test particles may be made of either organic or inorganic materials, and various materials can be combined. Considering the process of filling the microwells with the test particles and the process of binding molecules for capturing target substances, which will be described later, it is preferable that the test particles be configured as follows: That is, it is preferable that the test particles have a heavy inorganic layer on the core side and an organic shell on the outermost surface that easily binds molecules for capturing target substances.
[0093] Examples of materials that can be used to form the inorganic layer include silica, alumina, iron oxide, iron, zirconia, titanium oxide, etc. The core of the test particle can be formed from a single material, or can be formed by covering an organic layer with an inorganic layer.
[0094] Commercially available particles that can be used in the present invention include, for example, Magnosphere (registered trademark) MS300, Magnosphere (registered trademark) MS160, PureProteome (registered trademark) Nickel Magnetic Beads, magnetic particles provided in the Simoa (registered trademark) Homebrew Assay Kit (Quanterix), Polybead (registered trademark) Microspheres, and Hypressica (registered trademark) manufactured by Ube Exsymo.
[0095] The test particles are preferably made of a paramagnetic material such as iron, nickel, or magnetite, a ferromagnetic material, or a supermagnetic material, but other materials are also acceptable. By using magnetic particles, application of a magnetic field not only facilitates filling the microwells with the test particles described above, but also facilitates purifying the test particles that have captured the target substance after the reaction step of capturing the target substance on the test particles, which will be described later.
[0096] In addition, the test particles filled and sealed in the microwells may contain test particles that have captured a target substance as well as test particles that have not. For example, test particles to which molecules for specifically capturing the target substance are bound can be used as test particles that specifically capture a target substance. The molecules for specifically capturing the target substance may be bound to a modifying group on the surface of the test particle, for example, via a linker. The molecules for specifically capturing the target molecule can be bound, for example, to amino groups on the surface of amino-modified test particles by covalent bonding via a crosslinker containing N-hydroxysuccinimide or the like. The molecules for specifically capturing the target substance can be selected depending on the target substance, and for example, proteins, antibodies, nucleic acids, etc. can be used. It is preferable that more than 100,000 molecules of molecules for specifically capturing the target substance are bound to each test particle. For example, when the target capture molecule is an antibody, the dissociation constant is on the order of nM. However, the above-described configuration allows for a sufficiently high concentration of the target capture molecule when the test particle is reacted with the target substance.
[0097] The number of test particles introduced into the array is preferably equal to or greater than the total number of microwells constituting the array, and the upper limit of the number of test particles to be introduced can be determined based on the relationship between the size of the microwell and the size of the test particles. For example, if only one test particle can be accommodated in one microwell, the upper limit of the number of test particles to be introduced can be set to the same as the total number of microwells constituting the array. Also, for example, if the size relationship allows one microwell to be filled with three test particles, the upper limit of the number of particles to be introduced can be set to three times the total number of microwells constituting the array.
[0098] (target substance) The target substance refers to the molecule to be detected, i.e., the molecule to be detected by capturing it on the test particle. Examples of target substances include biomolecules such as proteins, enzymes, nucleic acids, peptides, lipid metabolites, and sugars, as well as virus particles themselves.
[0099] Enzymes include, for example, any enzymes present on the surface or inside of extracellular vesicles. Examples of such enzymes include MMP (matrix metalloproteinase), MMP family such as ADAM (a disintegrin and metalloproteinase), ADAMTS (ADAM with thrombospondin motifs), matriptase, β-secretase, ECE (endothelin-converting enzyme), calpain, DPPIV (dipeptidyl Examples of enzymes include various proteases such as peptidase-4, ACE1 (angiotensin-converting enzyme 1), and ACE2 (angiotensin-converting enzyme 2); various esterases such as AChE (acetylcholinesterase), autotaxin, lipase, phospholipase, and phosphatase; hydrolases such as various glycosidases such as β-galactosidase; various oxidases such as MAO (monoamine oxidase); various peroxidases such as MPO (myeloperoxidase); oxidoreductases such as catalase and superoxide dismutase; various acetylation / deacetylases such as HAT (histone acetyltransferase) and HDAC (histone deacetylase); transferases such as kinases, protein kinases, and glycosyltransferases; various cis-trans isomerases such as Pin1 (PPIase: peptidylprolyl isomerase); and isomerases such as racemases and mutases.
[0100] (dispersion medium) The dispersion medium used to contain test particles and fill the microwells with test particles can be appropriately selected from a variety of media depending on the test particles used. Among these, hydrophilic liquid media are often suitable for use as dispersion media. Examples of hydrophilic liquid media that can be used as dispersion media include at least one selected from the group consisting of water, hydrophilic alcohols, hydrophilic ethers, ketones, nitrile-based solvents, dimethyl sulfoxide, and N,N-dimethylformamide, or mixtures containing these. Examples of hydrophilic alcohols include ethanol, methanol, propanol, and glycerin. Examples of hydrophilic ethers include tetrahydrofuran, polyethylene oxide, and 1,4-dioxane. Examples of ketones include acetone and methyl ethyl ketone. Examples of nitrile-based solvents include acetonitrile. The dispersion medium contains test particles that have captured a target substance and test particles that have not captured a target substance, and may further contain other substances, such as a substance for specifically detecting the target substance captured by the test particles, a standard fluorescent substance for identifying the droplets or microwells, a blocking material, a buffer, a surfactant, etc.
[0101] A preferred example of a substance for specifically detecting a target substance captured by a test particle is a fluorescent substrate that is decomposed by a specific enzyme bound to the target substance captured by the test particle or a molecule specifically bound to the target substance to release a fluorescent substance. The molecule that specifically binds to the target substance may be, for example, a secondary antibody, a nucleic acid, or the like.
[0102] Examples of reporter molecules whose luminescence intensity increases upon structural changes due to enzymatic activity include molecules labeled with a fluorescent substance and a quencher. Examples of such reporter molecules include molecules (FRET substrates) that contain a fluorescent substance and a quencher at both ends or on a modifiable amino acid residue within the reporter molecule, respectively, and a peptide that serves as a substrate for the target enzyme between them. Before enzymatic cleavage, the fluorescent substance in the FRET substrate is quenched due to the proximity of the fluorescent substance and the quencher. However, upon enzymatic cleavage of the peptide, the quenching by the quencher is released, resulting in fluorescence emission. Using a FRET substrate as a reporter molecule allows the presence or absence of a target enzyme to be observed as a large change in fluorescence intensity. The peptide contained in the FRET substrate preferably has three or more residues in terms of reactivity and 30 or fewer residues in terms of quenching effect. Furthermore, reporter molecules that are converted from non-fluorescent to fluorescent substances upon a change in chemical structure due to enzymatic activity are also preferred, as they produce a large change in brightness. Commercially available reporter molecules can be used as appropriate for such reporter molecules.
[0103] Furthermore, custom synthesis can be performed by combining a fluorescent substance and a quencher at either end of the substrate sequence or within the substrate sequence, based on the substrate sequence of the target enzyme.
[0104] As a standard fluorescent substance for identifying droplets or microwells, a dye having a suitable emission wavelength can be selected from, for example, Alexa Fluor® dyes or Dy Light® dyes. When using the former and latter in combination, it is preferable to select dyes with different emission wavelengths for easier observation.
[0105] The blocking material functions to fill in the linker bonded portion of the test particle where the capture protein does not bind when the test particle and the capture protein are bonded. For example, when the amino group of the capture protein and the carboxyl group of the test particle are condensed using NHS / WSC, the test particle may have unreacted carboxyl groups after the reaction. Therefore, the carboxyl groups that do not bind to the capture protein can be reacted with a blocking agent such as ethanolamine or PEG having an amino group. Known blocking materials can be used, such as Blockmaster® CE510, CE210, DB1130, and PA1080.
[0106] Examples of the buffer include Tris-based buffers and HEPES-based buffers.
[0107] Surfactants can be used to stabilize the dispersion of test particles and to stabilize proteins. Examples of surfactants include Brij 35, Brij 58, Tween 20, Tween 80, NP40, Triton X-100, and Triton X-114. Specific examples of surfactants include Binding buffer (20 mM Tris-HCl (pH 7.6), 100 mM KCl, 5 mM MgCl, 1 mM DTT, 5% glycerol, and 50 μg / mL heparin), NEBuffer® 2.1 (10 mM Tris-HCl, 50 mM NaCl, 10 mM MgCl, and 100 μg / mL bovine serum albumin (BSA), pH 7.9), and FZ Buffer (20 mM HEPES, 60 mM NaCl, and 6 mM MgCl, pH 6.8).
[0108] (Encapsulation medium) If the sealing medium is a liquid, using a hydrophobic liquid medium can prevent the dispersion medium from mixing with a hydrophilic liquid medium. Suitable hydrophobic liquid media include, for example, at least one selected from the group consisting of saturated hydrocarbons, unsaturated hydrocarbons, aromatic hydrocarbons, silicone oils, fluorine-based oils, perfluorocarbons, halogen-based solvents, and hydrophobic ionic liquids, or mixtures containing the same.
[0109] Examples of saturated hydrocarbons include alkanes and cycloalkanes. Examples of alkanes include decane and hexadecane. Examples of unsaturated hydrocarbons include squalene. Examples of aromatic hydrocarbons include benzene and toluene. Examples of fluorine-based oils include SR-X Sealing Oil. Examples of perfluorocarbons include Fluorinert (registered trademark) FC40 (manufactured by SIGMA). Examples of halogen-based solvents include chloroform, methylene chloride, and chlorobenzene. Hydrophobic ionic liquids refer to ionic liquids that do not dissociate at least in water, and examples include 1-butyl-3-methylimidazolium hexafluorophosphate. Ionic liquids refer to salts that exist in liquid form at room temperature. If the sealing medium is solid, then, as mentioned above, for example, a wiping member can be used. Materials for the solid sealing medium can be selected from glass, metal, and the like, and these can also be combined.
[0110] <Target substance detection method> The target substance detection method according to the present invention includes a reaction step, a particle encapsulation step, and a detection step. The reaction step is a step of reacting the target substance with test particles that specifically capture the target substance. The particle encapsulation step is a step of performing the particle encapsulation method according to the present invention described above using the test particles after the reaction step. The detection step is a step of detecting test particles that have captured the target substance among the test particles contained in each of the microwells.
[0111] (Reaction step) The reaction step is a step of reacting a target substance with test particles, and can be achieved, for example, by mixing a solution containing test particles with a solution containing the target substance and causing the reaction to occur. The reaction carried out in the reaction step can suitably be, for example, an antigen-antibody reaction, a streptavidin-biotin reaction, a complementary binding of nucleic acids, or any other known molecular recognition reaction or intermolecular interaction.
[0112] (Particle encapsulation process) In the particle encapsulation step, each step in the particle encapsulation method described above can be carried out in the same manner.
[0113] (Detection process) The detection step is a step of detecting whether or not test particles capturing target substances are filled into each microwell after the particle encapsulation step.
[0114] A method for detecting whether a test particle capturing a target substance is contained in a microwell can be, for example, a method using fluorescence detection. Specifically, this method can include, for example, incubating a base plate having microwells and detecting fluorescence generated by the activity of a specific enzyme bound to the target substance or a molecule specifically bound to the target substance. Fluorescence generated by enzyme activity is, for example, fluorescence emitted by a fluorescent substance liberated by decomposing a fluorescent substrate due to the enzyme's activity. Fluorescence detection methods can include methods using a fluorescence microscope, an image sensor, or the like.
[0115] The detection step preferably includes detecting whether or not a test particle is contained in each microwell. A method for detecting whether or not a test particle is contained in each microwell includes, for example, observing the presence or absence of test particles under a microscope. Other methods for detecting the presence or absence of test particles include detecting scattered light from test particles and using potential measurement with a field effect transistor. Another detection method includes, as described above, detecting fluorescence by adding a standard fluorescent substance to a dispersion medium containing test particles. Here, methods for detecting fluorescence include, as described above, methods using a fluorescence microscope, an image sensor, or the like.
[0116] When detecting fluorescence both in the method for detecting whether test particles that have captured a target substance are contained and in the method for detecting whether test particles are contained in each microwell, it is preferable that the fluorescence wavelengths for each detection are sufficiently different from each other, which makes each detection easier.
[0117] The detection process will be described in more detail below. For example, in the case where a fluorescent substrate is decomposed by a specific enzyme bound to a target substance or a molecule specifically bound to the target substance through incubation, and the fluorescence emitted by the released fluorescent substance is detected, bright-field and fluorescent images are first acquired after incubation using a fluorescent microscope or the like.
[0118] The acquired bright-field image captures the test particles contained in the microwells and the microwells. In other words, the bright-field image is captured to detect the microwells and test particles. If a standard fluorescent substance or the like is added to the reaction solution so that all microwells emit fluorescence, a fluorescent image captured under imaging conditions suited to the fluorescent wavelength of the standard fluorescent substance can be acquired instead of a bright-field image. Alternatively, a fluorescent image can be captured to determine the position of the test particle by utilizing the autofluorescence of the test particle.
[0119] Next, the bright-field image is used to create a mask image of each microwell (well: 1, other than well: 0) (hereinafter also referred to as a well mask image) and an image in which the portion corresponding to the microwell containing the test particle is masked (hereinafter also referred to as a particle mask image).
[0120] Finally, the fluorescence intensity of each microwell is calculated using the fluorescence image, well mask image, and particle mask image, and microwells in which test particles are present and have a fluorescence intensity exceeding a predetermined threshold are identified (positive determination). The threshold may be determined automatically from the fluorescence intensity of each microwell using the Otsu method or the like, or it may be determined from the variation in fluorescence intensity obtained by measuring using a well plate containing no test particles. Alternatively, the threshold may be calculated using the fluorescence intensity information of each microwell containing no test particles.
[0121] As a result of the detection process, the number of microwells containing test particles and the number of microwells containing particles that have captured the target substance can be determined. Using these values, the ratio of the number of test particles that have captured the target substance to the total number of test particles enclosed in the microwells can be calculated. This makes it possible to quantify the concentration of the target substance.
[0122] Furthermore, when detecting fluorescent substances in an array using a fluorescence microscope, image sensor, etc., if the magnification is too high, the observation range will be narrow and the detection accuracy will be low. Therefore, a magnification that allows observation of at least 25,000 microwells is preferable as an effective observation range, and a magnification that allows observation of 1 million microwells is even more preferable. A wide observation range also makes it possible to test multiple samples and multiple items at the same time. [Example]
[0123] The present invention will be described in more detail below using examples and comparative examples. The present invention is not limited to the following examples in any way as long as the gist of the invention is not exceeded.
[0124] (Creating base plate 1) The base plate 11 shown in FIG. 1 was fabricated through a fluororesin coating process, a photolithography process, and an etching / resist removal process.
[0125] A quartz substrate (AQ grade synthetic quartz substrate, thickness 1 mm, manufactured by AGC) was used as the substrate used to fabricate the base plate 11. In the fluororesin coating process, the substrate was treated with a silane coupling agent (KBE-903, manufactured by Shin-Etsu Silicones), and then coated with a fluororesin (CYTOP (registered trademark) CTL-809A, manufactured by AGC).
[0126] In the photolithography process, a positive photoresist (AZ P4903, AZ Electronic Materials) was applied. Next, UV light was applied from above through a photomask with the desired pattern, and an alkaline development process was performed. During this development process, the photoresist dissolved only in the areas irradiated with UV light, exposing the hydrophobic resin layer.
[0127] In the etching and resist removal process, a part of the resin layer was removed by etching with oxygen plasma through the partially dissolved photoresist to form a hydrophobic partition wall.
[0128] Finally, the photoresist was dissolved in an organic solvent to form an array 14 consisting of the desired multiple microwells 13. Each microwell 13 had a circular opening diameter of 5 μm, a depth of 4 μm, a volume of 78.5 fL, a pitch of 10 μm, and approximately 1 million wells. The area on the base plate 11 where the array 14 was formed was a square with sides of approximately 10 mm. In this manner, the base plate 1 was fabricated.
[0129] (Production of wiping member 1) The wiping member 12 shown in Fig. 1 was produced by water jet processing using a quartz substrate (AQ grade synthetic quartz substrate, thickness 1 mm, manufactured by AGC Corporation) as the substrate material, and was used as the wiping member 1. The partition member 15 shown in Fig. 1 was also produced in the same manner as the wiping member 1, and was used as the partition member 1.
[0130] (Production of wiping member 2) The wiping member 12 (partition member 15) shown in FIG. 4 was fabricated by water jet processing using a quartz substrate (AQ grade synthetic quartz substrate, thickness 1 mm, manufactured by AGC Corporation) as the substrate material, to form the wiping member 2. In other words, the wiping member 2 is a member that also functions as a partition member. The opening of the first region 16 and the opening of the second region 17 each had a square shape with one side measuring 11 mm.
[0131] (Production of wiping member 3) The wiping member 12 (partition member 15) shown in FIG. 9 was fabricated by water jet processing using a quartz substrate (AQ-grade synthetic quartz substrate, 1 mm thick, manufactured by AGC Corporation) as the substrate material, to form the wiping member 3. In other words, the wiping member 3 also functions as a partition member. The widths of the first partition 51 and the second partition 52 in the second direction B were both 2 mm. The openings of the third regions 16a and 16b and the openings of the fourth regions 17a and 17b separated by the first partition 51 and the second partition 52 each had a rectangular shape with a short side of 4.5 mm and a long side of 11 mm.
[0132] (Production of wiping member 4) The wiping member 4 was fabricated by aluminum deposition on one surface of the wiping member 2 (the surface that will become the third surface 12c or the fourth surface 12d (see FIG. 6(e))). That is, the wiping member 4 is a member that also functions as a partition member, similar to the wiping member 2.
[0133] (Production of wiping member 5) In this example, the wiping member 12 (partition member 15) shown in Fig. 4 was produced as the wiping member 5 by water jet processing using a transparent polystyrene plate with a thickness of 1 mm. The opening of the first region 16 and the opening of the second region 17 in Fig. 4 each had a square shape with one side measuring 11 mm.
[0134] (Preparation of test particle 1) A dispersion of magnetic particles (Magnosphere (registered trademark) MS160 / Carboxyl, manufactured by JSR Corporation) was prepared as a dispersion of test particles 1.
[0135] (Preparation of test particle 2) A dispersion of magnetic particles (Magnosphere (registered trademark) MS300 / Carboxyl, manufactured by JSR Corporation) was prepared as a dispersion of test particles 2.
[0136] (Preparation of test particle 3) 0.5 g of Ube Exsymo's Hypressica (registered trademark) N3N (particle diameter 2.9 μm) was prepared as raw material particles and dispersed in a mixed solution of 75 mL of ethanol (Kishida Chemical) and 75 mL of pure water. Next, 1.5 mL of tetraethoxysilane (TEOS) (Kishida Chemical) was added, and 22.5 mL of 28% aqueous ammonia (Kishida Chemical) was added as a catalyst. The mixture was stirred for 1.5 hours while reacting. After the reaction, the solvent was removed by centrifugation, and the raw material particles were washed seven times with pure water to form a silica layer.
[0137] The obtained silica-coated particles were dispersed in a mixed solution of 10 mL of ethanol and 10 mL of pure water, and 100 μL of 3-methacryloxypropyltrimethoxysilane (LS-3380, Shin-Etsu Chemical Co., Ltd.) was added as a silane coupling agent and thoroughly mixed. Next, 2 mL of 28% aqueous ammonia was added and stirred for 1.5 hours. The solvent was then removed by centrifugation, and the mixture was thoroughly washed with pure water. Then, 60 mL of nitrogen-bubbled pure water was added to obtain an aqueous dispersion. This aqueous dispersion was then placed in a four-neck flask (200 mL) and stirred for 15 minutes with nitrogen bubbling at a stirring speed of 200 rpm. The nitrogen bubbling was then switched to a nitrogen flow, and 50 μL of styrene monomer (Kishida Chemical Co., Ltd.) was added to the aqueous dispersion. Next, 0.02 g of potassium persulfate (Sigma-Aldrich) was dissolved in 2 mL of pure water that had been degassed by nitrogen bubbling, and 1 mL of this solution was added to the flask. The mixture was then heated to 35°C in an oil bath for 30 minutes, then heated to 60°C and maintained at this temperature for 1 hour. Subsequently, 200 μL of glycidyl methacrylate (Kishida Chemical Co., Ltd.) was added, and the mixture was maintained for an additional 12 hours to complete the polymerization. After the polymerization was complete, the solvent was removed by centrifugation, and the mixture was thoroughly washed with pure water.
[0138] Next, 10 mg of the obtained particles were dispersed in 5 mL of pure water. Separately from this particle dispersion, 350 mg of mercaptosuccinic acid (Kishida Chemical) was dissolved in 5 mL of pure water, and 0.8 mL of triethylamine (Tokyo Chemical Industry Co., Ltd.) was added to adjust the pH. 1 mL of this solution was added to the particle dispersion, thoroughly stirred, and heat-treated at 60°C for 3 hours. After this, the solvent was removed by centrifugation, and the mixture was thoroughly washed with pure water to obtain a dispersion of test particles 3.
[0139] The solid concentration of the dispersion of test particle 3 determined by simultaneous differential thermal analysis (TG-DTA) was 30 mg / mL. The diameter of the test particle was 3.0 μm and the specific gravity was 2.1 g / cm. 3 Assuming that the particle number concentration of this dispersion is 1.0 × 10 9 The concentration was calculated as 1 / mL.
[0140] (Preparation of test particle 4) Test particle 4 was prepared as a composite particle in which a complex of Cas12a and crRNA was bound to the particle. First, a dispersion of magnetic particles (Magnosphere® MS300 / Carboxyl) was placed in a microtube and the magnetic particles were precipitated with a magnet. After removing the supernatant, the magnetic particle pellet was re-dispersed in MES buffer (100 mM, pH 5.4), and N-hydroxysulfosuccinimide (sulfo-NHS) and water-soluble carbodiimide (WSC) were added. The mixture was then stirred at 25°C for 1 hour, and the magnetic particles were collected with a magnet.
[0141] The collected magnetic particles were then washed with MES buffer, dispersed in MES buffer, and an arbitrary amount of anti-His tag antibody (Anti-His-tag mAb, MBL Life Sciences) was added, followed by stirring at 25°C for 2 hours. Subsequently, a large excess of ethanolamine was added to deactivate the active groups on the surface of the magnetic particles.The magnetic particles were collected using a magnet and washed with MES buffer to prepare antibody-immobilized particles.
[0142] A storage buffer (10 mM HEPES-NaOH (pH 7.9), 50 mM KCl, 1 mM EDTA, 10% glycerol) was added to the obtained antibody-immobilized particles to prepare an antibody-immobilized particle solution. The antibody-immobilized particle solution was stored at 4°C until use. Next, the diluted Cas12a and crRNA were mixed at a concentration ratio (molar ratio) of 1:1.25 and incubated at 37°C for 30 minutes to prepare the Cas12a-crRNA complex.
[0143] The antibody-immobilized particle solution (1 wt%) thus prepared was dispensed into a 2 mL sample tube (VIOLAMO, model number: 1-1600-04). After stirring, the sample tube was placed on a magnetic stand (Magical Trapper, TOYOBO, model number: MGS-101) and left to stand for 1 minute, after which the supernatant was removed to remove the solution. Phosphate-buffered saline containing 0.05% Tween 20 (PBS-T) was added as a particle washing solution, and after stirring, the solution was removed in the same manner as above. The above procedure was repeated twice for washing.
[0144] After washing, the antibody-immobilized particles were suspended in PBS-T, and the Cas12a-crRNA solution prepared above was added to the desired concentration. After stirring, the mixture was allowed to react for 1 hour on a shaker. Here, the Cas12a used has a His tag at the N-terminus, so Cas12a and the antibody-immobilized particles are bound by an antigen-antibody reaction between the His tag on Cas12 and the anti-His tag antibody on the antibody-immobilized particles. This resulted in the production of test particle 4, in which a complex of Cas12a and crRNA is bound to the particle. The final particle number concentration in the dispersion of test particle 4 was calculated to be 3.1 x 10 8 The number of cells / mL was 100. After the reaction, the solution was removed and the mixture was washed with PBS-T. After washing, the mixture was suspended in purified water, stirred, and stored at 4°C until use.
[0145] (Preparation of Dispersion Medium 1 Containing Test Particles 1) Aqueous dispersion of test particle 1 (10 mg / mL, 4.0 × 10 9 10 μL of the test particles (particles / mL) was diluted with 489.25 μL of buffer (A), and 0.75 μL of 1 mM Alexa Fluor 647 was added as a standard fluorescent substance to prepare dispersion medium 1 containing test particles 1. The composition of the buffer (A) is as follows: Buffer (A) composition: 50mM Tris-Cl (pH 7.6) 10mM CaCl2 0.01% Brij® 35
[0146] (Preparation of Dispersion Medium 2 Containing Test Particles 2) Aqueous dispersion of test particle 2 (10 mg / mL, 6.0 × 10 8 16.7 μL of the test particles (particles / mL) was diluted with 482.55 μL of buffer (A), and 0.75 μL of 1 mM Alexa Fluor 647 was added as a standard fluorescent substance to prepare a dispersion medium 2 containing test particles 2.
[0147] (Preparation of Dispersion Medium 3 Containing Test Particles 3) Dispersion of test particle 3 (30 mg / mL, 1.0 × 10 9 10 μL of the test particles (particles / mL) was diluted with 490 μL of buffer (A) to prepare a dispersion medium 3 containing test particles 3.
[0148] (Preparation of Dispersion Medium 4 Containing Test Particles 4) First, synthetic DNA (hereinafter referred to as DNA_113bp) was used as the target DNA. DNA_113bp was diluted with purified water to prepare a DNA stock solution (4 nM), and the concentration was confirmed by measuring with a Qubit (registered trademark) 2.0 Fluorometer (Life Technologies). The DNA stock solution (4 nM) was diluted with purified water to prepare a DNA solution (0.684 nM). The DNA solution (0.684 nM) was further diluted with purified water to prepare DNA solution 1 (0.228 nM). The base sequence of DNA_113bp (SEQ ID NO: 1) is as follows: ctcacgccttatgactgcccttatgtcaccgcttatgtctcccgatatcacacccgttatctcagccctaatctctgcggtttagtctggccttaatccatgcctcatagcta Next, the aqueous dispersion of test particle 4 (3.1 × 10 8 7.3 μL of DNA solution 1 (0.228 nM / mL), 22.7 μL of water, and 30 μL of DNA solution 1 (0.228 nM) were mixed together. The resulting mixed solution was reacted at 37° C. for 30 minutes to form a complex between the composite particles and DNA.
[0149] Next, the following materials were prepared: 25 μL of reporter molecule solution (12 μM) containing 800 nM HiLyte 488; 10 μL of Tween 20 (5%) BSA (30%): 1 μL Spermine aqueous solution (50 mM): 4 μL 10×Binding buffer: 10 μL These were mixed in advance in a 1.5 mL microtube, and 50 μL of the above-mentioned complex of composite particles and DNA was added to this mixed solution to prepare a dispersion medium 4 containing test particles 4. The reporter molecule solution used was a reporter molecule contained in a commercially available kit (product name: DNaseAlert (registered trademark) Substrate Nuclease Detection System 11-02-01-04, manufactured by IDT). This reporter molecule contains HEX, a fluorescent substance, and a quencher.
[0150] (Preparation of Dispersion Medium 5 Containing Test Particles 4) First, DNA_113bp was used as the target DNA. DNA_113bp was diluted with purified water to prepare a DNA stock solution (4nM), and the concentration was confirmed by measuring with a Qubit 2.0 Fluorometer (Life Technologies). The DNA stock solution (4nM) was diluted with purified water to prepare a DNA solution (0.684nM). The DNA solution (0.684nM) was further diluted with purified water to prepare DNA solution 2 (0.114nM). Next, the dispersion of test particle 4 (3.1 × 10 8 7.3 μL of DNA solution 2 (0.114 nM / mL), 22.7 μL of water, and 30 μL of DNA solution 2 (0.114 nM) were mixed together. The resulting mixed solution was reacted at 37° C. for 30 minutes to form a complex between the composite particles and DNA. Next, the following materials were prepared: 25 μL of reporter molecule solution (12 μM) containing 800 nM HiLyte 488; 10 μL of Tween 20 (5%) BSA (30%): 1 μL Spermine aqueous solution (50 mM): 4 μL 10×Binding buffer: 10 μL These were mixed in advance in a 1.5 mL microtube, and 50 μL of the above-mentioned complex of composite particles and DNA was added to this mixed solution to form a dispersion medium 5 containing test particles 4.
[0151] [Example 1] A combination of a base plate 1 and a wiping member 2 was selected as the microwell device, and dispersion medium 2 containing test particles 2 was selected as the dispersion medium containing the test particles to be introduced into the array. First, the base plate and wiping member were positioned as shown in Figure 6(a). Next, 100 μL of dispersion medium containing test particles was dispensed into the first region of the wiping member using a micropipette. Immediately after dispensing, the wiping member was slid across the base plate to the position shown in Figure 6(c). The microwell device was then degassed by placing it in a vacuum desiccator at 0.1 atmospheres for approximately 30 seconds. After degassing, the device was left to stand for 5 minutes to allow test particles 2 to fill the microwells. While the device was still standing, 100 μL of SR-X Sealing Oil, a fluorinated oil, was dispensed into the second region of the wiping member using a micropipette. Next, the wiping member was slowly slid across the base plate to the position shown in Figure 6(f), sealing the microwells with the fluorinated oil.
[0152] [Example 2] The same procedure as in Example 1 was carried out except that the sealing step was changed as follows. While the sample was left stationary in the position shown in Figure 6(c), 100 μL of SR-X Sealing Oil, a fluorinated oil, was added to the second region of the wiping member using a micropipette. Next, the wiping member was slowly slid over the base plate to the position shown in Figure 6(f). The wiping member was then slowly slid over the base plate to the position shown in Figure 6(g) while loosening its pressure on the base plate, sealing the microwells with a thin layer of oil and the wiping member.
[0153] [Example 3] In Example 2, the "dispersion medium 2 containing test particles 2" was changed to "dispersion medium 3 containing test particles 3." The rest of the experiment was carried out in the same manner as in Example 2.
[0154] [Example 4] In Example 2, "dispersion medium 2 containing test particles 2" was changed to "dispersion medium 1 containing test particles 1." The rest of the experiment was carried out in the same manner as in Example 2.
[0155] [Example 5] In Example 2, wiping member 2 was changed to wiping member 4. Wiping member 4 was set and used so that its metal vapor deposition surface was in contact with the surface of the base plate having the array. In other words, the third surface of wiping member 4 was configured to have a metal vapor deposition surface. Other than that, the same procedure as in Example 2 was carried out.
[0156] [Example 6] In Example 5, the wiping member 4 was set and used so that the surface opposite the metal-deposited surface was in contact with the surface of the base plate having the array. In other words, the fourth surface of the wiping member 4 was configured to have the metal-deposited surface. Other than that, the same procedure as in Example 5 was carried out.
[0157] [Example 7] The same procedure as in Example 2 was carried out except that the introduction step was changed as follows. The base plate and the wiping member were set as shown in Fig. 6(c). Next, 100 µL of dispersion medium 2 containing test particles 2 was poured into the first region of the wiping member using a micropipette.
[0158] [Example 8] The same procedure as in Example 7 was carried out except that "dispersion medium 2 containing test particles 2" was changed to "dispersion medium 1 containing test particles 1" and the filling step was changed as follows. In the arrangement shown in Figure 6(c), the microwell device was degassed by placing it in a vacuum desiccator at 0.1 atmospheres for approximately 30 seconds, and after degassing, the entire array was traced from the backside of the base plate with a neodymium magnet (15 mm diameter, 10 mm height, manufactured by Niroku Seisakusho) for 5 seconds. After that, it was left to stand for 5 minutes to allow test particles 1 to fill the microwells.
[0159] [Example 9] A combination of a base plate 1 and a wiping member 3 was selected as the microwell device. Two types of dispersion media containing test particles were also selected: dispersion medium 1 containing test particle 1 and dispersion medium 2 containing test particle 2. First, the base plate and the wiping member were set as shown in Fig. 6(c). Next, 80 μL of dispersion medium 1 containing test particles 1 was poured into one of the third regions 16a, and similarly, 80 μL of dispersion medium 2 was poured into the other third region 16b. Next, the microwell device was degassed by placing it in a vacuum desiccator at 0.1 atmospheres for approximately 30 seconds. After degassing, it was left to stand for 10 minutes to allow test particles 1 and 2 to fill the microwells. While the device was standing, 100 μL of SR-X Sealing Oil, a fluorinated oil, was dispensed into the fourth regions 17a and 17b using a micropipette. Next, the wiping member was slowly slid over the base plate to the position shown in Figure 6(f). The wiping member was then slowly slid over the base plate to the position shown in Figure 6(g) while loosening its pressure against the base plate, sealing the microwells with a thin layer of oil and the wiping member.
[0160] [Example 10] The same procedure as in Example 1 was carried out except that the sealing step was changed as follows. After the filling step was performed in the position shown in Figure 6(c), the wiping member was slowly slid over the base plate to the position shown in Figure 6(f). Then, 100 μL of SR-X Sealing Oil, a fluorine-based oil, was poured into the second region of the wiping member using a micropipette along the wall of the hole, sealing the microwell with the fluorine-based oil.
[0161] [Example 11] The same procedure as in Example 10 was carried out except that the introduction step was changed as follows. First, the base plate and wiping member were set in the arrangement shown in Fig. 6(c) Then, 100 µL of dispersion medium 2 was poured into the first region of the wiping member using a micropipette.
[0162] [Example 12] A combination of a base plate 1, a wiping member 1, and a partition member 1 was selected as the microwell device, and a dispersion medium 2 containing test particles 2 was selected as the dispersion medium containing the test particles to be introduced into the array. First, the base plate, wiping member, and partition member were positioned as shown in Figure 3(a). Next, 100 μL of dispersion medium 2 containing test particles 2 was dispensed using a micropipette into the area on the base plate between the array and the first surface of the wiping member. Immediately after dispensing, the wiping member was slid across the base plate to the position shown in Figure 3(c). The microwell device was then degassed by placing it in a vacuum desiccator at 0.1 atmospheres for approximately 30 seconds. After degassing, the device was left to stand for 5 minutes to allow the test particles 2 to fill the microwells. After standing, the wiping member was slowly slid across the base plate to the position shown in Figure 3(e). Next, 100 μL of SR-X Sealing Oil, a fluorinated oil, was dispensed using a micropipette into the area on the base plate between the array and the second surface of the wiping member. Immediately after dispensing, the wiping member was slowly slid across the base plate to the position shown in Figure 3(f) to seal the microwells with oil.
[0163] [Example 13] The same procedure as in Example 12 was carried out except that the introduction step was changed as follows. First, the base plate, wiping member, and partition member were set as shown in Figure 3(c). Next, 100 μL of dispersion medium 2 containing test particles 2 was poured onto the array using a micropipette along the first surface of the wiping member.
[0164] [Example 14] The same procedure as in Example 12 was carried out except that the sealing step was changed as follows. After the filling step was performed in the arrangement shown in Figure 3(c), the wiping member was slowly slid over the base plate to the position shown in Figure 3(e) and then to the position shown in Figure 3(f). Then, 100 μL of SR-X Sealing Oil, a fluorinated oil, was dispensed onto the array using a micropipette along the second surface of the wiping member to seal the microwells with oil.
[0165] [Example 15] The same procedure as in Example 13 was carried out except that the sealing step was changed as follows. After the filling step was performed in the arrangement shown in Figure 3(c), the wiping member was slowly slid over the base plate to the position shown in Figure 3(e) and then to the position shown in Figure 3(f). Then, 100 μL of SR-X Sealing Oil, a fluorinated oil, was dispensed onto the array using a micropipette along the second surface of the wiping member to seal the microwells with oil.
[0166] [Example 16] In Example 1, the "dispersion medium 2 containing test particles 2" was changed to "dispersion medium 4 containing test particles 4." The rest of the experiment was carried out in the same manner as in Example 1.
[0167] [Example 17] In Example 2, the "dispersion medium 2 containing test particles 2" was changed to "dispersion medium 4 containing test particles 4." The rest of the experiment was carried out in the same manner as in Example 2.
[0168] [Example 18] In Example 7, the "dispersion medium 2 containing test particles 2" was changed to "dispersion medium 4 containing test particles 4." The rest of the experiment was carried out in the same manner as in Example 7.
[0169] [Example 19] In Example 8, the "dispersion medium 2 containing test particles 2" was changed to "dispersion medium 4 containing test particles 4." The rest of the experiment was carried out in the same manner as in Example 8.
[0170] [Example 20] In Example 5, the "dispersion medium 2 containing test particles 2" was changed to "dispersion medium 4 containing test particles 4." The rest of the experiment was carried out in the same manner as in Example 5.
[0171] [Example 21] In Example 6, the "dispersion medium 2 containing test particles 2" was changed to "dispersion medium 4 containing test particles 4." The rest of the experiment was carried out in the same manner as in Example 6.
[0172] [Example 22] In Example 9, the two types of dispersion medium 1 containing test particles 1 and dispersion medium 2 containing test particles 2 were changed to two types of dispersion medium 4 containing test particles 4 and dispersion medium 5 containing test particles 4. Furthermore, in the introduction step, dispersion medium 4 containing test particles 4 was introduced into one third region 16a, and dispersion medium 5 containing test particles 4 was introduced into the other third region 16b. Other than that, the same procedures as in Example 9 were carried out.
[0173] [Example 23] First, 120 μL of SR-X Sealing Oil, a fluorine-based oil, was applied to the entire back surface of the wiping member using a micropipette.Then, the oil-coated surface was brought into contact with the base plate and set as shown in Figure 6(a), except for this, the same procedure as in Example 10 was carried out.
[0174] [Example 24] The same procedure as in Example 23 was carried out except that wiping member 5 was selected instead of wiping member 2.
[0175] [Example 25] The same procedure as in Example 24 was carried out except that pure water was used as the medium to be applied to the entire rear surface of the wiping member instead of SR-X Sealing Oil, which is a fluorine-based oil.
[0176] [Example 26] The same procedure as in Example 24 was carried out except that the degassing operation of the microwell device after the first sliding operation was not carried out.
[0177] [Example 27] The same procedure as in Example 26 was carried out, except that the base plate was placed so as to come into contact with the magnet surface of a magnetic soft case (CR-MGA5, manufactured by Crown Co.), and then the wiping member was set.
[0178] [Example 28] The same procedure as in Example 27 was carried out, except that a magnet bar (Kokuyo Co., Ltd., Maku 201NB) was used instead of the magnet soft case, and the base plate was placed so as to contact the magnet surface before the wiping member was set.
[0179] [Example 29] After waiting 5 minutes for the test particles 2 to fill the microwells in the configuration shown in Figure 6(c), the microwell device was removed from the magnet bar and held in a state without a magnetic field for 1 minute. The same procedure as in Example 28 was then carried out, except that the wiping member was then slowly slid on the base plate to the position shown in Figure 6(f).
[0180] [Comparative Example 1] A combination of a base plate 1 and a wiping member 2 was selected as the microwell device, and a dispersion medium 2 containing test particles 2 was selected as the dispersion medium containing the test particles to be introduced into the array. First, the base plate and wiping member were set as shown in Figure 6(a). Next, 100 μL of dispersion medium 2 containing test particles 2 was dispensed into the first region of the wiping member using a micropipette. Immediately after dispensing, the wiping member was slid over the base plate to the position shown in Figure 6(c). The microwell device was then degassed by placing it in a vacuum desiccator at 0.1 atmospheres for approximately 30 seconds. After degassing, the device was left to stand for 5 minutes to allow the test particles 2 to fill the microwells. After leaving the device to stand, the dispersion medium 2 in the first region was slowly aspirated in one go using a micropipette. Then, 100 μL of SR-X Sealing Oil, a fluorinated oil, was dispensed into the first region using a micropipette to seal the microwells with oil.
[0181] Comparative Example 2 The same procedure as in Comparative Example 1 was carried out except that the introduction step was changed as follows. First, the base plate and wiping member were set in the arrangement shown in Fig. 6(c) Next, 100 µL of dispersion medium 2 was poured into the first region of the wiping member using a micropipette.
[0182] Comparative Example 3 The microwell device used was Simoa Discs (16 discs): 100001 (Quanterix). The specifications indicated a microwell opening diameter of 4.25 μm, a depth of 3.25 μm, a volume of 50 fL, and a total of 239,000 microwells. The area on the base plate where the array was formed was a rectangle with short sides of 3 mm and long sides of 4 mm. Dispersion medium 2 containing test particles was selected as the dispersion medium containing the test particles to be introduced into the array. Dispersion medium 2 containing 25 μL of test particles 2 was slowly poured into the inlet hole of the microwell device using a micropipette. After pouring, the microwell device was degassed by leaving it in a vacuum desiccator at 0.1 atmospheres for approximately 30 seconds. After degassing, the device was left to stand for 5 minutes to allow test particles 2 to fill the microwells. After leaving it to stand, 100 μL of SR-X Sealing Oil, a fluorinated oil, was poured into the inlet hole of the microwell device using a micropipette, sealing the microwells with oil. When the sealing fluorinated oil was poured into the inlet hole, a small amount of dispersion medium 2 was pushed out from the outlet hole.
[0183] Comparative Example 4 In Comparative Example 3, dispersion medium 1 containing test particles 1 was selected instead of dispersion medium 2 containing test particles 2, and the standing time was set to 10 minutes, but the same procedure was followed as in Comparative Example 3. When fluorine-based sealing oil was poured into the inlet hole, a small amount of dispersion medium 1 was extruded from the outlet hole, just like in Comparative Example 3.
[0184] Comparative Example 5 The experiment was carried out under the following conditions to reproduce the PITAT METHOD, which is a particle encapsulation method described in Non-Patent Document 1. A base plate 1 was selected as the microwell device, and a dispersion medium 2 containing test particles 2 was selected as the dispersion medium containing test particles to be introduced into the array. 100 μL of dispersion medium 2 containing test particles 2 was dispensed onto the array on the base plate using a micropipette. The microwell device was placed on an ice-cooled aluminum block for 1 minute to degas it, and then returned to room temperature of 25°C and left to stand for 5 minutes. After standing, a piece of Scotch (registered trademark) 145RN (manufactured by 3M) tape cut into a rectangle with short sides of approximately 6 mm and long sides of approximately 15 mm was lightly attached across the array. Then, a plastic rod wrapped in Kapton tape approximately 0.2 mm thick was rolled over the 145RN tape, firmly attaching the tape to the array and sealing the microwells. When sealing the microwells with the 145RN tape, dispersion medium 2 was extruded from the side of the tape. Furthermore, when the plastic rod was being rolled, the extruded dispersion medium 2 adhered to the wrapped Kapton tape, and also adhered to the surface of the sealed 145RN tape.
[0185] [evaluation] The results of the examples were evaluated based on three criteria: filling rate, width of effective observation area, and fouling of the microwell device. For actual detection sensitivity, the first important factor is how many test particles are packed into the microwells. Even if the test particles capture the target substance in pretreatment, they cannot be detected unless the microwells are packed with test particles, making this an unsuitable method for particle encapsulation.
[0186] The next important factor is the width of the effective observation range. Even if the particles are filled into the microwells, there may be cases where test particle aggregates or air bubbles are present in the microwells during actual detection, or the sealing medium does not uniformly cover the microwell array. Methods that cause such cases are unsuitable as particle encapsulation methods because the area in which the position of the microwell itself, the test particles, and the luminescent microwells can be detected in the specified image processing is narrow.
[0187] Furthermore, in actual handling operations, the microwell device itself may be contaminated with the dispersion medium or sealing medium discharged during the sealing step, etc., and the testing device may also be contaminated during the subsequent detection step, etc. Methods that cause such cases may affect the accuracy of the test results, and are therefore unsuitable as particle encapsulation methods, even if they enable highly sensitive detection.
[0188] Among the above examples, in the examples in which dispersion medium 3 containing test particles 3 and dispersion medium 4 containing test particles 4 were selected as dispersion media containing test particles to be introduced into the array, the generation of fluorescence was promoted by incubating and reacting at 37°C.
[0189] The filling rate and the width of the effective observation range were evaluated using a fluorescence microscope (BZ-X800 (manufactured by Keyence Corporation)) under conditions where approximately 25,000 microwells could be observed.
[0190] Specifically, the test particle filling rate was determined as follows. First, the positions of the microwells were confirmed based on the fluorescence of the standard fluorescent material, and then wells within those microwells that had contour edges due to the test particles were extracted using image processing. The test particle filling rate was then determined from the ratio of the total number of microwells within the observation range to the number of microwells filled with test particles. When the dispersion medium did not contain the standard fluorescent material, the positions of the microwells were confirmed based on a mask image of the microwells obtained by previously filling the microwells with a solvent containing the same standard fluorescent material. Next, microwells within those microwells that had contour edges due to the test particles were extracted using image processing, and the test particle filling rate was determined from the ratio of the total number of microwells within the observation range to the number of microwells filled with test particles.
[0191] The fluorescence intensity of each microwell was measured, and microwells exceeding a predetermined threshold were determined to be positive microwells in which fluorescence was generated due to the enzymatic activity of the target substance. The number of positive microwells was counted, and the positive rate was calculated as a reference value from the ratio of the number of microwells filled with test particles to the number of positive microwells.
[0192] The filling rate is shown in Table 1, and the positive rate is shown in Table 2. The measurement conditions for each fluorescent substance are as follows: (Dispersion medium 1 containing test particle 1 and dispersion medium 2 containing test particle 2) Standard fluorescent substance (Alexa Fluor® 647): ex 650 nm, em 670 nm (Dispersion medium 4 containing test particles 4 and dispersion medium 5 containing test particles 4) HEX: ex 533nm, em 559nm Standard fluorescent substance (HiLyte® Fluor 488): ex 499 nm, em 523 nm
[0193] [Table 1]
[0194] [Table 2]
[0195] The contamination of the microwell device was evaluated as follows. After the sealing process, the microwell device was left at a 5° angle for 10 minutes to observe whether the dispersion medium and sealing medium introduced into the microwell device would run down the surface of the microwell device and contaminate it. The 5° angle was set as the tilt of the microwell device expected during normal handling operations. In the present invention, the filling rate, the width of the effective observation range, and the contamination of the device were each evaluated and ranked based on the following evaluation criteria. In the present invention, AB was considered a preferable level and C was considered an unacceptable level. The evaluation results are summarized in Table 3.
[0196] <Filling rate> A: The filling rate exceeds 50%. B: The filling rate is more than 30% and less than 50%. C: The filling rate is 30% or less.
[0197] <Wide range of effective observation> A: The ratio of the number of microwells in the area where luminescent microwells cannot be correctly detected by image processing to the total number of microwells in the observation range is less than 5% at most. B: The ratio of the number of microwells in the area where luminescent microwells cannot be correctly detected by image processing to the total number of microwells in the observation range is at most 5% or more but less than 20%. C: The ratio of the number of microwells in the area where luminescent microwells cannot be correctly detected by image processing to the total number of microwells in the observation range is up to 20% or more.
[0198] <Device contamination> A: There is no risk of the microwell device being contaminated even if it is tilted at a 5 degree angle and held for 10 minutes. C: There is a concern that the microwell device may be contaminated if it is tilted at a 5 degree angle and held for 10 minutes.
[0199] [Table 3]
[0200] Disclosure according to an embodiment of the present invention includes the following configurations and methods. (Method 1) a preparation step of preparing a microwell device comprising a base plate having an array of a plurality of microwells provided on its upper surface, and a wiping member; an introduction step of introducing a dispersion medium containing test particles into the array; a filling step of filling the microwells with the test particles; a removal step of removing the dispersion medium outside the microwells; a sealing step of sealing the microwells with a sealing medium; and A particle encapsulation method characterized in that the removal process includes sliding the wiping member in a first direction while in contact with the upper surface of the base plate, thereby moving the dispersion medium outside the microwells outside the array. (Method 2) The microwell device further comprises a partition member; the partition member has two first portions extending in the first direction on the upper surface of the base plate outside the array, with the array sandwiched between them; and the partition member further has at least one second portion connecting ends of the two first portions to each other and extending in a second direction perpendicular to the first direction; A particle encapsulation method as described in Method 1, wherein the wiping member is configured to be used in a state where it is placed between the two first parts so that it can sandwich the array together with the second part. (Method 3) the wiping member has a first surface that comes into contact with the dispersion medium in the removing step to move the dispersion medium, the introducing step includes introducing the dispersion medium containing the test particles into a region sandwiched between the first surface and the second portion. The particle encapsulation method according to method 2. (Method 4) 4. The particle encapsulation method of Method 3, wherein the wiping member is configured for use in connection with each of the two first portions. (Method 5) the wiping member has a second surface that comes into contact with the sealing medium in the sealing step to move the sealing medium; A particle encapsulation method according to any one of Methods 2 to 4, wherein the encapsulating step includes introducing the encapsulating medium into the region sandwiched between the second surface and the second portion. (Method 6) 6. The particle encapsulation method of method 5, wherein the wiping member is configured for use in connection with each of the two first portions. (Method 7) the wiping member has a first surface that comes into contact with the dispersion medium in the removing step to move the dispersion medium, and one or more first partitions that extend from the first surface in the first direction and are configured to prevent movement of the dispersion medium in a second direction perpendicular to the first direction; A particle encapsulation method according to any one of methods 1 to 6, wherein the introducing step includes introducing the dispersion medium containing the test particles into an area defined by the first partition and the first surface. (Method 8) the wiping member has a second surface that contacts the sealing medium in the sealing step to move the sealing medium, and the wiping member has one or more second partitions that extend from the second surface in the first direction and are configured to prevent the sealing medium from moving in the second direction; the second partition is provided at the same position as the first partition in the second direction, The particle encapsulation method of Method 7, wherein the sealing step includes introducing the sealing medium into an area defined by the second partition and the second surface. (Method 9) the base plate is made of a light-transmitting material, a third surface of the wiping member in contact with the base plate has a sealing surface having a size sufficient to cover the array, the sealing surface being coated with metal; A particle encapsulation method according to any one of methods 1 to 8, wherein the sealing step includes covering the array with the sealing surface. (Method 10) the base plate and the wiping member are each made of a light-transmitting material; a third surface of the wiping member in contact with the base plate having a sealing surface large enough to cover the array; a fourth surface of the wiping member opposite to the third surface in contact with the base plate faces the sealing surface and has a surface coated with metal having a size sufficient to cover the sealing surface; 10. A particle encapsulation method according to any one of methods 1 to 9, wherein the sealing step comprises covering the array with the sealing surface. (Method 11) A particle encapsulation method described in any of methods 1 to 10, wherein the sealing step includes sliding the wiping member in a direction opposite to the first direction while in contact with the upper surface of the base plate to move the sealing medium onto the microwell. (Method 12) A particle encapsulation method described in any of Methods 1 to 11, wherein the maximum length of the microwell in the first direction, the maximum length in a second direction perpendicular to the first direction, and the depth are each 1.0 times or more and less than 2.0 times the average particle diameter of the test particles. (Configuration 1) A base plate having an array of a plurality of microwells on its upper surface, and a wiping member, the microwell is a well for containing test particles dispersed in a dispersion medium; A microwell device characterized in that the wiping member is configured to be able to move the dispersion medium outside the microwells outside the array by sliding it in a first direction while in contact with the upper surface of the base plate. (Configuration 2) Further comprising a partition member, 2. The microwell device of claim 1, wherein the partition member has at least a first portion extending in the first direction outside the array on the top surface of the base plate, thereby being configured to impede flow of the dispersion medium in a second direction perpendicular to the first direction on the top surface of the base plate. (Configuration 3) the partition member has two of the first portions provided on either side of the array, and at least one second portion connecting ends of the two first portions to each other and extending in the second direction; 3. The microwell device of configuration 2, wherein the wiping member is configured to be used in a state where it is placed between the two first portions so that it can sandwich the array together with the second portion. (Configuration 4) 4. The microwell device of Configuration 3, wherein the partition member has two second portions: a second portion connecting one end of each of the two first portions, and a second portion connecting the other end of each of the two first portions. (Configuration 5) 5. The microwell device of configuration 3 or 4, wherein the wiping member is configured for use in a state in which it is connected to each of the two first portions. (Configuration 6) 6. The microwell device of any one of configurations 1 to 5, wherein the wiping member has a first surface configured to contact the dispersion medium and move the dispersion medium, and one or more first partitions extending from the first surface in the first direction and configured to prevent movement of the dispersion medium in a second direction perpendicular to the first direction. (Configuration 7) the wiping member has a second surface configured to contact a sealing medium for sealing the microwells and move the sealing medium, and the wiping member has one or more second partitions extending from the second surface in the first direction and configured to prevent movement of the sealing medium in the second direction; 7. The microwell device of configuration 6, wherein the second partition is located at the same position as the first partition in the second direction. (Configuration 8) 8. The microwell device according to any one of configurations 1 to 7, wherein the base plate is made of a light-transmitting material. (Configuration 9) 9. The microwell device of configuration 8, wherein a third surface of the wiping member that contacts the base plate has a sealing surface large enough to cover the array, and the sealing surface is coated with metal. (Configuration 10) The wiping member is made of a light-transmitting material, a third surface of the wiping member in contact with the base plate having a sealing surface large enough to cover the array; 10. The microwell device of configuration 8 or 9, wherein a fourth surface of the wiping member opposite the third surface that contacts the base plate faces the sealing surface and has a metal-coated surface large enough to cover the sealing surface. (Method 13) a reaction step of reacting the test particles, which specifically capture the target substance, with the target substance; a particle encapsulation step of carrying out the particle encapsulation method according to any one of methods 1 to 11 using the test particles after the reaction step; a detection step of detecting test particles that have captured the target substance among the test particles contained in each of the microwells after the particle encapsulation step; A method for detecting a target substance, comprising: (Method 14) 14. The method for detecting a target substance according to Method 13, wherein the detecting step comprises detecting fluorescence generated by the activity of the enzyme. [Explanation of symbols]
[0201] 10, 20, 30, 40, 50 microwell devices 11 Base Plate 12 Wiping member 12a First Side 12b Second Side 12c Third Face 12d Fourth Face 13 microwells 14 Array 15 Partition member 16 First Area 16a, 16b Third Region 17 Second Area 17a, 17b Fourth Region 18a Test particle 18b Dispersion medium 19 Sealing medium 51 First Compartment 52 Second partition 151 First Part 152 Second Part A. First direction B Second Direction
Claims
1. a preparation step of preparing a microwell device comprising a base plate having an array of a plurality of microwells provided on its upper surface, and a wiping member; an introduction step of introducing a dispersion medium containing test particles into the array; a filling step of filling the microwells with the test particles; a removal step of removing the dispersion medium outside the microwells; a sealing step of sealing the microwells with a sealing medium; and The particle encapsulation method, characterized in that the removal step includes sliding the wiping member in a first direction while in contact with the upper surface of the base plate, thereby moving the dispersion medium outside the microwells outside the array.
2. The microwell device further comprises a partition member; the partition member has two first portions extending in the first direction on the upper surface of the base plate outside the array, with the array sandwiched between them; and the partition member further has at least one second portion connecting ends of the two first portions to each other and extending in a second direction perpendicular to the first direction; The particle encapsulation method of claim 1 , wherein the wiping member is configured to be used in a state where it is placed between the two first portions so that it can sandwich the array together with the second portion.
3. the wiping member has a first surface that comes into contact with the dispersion medium in the removing step to move the dispersion medium, the introducing step includes introducing the dispersion medium containing the test particles into a region sandwiched between the first surface and the second portion. The method for encapsulating particles according to claim 2 .
4. The method of claim 3 , wherein the wiping member is configured to be used in a state in which it is connected to each of the two first portions.
5. the wiping member has a second surface that comes into contact with the sealing medium in the sealing step to move the sealing medium; The particle encapsulation method according to claim 2 , wherein the encapsulating step includes introducing the encapsulating medium into a region sandwiched between the second surface and the second portion.
6. The method of claim 5 , wherein the wiping member is configured to be used in a state in which it is connected to each of the two first portions.
7. The wiping member has a first surface that comes into contact with the dispersion medium in the removing step to move the dispersion medium, and one or more first partitions that extend from the first surface in the first direction and are configured to prevent movement of the dispersion medium in a second direction perpendicular to the first direction, The particle encapsulation method according to claim 1 , wherein the introducing step includes introducing the dispersion medium containing the test particles into a region defined by the first partition and the first surface.
8. the wiping member has a second surface that contacts the sealing medium in the sealing step to move the sealing medium, and the wiping member has one or more second partitions that extend from the second surface in the first direction and are configured to prevent the sealing medium from moving in the second direction; the second partition is provided at the same position as the first partition in the second direction, The method for encapsulating particles according to claim 7 , wherein the encapsulating step includes introducing the encapsulating medium into an area defined by the second partition and the second surface.
9. the base plate is made of a light-transmitting material, a third surface of the wiping member in contact with the base plate has a sealing surface having a size sufficient to cover the array, the sealing surface being coated with metal; The method of claim 1 , wherein the sealing step includes covering the array with the sealing surface.
10. the base plate and the wiping member are each made of a light-transmitting material; a third surface of the wiping member in contact with the base plate having a sealing surface large enough to cover the array; a fourth surface of the wiping member opposite to the third surface that contacts the base plate; a metal-coated surface facing the sealing surface and large enough to cover the sealing surface; The method of claim 1 , wherein the sealing step includes covering the array with the sealing surface.
11. The particle encapsulation method according to claim 1, wherein the sealing step includes sliding the wiping member in a direction opposite to the first direction while in contact with the upper surface of the base plate to move the sealing medium onto the microwell.
12. The particle encapsulation method of claim 1, wherein the maximum length of the microwell in the first direction, the maximum length in a second direction perpendicular to the first direction, and the depth are each 1.0 times or more and less than 2.0 times the average particle diameter of the test particles.
13. A base plate having an array of a plurality of microwells on its upper surface, and a wiping member, the microwell is a well for containing test particles dispersed in a dispersion medium; A microwell device characterized in that the wiping member is configured to be able to move the dispersion medium outside the microwells outside the array by sliding it in a first direction while in contact with the upper surface of the base plate.
14. Further comprising a partition member, 14. The microwell device of claim 13, wherein the partition member has at least a first portion extending in the first direction outside the array on the top surface of the base plate, thereby being configured to impede flow of the dispersion medium in a second direction perpendicular to the first direction on the top surface of the base plate.
15. the partition member has two first portions provided on either side of the array, and at least one second portion connecting ends of the two first portions to each other and extending in the second direction; 15. The microwell device of claim 14, wherein the wiping member is configured to be used while being placed between the two first portions so that the wiping member can sandwich the array together with the second portion.
16. 16. The microwell device of claim 15, wherein the partition member has two second portions: a second portion connecting one end of each of the two first portions, and a second portion connecting the other end of each of the two first portions.
17. 16. The microwell device of claim 15, wherein the wiping member is configured for use in connection with each of the two first portions.
18. 14. The microwell device of claim 13, wherein the wiping member has a first surface configured to contact the dispersion medium and move the dispersion medium, and one or more first partitions configured to extend from the first surface in the first direction and prevent movement of the dispersion medium in a second direction perpendicular to the first direction.
19. The wiping member has a second surface configured to contact a sealing medium for sealing the microwells and move the sealing medium, and the wiping member one or more second partitions extending from the second surface in the first direction and configured to impede movement of the sealing medium in the second direction; 20. The microwell device of claim 18, wherein the second partition is located at the same position as the first partition in the second direction.
20. The microwell device of claim 13 , wherein the base plate is made of a light-transmitting material.
21. 21. The microwell device of claim 20, wherein a third surface of the wiping member that contacts the base plate has a sealing surface large enough to cover the array, the sealing surface being coated with metal.
22. The wiping member is made of a light-transmitting material, a third surface of the wiping member in contact with the base plate having a sealing surface large enough to cover the array; a fourth surface of the wiping member opposite to the third surface that contacts the base plate; 21. The microwell device of claim 20, having a metal-coated surface facing said sealing surface and large enough to cover said sealing surface.
23. a reaction step of reacting the test particles, which specifically capture the target substance, with the target substance; a particle encapsulation step of performing the particle encapsulation method according to any one of claims 1 to 11 using the test particles after the reaction step; a detection step of detecting test particles that have captured the target substance among the test particles contained in each of the microwells after the particle encapsulation step; A method for detecting a target substance, comprising:
24. 24. The method for detecting a target substance according to claim 23, wherein the detecting step includes detecting fluorescence generated by the activity of the enzyme.
Citation Information
Patent Citations
Bead sealing method, method for detecting target molecule, array, kit, and target molecule detection device
WO2012121310A1
Cited By
Filling method and filling system
EP4667101A1