Inhibitor of hedgehog signal

Abstract

To provide a novel inhibitor that can inhibit a Hedgehog signal even for a subject having SMO gene mutation.SOLUTION: A Hedgehog signal inhibitor includes a molecule targeting phosphorization of a serine residue at a position equivalent to position 252 of sequence number 1 in GLI2 having an amino acid sequence shown by sequence number 1 or an amino acid sequence identical to sequence number 1 by 90% or more, and / or a serine residue at a position equivalent to position 313 of sequence number 2 in GLI3 having an amino acid sequence shown by sequence number 2 or an amino acid sequence identical to sequence number 2 by 90% or more.SELECTED DRAWING: Figure 7

Description

[Technical Field]

[0001] The present invention relates to inhibitors of Hedgehog signaling. [Background technology]

[0002] Abnormal activity of Hedgehog signaling is a cause of carcinogenesis, such as basal cell carcinoma (BCC) and medulloblastoma (MB). Basal cell carcinoma is the most common type of skin cancer, and approximately 1% of cases are advanced basal cell carcinoma. This leads to advanced BCC. Advanced BCC is divided into locally recurrent (approximately 95%) and metastatic (approximately 5%). Medulloblastoma is the most common pediatric brain tumor (approximately 25%) and is a Grade IV malignant brain tumor. Hedgehog is known to be involved in approximately 30% of medulloblastomas.

[0003] Currently, FDA-approved Hedgehog inhibitors, Vismodegib and Sonidegib, target the G protein-coupled receptor (GPCR) Smoothened (SMO). However, it is known that SMO gene mutations are induced in approximately 20% of patients treated with these Hedgehog inhibitors. These SMO gene mutations cause drug resistance to Hedgehog inhibitors and constitutive oncogenic activation. Therefore, patients with SMO gene mutations induced by current Hedgehog inhibitors are refractory to these Hedgehog inhibitors. Therefore, there is a need to develop therapeutic agents that are effective for patients with mutations that are refractory to current Hedgehog inhibitors.

[0004] It is also known that the activation process of Hedgehog signaling requires the conversion of the transcription factors GLI2 / GLI3 to their active forms downstream of SMO. By separating the SUFU (Suppressor of fused) from the ATP, it acts as an active transcription factor. It is known that nuclear translocation occurs, but the mechanism by which GLI2 / GLI3 become activated remains unknown. It was unclear whether it would be converted.

[0005] The present inventors have previously revealed that a kinase called dual-specificity tyrosine-regulated kinase-2 (DYRK2) is involved in Hedgehog signaling during mammalian embryogenesis (Non-Patent Document 1). [Prior art documents] [Non-patent literature]

[0006] [Non-Patent Document 1] S. Yoshida et al., eLife, 2020;9:e57381 Summary of the Invention [Problem to be solved by the invention]

[0007] The present invention inhibits Hedgehog signaling even in subjects with SMO gene mutations. The objective of the present invention is to provide a novel inhibitor that can [Means for solving the problem]

[0008] To solve the above-mentioned problems, the present inventors have discovered a molecule that can inhibit Hedgehog signaling independently of SMO gene mutations by targeting a molecule downstream of SMO. Specifically, upon Hedgehog signaling activation, the kinase DYRK2 activates GLI2 / GLI3 (especially GLI2) and GLI3. S252 / GLI3 S313 ) is converted to its active form by phosphorylation. S252 / GLI3 S313We also demonstrated that phosphorylation of GLI2 / GLI3 promotes SUFU dissociation and nuclear translocation. S252 / GLI3 S313 We demonstrated that Hedgehog signaling can be inhibited by introducing antibodies into cells. S252 / GLI3 S313 The antibody targets a mutant SMO that is resistant to current FDA-approved drugs. W535L The present inventors demonstrated that Hedgehog signaling can be inhibited by inhibiting factors that act downstream of SMO, thereby completing the present invention.

[0009] That is, the present invention is as follows. [1] A serine residue at a position corresponding to position 252 of SEQ ID NO: 1 in GLI2 having the amino acid sequence represented by SEQ ID NO: 1 or an amino acid sequence that is 90% or more identical to SEQ ID NO: 1 (hereinafter, GLI2 S252 also known as), and / or A serine residue at a position corresponding to position 313 of SEQ ID NO: 2 in GLI3 having the amino acid sequence shown in SEQ ID NO: 2 or an amino acid sequence that is 90% or more identical to SEQ ID NO: 2 (hereinafter, GLI3 S313 Also called Hedgehog signaling inhibitors, including molecules that target phosphorylation of [2] The molecule is phosphorylated GLI2 S252 and / or phosphorylated GLI3 S313 The inhibitor according to [1], which is an antibody or an antigen-binding fragment thereof targeting [3] The inhibitor described in [1] or [2], wherein the antibody or antigen-binding fragment thereof targets an amino acid sequence including the amino acid sequence represented by SEQ ID NO: 3 or 4. [4] The inhibitor according to any one of [1] to [3], which is introduced into a cell. [5] A pharmaceutical composition comprising the inhibitor according to any one of [1] to [4] and a pharmaceutically acceptable additive. [6] The pharmaceutical composition according to [5] for treating a Hedgehog signal-dependent solid cancer. [7] The pharmaceutical composition according to [6], wherein the Hedgehog signal-dependent solid cancer is selected from the group consisting of basal cell carcinoma and medulloblastoma. [8] The Hedgehog signaling-dependent solid cancer is selected from basal cell carcinoma and medulloblastoma with SMO mutations. The pharmaceutical composition according to [6], wherein the compound is selected from the group consisting of blastoma, bronchial asthma, leukemia, and leukemia. [9] The pharmaceutical composition according to any one of [5] to [8], further comprising an agent for introducing the inhibitor into cells.

[10] GLI2 S252 or GLI3 S313 A method for screening for a compound that inhibits Hedgehog signaling, using phosphorylation of Introducing the test substance into cells of Hedgehog signaling-dependent solid cancer; GLI2 S252 or GLI3 S313 measuring phosphorylation of; GLI2 after administration of the test substance compared to before administration of the test substance S252 or GLI3 S313 When the phosphorylation of Hedgehog is decreased, the test substance is screened as a candidate compound that inhibits Hedgehog signaling. [Effects of the Invention]

[0010] By targeting the phosphorylation required for GLI2 / GLI3 activation, we were able to provide a Hedgehog signaling inhibitor that is independent of SMO gene mutations. [Brief explanation of the drawings]

[0011] [Figure 1] FIG. 1 shows partial amino acid sequences of GLI2 and GLI3 and the interspecies homology at the identified active phosphorylation sites. [Figure 2]Figure 2 shows the identification of the kinase DYRK2 as an interacting molecule of GLI2 / GLI3. The upper panel is an immunoblot photograph showing the results of treating a Lenti-X 293T cell line overexpressing EGFP-DYRK2 together with GLI2 (wild-type or S252A mutant) with anti-phosphorylated GLI2S252 / GLI3S313 antibodies. The lower panel is an immunoblot photograph showing the results of treating a Lenti-X 293T cell line overexpressing EGFP-DYRK2 together with GLI3 (wild-type or S313A mutant) with anti-phosphorylated GLI2S252 / GLI3S313 antibodies. [Figure 3] FIG. 3 shows immunoblot photographs of wild-type and Dyrk2 − / − MEFs stimulated with a Hedgehog signal activating agent (SAG; an SMO agonist), immunoprecipitated with anti-GLI3 antibody, and then subjected to immunoblot analysis using anti-phosphorylated GLI2S252 / GLI3S313 antibody. [Figure 4] Figure 4 is a graph of the immunoblot results shown in Figure 3. Error bars indicate means ± SEM. Statistical analysis was performed by one-way ANOVA followed by the Tukey multiple comparison test (*P<0.05, **P<0.01). [Figure 5] FIG. 5 shows the results of evaluating the binding ability of GLI3 to SUFU by phosphorylation. [Figure 6] FIG. 6 is a photograph showing the results of an analysis of the intracellular localization of glutamic acid mutants or alanine mutants that mimic phosphorylation of GLI2 expressed in cells. [Figure 7] Figure 7 is a graph showing the inhibitory effect of Hedgehog signaling on wild-type MEFs by transfection with anti-phosphorylated GLI2S252 / GLI3S313 antibodies. Error bars indicate means ± SEM. Statistical analysis was performed using Student's t-test. [Figure 8]Figure 8 is a graph showing the inhibitory effect of transfection of anti-phospho-GLI2 S252 / GLI3 S313 antibody on mutant SMOW535L-expressing cells. Error bars indicate Means±SEM. Statistical analysis was performed by Student’s t-test. [Figure 9] Figure 9 is a schematic diagram showing that intracellular introduction of anti-phospho-GLI2 S252 / GLI3 S313 antibody inhibits Hedgehog signal.

Mode for Carrying Out the Invention

[0012] <Hedgehog Signal Inhibitor> One embodiment of the present invention is a serine residue at a position corresponding to position 252 of SEQ ID NO: 1 in GLI2 having the amino acid sequence represented by SEQ ID NO: 1 or an amino acid sequence 90% or more identical to SEQ ID NO: 1 (hereinafter also referred to as GLI2), and / or a serine residue at a position corresponding to position 313 of SEQ ID NO: 2 in GLI3 having the amino acid sequence represented by SEQ ID NO: 2 or an amino acid sequence 90% or more identical to SEQ ID NO: 2 (hereinafter also referred to as GLI3) S252 ), and a Hedgehog signal inhibitor comprising a molecule targeting the phosphorylation thereof. GLI2 and GLI3 are transcription factors that are activated downstream of SMO in the process of activating the Hedgehog signal, respectively. When GLI2 and GLI3 are activated, the Hedgehog signal is activated. S313 Activation of GLI2 and GLI3 occurs by phosphorylation of specific-position amino acid residues of GLI2 and GLI3, respectively.

[0013] GLI2 and GLI3 are transcription factors that are activated downstream of SMO in the process of activating the Hedgehog signal, respectively. When GLI2 and GLI3 are activated, the Hedgehog signal is activated.

[0014] Activation of GLI2 and GLI3 occurs by phosphorylation of specific-position amino acid residues of GLI2 and GLI3, respectively.

[0015] Specifically, the phosphorylation of an amino acid residue at a specific position in GLI2 may refer to phosphorylation of the serine residue at position 252 of the amino acid sequence represented by SEQ ID NO: 1 when GLI2 has the amino acid sequence represented by SEQ ID NO: 1 (NP_001358200.1). Furthermore, GLI2 is capable of activating Hedgehog signaling by being phosphorylated. As long as the amino acid sequence is 90% or more identical to SEQ ID NO: 1, preferably 95% or more identical, and more preferably 98% or more identical, the GLI2 may be a GLI2 having an amino acid sequence that is 90% or more identical to SEQ ID NO: 1, and in this case, the serine residue at the position corresponding to position 252 of the amino acid sequence represented by SEQ ID NO: 1 may be phosphorylated.

[0016] Specifically, when GLI3 has the amino acid sequence represented by SEQ ID NO: 2 (NP_000159.3), phosphorylation of an amino acid residue at a specific position in GLI3 refers to phosphorylation of the amino acid residue represented by SEQ ID NO: 2. Alternatively, the GLI3 may be a GLI3 having an amino acid sequence that is 90% or more identical, preferably 95% or more identical, and more preferably 98% or more identical to that of SEQ ID NO: 2, so long as it can activate Hedgehog signaling by being phosphorylated, and in this case, the GLI3 may be a GLI3 having a serine residue at a position corresponding to position 313 of the amino acid sequence represented by SEQ ID NO: 2 that is phosphorylated.

[0017] GLI2 S252 and GLI3 S313 The phosphorylation of the protein is not particularly limited, but may be mediated by, for example, the kinase DYRK2. This will be carried out by:

[0018] Both GLI2 and GLI3 are present in cells, so GLI2 S252 and GLI3 S313The molecule that targets phosphorylation of the target protein needs to be capable of being introduced into cells. The molecule is not particularly limited as long as it can be introduced into a target cell and can target the phosphorylation, and may be, for example, an antibody or antigen-binding fragment, a peptide, a compound, a nucleic acid, or the like. The cells into which the molecule is introduced are not particularly limited, and examples include Hedgehog signal-dependent solid cancer cells, or any cells that overexpress DYRK2.

[0019] When the molecule targeted for phosphorylation is an antibody or an antigen-binding fragment, phosphorylated GLI2 S252 and / or GLI3 S313 It is preferred to use an antibody or antigen-binding fragment that targets phosphorylated GLI2. S252 or phosphorylated GLI3 S313 The antibody or antigen-binding fragment may be an antibody or antigen-binding fragment that targets an amino acid sequence comprising SEQ ID NO: 3 or 4, respectively. The antibody or antigen-binding fragment contains unphosphorylated GLI2 S252 and / or GLI3 S313 Preferably, it does not target the

[0020] The antibody may be either a polyclonal antibody or a monoclonal antibody, but is preferably a monoclonal antibody from the viewpoint of stabilizing the effect. Furthermore, for administration to humans, the antibody is preferably a chimeric antibody, a humanized antibody, or a fully human antibody from the viewpoint of reducing antigenicity. For example, the animal from which the antibody is derived may be a human, a mouse, a rat, a rabbit, a monkey, or a camelid such as a dromedary, a Bactrian camel, a llama, an alpaca, a guanaco, or a vicuna, or a cartilaginous fish such as a shark or a chimaera.

[0021] The antibody may be a commercially available antibody, or may be an antibody prepared by a method known to those skilled in the art. The method for producing an antibody is, for example, to generate a monoclonal antibody by detecting phosphorylated GLI2 S252 or GLI3S313 Animals such as mice are immunized with this antigen, and phosphorylated GLI2 S252 or GLI3 S313 Cells that produce antibodies against the antigen protein are collected, and the collected cells are fused with allogeneic or heterogeneous myeloma cells to produce monoclonal antibodies against the antigen protein (hereinafter referred to as anti-phosphorylated GLI2). S252 / GLI3 S313 By selecting hybridoma cells that produce the antibody, the antibody can be obtained from the culture supernatant of the hybridoma cells. Furthermore, the hybridoma cells can be further modified to obtain chimeric or humanized antibodies. Specifically, for example, the desired antibody can be obtained by manipulating a gene extracted from the hybridoma cells by replacing the portion of the gene encoding the Fc region with a gene encoding a human Fc region using genetic recombination techniques, a method known to those skilled in the art.

[0022] Anti-phosphorylated GLI2 S252 / GLI3 S313 Fully human antibodies are produced by transfecting genetically engineered mice capable of producing human antibodies with phosphorylated GLI2. S252 or GLI3 S313 The mice were immunized with the antigen, and the anti-phosphorylated GLI2 antibody obtained from the genetically modified mice was S252 / GLI3 S313 Antibody-producing cells were harvested and fused with myeloma cells to generate anti-phosphorylated GLI2 S252 / GLI3 S313 By selecting hybridoma cells that produce antibodies, the antibodies can be obtained from the culture supernatant of the hybridoma cells. In addition, anti-phosphorylated GLI2 S252 / GLI3 S313 Fully human antibodies can also be produced using phage display methods, which are known to those skilled in the art.

[0023] Antigen-binding fragments include, for example, Fab, Fab', F(ab')2, scFab, scFv, diabodies, Examples include triabodies, minibodies, nanobodies, etc. Antigen-binding fragments Any of the antigen-binding fragments can be produced by utilizing gene modification techniques known to those skilled in the art. For example, the antigen-binding fragments may be obtained from transgenic animals carrying genes capable of producing these antigen-binding fragments. The antigen-binding fragments may be derived from VHH (variable domain of heavy chain of heavy chain) derived from camelids. Although not particularly limited, the Hedgehog signal inhibitor of this embodiment may be introduced into cells and inhibit GLI2 in the cells. S252 and GLI3 S313 Since the compound acts by targeting phosphorylation of the target protein, it is preferable that the molecular weight of the compound is small so that it can be easily introduced into cells.

[0024] When the molecule targeted for phosphorylation is a peptide, there is no particular limitation as long as it targets phosphorylation. For example, the molecule targeted for phosphorylation may be a peptide that targets a position corresponding to position 252 in the amino acid sequence represented by SEQ ID NO: 1. The peptide may be a peptide containing a serine residue at a position corresponding to position 313 in the amino acid sequence of SEQ ID NO: 2. The length of the peptide is not particularly limited, and the upper limit may be, for example, 300 amino acids or less, 200 amino acids or less, 100 amino acids or less, 50 amino acids or less, 30 amino acids or less, or 20 amino acids or less, and the lower limit may be, for example, 10 amino acids or more, 20 amino acids or more, 30 amino acids or more, or 50 amino acids or more. Any combination of these upper and lower limits may also be used, such as, for example, 10 to 100 amino acids.

[0025] When the molecule targeted for phosphorylation is a compound, it is not particularly limited as long as it targets phosphorylation, but is preferably, for example, a medium-molecular-weight compound or a low-molecular-weight compound. The compound may be a commercially available compound, or a compound prepared by a method known to those skilled in the art may also be used.

[0026] When the molecule targeted for phosphorylation is a nucleic acid, there is no particular limitation as long as it targets phosphorylation, and examples include siRNA, miRNA, antisense nucleic acid, etc. Commercially available nucleic acids may be used as the nucleic acid, but nucleic acids prepared by methods known to those skilled in the art may also be used.

[0027] The method for introducing the inhibitor of this embodiment into cells is not particularly limited as long as it can be introduced into the target cells. For example, the inhibitor can be introduced into the cells using an introduction agent. Examples of the introduction agent include lipid-based agents such as liposomes. For specific delivery to the target solid cancer cells, the inhibitor may be a lipid carrier such as liposomes to which a cell surface antigen specifically expressed in the solid cancer is bound.

[0028] The Hedgehog signal inhibitory activity can be measured by a method known to those skilled in the art. For example, but not limited to, the activity can be measured by RT-qPCR, which is known as an indicator of Hedgehog signal activation. The level of the inhibitory effect can be determined by measuring the expression level of Gli1. The Hedgehog signal inhibitory effect may be, for example, one that reduces the level of Gli1 gene expression when the inhibitor of this embodiment is added compared to when the inhibitor of this embodiment is not added. When the degree of reduction can be quantified, it may be, for example, a reduction of 10% or more, 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, or 90% or more. Furthermore, it may be, for example, one that reduces the level of Gli1 gene expression when the inhibitor of this embodiment is added compared to when a control is added. When the degree of reduction can be quantified, it may be, for example, a reduction of 10% or more, 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, or 90% or more.

[0029] With regard to the Hedgehog signal inhibitor of this embodiment, the subjects to be administered, the dosage, the administration method, etc. can be referenced from the description in the section <Pharmaceutical Composition> below.

[0030] <Pharmaceutical Composition> Another embodiment of the present invention is a pharmaceutical composition comprising the above-described Hedgehog signaling inhibitor and a pharmaceutically acceptable excipient.

[0031] Diseases to be treated include Hedgehog signaling-dependent solid cancers. Examples of such solid cancers include basal cell carcinoma (BCC) and medulloblastoma (MB), including basal cell carcinoma and medulloblastoma with SMO mutations. Basal cell carcinoma (BCC) may be advanced BCC, and advanced BCC may be either locally recurrent or metastatic. Medulloblastoma (MB) may be, for example, a medulloblastoma belonging to a subgroup characterized by activation of the Sonic Hedgehog pathway (SHH type). Diseases to be treated also include any disease involving GLI2 / GLI3. The pharmaceutical composition of this embodiment inhibits factors that act downstream of SMO, and is therefore useful in subjects with SMO gene mutations.

[0032] Examples of pharmacologically acceptable additives include solvents, distilled water, physiological saline, diluents, surfactants, stabilizers, solubilizers, suspending agents, emulsifiers, buffers, preservatives, etc. Furthermore, additives such as preservatives, antioxidants, colorants, adsorbents, and wetting agents can be used as needed. These additives can be used in appropriate amounts as needed.

[0033] The pharmaceutical composition of the present embodiment may contain other active ingredients as desired. Examples of other active ingredients include immunostimulants such as cytokines, chemotherapeutic agents, etc. These other active ingredients can be used appropriately in appropriate amounts.

[0034] The subjects of administration are mammals that have developed Hedgehog signaling-dependent solid cancers, such as humans and mice. Humans that have developed Hedgehog signaling-dependent solid cancers are preferred. The subjects of administration also include mammals that have developed any disease involving GLI2 / GLI3.

[0035] The content of the Hedgehog signal inhibitor in the pharmaceutical composition of this embodiment is not particularly limited as long as it inhibits Hedgehog signaling in cells, thereby enabling treatment of Hedgehog signal-dependent solid cancer, and can be, for example, 1 ng / mL to 1 mg / mL.

[0036] The dosage of the pharmaceutical composition of this embodiment is not particularly limited, as long as the active ingredient, a Hedgehog signal inhibitor, is an amount that can inhibit Hedgehog signaling intracellularly, thereby treating Hedgehog signal-dependent solid cancer. The dosage can be adjusted appropriately depending on the age, sex, weight, symptoms, therapeutic effect, area of ​​the treatment site, dosage form, administration method, etc. of the subject. For example, for an average human weighing approximately 60 kg, the dosage is preferably approximately 0.01 mg to 5000 mg per day, more preferably approximately 0.1 mg to 500 mg. The total daily dosage may be administered once per day, or may be administered in divided doses multiple times per day.

[0037] The pharmaceutical composition of the present embodiment may be formulated in any dosage form, such as a liquid, suspension, or injection.

[0038] The method of administration is not particularly limited, but examples include local administration to the affected area or its surroundings by injection or intravenous or arterial injection.

[0039] Regarding the therapeutic effect, for example, as a result of treatment with the pharmaceutical composition of this embodiment, A therapeutic effect can be determined when it is confirmed that the growth of solid tumors is inhibited, the number of cells constituting solid tumors is reduced, or the size of solid tumors is reduced, compared to subjects before treatment with the pharmaceutical composition of the present embodiment or compared to controls not treated with the pharmaceutical composition of the present embodiment. For example, when the degree of inhibition of growth of solid tumors, reduction in cell number, or reduction in size can be quantified, a therapeutic effect can be determined when an inhibition, reduction, or decrease of, for example, 10% or more, 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, or 90% or more is confirmed. The analytical method is not particularly limited, and can be performed by any method known to those skilled in the art.

[0040] <Screening method> Another embodiment of the present invention is GLI2 S252 or GLI3 S313 A method for screening for a compound that inhibits Hedgehog signaling, using phosphorylation of Introducing the test substance into the cells; GLI2 S252 or GLI3 S313 measuring phosphorylation of; GLI2 after administration of the test substance compared to before administration of the test substance S252 or GLI3 S313When the phosphorylation of decreases, the test substance is screened as a candidate substance for a compound that inhibits the Hedgehog signal, including the method.

[0041] The method of this embodiment may optionally include additional steps.

[0042] The test substance is not particularly limited, and examples include antibodies or antigen-binding fragments, peptides, compounds, nucleic acids, and the like.

[0043] In this embodiment, the cells into which the test substance is introduced are not particularly limited. For example, Hedgehog signal-dependent solid cancer cells can be used. Also, any cells overexpressing DYRK2 may be used, and the cells may further be cells overexpressing GLI2 and / or GLI3.

[0044] The method for measuring phosphorylation is not particularly limited, and examples include immunoblotting.

[0045] Regarding the screening method of this embodiment, the method of introducing into cells and the like can be referred to the description in the section of <Hedgehog signal inhibitor> above.

Example

[0046] The examples are described for the purpose of disclosure and are not intended to limit the scope of the present invention.

[0047] <Construction of plasmid> (The full-length human cDNA fragments (GLI2, GLI3, DYRK2, SMO) were amplified by polymerase chain reaction (PCR) and cloned in-frame into pEGFP-C1 (TaKaRa Bio) using NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs). Serine / alanine (S / A) substitution The substituted or serine / glutamic acid (S / E) substituted GLI2, the serine / alanine (S / A) substituted GLI3, and the tryptophan / leucine (W / L) substituted SMO were cloned using fragments amplified by inverted PCR using KOD-one (TOYOBO) or synthetic oligo DNA (IDT Corporation). The sequences of the primers used are as follows: human GLI2 Forward primer: CGATGACAAGGGATCCGAGACGTCTGCCTCAGCC (SEQ ID NO: 5) Reverse primer: GATATCTGCAGAATTCCTAGGTCATCATGTTCAGG (SEQ ID NO: 6) human GLI2 S252A Forward primer: GCACCGCACCCAACTCGC (SEQ ID NO: 7) Reverse primer: GGATCATCCGCTGCAGGTC (SEQ ID NO: 8) human GLI3 Forward primer: CGATGACAAGGGATCCGAGGCCCAGTCCCACAGC (SEQ ID NO: 9) Reverse primer: GATATCTGCAGAATTCCTATTGCATAACTGCAAGGA (SEQ ID NO: 10) human GLI3 S313A Forward primer: GCACCCAACTCCTTGGTC (SEQ ID NO: 11) Reverse primer: TGCCCTTATCATGGTCTG (SEQ ID NO: 12) human DYRK2 Forward primer: GGTACCCGGGGATCCATGAATGATCACCTGCATGTC (SEQ ID NO: 13) Reverse primer: GGATCCGAATTCGAATCCGCTAACAAGTTTTGGCAAC (SEQ ID NO: 14) human SMO · Forward primer: CCGCTAGCGCTACCGGTATGGCCGCTGCCCGCCCA (SEQ ID NO: 15) · Reverse primer: TCGAGGTCGAGAATTCTCAGAAGTCCGAGTCTGC (SEQ ID NO: 16)

[0048] <Cell culture and transfection of plasmid into cells> Primary MEFs were generated from E13.5 wild-type and Dyrk2 - / - embryos by the method described in Non-Patent Document 1. The Lenti-X 293T cell line was obtained from Takara Bio. These cells were cultured at 37 °C under 5% CO2 in DMEM (Nacalai Tesque) containing 10% FBS (Biowest), 2 mM L-glutamine (Nacalai Tesque), and 1% penicillin-streptomycin (Nacalai Tesque). When ciliogenesis was induced by 24-hour serum starvation (0.5% FBS) at the time when the cells reached 80% - 90% confluence. When SAG stimulation was performed on MEFs, they were treated with 100 nM SAG (Merck) after serum starvation. When transient overexpression was performed on Lenti-X 293T cells, they were cultured in dishes (Iwaki) coated with type I collagen and transfected with the appropriate plasmid at a ratio (w / w) of 3:1 of the reagent to the DNA plasmid using polyethyleneimine Max (Polysciences). Twenty-four hours after transfection, cell lysates were prepared and subjected to immunoprecipitation or immunoblotting.

[0049] <Knockout of endogenous Smo gene by CRISPR-Cas9 system and stable expression of mutant SMO W535L Mutant human SMO W535L ​​The expression cells were NIH3T3 cells in which the endogenous Smo gene was knocked out using the CRISPR-Cas9 system, and mutant SMO was transfected using lentivirus. W535L was stably expressed and produced. First, a single guide RNA (sgRNA) targeting the following sequence in the mouse Smo gene (5'-CCAGCTCGGGCCCACGCACG (SEQ ID NO: 17)-3') was designed using the CRISPR-Cas9 system, and the sgRNA was inserted into the LentiCRISPRv2 plasmid (Addgene, #52961). The sgRNA vector was transfected into cells using Lipofectamine 3000 transfection reagent (ThermoFisher Scientific), followed by selection with 1.5 μg / mL puromycin (GIBCO) for NIH3T3 cells. Mutant SMO W535L Stable expression of was carried out in the same manner as described in <Cell culture and transfection of plasmids into cells>.

[0050] <Peptide> Phosphorylated GLI2 S252 / GLI3 S313 For the generation of antibodies against GLI3, the peptide NH2-Cys-RMIRT(pS)PNSLV(SEQ ID NO: 18)-COOH (purity >80%) was obtained from SCRUM Inc. For SPR analysis, GLI3 309-345 (NH2-MIRTSPNSLVTILNNSRSSSSASGSYGHLSASAISPA (SEQ ID NO: 19)-PEG4-K-biotin-COOH) and phosphorylated GLI3 S313 309-345 (NH2-MIRT(pS)PNSLVTILNNSRSSSSASGSYGHLSASAISPA (SEQ ID NO: 20)-PEG4-K-biotin-COOH) was synthesized and purified by HPLC (SCRUM Inc.). The purified DNA was purified (purity >95%). Multiple sequence alignment was performed using Clustal Omega software. was carried out.

[0051] <Antibody generation> Anti-phosphorylated GLI2 S252 / GLI3 S313 Rabbits using synthetic peptides to generate antibodies The rabbits were immunized with IgG. Antibodies against the phosphorylated peptide of interest were purified from the resulting rabbit serum, and antibodies reacting with the non-phosphorylated peptide were absorbed and removed (SCRUM Inc.).

[0052] <Immunocytochemistry> Cells were cultured in 8-well chambers coated with poly-D-lysine (Sigma-Aldrich). The cells were cultured on slides (ThermoFisher Scientific) or 48-well plates. Cells were fixed using 4% paraformaldehyde in 20 mM HEPES (pH 7.5). Primary antibody reactions were performed overnight at 4°C using an appropriate dilution in HEPES buffer containing 0.75% (v / v) BSA and 0.4% (v / v) Triton X-100 (blocking buffer) (Anti-GLI2 (Goat polyclonal), R&D systems, Cat# AF3635). Next, cells were incubated with a secondary antibody using an FITC-conjugated IgG antibody (Jackson ImmunoResearch). After washing, fluorescence was observed using a BZ-X800 fluorescence microscope (KEYENCE).

[0053] <Immunoblotting> The cells were washed twice with chilled PBS and incubated with protease inhibitors (1 mM PMSF, 10 μg / mL approach). The cells were lysed in NP-40 buffer (25 mM Tris-HCl [pH 7.5], 150 mM NaCl, 1 mM EDTA, 1.0% NP-40, and 5% glycerol) containing 1 μg / mL leupeptin, 1 μg / mL pepstatin A, 1 mM Na3VO4, and 10 mM NaF) on ice for 15 min. The lysate was then centrifuged at 20,000 xg for 15 min at 4°C. For phosphatase treatment, the lysate was incubated with lambda phosphatase (New England Biolabs) for 30 min at 30°C. Equal amounts of protein were separated by SDS-PAGE and transferred to a PVDF membrane (Merck). The membrane was blocked with 5% skim milk in Tris-buffered saline containing 0.05% Tween 20 (TBST) or 0.1% casein / gelatin in TBST. Primary and secondary antibodies were incubated in the respective blocking buffers. In each example, the following antibodies were used as primary antibodies: ·Anti-GLI2 (Goat polyclonal)(R&D systems, Cat# AF3635); ·Anti-GLI3 (Goat polyclonal)(R&D systems, Cat# AF3690); ·Anti-DYRK2 (Rabbit polyclonal)(Sigma-Aldrich, Cat# HPA027230); ·Anti-GFP (Rabbit monoclonal)(Abcam, Cat# ab183734); ·Anti-GAPDH (Mouse monoclonal)(Santa Cruz Biotechnology, Cat# sc-32233); Anti-phosphorylated GLI2 S252 / GLI3 S313 antibody. As secondary antibodies, labeled antibodies capable of recognizing these primary antibodies were used respectively. Signals were detected using either ImmunoStar LD (Wako) or Western Lightning Plus ECL (PerkinElmer) chemiluminescent reagents. Visualization of signals and measurement of band intensity were performed using a Fusion-Solo system (M&S Instruments).

[0054] <Immunoprecipitation> Cells were lysed on ice for 15 minutes using NP-40 buffer containing an inhibitor, and then the lysate was centrifuged at 20,000 g for 15 minutes at 4°C. The lysate was incubated with Flag M2 affinity beads (Sigma-Aldrich) or anti-GFPmAb agarose (MBL) at 4°C for 90 minutes. For immunoprecipitation of endogenous GLI3, the lysate was incubated with an anti-GLI3 antibody (R&D) at 4°C for 3 hours, followed by incubation with protein G sepharose fast flow (GE Healthcare) at 4°C for 1 hour. The beads were collected by centrifugation at 2,500 g for 1 minute, washed, and then boiled at 95°C for 5 minutes using 2×SDS sample buffer.

[0055] <SPR analysis> SPR analysis of the binding of recombinant SUFU protein (Abcam) to the GLI3 peptide was performed using a BIAcore T200 system (GE Healthcare) at 25°C in HBS-EP+ buffer (Cytiva). Phosphorylated GLI3[[ID=IS]] S313 309-345 peptide or non-phosphorylated GLI3 309-345 peptide was immobilized on a Series S sensor chip SA (Cytiva) according to the manufacturer's protocol. Recombinant SUFU at concentrations ranging from 50 to 2,000 nM in HBS-EP+ buffer was injected according to the single-cycle kinetics method Dissociation constant (K D) was calculated by curve fitting according to the manufacturer's instructions.

[0056] <rt-qpcr> Total RNA was isolated from cells using the RNeasy mini kit (QIAGEN). Reverse transcription was performed using PrimeScript Reverse Transcriptase (TaKaRa Bio), followed by RT-qPCR using the PIKOREAL96 system (ThermoFisher Scientific). The reaction was performed using KAPA SYBR FAST qPCR Master Mix (NIPPON Genetics) containing 0.2 μM of a primer set specific for the GLI1 gene. Data were quantified using the comparative CT method (delta CT method), with mouse Hprt as the internal standard. The sequences of the primers used are as follows: mouse Gli1 Forward primer: GCACCACATCAACAGTGAGC (SEQ ID NO: 21) Reverse primer: GCGTCTTGAGGTTTTCAAGG (SEQ ID NO: 22) mouse Hprt Forward primer: CTCATGGACTGATTATGGACAGGAC (SEQ ID NO: 23) Reverse primer: GCAGGTCAGCAAAGAACTTATAGCC (SEQ ID NO: 24)

[0057] Example 1: Identification of the kinase DYRK2 as an interacting molecule of GLI2 / GLI3 To identify the phosphorylation sites of GLI2 and GLI3 by DYRK2, we investigated candidate sites conserved among species using the DYRK2 consensus sequence (Rx(x)[S / T]P). S252 and GLI3 S313 The amino acid sequence of GLI2 is highly conserved not only among vertebrate species but also between GLI2 and GLI3 (Fig. 1). S252 and GLI3 S313 To monitor the phosphorylation status of GLI2, we used anti-phosphorylated GLI2 S252 / GLI3 S313 We generated a phosphorylation-specific antibody named antibody. DYRK2 to GLI2 S252A or GLI3 S313A When overexpressed with anti-phosphorylated GLI2 S252 / GLI3 S313 On the other hand, when DYRK2 was overexpressed together with wild-type GLI2 or GLI3, the activity of the anti-phosphorylated GLI2 antibody was barely detected. S252 / GLI3 S313 The band intensity detected by the antibody was significantly enhanced (Fig. 2). These results suggest that DYRK2 binds to GLI2, which contains a highly conserved serine residue. S252 and GLI3 S313 It was shown that DYRK2 directly interacts with and specifically phosphorylates GLI2. S252 / GLI3 S313 was identified.

[0058] Example 2: GLI3 S313 Phosphorylation of Wild type and Dyrk2 - / - The phosphorylation status of endogenous GLI3 in MEFs was compared. S252 / GLI3 S313 We analyzed the phosphorylation state of endogenous GLI3 immunoprecipitated with a polyclonal antibody that recognizes GLI3. - / - MEFs were stimulated with a Hedgehog signaling activator (SAG; an agonist of SMO), and immunoprecipitated with anti-GLI3 antibody. S252 / GLI3 S313 Immunoblotting was performed using antibodies against GLI3. Three hours after SAG stimulation, S313 Phosphorylation of Dyrk2 was significantly induced (Fig. 3, Fig. 4). - / - Phosphorylated GLI3 in MEFs S313 The absence of a band of GLI3 (Figures 3 and 4) indicates that the phosphorylation of GLI3 after SMO activation is specifically induced by DYRK2, and that the phosphorylation of GLI3 by DYRK2 is dependent on Hh ligand stimulation. In other words, upon Hedgehog signal activation, the kinase DYRK2 phosphorylates GLI3 (GLI3 S313 ) is converted to its active form by phosphorylation.

[0059] Example 3: Phosphorylation by DYRK2 converts GLI2 / GLI3 to an active form and promotes nuclear translocation In response to SAG stimulation, the GLI2 / GLI3-SUFU complex dissociates, and GLI2 and GLI3 are converted to active GLI2 and active GLI3, respectively, and are able to translocate to the nucleus. However, the mechanism by which SAG stimulation causes GLI2 / GLI3 to dissociate from SUFU and convert to active GLI2 / active GLI3 is still unclear. DYRK2-mediated phosphorylation site GLI2 S252 and GLI3 S313 is contained in the SUFU-binding domain. DYRK2-dependent phosphorylation site (GLI2 S252 and GLI3 S313 ) is directly related to the interaction with SUFU To further investigate whether this effect is related to the surface plasmon resonance (SPR) analysis using Biascore, Analysis revealed that non-phosphorylated peptides (GLI3 309-345 ) and phosphorylated peptide (phospho-GLI3 S313 309-345 The binding of SUFU to 2.64 × 10 -6 Dissociation constant (KD) of GLI3 309-345 In contrast, phosphorylated GLI3 bound to S313 309-345 Peptides are SUFU and binding is reduced, and the KD is 5.08 x 10 -6 Furthermore, the serine (S) at position 252 was A glutamic acid mutant (GLI2) mimicking phosphorylation by mutating it to glutamic acid (E) S252E ) and an alanine mutant in which serine (S) at position 252 was mutated to alanine (A) (GLI2 S252A We prepared a glutamate mutant (GLI2) that mimicked phosphorylation and analyzed its localization in cells. S252E ) were expressed in wild-type GLI2 and the alanine mutant (GLI2 S252A ) showed distinct nuclear localization, in contrast to the predominant cytoplasmic distribution of GLI2 and GLI3 (Fig. 6). These results indicate that DYRK2-dependent phosphorylation of GLI2 and GLI3 promotes their dissociation from SUFU and subsequent nuclear translocation, leading to activation of Hh signaling.

[0060] <Example 4> Anti-phosphorylated GLI2 S252 / GLI3 S313 Intracellular introduction of antibodies suppresses Hh signaling in wild-type MEFs After serum starvation of the wild-type MEFs, anti-phosphorylated GLI2 was transfected using Xfect Protein Transfection Reagent (TAKARA Bio). S252 / GLI3 S313 Cells were transfected with antibodies or normal rabbit IgGs (ProteinTech) according to the manufacturer's instructions. On the same day as transfection, cells were treated with 100 nM SAG (Merck). 24 hours later, cells were sampled and Gli1 gene expression, an indicator of Hedgehog signaling activation, was measured by RT-qPCR. The results showed that specific inhibition of the GLI2 / GLI3 phosphorylation site significantly reduced Gli1 gene expression, indicating that Hedgehog signaling activation could be inhibited (Figure 7).

[0061] <Example 5> Anti-phosphorylated GLI2 S252 / GLI3 S313 Intracellular introduction of antibodies W535L Expression cells Represses Hh signaling in the cytoplasm The above mutant SMO W535L After serum starvation of stable expressing cells, anti-phosphorylated GLI2 was detected using Ab-DeliverIn (Oz Biosciences). S252 / GLI3 S313 Antibody or Normal rabbit IgGs (ProteinTech) On the same day as transfection, the cells were treated with 100 nM SAG (Merck), and 24 hours later, samples were taken and the Hedgehog signal was measured. The expression of the Gli1 gene, which is involved in the GLI2 / GLI3 phosphorylation, was measured by RT-qPCR. As a result, we found that the mutant SMO1, which does not show inhibitory effects with current Hedgehog inhibitors, specifically inhibits the phosphorylation site of GLI2 / GLI3. W535L We also demonstrated that Gli1 gene expression was significantly reduced in expressing cells, indicating that Hedgehog signal activation could be inhibited (Fig. 8).

[0062] As shown in Figure 9, current Hedgehog inhibitors target SMO, and patients with SMO mutations are refractory to current drugs, resulting in activation of Hedgehog signaling. The present inventors identified the phosphorylation site of GLI2 / GLI3 required for activation of Hedgehog signaling, and demonstrated that GLI2 S252 / GLI3 S313 We found that phosphorylation of GLI2 / GLI3 converts GLI2 / GLI3 to its active form. S252 / GLI3 S313 We demonstrated that intracellular introduction of the antibody inhibits Hedgehog signaling. Because GLI2 / GLI3 phosphorylation is downstream of SMO during the Hedgehog signaling activation process, the present invention makes it possible to inhibit Hedgehog signaling regardless of the presence or absence of SMO gene mutations.

Claims

1. A serine residue at a position corresponding to position 252 of SEQ ID NO: 1 in GLI2 having the amino acid sequence represented by SEQ ID NO: 1 or an amino acid sequence having 90% or more identity to SEQ ID NO: 1 (hereinafter, GLI2 S252 also referred to as A serine residue at a position corresponding to position 313 of SEQ ID NO: 2 in GLI3 having the amino acid sequence shown in SEQ ID NO: 2 or an amino acid sequence that is 90% or more identical to SEQ ID NO: 2 (hereinafter, GLI3 S313 Also called Hedgehog signaling inhibitors, including molecules that target phosphorylation of

2. The molecule is phosphorylated GLI2 S252 and / or phosphorylated GLI3 S313 The inhibitor of claim 1, which is an antibody or antigen-binding fragment thereof that targets

3. The inhibitor of claim 1 , wherein the antibody or antigen-binding fragment thereof targets an amino acid sequence comprising the amino acid sequence represented by SEQ ID NO: 3 or 4.

4. The inhibitor according to claim 1, which is introduced into a cell.

5. A pharmaceutical composition comprising the inhibitor according to any one of claims 1 to 4 and a pharmaceutically acceptable additive.

6. The pharmaceutical composition according to claim 5 for treating Hedgehog signal-dependent solid cancer.

7. The pharmaceutical composition according to claim 6, wherein the Hedgehog signal-dependent solid cancer is selected from the group consisting of basal cell carcinoma and medulloblastoma.

8. The Hedgehog signaling-dependent solid cancers are basal cell carcinoma and medulloblastoma with SMO mutations.

7. The pharmaceutical composition of claim 6, wherein the compound is selected from the group consisting of:

9. The pharmaceutical composition according to claim 5 , further comprising an agent for introducing the inhibitor into cells.

10. GLI2 S252 or GLI3 S313 A method for screening for a compound that inhibits Hedgehog signaling, using phosphorylation of introducing the test substance into cells of a Hedgehog signaling-dependent solid cancer; GLI2 S252 or GLI3 S313 measuring the phosphorylation of; GLI2 after administration of the test substance compared to before administration of the test substance S252 or GLI3 S313 When the phosphorylation of Hedgehog is decreased, the test substance is screened as a candidate compound that inhibits Hedgehog signaling.

Images