Anti-SARS-cov-2 single domain antibody
Single-domain antibodies with binding and neutralizing activity against SARS-CoV-2 are developed for treating, preventing, and diagnosing the virus, addressing the lack of effective treatments and providing diagnostic and preventive solutions.
Patent Information
- Application Number
- JP2025108663
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2025-06-27
- Publication Date
- 2025-10-15
AI Technical Summary
There are currently no approved drugs for the treatment of SARS-CoV-2 infection primarily composed of single-domain antibodies, and there is a need for effective treatments, diagnostic reagents, and hygiene products to prevent and detect SARS-CoV-2 infection.
Development of single-domain antibodies with binding and neutralizing activity against SARS-CoV-2, including pharmaceutical compositions, detection reagents, and hygiene products containing these antibodies to treat, prevent, and diagnose SARS-CoV-2 infection.
The single-domain antibodies provide effective treatment and prevention of SARS-CoV-2 infection, facilitate accurate diagnosis through detection methods, and offer hygiene products that inhibit viral transmission.
Smart Images

Figure 2025157275000003 
Figure 2025157275000004 
Figure 2025157275000005
Abstract
Description
[Technical Field]
[0001] The present invention relates to single domain antibodies for neutralizing SARS-CoV-2. [Background technology]
[0002] Coronaviruses are a group of RNA viruses in the family Coronaviridae, subfamily Orthocoronavirus, order Nidovirales. Coronaviruses are enveloped viruses with a positive-sense single-stranded RNA genome and a helical symmetric nucleocapsid, giving them a characteristic shape with club-shaped projections protruding from the capsid surface. Coronaviruses are large among RNA viruses, with genome sizes of approximately 26-32 kilobases.
[0003] Coronaviruses are RNA viruses that cause infectious diseases in mammals, birds, and other animals, particularly mild to severe respiratory tract infections. In humans, coronaviruses cause the common cold when symptoms are mild (though many other cold-causing viruses are known), but some coronaviruses, such as SARS and MERS, are known to cause more fatal symptoms. In particular, SARS-CoV-2, a novel coronavirus discovered in China in 2019, spread worldwide in a short period of time, resulting in numerous infections and deaths, partly due to the lack of effective treatments. The number of cases continues to increase, and there is a growing desire for the rapid development and widespread use of treatments for SARS-CoV-2.
[0004] SARS-CoV-2 has spike proteins on its viral surface that bind to host cell receptors. These spike proteins are glycoproteins with a trimeric structure, with each polypeptide chain consisting of an N-terminal domain (NTD), an S1 domain, and an S2 domain. The receptor-binding domain (RBD) on the S1 domain has two conformations: a "down conformation" and an "up conformation." It has been shown that the RBD in the up conformation binds to the angiotensin convertase II (ACE2) receptor on the host cell surface (Non-Patent Document 1).
[0005] Single-domain antibodies are antibodies consisting of the variable region of an antibody (immunoglobulin) composed only of heavy chains. Examples include VHHs found in camelids and VNARs found in sharks. Single-domain antibodies are also called single-chain antibodies or nanobodies (registered trademark). While single-domain antibodies possess antigen-binding properties similar to those of conventional antibodies, they are known to have excellent acid and heat resistance, and even after denaturation, their antigen-binding properties are restored by exposure to physiological conditions. Single-domain antibodies have a molecular weight of approximately 12-15 kDa and are relatively easy to produce using recombinant microorganisms such as Escherichia coli and yeast. These characteristics make them promising candidates for use as antibody therapeutics, and a single-domain antibody targeting von Willebrand factor (vWF) is already commercially available as a treatment for acquired thrombotic thrombocytopenic purpura (aTTP) (Non-Patent Document 2). [Prior art documents] [Non-patent literature]
[0006] [Non-Patent Document 1] D. Wrapp et al., Science, Vol. 367, pp. 1260-1263 (2020) [Non-patent document 2] F. Peyvandi et al., Journal of Thrombosis and Haemostasis, Vol. 15, pp. 1448-1452 (2017) Summary of the Invention [Problem to be solved by the invention]
[0007] Many institutions are developing drugs to treat SARS-CoV-2 infection (Covid-19), and antibody drugs have been commercialized. However, there are currently no approved drugs for the treatment of SARS-CoV-2 infection that are primarily composed of single-domain antibodies. The present invention aims to provide single-domain antibodies that have binding activity and neutralizing activity against SARS-CoV-2. The present invention also aims to provide pharmaceutical compositions useful for the treatment and / or prevention of SARS-CoV-2 infection, reagents and methods for detecting SARS-CoV-2 in samples that are useful for aiding in the diagnosis of SARS-CoV-2 infection, and hygiene products effective in preventing SARS-CoV-2 infection. [Means for solving the problem]
[0008] According to this specification, the following inventions are provided. (1) A single domain antibody comprising a polypeptide selected from the group of polypeptides (a) to (c) below: (a) a polypeptide having the amino acid sequence set forth in SEQ ID NO: 2; (b) a polypeptide having 90% or more sequence identity with the amino acid sequence of the polypeptide described in (a) above and having binding activity to the receptor binding domain (RBD) of SARS-CoV-2; (c) A polypeptide comprising the amino acid sequence of the polypeptide described in (a) or (b) above as a partial sequence and having binding activity to SARS-CoV-2 RBD. (2) The single domain antibody of (1), wherein the polypeptide comprises the following three CDRs: (g) CDR1 consisting of the amino acid sequence shown in SEQ ID NO: 9 or the amino acid sequence shown in SEQ ID NO: 9 in which one or two amino acids are deleted, substituted, or added; (h) CDR2 consisting of the amino acid sequence shown in SEQ ID NO: 13 or the amino acid sequence shown in SEQ ID NO: 13 in which one or two amino acids are deleted, substituted, or added; and (i) A CDR3 consisting of the amino acid sequence shown in SEQ ID NO: 17 or the amino acid sequence shown in SEQ ID NO: 17 in which one or two amino acids have been deleted, substituted or added. (3) A pharmaceutical composition used for the treatment or prevention of SARS-CoV-2 infection, comprising the single domain antibody according to (1) or (2) as an active ingredient. (4) A detection reagent for SARS-CoV-2, comprising the single domain antibody described in (1) or (2). (5) A method for detecting SARS-CoV-2 in a sample, comprising a step of contacting the sample with the single domain antibody described in (1) or (2). (6) The method according to (5), wherein the sample is a sample taken from a subject. (7) The method according to (6), wherein the subject is a human. (8) A sanitary product used for preventing SARS-CoV-2 infection, containing the single domain antibody described in (1) or (2) as an active ingredient. [Effects of the Invention]
[0009] The present invention provides a single-domain antibody having binding activity and neutralizing activity against SARS-CoV-2. The present invention also provides a pharmaceutical composition useful for treating and / or preventing SARS-CoV-2 infection, a reagent and method for detecting SARS-CoV-2 in a sample that are useful for assisting in the diagnosis of SARS-CoV-2 infection, and a hygiene product effective in preventing SARS-CoV-2 infection. [Brief explanation of the drawings]
[0010] [Figure 1] 1 shows an alignment of VHH antibodies (A02, A03, A15, B02, B04, B13, and B16) having the amino acid sequences shown in SEQ ID NOs: 1 to 7. [Figure 2]This graph shows the results of evaluating the binding activity of each anti-SARS-CoV-2 RBD VHH antibody to RBD. The test was performed in four increments. All of the anti-RBD VHH antibodies used were confirmed to have binding activity to RBD. In particular, A02, A03, and A15 showed high binding activity. [Figure 3] 1 is a graph showing the results of evaluating the neutralizing activity of each SARS-CoV-2 RBD VHH antibody. The test was performed with n=4. The average absorbance of the positive control group was defined as 100% ACE2 binding rate, and the ACE2 binding rate was calculated from the average absorbance of each measurement group. It was confirmed that A02, A03, and A15, which showed high RBD binding activity in Example 3, exhibited relatively high neutralizing activity. DETAILED DESCRIPTION OF THE INVENTION
[0011] [1] Definition As used herein, the term "polypeptide" refers to a molecule formed by peptide bonds between multiple amino acids. The polypeptide of the present invention encompasses not only polypeptide molecules consisting of a large number of amino acids, but also low-molecular-weight molecules (oligopeptides) consisting of a small number of amino acids.
[0012] As used herein, the term "antibody" refers to a protein that specifically binds to a specific substance (antigen). In the present invention, the antigen is the receptor binding domain (RBD) on the S1 domain of SARS-CoV-2, and the antibody is an anti-SARS-CoV-2 RBD antibody. The single-domain antibody of the present invention has binding activity to the RBD of SARS-CoV-2 present in the body of a subject, and can therefore inhibit SARS-CoV-2 infection of the host by inhibiting the binding of the RBD to the angiotensin convertase II (ACE2) receptor on the surface of host cells.
[0013] As used herein, the "binding activity" of an antibody refers to the activity of an antibody to specifically bind to a specific protein (antigen). In the present invention, "binding activity" specifically refers to the activity of an antibody to bind to SARS-CoV-2 RBD. As used herein, the "neutralizing activity" of an antibody refers to the activity of an antibody to neutralize the activity of a specific protein (antigen). In the present invention, "neutralizing activity" specifically refers to the activity of an antibody to neutralize the binding activity of SARS-CoV-2 RBD to the ACEII receptor of a host cell.
[0014] As used herein, the term "single-domain antibody" refers to an antibody consisting of an antibody variable region composed only of a heavy chain. Any known single-domain antibody, such as a VHH antibody or a VNAR antibody, can be used as the single-domain antibody of the present invention. VHH antibodies are particularly suitable for use. VHH antibodies have four framework regions (FR1-4) and three complementarity-determining regions (CDR1-3), with the FRs and CDRs linked alternately. The molecular weight of a VHH monomer is approximately 12-15 kDa. VHHs may be used as monomers, or multiple VHHs may be linked in tandem using linkers or the like to form dimers to tetramers.
[0015] As used herein, the term "complementarity determining region (CDR)" refers to the region in a single domain antibody that directly contacts an antigen. The single domain antibody of the present invention has three CDRs, CDR1 to CDR3. As used herein, the positions of CDR1 and CDR3 refer to the positions determined using the Kabat numbering system (Kabat EA et al., Sequences of Proteins of Immunological Interest, NIH (1991)). The position of CDR2 refers to the position determined using the IGMT numbering system (M.-P. Lefranc et al., Dev. Comp. Immunol. 27, 55-77 (2003)). As used herein, the term "frame region (FR)" refers to the portion of a single domain antibody other than the CDRs.
[0016] As used herein, the term "subject" refers to mammals and birds. Birds refer to animals belonging to the phylum Chordata, subphylum Vertebrata, class Aves, and include, for example, chickens, ducks, quails, geese, wild ducks, turkeys, budgerigars, parrots, mandarin ducks, and swans. Mammals refer to animals belonging to the phylum Chordata, subphylum Vertebrata, class Mammalia, which includes both humans and non-humans, and include, for example, primates including humans and chimpanzees, pet animals such as dogs and cats, livestock animals such as cows, pigs, horses, sheep, and goats, rodents such as mice and rats, and mammals kept in zoos. The subject herein is preferably a human.
[0017] As used herein, the "sequence identity" of an amino acid sequence refers to a value that can be determined using a protein search system such as BLAST (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi), with or without introducing gaps. Furthermore, as used herein, the "number" in "several" refers to an integer of 2 to 10, preferably an integer of 2 to 6, an integer of 2 to 4, an integer of 2 or 3, or an integer of 2.
[0018] As used herein, "pharmaceutical composition" refers to a composition for administration to a subject for the purpose of treating or preventing a SARS-CoV-2 infection in the subject.
[0019] As used herein, the term "detection reagent" refers to a composition or the like used to detect SARS-CoV-2 in a sample in vitro. The reagent referred to here may be in any form, as long as it is capable of detecting SARS-CoV-2. It may be a single agent such as a composition, but also may be in the form of a kit containing, for example, a microwell plate, a solid phase such as magnetic beads, a washing solution, multiple compositions such as a detection reagent, a substrate, etc.
[0020] As used herein, "hygiene products" refer to items other than machinery and equipment that are primarily used by healthy people in their daily lives to maintain their health by cleaning the body, maintaining indoor hygiene, preventing illness, etc. In this specification, "hygiene products" also include "quasi-drugs" under the Pharmaceutical and Medical Device Act (Act on Ensuring Quality, Efficacy, and Safety of Pharmaceuticals, Medical Devices, etc.). For example, hygiene products include gauze, sheets, masks, cotton swabs, etc. Furthermore, they include, for example, cleaning materials for wiping the bodies of humans and pets, and cleaning sheets used for wiping indoors, etc.
[0021] [2] Single-domain antibodies The single domain antibody of the present invention is a single domain antibody characterized by comprising a polypeptide selected from the group of polypeptides described in the following (a) to (c): (a) a polypeptide having an amino acid sequence shown in any one of SEQ ID NOs: 1 to 7; (b) a polypeptide having 80% or more sequence identity with the amino acid sequence of any of the polypeptides described in (a); (c) A polypeptide comprising the amino acid sequence of the polypeptide described in (a) or (b) above as a partial sequence. The single domain antibody of the present invention has the above-mentioned characteristics and thus has binding activity to the RBD of SARS-CoV-2 and neutralizing activity against the SARS-CoV-2 RBD.
[0022] FIG. 1 shows an alignment of the amino acid sequences of SEQ ID NOs: 1 to 7.
[0023] A first embodiment of the single domain antibody of the present invention comprises the following three complementarity determining regions (CDRs): (d) CDR1 consisting of the amino acid sequence shown in SEQ ID NO: 8 or the amino acid sequence shown in SEQ ID NO: 8 in which one or two amino acids are deleted, substituted, or added; (e) CDR2 consisting of the amino acid sequence shown in SEQ ID NO: 12 or the amino acid sequence shown in SEQ ID NO: 12 in which one or two amino acids are deleted, substituted, or added; and (f) A CDR3 consisting of the amino acid sequence shown in SEQ ID NO: 16 or the amino acid sequence shown in SEQ ID NO: 16 in which one or two amino acids have been deleted, substituted or added.
[0024] In other words, the first embodiment of the single domain antibody of the present invention has the amino acid sequence shown in SEQ ID NO: 1 and the following three CDRs: CDR1: RNTMH (SEQ ID NO: 8); CDR2: ISSRGDWT (SEQ ID NO: 12); and CDR3: YLWLLGGVY (SEQ ID NO: 16) an antibody comprising the above (hereinafter referred to as "A02"), an antibody comprising a polypeptide having 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or more sequence homology to the amino acid sequence shown in SEQ ID NO: 1, and / or an antibody in which one, two, or three of CDRs 1 to 3 have been replaced with CDR1 consisting of an amino acid sequence in which one or two amino acids have been deleted, substituted, or added from the amino acid sequence shown in SEQ ID NO: 8, CDR2 consisting of an amino acid sequence in which one or two amino acids have been deleted, substituted, or added from the amino acid sequence shown in SEQ ID NO: 12, or CDR3 consisting of an amino acid sequence in which one or two amino acids have been deleted, substituted, or added from the amino acid sequence shown in SEQ ID NO: 16.
[0025] A second embodiment of the single domain antibody of the present invention comprises the following three CDRs: (g) CDR1 consisting of the amino acid sequence shown in SEQ ID NO: 9 or the amino acid sequence shown in SEQ ID NO: 9 in which one or two amino acids are deleted, substituted, or added; (h) CDR2 consisting of the amino acid sequence shown in SEQ ID NO: 13 or the amino acid sequence shown in SEQ ID NO: 13 in which one or two amino acids are deleted, substituted, or added; and (i) A CDR3 consisting of the amino acid sequence shown in SEQ ID NO: 17 or the amino acid sequence shown in SEQ ID NO: 17 in which one or two amino acids have been deleted, substituted or added.
[0026] In other words, the second embodiment of the single domain antibody of the present invention has the amino acid sequence shown in SEQ ID NO: 2 and the following three CDRs: CDR1: HNAMH (SEQ ID NO: 9); CDR2: ISHVVYRT (SEQ ID NO: 13); and CDR3: VALTDLRLY (SEQ ID NO: 17) an antibody comprising the above (hereinafter referred to as "A03"), an antibody comprising a polypeptide having 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% or more sequence homology to the amino acid sequence shown in SEQ ID NO: 2, and / or an antibody in which one, two or three of CDRs 1 to 3 have been replaced with CDR1 consisting of an amino acid sequence shown in SEQ ID NO: 9 in which one or two amino acids have been deleted, substituted or added, CDR2 consisting of an amino acid sequence shown in SEQ ID NO: 13 in which one or two amino acids have been deleted, substituted or added, or CDR3 consisting of an amino acid sequence shown in SEQ ID NO: 17 in which one or two amino acids have been deleted, substituted or added.
[0027] A third embodiment of the single domain antibody of the present invention comprises the following three CDRs: (j) CDR1 consisting of the amino acid sequence shown in SEQ ID NO: 8 or the amino acid sequence shown in SEQ ID NO: 8 in which one or two amino acids are deleted, substituted, or added; (k) CDR2 consisting of the amino acid sequence shown in SEQ ID NO: 12 or the amino acid sequence shown in SEQ ID NO: 12 in which one or two amino acids are deleted, substituted, or added; and (l) A CDR3 consisting of the amino acid sequence shown in SEQ ID NO: 18 or the amino acid sequence shown in SEQ ID NO: 18 in which one or two amino acids have been deleted, substituted or added.
[0028] In other words, a third aspect of the single domain antibody of the present invention has the amino acid sequence shown in SEQ ID NO: 3 and the following three CDRs: CDR1: RNTMH (SEQ ID NO: 8); CDR2: ISSRGDWT (SEQ ID NO: 12); and CDR3: SVSAFGWLY (SEQ ID NO: 18) an antibody comprising the amino acid sequence shown in SEQ ID NO: 3 (hereinafter referred to as "A15"), an antibody comprising a polypeptide having 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or more sequence homology to the amino acid sequence shown in SEQ ID NO: 3, and / or an antibody in which one, two, or three of CDR1 to CDR3 have been replaced with CDR1 consisting of an amino acid sequence shown in SEQ ID NO: 8 in which one or two amino acids have been deleted, substituted, or added, CDR2 consisting of an amino acid sequence shown in SEQ ID NO: 12 in which one or two amino acids have been deleted, substituted, or added, or CDR3 consisting of an amino acid sequence shown in SEQ ID NO: 18 in which one or two amino acids have been deleted, substituted, or added.
[0029] A fourth embodiment of the single domain antibody of the present invention comprises the following three CDRs: (m) a CDR1 consisting of the amino acid sequence shown in SEQ ID NO: 8 or the amino acid sequence shown in SEQ ID NO: 8 in which one or two amino acids are deleted, substituted, or added; (n) CDR2 consisting of the amino acid sequence shown in SEQ ID NO: 12 or the amino acid sequence shown in SEQ ID NO: 12 in which one or two amino acids are deleted, substituted, or added; and (o) A CDR3 consisting of the amino acid sequence shown in SEQ ID NO: 19 or the amino acid sequence shown in SEQ ID NO: 19 in which one or two amino acids have been deleted, substituted or added.
[0030] In other words, a fourth aspect of the single domain antibody of the present invention has the amino acid sequence shown in SEQ ID NO: 4 and the following three CDRs: CDR1: RNTMH (SEQ ID NO: 8); CDR2: ISSRGDWT (SEQ ID NO: 12); and CDR3: LLWNYGGVC (SEQ ID NO: 19) an antibody comprising the amino acid sequence shown in SEQ ID NO: 4 (hereinafter referred to as "B02"), an antibody comprising a polypeptide having 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% or more sequence homology to the amino acid sequence shown in SEQ ID NO: 4, and / or an antibody in which the CDR1 is replaced with an amino acid sequence in which one or two amino acids have been deleted, substituted or added from the amino acid sequence shown in SEQ ID NO: 8, a CDR2 is replaced with an amino acid sequence in which one or two amino acids have been deleted, substituted or added from the amino acid sequence shown in SEQ ID NO: 12, or a CDR3 is replaced with an amino acid sequence in which one or two amino acids have been deleted, substituted or added from the amino acid sequence shown in SEQ ID NO: 19.
[0031] A fifth embodiment of the single domain antibody of the present invention comprises the following three CDRs: (p) a CDR1 consisting of the amino acid sequence shown in SEQ ID NO: 8 or the amino acid sequence shown in SEQ ID NO: 8 in which one or two amino acids are deleted, substituted, or added; (q) CDR2 consisting of the amino acid sequence shown in SEQ ID NO: 12 or the amino acid sequence shown in SEQ ID NO: 12 in which one or two amino acids are deleted, substituted, or added; and (r) A CDR3 consisting of the amino acid sequence shown in SEQ ID NO: 20 or the amino acid sequence shown in SEQ ID NO: 20 in which one or two amino acids have been deleted, substituted or added.
[0032] In other words, a fifth aspect of the single domain antibody of the present invention has the amino acid sequence shown in SEQ ID NO: 5 and the following three CDRs: CDR1: RNTMH (SEQ ID NO: 8); CDR2: ISSRGDWT (SEQ ID NO: 12); and CDR3: LLWHYGGVY (SEQ ID NO: 20) an antibody comprising the amino acid sequence shown in SEQ ID NO: 5 (hereinafter referred to as "B04"), an antibody comprising a polypeptide having 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% or more sequence homology to the amino acid sequence shown in SEQ ID NO: 5, and / or an antibody in which the CDR1 is replaced with an amino acid sequence in which one or two amino acids have been deleted, substituted or added from the amino acid sequence shown in SEQ ID NO: 8, a CDR2 is replaced with an amino acid sequence in which one or two amino acids have been deleted, substituted or added from the amino acid sequence shown in SEQ ID NO: 12, or a CDR3 is replaced with an amino acid sequence in which one or two amino acids have been deleted, substituted or added from the amino acid sequence shown in SEQ ID NO: 20.
[0033] A sixth embodiment of the single domain antibody of the present invention comprises the following three CDRs: (s) a CDR1 consisting of the amino acid sequence shown in SEQ ID NO: 10 or the amino acid sequence shown in SEQ ID NO: 10 in which one or two amino acids are deleted, substituted, or added; (t) CDR2 consisting of the amino acid sequence shown in SEQ ID NO: 14 or the amino acid sequence shown in SEQ ID NO: 14 in which one or two amino acids are deleted, substituted, or added; and (u) A CDR3 consisting of the amino acid sequence shown in SEQ ID NO: 21 or the amino acid sequence shown in SEQ ID NO: 21 in which one or two amino acids have been deleted, substituted or added.
[0034] In other words, a sixth aspect of the single domain antibody of the present invention has the amino acid sequence shown in SEQ ID NO: 6 and the following three CDRs: CDR1:HHTML (SEQ ID NO: 10); CDR2: ISFRGNWT (SEQ ID NO: 14); and CDR3: HLWLLGGVY (SEQ ID NO: 21) an antibody comprising the amino acid sequence shown in SEQ ID NO: 6 (hereinafter referred to as "B13"), an antibody comprising a polypeptide having 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% or more sequence homology to the amino acid sequence shown in SEQ ID NO: 6, and / or an antibody in which the CDR1 is replaced with an amino acid sequence in which one or two amino acids have been deleted, substituted or added from the amino acid sequence shown in SEQ ID NO: 10, a CDR2 is replaced with an amino acid sequence in which one or two amino acids have been deleted, substituted or added from the amino acid sequence shown in SEQ ID NO: 14, or a CDR3 is replaced with an amino acid sequence in which one or two amino acids have been deleted, substituted or added from the amino acid sequence shown in SEQ ID NO: 21.
[0035] A seventh embodiment of the single domain antibody of the present invention comprises the following three CDRs: (v) CDR1 consisting of the amino acid sequence shown in SEQ ID NO: 11 or the amino acid sequence shown in SEQ ID NO: 11 in which one or two amino acids are deleted, substituted, or added; (w) CDR2 consisting of the amino acid sequence shown in SEQ ID NO: 15 or the amino acid sequence shown in SEQ ID NO: 15 in which one or two amino acids are deleted, substituted, or added; and (x) A CDR3 consisting of the amino acid sequence shown in SEQ ID NO: 16 or the amino acid sequence shown in SEQ ID NO: 16 in which one or two amino acids have been deleted, substituted or added.
[0036] In other words, a seventh aspect of the single domain antibody of the present invention has the amino acid sequence shown in SEQ ID NO: 7 and the following three CDRs: CDR1: HNAVH (SEQ ID NO: 11); CDR2: ISHLVHRT (SEQ ID NO: 15); and CDR3: YLWLLGGVY (SEQ ID NO: 16) an antibody comprising the amino acid sequence shown in SEQ ID NO: 7 (hereinafter referred to as "B16"), an antibody comprising a polypeptide having 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% or more sequence homology to the amino acid sequence shown in SEQ ID NO: 7, and / or an antibody in which the CDR1 is replaced with an amino acid sequence in which one or two amino acids have been deleted, substituted or added from the amino acid sequence shown in SEQ ID NO: 11, a CDR2 is replaced with an amino acid sequence in which one or two amino acids have been deleted, substituted or added from the amino acid sequence shown in SEQ ID NO: 15, or a CDR3 is replaced with an amino acid sequence in which one or two amino acids have been deleted, substituted or added from the amino acid sequence shown in SEQ ID NO: 16.
[0037] The antibodies of the present invention include, but are not limited to, all polypeptides having the amino acid sequences of SEQ ID NOs: 1 to 7, and also include polypeptides having 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or more sequence identity to the amino acid sequences of SEQ ID NOs: 1 to 7. Alternatively, the antibodies of the present invention also include polypeptides in which one or several amino acids have been modified in the polypeptides having the amino acid sequences of SEQ ID NOs: 1 to 7. In general, modification of less than 20%, particularly less than 15% or less than 10%, or modification of one or several amino acids in a polypeptide is thought to have no effect on the function of the original polypeptide and may even enhance the desired function of the original polypeptide in some cases. In fact, modified polypeptides consisting of an amino acid sequence in which one or several amino acid residues have been modified (i.e., substituted, deleted, added, and / or inserted) compared to the original amino acid sequence are known to retain the biological activity of the original polypeptide (Mark et al., 1984, Proc. Natl. Acad. Sci. USA, 81, pp. 5662-5666; Zoller and Smith, 1982, Nucleic Acids Res. 10, pp. 6487-6500; Dalbadie-McFarland et al., 1982, Proc. Natl. Acad. Sci. USA. 79, pp. 6409-6413).
[0038] Furthermore, the polypeptides of the present invention include not only polypeptides having the amino acid sequences of SEQ ID NOs: 1 to 7 (including the above-mentioned modified polypeptides), but also polypeptides that contain these as a part. Alternatively, the polypeptides may be polypeptides having a structure in which 2 to 4 of the same polypeptides or a combination of 2 to 4 types of polypeptides are linked in tandem among the above-mentioned polypeptides.
[0039] The 20 types of amino acids that make up natural proteins can be divided into groups with similar properties, such as neutral amino acids with low polarity side chains (Gly, Ile, Val, Leu, Ala, Met, Pro), neutral amino acids with hydrophilic side chains (Asn, Gln, Thr, Ser, Tyr, Cys), acidic amino acids (Asp, Glu), basic amino acids (Arg, Lys, His), and aromatic amino acids (Phe, Tyr, Trp), and it is known that substitutions between these groups often do not alter the properties of the polypeptide. Therefore, when substituting amino acid residues in the amino acid sequences of SEQ ID NOs: 1 to 7, substitutions between these groups are more likely to maintain binding activity and neutralizing activity.
[0040] The method for preparing the polypeptide of the present invention is not particularly limited, and any known method for preparing polypeptides used in the technical field can be used, for example, chemical synthesis methods such as peptide solid-phase synthesis methods such as Fmoc solid-phase synthesis and Boc solid-phase synthesis, and production by genetic recombination techniques using Escherichia coli, Brevibacillus, yeast, Aspergillus oryzae, insect cells, mammalian cells, or the like as hosts.
[0041] [3] Pharmaceutical composition The pharmaceutical composition of the present invention is a pharmaceutical composition for treating or preventing SARS-CoV-2 infection, which comprises at least one single domain antibody of the present invention described in the section "(2) Single Domain Antibodies." The pharmaceutical composition of the present invention may comprise only one type of polypeptide of the present invention, or may comprise multiple types of polypeptides of the present invention.
[0042] The route of administration of the pharmaceutical composition of the present invention is not particularly limited, and any known route of administration such as oral, nasal, sublingual, subcutaneous, or intramuscular may be used.
[0043] In addition to the single domain antibody, the pharmaceutical compositions of the present invention may contain a pharmaceutically acceptable carrier, if necessary. The term "pharmaceutically acceptable carrier" as used herein refers to additives commonly used in the pharmaceutical technology field, such as excipients, binders, disintegrants, fillers, emulsifiers, flow regulators, lubricants, etc.
[0044] The pharmaceutical composition of the present invention may further contain a pharmaceutically acceptable carrier, if necessary. The term "pharmaceutically acceptable carrier" refers to an additive commonly used in the pharmaceutical technology field. Examples include excipients, binders, disintegrants, fillers, emulsifiers, flow regulators, lubricants, etc.
[0045] Examples of excipients include sugars such as monosaccharides, disaccharides, cyclodextrins, and polysaccharides (more specifically, but not limited to, glucose, sucrose, lactose, raffinose, mannitol, sorbitol, inositol, dextrin, maltodextrin, starch, and cellulose), metal salts (e.g., sodium chloride, sodium or calcium phosphate, calcium sulfate, magnesium sulfate, calcium carbonate), citric acid, tartaric acid, glycine, low-, medium-, and high-molecular-weight polyethylene glycols (PEGs), pluronics, kaolin, silicic acid, or combinations thereof.
[0046] Examples of binders include starch paste using corn, wheat, rice, or potato starch, simple syrup, glucose solution, gelatin, tragacanth, methylcellulose, hydroxypropylmethylcellulose, sodium carboxymethylcellulose, shellac, and / or polyvinylpyrrolidone.
[0047] Examples of disintegrants include the above-mentioned starches, lactose, carboxymethyl starch, cross-linked polyvinylpyrrolidone, agar, laminaran powder, sodium hydrogen carbonate, calcium carbonate, alginic acid or sodium alginate, polyoxyethylene sorbitan fatty acid esters, sodium lauryl sulfate, stearic acid monoglyceride, or salts thereof.
[0048] Examples of fillers include the above-mentioned sugars and / or calcium phosphate (for example, tricalcium phosphate or calcium hydrogen phosphate).
[0049] Examples of emulsifiers include sorbitan fatty acid esters, glycerin fatty acid esters, sucrose fatty acid esters, and propylene glycol fatty acid esters.
[0050] Examples of flow regulators and lubricants include silicates, talc, stearates or polyethylene glycol.
[0051] Such carriers are primarily used to facilitate the formation of the dosage form and to maintain the dosage form and pharmacological effect, and may be used appropriately as needed. In addition to the above-mentioned additives, flavoring agents, solubilizing agents, suspending agents, diluents, surfactants, stabilizers, absorption enhancers, bulking agents, wetting agents, humectants, adsorbents, disintegration inhibitors, coating agents, coloring agents, preservatives, antioxidants, perfumes, flavoring agents, sweeteners, buffers, etc. may also be included as needed.
[0052] The pharmaceutical composition of the present invention may also contain other drugs to the extent that the effect of the single domain antibody is not lost. For example, in the case of an injection, it may contain a predetermined amount of other antibiotics.
[0053] The dosage form of the pharmaceutical composition of the present invention is not particularly limited as long as it does not inactivate the single domain antibody as an active ingredient and other additional active ingredients. For example, it may be any liquid, solid, or semisolid. Specific dosage forms include oral dosage forms such as liquids, powders, granules, tablets, capsules, sublingual tablets, and lozenges, and parenteral dosage forms such as injections, suspensions, emulsions, eye drops, nasal drops, creams, ointments, plasters, patches, and suppositories.
[0054] The pharmaceutical composition of the present invention can be administered by any suitable method that does not inactivate the active ingredient contained therein, for example, orally or parenterally (for example, by injection, aerosol, topical application, eye drops, or nasal drops).
[0055] The pharmaceutical composition of the present invention preferably contains the single-domain antibody in an amount that is effective in treating or preventing SARS-CoV-2 and is highly unlikely to cause serious side effects. The dosage of the single-domain antibody is not particularly limited as long as it is effective in treating or preventing SARS-CoV-2 and is highly unlikely to cause serious side effects, and can be adjusted to, for example, a total of 0.01 to 30 mg / kg body weight, particularly 0.02 to 6 mg / kg body weight.
[0056] The number of times the pharmaceutical composition of the present invention is administered is not particularly limited as long as it is sufficiently effective in treating or preventing SARS-CoV-2 infection and does not cause serious side effects, but is preferably administered, for example, once every three days to five times a day, particularly once to three times a day. The administration period of the pharmaceutical composition of the present invention is not particularly limited, but can be, for example, three days to one month, particularly one to two weeks.
[0057] The present specification also provides a method for producing the pharmaceutical composition of the present invention. The method for producing the pharmaceutical composition disclosed herein is a method for producing a pharmaceutical composition for treating or preventing SARS-CoV-2 infection using at least one single domain antibody from the single domain antibodies of the present invention described in Section "[2] Single Domain Antibodies." The structure and production method of the single domain antibody are as described in Section "[2] Single Domain Antibodies," unless otherwise inconsistent. Furthermore, the raw materials, composition, properties, etc. of the produced pharmaceutical composition are as described in Section "[3] Pharmaceutical Composition," unless otherwise inconsistent.
[0058] [4] SARS-CoV-2 detection reagents and detection methods The detection reagent of the present invention is characterized by comprising at least one single-domain antibody selected from the single-domain antibodies of the present invention described in the section "(2) Single-domain antibodies." Furthermore, the method of the present invention for detecting SARS-CoV-2 in a sample (hereinafter also referred to as the "detection method of the present invention") is characterized by comprising a step of contacting the sample with at least one single-domain antibody selected from the single-domain antibodies of the present invention described in the section "(2) Single-domain antibodies." The detection reagent and detection method of the present invention use the single-domain antibody of the present invention to specifically bind SARS-CoV-2 in a sample to the antibody, thereby enabling accurate detection of SARS-CoV-2.
[0059] The detection reagent and detection method of the present invention are used to aid in the diagnosis of SARS-CoV-2 infection in a subject, particularly by detecting SARS-CoV-2 in vitro in a sample taken from a subject suspected of being infected with SARS-CoV-2. The detection reagent of the present invention may be in the form of a single composition or a kit containing multiple compositions, substrates, etc., as long as it contains the single domain antibody of the present invention and is capable of detecting SARS-CoV-2 in a sample.
[0060] The sample may be a sample taken from a subject, such as a nasal swab, throat swab, nasal discharge, saliva, sputum, gargle, blood (e.g., whole blood, serum, plasma), urine, feces, milk, tissue or cell extract, or a mixture thereof. Alternatively, it may be other samples suspected of containing SARS-CoV-2, such as sewage or used cleaning sheets. A sample taken from a subject is preferred, and a nasal swab or saliva is more preferred.
[0061] The detection reagent of the present invention is specifically a reagent for immunoassays using single-domain antibodies against the SARS-CoV-2 RBD. The detection method of the present invention is specifically a method for immunoassays, comprising a step of reacting a sample taken from a subject with a single-domain antibody against the SARS-CoV-2 RBD. Examples of such immunoassays include direct competitive assays, indirect competitive assays, and sandwich assays. Examples of such immunoassays include chemiluminescent enzyme immunoassays (CLEIA), chemiluminescent immunoassays (CLIA), turbidimetric immunoassays (TIA), enzyme immunoassays (EIA) (e.g., direct competitive ELISA, indirect competitive ELISA, and sandwich ELISA), radioimmunoassays (RIA), latex agglutination assays, fluorescent immunoassays (FIA), and immunochromatography. The principles and specific techniques of the above immunoassays are well known to those skilled in the art.
[0062] Detection of SARS-CoV-2 in the detection reagent and detection method of the present invention may be qualitative or quantitative. A qualitative method may involve, for example, comparing the signal obtained from the sample with a predetermined cutoff to determine the presence or absence of SARS-CoV-2 in the sample. A quantitative method may involve performing an immunoassay on a standard solution containing a known amount of antigen peptide (here, a peptide corresponding to the SARS-CoV-2 RBD) in the same manner as the sample, and then calculating the amount of antigen in the sample by comparing the signal intensities obtained from the sample and the standard solution. In this case, the detection reagent of the present invention may contain the standard solution. Furthermore, the detection method of the present invention may include a step of detecting the antigen in the standard solution and a step of calculating the amount of SARS-CoV-2 in the sample from the detection results of the standard solution.
[0063] [5] Sanitary products The sanitary product of the present invention is characterized in that it is used for the prevention of SARS-CoV-2 and contains at least one single domain antibody of the present invention described in the section "[2] Single domain antibodies."
[0064] The hygiene product of the present invention can be, for example, a wet product (e.g., a wet sheet) obtained by impregnating paper, nonwoven fabric, cloth, absorbent cotton, or the like with a composition containing a single domain antibody as an active ingredient in the form of an aqueous solution or the like. It can also be an article (e.g., a mask, a cotton swab, etc.) obtained by impregnating paper, nonwoven fabric, cloth, absorbent cotton, or the like with a composition containing a single domain antibody in the form of an aqueous solution or the like and then drying it. Alternatively, the hygiene product of the present invention can be a liquid composition itself (hereinafter referred to as a "hygiene composition"), which the user can spray onto paper, nonwoven fabric, cloth, absorbent cotton, or the like just before use to impregnate the composition before use. When the hygiene product is impregnated into a hygiene product, the content of the single domain antibody in the hygiene composition is preferably an amount that is effective in preventing viral infections and is unlikely to cause abnormalities such as redness when the impregnated hygiene product comes into contact with human skin, etc. The content of the single domain antibody in the hygiene composition can be adjusted appropriately depending on the material, shape, and usage pattern of the specific hygiene product, but can be, for example, 0.01 pg / mL to 0.1 mg / mL, particularly 1 pg / mL to 1 ng / mL.
[0065] In addition to the single domain antibody, the hygiene product of the present invention may contain a known antibacterial agent, bactericide, or disinfectant such as ethanol, isopropanol, sodium hypochlorite, cetylpyridinium chloride (CPC), propyl iodine, or sodium emulsify.
[0066] [6] Methods for treating or preventing SARS-CoV-2 infection The method of the present invention for treating or preventing SARS-CoV-2 infection (hereinafter also referred to simply as the "treatment method of the present invention") is characterized by comprising a step of administering to a subject the pharmaceutical composition of the present invention described in the section "(3) Pharmaceutical composition."
[0067] Detailed conditions of the therapeutic method of the present invention, such as the target, dosage form, and ingredients of the pharmaceutical composition to be administered, are as described in the section "[3] Pharmaceutical Composition," unless otherwise inconsistent. [Example]
[0068] EXAMPLES Hereinafter, examples will be shown to explain the present invention in more detail, but it is not intended that the scope of the present invention be limited to the scope of the examples.
[0069] [Reference Example 1] Screening of anti-SARS-CoV-2 VHH antibodies The VHH antibody gene library was prepared by degeneration PCR with reference to the method described in JP 2016-44126 A. The library diversity was approximately 10 10 The SARS-CoV-2 RBD protein (Recombinant SARS-CoV-2, S1 Subunit Protein (RBD), obtained from RayBiotech Life, Inc.) was immobilized on magnetic beads, and VHH antibody genes that specifically bind to the RBD protein were selected from the library using mRNA display with an Escherichia coli cell-free translation system. The nucleotide sequences of the seven VHH antibody genes obtained (SEQ ID NOs: 22 to 28) are shown in Table 1.
[0070] [Table 1] TIFF2025157275000002.tif24390
[0071] [Example 1] Construction of anti-SARS-CoV-2 VHH antibody expression vector PCR was carried out using each gene shown in Table 1 as a template and the following primers A and B. Primer A: CCCATGGCTTTCGCTGCAGGATCCCAAGTACAACTGGTAGAATCC (SEQ ID NO: 30) Primer B: CCCCCGCATCCTGTTAAGCTTTTACTTATCGTCGTCGTCCTTATAG (SEQ ID NO: 31) The Brebacillus expression vector pROXb3 (Protein Express) was linearized by restriction enzymes BamHI and HindIII, and the above PCR products were introduced into it using the Gibson assembly method to construct VHH antibody expression vectors. His and FLAG tags were added to the C-terminus of each VHH antibody gene. A green fluorescent protein (GFP)-binding VHH antibody gene (SEQ ID NO: 29 in Table 1; see M.H. Kubala et al., Protein Sci. 19(12), pp. 2389-2401 (2010)) was artificially synthesized and used to construct an expression vector in the same manner as described above.
[0072] [Example 2] Preparation of VHH antibody protein Brevibacillus choshinensis strain HPD31 was transformed by electroporation using each of the expression vectors constructed in Example 1 (see H. Takagi et al., Agric. Biol. Chem. 53(11) 3099-3100 (1989)). Each transformant was cultured in TMN medium (1% polypeptone, 0.5% meat extract, 0.2% yeast extract, 0.001% iron(II) sulfate heptahydrate, 0.001% manganese(II) sulfate pentahydrate, 0.0001% zinc sulfate heptahydrate, 1% glucose, and 50 μg / mL neomycin) at 30°C for 66 hours. After the culture was completed, the culture supernatant was collected by centrifugation at 10,000 g for 10 minutes and sterilized by filtration using a 0.2 μm filter. The secreted VHH antibody protein was purified from the sterilized culture supernatant using Ni Sepharose (Cytiva), and the solvent was replaced with PBS to prepare a VHH antibody solution.
[0073] [Example 3] Evaluation of binding activity of each VHH antibody to SARS-CoV-2 RBD SARS-CoV-2 RBD protein suspended in carbonate buffer was added to a 96-well microwell plate at 50 ng / well and incubated overnight at 4°C. After removing the protein solution, 3% bovine serum albumin (BSA) / PBS solution was added and incubated at room temperature for 2 hours to block the wells. After washing the wells three times with 0.05% Tween 20 / PBS, each VHH antibody diluted in 3% BSA / PBS was added at 50 ng / well and incubated at room temperature for 2 hours. 3% BSA / PBS alone was added to the blank section. After washing the wells three times with 0.05% Tween 20 / PBS, an anti-FLAG antibody (monoclonal anti-FLAG M2 antibody produced in mouse, obtained from Merck KGaA) diluted 1:10,000 in 3% BSA / PBS was added and incubated at room temperature for 1 hour. After washing the wells three times, HRP-labeled anti-mouse antibody (goat anti-mouse IgG (H+L)-HRP conjugate, obtained from Bio-Rad Laboratories, Inc.) diluted 5000-fold in 3% BSA / PBS was added and incubated at room temperature for 1 hour. After washing the wells three times with 0.05% Tween 20 / PBS, a color reaction was performed using a TMB peroxidase EIA conjugate substrate kit (obtained from Bio-Rad Laboratories, Inc.). The reaction was stopped with 3% sulfuric acid, and the binding activity of the obtained VHH antibodies to the S1 protein (RBD) was evaluated by measuring the absorbance at 450 nm. Each experiment was performed in duplicate.
[0074] Figure 2 shows the results of evaluating the binding activity of each of the above VHH antibodies to RBD. All of the anti-RBD VHH antibodies used were confirmed to have binding activity to RBD. In particular, A02, A03, and A15 showed high binding activity.
[0075] [Example 4] Evaluation of SARS-CoV-2 RBD neutralizing activity of each VHH antibody The neutralizing activity of each VHH antibody was evaluated using the ACE2:SARS-CoV-2 Spike S1-Biotin Inhibitor Screening Assay Kit (obtained from BPS Bioscience Inc.). ACE2 protein was immobilized on a plate and blocked according to the kit's instructions. Then, VHH antibody (4 ng per well) was added together with the S1 protein-biotin conjugate and incubated at room temperature for 1 hour. After washing the wells, streptavidin-HRP was added, and a color reaction was performed using a TMB peroxidase EIA conjugate substrate kit, similar to the ELISA. The positive control was a group without VHH antibody, and the blank group was a group without S1 protein-biotin conjugate. Each test was performed in quadruplicate.
[0076] Figure 3 shows the results of evaluating the SARS-CoV-2 RBD neutralizing activity of each VHH antibody. The average absorbance of the positive control group was defined as 100% ACE2 binding rate, and the ACE binding rate was calculated from the average absorbance of each measurement group. A02, A03, and A15, which showed high RBD binding activity in Example 3, were confirmed to have relatively high neutralizing activity.
[0077] The present specification includes the following embodiments. [1] A single domain antibody comprising a polypeptide selected from the group of polypeptides (a) to (c) below: (a) a polypeptide having an amino acid sequence shown in any one of SEQ ID NOs: 1 to 7; (b) a polypeptide having 80% or more sequence identity with the amino acid sequence of any of the polypeptides described in (a); (c) A polypeptide comprising the amino acid sequence of the polypeptide described in (a) or (b) above as a partial sequence. [2] The single domain antibody of [1], wherein the polypeptide comprises the following three complementarity determining regions (CDRs): (d) CDR1 consisting of the amino acid sequence shown in SEQ ID NO: 8 or the amino acid sequence shown in SEQ ID NO: 8 in which one or two amino acids are deleted, substituted, or added; (e) CDR2 consisting of the amino acid sequence shown in SEQ ID NO: 12 or the amino acid sequence shown in SEQ ID NO: 12 in which one or two amino acids are deleted, substituted, or added; and (f) A CDR3 consisting of the amino acid sequence shown in SEQ ID NO: 16 or the amino acid sequence shown in SEQ ID NO: 16 in which one or two amino acids have been deleted, substituted or added. [3] The single domain antibody of [1], wherein the polypeptide comprises the following three CDRs: (g) CDR1 consisting of the amino acid sequence shown in SEQ ID NO: 9 or the amino acid sequence shown in SEQ ID NO: 9 in which one or two amino acids are deleted, substituted, or added; (h) CDR2 consisting of the amino acid sequence shown in SEQ ID NO: 13 or the amino acid sequence shown in SEQ ID NO: 13 in which one or two amino acids are deleted, substituted, or added; and (i) A CDR3 consisting of the amino acid sequence shown in SEQ ID NO: 17 or the amino acid sequence shown in SEQ ID NO: 17 in which one or two amino acids have been deleted, substituted or added. [4] The single domain antibody of [1], wherein the polypeptide comprises the following three CDRs: (j) CDR1 consisting of the amino acid sequence shown in SEQ ID NO: 8 or the amino acid sequence shown in SEQ ID NO: 8 in which one or two amino acids are deleted, substituted, or added; (k) CDR2 consisting of the amino acid sequence shown in SEQ ID NO: 12 or the amino acid sequence shown in SEQ ID NO: 12 in which one or two amino acids are deleted, substituted, or added; and (l) A CDR3 consisting of the amino acid sequence shown in SEQ ID NO: 18 or the amino acid sequence shown in SEQ ID NO: 18 in which one or two amino acids have been deleted, substituted or added. [5] The single domain antibody of [1], wherein the polypeptide comprises the following three CDRs: (m) a CDR1 consisting of the amino acid sequence shown in SEQ ID NO: 8 or the amino acid sequence shown in SEQ ID NO: 8 in which one or two amino acids are deleted, substituted, or added; (n) CDR2 consisting of the amino acid sequence shown in SEQ ID NO: 12 or the amino acid sequence shown in SEQ ID NO: 12 in which one or two amino acids are deleted, substituted, or added; and (o) A CDR3 consisting of the amino acid sequence shown in SEQ ID NO: 19 or the amino acid sequence shown in SEQ ID NO: 19 in which one or two amino acids have been deleted, substituted or added. [6] The single domain antibody of [1], wherein the polypeptide comprises the following three CDRs: (p) a CDR1 consisting of the amino acid sequence shown in SEQ ID NO: 8 or the amino acid sequence shown in SEQ ID NO: 8 in which one or two amino acids are deleted, substituted, or added; (q) CDR2 consisting of the amino acid sequence shown in SEQ ID NO: 12 or the amino acid sequence shown in SEQ ID NO: 12 in which one or two amino acids are deleted, substituted, or added; and (r) A CDR3 consisting of the amino acid sequence shown in SEQ ID NO: 20 or the amino acid sequence shown in SEQ ID NO: 20 in which one or two amino acids have been deleted, substituted or added. [7] The single domain antibody of [1], wherein the polypeptide comprises the following three CDRs: (s) a CDR1 consisting of the amino acid sequence shown in SEQ ID NO: 10 or the amino acid sequence shown in SEQ ID NO: 10 in which one or two amino acids are deleted, substituted, or added; (t) CDR2 consisting of the amino acid sequence shown in SEQ ID NO: 14 or the amino acid sequence shown in SEQ ID NO: 14 in which one or two amino acids are deleted, substituted, or added; and (u) A CDR3 consisting of the amino acid sequence shown in SEQ ID NO: 21 or the amino acid sequence shown in SEQ ID NO: 21 in which one or two amino acids have been deleted, substituted or added. [8] The single domain antibody of [1], wherein the polypeptide comprises the following three CDRs: (v) CDR1 consisting of the amino acid sequence shown in SEQ ID NO: 11 or the amino acid sequence shown in SEQ ID NO: 11 in which one or two amino acids are deleted, substituted, or added; (w) CDR2 consisting of the amino acid sequence shown in SEQ ID NO: 15 or the amino acid sequence shown in SEQ ID NO: 15 in which one or two amino acids are deleted, substituted, or added; and (x) A CDR3 consisting of the amino acid sequence shown in SEQ ID NO: 16 or the amino acid sequence shown in SEQ ID NO: 16 in which one or two amino acids have been deleted, substituted or added. [9] A pharmaceutical composition used for the treatment or prevention of SARS-CoV-2 infection, comprising as an active ingredient the single domain antibody described in any one of [1] to [8].
[10] A reagent for detecting SARS-CoV-2, comprising the single domain antibody described in any one of [1] to [8].
[11] A method for detecting SARS-CoV-2 in a sample, comprising a step of contacting the sample with the single domain antibody described in any one of [1] to [8].
[12] The method according to
[11] , wherein the sample is a sample taken from a subject.
[13] The method according to
[12] , wherein the subject is a human.
[14] A hygiene product used for preventing SARS-CoV-2 infection, comprising as an active ingredient the single domain antibody described in any one of [1] to [8].
Claims
1. A single domain antibody comprising a polypeptide selected from the group of polypeptides described in (a) to (c) below: (a) a polypeptide having the amino acid sequence set forth in SEQ ID NO: 2; (b) a polypeptide having 90% or more sequence identity with the amino acid sequence of the polypeptide described in (a) above and having binding activity to the receptor binding domain (RBD) of SARS-CoV-2; (c) A polypeptide comprising the amino acid sequence of the polypeptide according to (a) or (b) above as a partial sequence and having binding activity to SARS-CoV-2 RBD.
2. 2. The single domain antibody of claim 1, wherein the polypeptide comprises the following three CDRs: (g) CDR1 consisting of the amino acid sequence shown in SEQ ID NO: 9 or the amino acid sequence shown in SEQ ID NO: 9 in which one or two amino acids have been deleted, substituted, or added; (h) CDR2 consisting of the amino acid sequence shown in SEQ ID NO: 13 or the amino acid sequence shown in SEQ ID NO: 13 in which one or two amino acids are deleted, substituted, or added; and (i) A CDR3 consisting of the amino acid sequence shown in SEQ ID NO: 17 or an amino acid sequence in which one or two amino acids are deleted, substituted or added from the amino acid sequence shown in SEQ ID NO:
17.
3. A pharmaceutical composition for use in treating or preventing SARS-CoV-2 infection, comprising the single domain antibody of claim 1 or 2 as an active ingredient.
4. A reagent for detecting SARS-CoV-2, comprising the single domain antibody of claim 1 or 2.
5. A method for detecting SARS-CoV-2 in a sample, comprising the step of contacting the sample with the single domain antibody of claim 1 or 2.
6. The method of claim 5 , wherein the sample is a sample removed from a subject.
7. The method of claim 6 , wherein the subject is a human.
8. A hygiene product used for preventing SARS-CoV-2 infection, comprising the single domain antibody according to claim 1 or 2 as an active ingredient.
Citation Information
Patent Citations
Method of fabricating DNA library for fabricating next-generation type fragment antibody, library fabricated by using the method, and next-generation type fragment antibody
JP2016044126A
Corona virus binders
WO2021156490A2