Materials and methods for preparing spatial transcriptomics libraries

Abstract

The present disclosure relates generally to materials and methods for improving in situ RNA capture from tissue samples, as well as improved methods for synthesizing cDNA from the captured RNA.

Description

[Technical Field]

[0001] (CROSS-REFERENCE TO RELATED APPLICATIONS) This application claims priority benefit of U.S. Provisional Patent Application No. 63 / 477,730, filed December 29, 2022, which is incorporated herein by reference in its entirety.

[0002] Incorporation by reference of sequence disclosure A sequence listing, which is part of this disclosure, is submitted herewith as a computer-readable file. The file containing the sequence listing is named "IP-2526_SeqListing.xml," was created on December 21, 2023, and is 10,966 bytes in size. The subject matter of the sequence listing is incorporated herein by reference in its entirety.

[0003] The present disclosure relates generally to improved methods for preparing RNA from tissue samples and the preparation of spatial transcriptomics libraries from the isolated RNA. [Background technology]

[0004] Spatial transcriptomics enables highly multiplexed, spatially aligned gene expression analysis from fresh-frozen and formalin-fixed, paraffin-embedded (FFPE) tissue samples. However, fragmentation, degradation, and crosslinking due to the freezing or fixation process of FFPE tissue can alter the quality and quantity of RNA and DNA for transcriptomics library preparation. Current commercially available spatial workflows capture and convert less than 1% of mRNA within a tissue section. Summary of the Invention

[0005] Presented herein are methods that result in higher capture and spatial library conversion from archived tissue samples, such as frozen or FFPE tissue samples. In situ polyadenylation can enable capture of fragmented FFPE RNA on oligo-dT surfaces. Also provided herein are improved methods for synthesizing cDNA from isolated mRNA transcripts to improve the overall synthesis and alignment quality of mRNA sequences and the preparation of spatial transcriptomics libraries.

[0006] The present disclosure provides a method for isolating RNA from a sample, the method comprising: (a) contacting total RNA isolated from the sample with polynucleotide kinase (PNK) to modify 3' phosphates to hydroxyl groups to generate end-repaired total RNA; (b) contacting the end-repaired total RNA with polyadenylate polymerase (PAP) and adenosine nucleotides to generate polyadenylated total RNA; (c) capturing the polyadenylated total RNA on a substrate comprising one or more oligonucleotides containing poly-T sequences; and (d) eluting the polyadenylated total RNA from the substrate.

[0007] In various embodiments, the method further comprises quantifying total RNA. In some aspects, the RNA is quantified using Qubit or RT-qPCR.

[0008] Also provided is a method for preparing an RNA library from a tissue sample, the method comprising: (a) contacting total RNA isolated from the sample with polynucleotide kinase (PNK) to modify 3' phosphates to hydroxyl groups to generate end-repaired total RNA; (b) contacting the end-repaired total RNA with polyadenylate polymerase (PAP) and adenosine nucleotides to generate polyadenylated total RNA; (c) releasing the polyadenylated total RNA from the tissue sample; (d) capturing the polyadenylated total RNA on a substrate comprising one or more oligonucleotides containing poly-T sequences; and (e) generating an RNA library from the polyadenylated total RNA using an RNA library preparation kit.

[0009] In various embodiments, the releasing is achieved by lysing and / or permeabilizing the tissue sample.

[0010] In various embodiments, the RNA comprises rRNA and / or mRNA.

[0011] Further contemplated is a method for preparing an mRNA transcriptome library from a tissue sample, comprising: (a) contacting total RNA isolated from the sample with polynucleotide kinase (PNK) to modify 3' phosphates to hydroxyl groups to generate end-repaired total RNA; (b) contacting the end-repaired total RNA with polyadenylate polymerase (PAP) and adenosine nucleotides to generate polyadenylated total RNA; (c) releasing the polyadenylated total RNA from the tissue sample; (d) capturing the polyadenylated total RNA on a substrate comprising one or more oligonucleotides containing poly-T sequences; (e) depleting ribosomal RNA from the total RNA to leave polyadenylated mRNA; and (f) generating an mRNA library from the polyadenylated mRNA using an mRNA library preparation kit.

[0012] In various embodiments, the substrate is a bead, a bead array, a spot array, a flow cell (e.g., a clustered flow cell), clustered particles disposed on the surface of a chip, a film, and a plate (e.g., a multi-well plate).

[0013] In various embodiments, the sample is a fresh frozen tissue sample or a formalin-fixed, paraffin-embedded (FFPE) sample.

[0014] In various embodiments, the releasing comprises contacting the sample with a lysis buffer, a permeabilization buffer, and / or a reagent for deparaffinizing the FFPE sample. For example, if the sample is an FFPE sample on a slide, the method may comprise permeabilizing and treating the sample on the slide with collagenase before contacting the RNA with PNK. The method may further comprise decrosslinking the FFPE sample, optionally using TE buffer, pH 9.

[0015] In various embodiments, after polyadenylation, the polyA tail is between 3 and 50 nucleotides.

[0016] In various embodiments, generating an RNA library includes eluting polyadenylated total RNA from the substrate and generating an RNA library from the eluted polyadenylated RNA library using an RNA library preparation kit. In some embodiments, generating an RNA library includes: i) contacting the isolated RNA with reverse transcriptase (RT) or DNA polymerase to generate a first strand cDNA complementary to the RNA; ii) contacting the first strand cDNA with reverse transcriptase (RT) or DNA polymerase to generate a second strand cDNA complementary to the first strand cDNA; iii) amplifying the second strand cDNA to form a PCR template and isolating the PCR template; and iv) generating an RNA library from the PCR template.

[0017] In various embodiments, one or more of the first clustering sequence, index sequence, and / or read 2 sequence are added during or before second strand synthesis.

[0018] In various embodiments, the RNA library is an mRNA library.

[0019] In various embodiments, the PCR templates are further processed by tagging to generate a spatial transcriptomics library. In some embodiments, the tagging comprises bead tagging, and the beads comprise a plurality of bead-linked transposomes (BLTs). In some embodiments, the BLTs comprise a plurality of oligonucleotides, including: i) a plurality of oligonucleotides comprising a first clustered sequence (P7), a first index sequence, and a Read 1 sequencing primer (Rd1 SP); and ii) a plurality of oligonucleotides comprising a second clustered sequence (P5), a second index sequence, and a Read 2 sequencing primer (Rd2 SP).

[0020] Also provided by the present disclosure is a method for improving the capture efficiency of mRNA transcripts for in situ mRNA transcript library preparation, the method comprising: (a) capturing mRNA transcripts from a sample onto a substrate; (b) contacting the substrate with a high-processivity reverse transcriptase (RT) to generate a first strand cDNA complementary to the mRNA transcripts; (c) contacting the first strand cDNA with a DNA polymerase to generate a second strand cDNA complementary to the first strand cDNA; and (d) amplifying the second strand cDNA to form a PCR template and isolating the PCR template.

[0021] In other embodiments, a method for improving capture efficiency of mRNA transcripts for in situ mRNA transcript library preparation includes: (a) capturing mRNA transcripts from a sample onto a substrate; (b) contacting the substrate with a high-processivity reverse transcriptase (RT) to generate a first strand cDNA complementary to the mRNA transcripts; (c) contacting the first strand cDNA with a high-processivity reverse transcriptase (RT) or a high-processivity DNA polymerase to generate a second strand cDNA complementary to the first strand cDNA; and (d) amplifying the second strand cDNA to form a PCR template and isolating the PCR template.

[0022] In yet another embodiment, a method is provided for improving the nucleotide length of polynucleotides used in generating an in situ transcriptome library, the method comprising: (a) capturing mRNA transcripts from a sample onto a substrate; (b) contacting the substrate with a high-processivity reverse transcriptase (RT) to generate a first strand cDNA complementary to the mRNA transcript; (c) contacting the first strand cDNA with a high-processivity reverse transcriptase (RT) or a high-processivity DNA polymerase to generate a second strand cDNA complementary to the first strand cDNA; and (d) amplifying the second strand cDNA to form a PCR template, and isolating the PCR template.

[0023] In various embodiments, the highly processive RT is Superscript IV, thermostable group II intron RT (TGIRT), or Marathon RT. In various embodiments, the highly processive DNA polymerase is Klenow exo-, Bst 3.0, or phi29. In various embodiments, the DNA polymerase lacks both 5' to 3' and 3' to 5' exonuclease activity.

[0024] Also disclosed is a method for preparing an mRNA transcriptome library from a tissue sample, comprising: (a) contacting total RNA isolated from the sample with polynucleotide kinase (PNK) to modify the 3' phosphate to a hydroxyl group to generate end-repaired total RNA; (b) contacting the total RNA with polynucleotide kinase (PNK) to modify the 3' phosphate to a hydroxyl group to generate end-repaired total RNA; (c) contacting the end-repaired total RNA with polyadenylate polymerase (PAP) and adenosine nucleotides to generate polyadenylated total RNA; (d) releasing the polyadenylated total RNA from the tissue sample; and (e) removing poly-T sequences from the tissue sample. (f) depleting ribosomal RNA from the total RNA, leaving polyadenylated mRNA; (g) contacting the polyadenylated mRNA with a high-processivity reverse transcriptase (RT) to generate a first strand cDNA complementary to the mRNA transcript; (h) contacting the first strand cDNA with a high-processivity reverse transcriptase (RT) or a high-processivity DNA polymerase to generate a second strand cDNA complementary to the first strand cDNA, generating a PCR template; (i) eluting the PCR template; and (j) generating an mRNA library from the PCR template.

[0025] In various embodiments, the sample is a fresh-frozen tissue sample or a formalin-fixed, paraffin-embedded (FFPE) sample. In various embodiments, if the sample is an FFPE sample on a slide, the method may include permeabilizing and collagenase-treating the sample on the slide before contacting the RNA with PNK. Optionally, the method may further include decrosslinking the FFPE sample, optionally using TE buffer, pH 9.

[0026] In various embodiments, generating an RNA library includes: i) contacting the isolated RNA with reverse transcriptase (RT) to generate a first strand cDNA complementary to the RNA; ii) contacting the first strand cDNA with reverse transcriptase (RT) or a DNA polymerase to generate a second strand cDNA complementary to the first strand cDNA; iii) amplifying the second strand cDNA to form a PCR template; and isolating the PCR template; and iv) generating an RNA library from the PCR template.

[0027] In various embodiments, one or more of the first clustered sequence, index sequence, and / or read 1 or read 2 sequences are added during or before second strand synthesis.

[0028] In various embodiments, the RNA library is an mRNA library.

[0029] In various embodiments, the PCR templates are further processed by tagging to generate a spatial transcriptomics library. In some embodiments, the tagging comprises bead tagging, and the beads comprise a plurality of bead-linked transposome BLTs. In various embodiments, the BLT comprises i) a plurality of oligonucleotides comprising a first clustered sequence (P7), a first index sequence, and a read 1 sequencing primer (Rd1 SP), and ii) a plurality of oligonucleotides comprising a second clustered sequence (P5), a second index sequence, and a read 2 sequencing primer (Rd2 SP).

[0030] It is understood that each feature or embodiment, or combination, described herein is a non-limiting illustrative example of one of the aspects of the invention and is therefore meant to be combinable with any other feature, embodiment, or combination described herein. For example, when a feature is described with words such as "one embodiment," "various embodiments," "some embodiments," "an embodiment," "further embodiment," "particular exemplary embodiment," and / or "another embodiment," each of these types of embodiments is a non-limiting example of the feature that is intended to be combined with any other feature or combination of features described herein, without necessarily listing every possible combination.

[0031] Any such feature or combination of features applies to any of the aspects of the invention. When example values ​​falling within ranges are disclosed, any of these examples are contemplated as possible endpoints of the range, and any and all values ​​between such endpoints are contemplated, with any and all combinations of upper and lower limits envisioned. [Brief explanation of the drawings]

[0032] [Figure 1] FIG. 1 is a schematic diagram showing polyadenylation in formalin-fixed paraffin-embedded (FFPE) and fresh frozen (FF) tissues. [Figure 2] Schematic of the workflow for testing the efficiency of polyadenylation on extracted total RNA from FFPE and fresh-frozen tissues. [Figure 3] Protocol for polyadenylation studies on extracted RNA. [Figure 4] % capture of RNA on oligo-dT beads from the in-tube polyadenylation workflow. [Figure 5] The captured RNA is run on a high-sensitivity RNA screen tape. [Figure 6] Schematic of the workflow for testing the efficiency of in situ polyadenylation on FFPE and fresh-frozen tissues. [Figure 7]Detailed protocols for polyadenylation studies on FFPE and fresh-frozen tissues. [Figure 8] Probe-based RT-PCR of captured RNA from in situ polyadenylation experiments. [Figure 9] Captured RNA yield is quantified using a highly sensitive RNA Qubit kit. [Figure 10] Schematic diagram of library preparation and sequencing libraries. [Figure 11] Results of polyA trimming of the sequenced library. [Figure 12A] FF and FFPE sequencing data from basespace RNA-seq alignment app. Figure 12A) Polyadenylation shifts 3'-biased transcript coverage. Figure 12B) Polyadenylation increases insert size. Figure 12C) Polyadenylation increases the % of reads aligning to coding regions in FFPE. [Figure 12B] FF and FFPE sequencing data from basespace RNA-seq alignment app. Figure 12A) Polyadenylation shifts 3'-biased transcript coverage. Figure 12B) Polyadenylation increases insert size. Figure 12C) Polyadenylation increases the % of reads aligning to coding regions in FFPE. [Figure 12C] FF and FFPE sequencing data from basespace RNA-seq alignment app. Figure 12A) Polyadenylation shifts 3'-biased transcript coverage. Figure 12B) Polyadenylation increases insert size. Figure 12C) Polyadenylation increases the % of reads aligning to coding regions in FFPE. [Figure 13] Analysis of cDNA size after using SSIV in second strand synthesis. [Figure 14] Improved cDNA length when SSIV is used as the polymerase for second strand synthesis. [Figure 15] cDNA preparation using SSIV for first- and second-strand synthesis. DETAILED DESCRIPTION OF THE INVENTION

[0033] Isolating mRNA from preserved tissue samples and converting it to cDNA on a flat surface presents several challenges, including low-quality mRNA transcripts isolated from tissue samples, shorter synthetic cDNA fragments (less than 450 bp) in the library preparation product, and the presence of a high proportion of polyA fragments in the cDNA region of the final sequencing product. These challenges result in subsequent low mapping rates of exons to mRNA transcript regions in RNA-seq alignments.

[0034] To address this issue, we hypothesized that an improved method for achieving higher capture and spatial library conversion from FFPE tissue samples was needed. In situ polyadenylation could enable the capture of fragmented FFPE RNA on oligo-dT surfaces. Improvements were also needed in synthesizing cDNA using a reverse transcriptase (RTase) with faster processivity and thermostability, such as Superscript IV, in combination with 1) replacing the well-established DNA polymerase (Klenow exo-) typically used in the second-strand synthesis step with a DNA polymerase, and optionally 2) replacing the slower RTase (e.g., Maxima H-) used in first-strand synthesis with a high-processivity RTase, to achieve longer cDNA lengths in a shorter workflow timeframe.

[0035] definition Unless otherwise stated, the following terms used in this Application, including the specification and claims, have the definitions given below.

[0036] As used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the content clearly dictates otherwise. Thus, for example, reference to a "capture probe" includes mixtures of two or more capture probes, and so on.

[0037] The term "about," particularly with respect to a given quantity, is meant to encompass a deviation of plus or minus 5 percent.

[0038] As used herein, the terms "include," "including," "includes," "including," "contain," "containing," and any variations thereof, are intended to cover a non-exclusive inclusion, such that a process, method, product-by-process, or composition of matter that includes, includes, or contains an element or list of elements not only includes those elements, but may also include other elements not expressly listed in or inherent to such process, method, product-by-process, or composition of matter.

[0039] As used herein, the terms "address," "tag," or "index," when used in reference to a nucleotide sequence, are intended to mean a unique nucleotide sequence that is distinct from other indices and from other nucleotide sequences within polynucleotides contained within a sample. A nucleotide "address," "tag," or "index" can be a random or specifically designed nucleotide sequence. An "address," "tag," or "index" can be of any desired sequence length, so long as it is long enough to be a unique nucleotide sequence within multiple indices in the population and / or multiple polynucleotides being analyzed or interrogated. The nucleotide "addresses," "tags," or "indexes" of the present disclosure are useful, for example, for attaching to target polynucleotides to tag or mark specific species to identify all members of the tagged species within a population. Thus, indexes are useful as barcodes, where different members of the same molecular species can contain the same index, and different species within different polynucleotide populations can have different indexes.

[0040] A tag / index / barcode sequence may be unique to a single nucleic acid species in a population, or may be shared by several different nucleic acid species in the population. For example, each nucleic acid probe in a population may contain a tag / index / barcode sequence that is different from all other nucleic acid probes in the population. Alternatively, each nucleic acid probe in a population may contain a tag / index / barcode sequence that is different from several or most other nucleic acid capture probes in the population. For example, each probe in a population may have a tag / index / barcode that is present in several different capture probes in the population, even if probes with a common tag / index / barcode differ from each other in other sequence regions along their length. In certain embodiments, one or more tag / index / barcode sequences used with a biological specimen are not present in the genome, transcriptome, or other nucleic acids of the biological specimen. For example, a tag / index / barcode sequence may have less than 80%, 70%, 60%, 50%, or 40% sequence identity to a nucleic acid sequence in a particular biological specimen.

[0041] As used herein, "spatial address," "spatial tag," "spatial barcode," "spatial barcode sequence," or "spatial index," when used in reference to a nucleotide sequence, means an address, tag, barcode, or index that encodes spatial information related to the region or location of origin of the addressed, tagged, barcoded, or indexed nucleic acid in a tissue sample. The sequence can be a naturally occurring sequence or a sequence that does not naturally occur in the organism from which the barcoded nucleic acid is obtained.

[0042] As used herein, the term "substrate" is intended to mean a solid support or support structure. This term includes any material that can serve as a solid or semi-solid base for generating features such as wells for the deposition of biopolymers, including nucleic acids, polypeptides, and / or other polymers. Non-limiting examples of substrates include bead arrays, spot arrays, clustered particles arranged on the surface of a chip, films, multiwell plates, and flow cells. The substrates provided herein can be modified, for example, or modified to accommodate the attachment of biopolymers by various methods well known to those of skill in the art. Exemplary types of substrate materials include glass, modified glass, functionalized glass, inorganic glass, microspheres containing inert and / or magnetic particles, plastics, polysaccharides, nylon, nitrocellulose, ceramics, resins, silica, silica-based materials, carbon, metals, optical fibers or fiber optic bundles, various polymers other than those exemplified above, and multiwell microtiter plates. Specific types of exemplary plastics include acrylic, polystyrene, copolymers of styrene with other materials, polypropylene, polyethylene, polybutylene, polyurethane, and Teflon™. Specific types of exemplary silica-based materials include silicon and various forms of modified silicon.

[0043] Those skilled in the art will know or understand that the composition and shape of the substrates provided herein can vary depending on the intended use and user preference. Thus, while planar substrates such as slides, chips, wafers, or beads are useful for microarrays, those skilled in the art will understand that a wide variety of other substrates exemplified herein or known in the art can also be used in the methods and / or compositions herein.

[0044] In some embodiments, a solid support comprises one or more surfaces accessible to reagents, beads, or analytes. The surface may be substantially flat or planar. Alternatively, the surface may be rounded or contoured. Exemplary contours that may be included on the surface include wells (e.g., microwells or nanowells), depressions, posts, ridges, channels, and the like. Examples of materials that can be used as surfaces include glass, such as modified or functionalized glass; plastics, such as acrylic, polystyrene, or copolymers of styrene with another material, polypropylene, polyethylene, polybutylene, polyurethane, or TEFLON; polysaccharides or cross-linked polysaccharides, such as agarose or Sepharose; nylon; nitrocellulose; resins; silica or silica-based materials, including silicon and modified silicon, carbon fiber; metals; inorganic glass; fiber optic bundles, or various other polymers. A single material or a mixture of several different materials can form a surface useful in the present invention. In some examples, the surface comprises a well (e.g., a microwell or nanowell). In some embodiments, the surface comprises wells in an array of wells (e.g., microwells or nanowells) on glass, silicon, plastic, or other suitable solid support comprising a patterned, covalently linked gel such as poly(N-(5-azidoacetamidylpentyl)acrylamide-co-acrylamide) (PAZAM, see, e.g., U.S. Patent Application Publication No. 2014 / 0079923 A1, incorporated herein by reference). In some examples, the support structure can comprise one or more layers.

[0045] In some embodiments, the solid support comprises one or more surfaces of a flow cell. As used herein, the term "flow cell" refers to a chamber containing a solid surface through which one or more fluidic reagents can be passed. The flow cell can be an ordered or random flow cell. Examples of flow cells and associated fluidic systems and detection platforms that can be readily used in the methods of the present disclosure are described, for example, in Bentley et al., Nature 456:53-59 (2008), WO 04 / 018497, U.S. Patent No. 7,057,026, WO 91 / 06678, WO 07 / 123744, U.S. Patent No. 7,329,492, U.S. Patent No. 7,211,414, U.S. Patent No. 7,315,019, U.S. Patent No. 7,405,281, and U.S. Patent Application Publication No. 2008 / 0108082, each of which is incorporated herein by reference.

[0046] In some embodiments, the solid support comprises a patterned surface. A "patterned surface" refers to an arrangement of distinct regions within or on an exposed layer of a solid support. For example, one or more of the regions can be features in which one or more amplification primers are present. The features can be separated by interstitial regions in which amplification primers are absent. In some embodiments, the pattern can be an xy format of features in rows and columns. In some embodiments, the pattern can be a repeating arrangement of features and / or interstitial regions. In some embodiments, the pattern can be a random arrangement of features and / or interstitial regions. Exemplary patterned surfaces that can be used in the methods and compositions described herein are described in U.S. Patent Application No. 13 / 661,524 or U.S. Patent Application Publication No. 2012 / 0316086 or WO 2017 / 019456, each of which is incorporated herein by reference.

[0047] As used herein, the term "immobilized," when used in reference to nucleic acids, is intended to mean direct or indirect attachment to a solid support via covalent or non-covalent bonds. In certain embodiments, covalent attachment may be used, but what is required is that the nucleic acid remain immobilized or attached to the support under conditions under which the support is intended to be used, for example, in applications requiring nucleic acid amplification and / or sequencing. Oligonucleotides used as capture primers or amplification primers can be immobilized so that their 3' ends are available for enzymatic extension and at least a portion of their sequence is capable of hybridizing to a complementary sequence.

[0048] Immobilization can occur via hybridization to surface-attached oligonucleotides, in which case the immobilized oligonucleotide or polynucleotide can be in a 3' to 5' orientation. Alternatively, immobilization can occur by means other than base-pairing hybridization, such as covalent attachment as described above.

[0049] Exemplary covalent linkages include, for example, those resulting from the use of click chemistry techniques. Exemplary non-covalent linkages include, but are not limited to, non-specific interactions (e.g., hydrogen bonds, ionic bonds, van der Waals interactions, etc.) or specific interactions (e.g., affinity interactions, receptor-ligand interactions, antibody-epitope interactions, avidin-biotin interactions, streptavidin-biotin interactions, lectin-carbohydrate interactions, etc.). Exemplary linkages are described in U.S. Patent Nos. 6,737,236, 7,259,258, 7,375,234, and 7,427,678, and U.S. Patent Application Publication No. 2011 / 0059865(A1), each of which is incorporated herein by reference.

[0050] As used herein, the term "array" refers to a collection of sites that can be distinguished from one another according to their relative positions. Different molecules at different sites of an array can be distinguished from one another according to the site's position within the array. Each site of an array can contain one or more molecules of a particular type. For example, a site can contain a single target nucleic acid molecule having a particular sequence, or a site can contain several nucleic acid molecules having the same sequence (and / or its complementary sequence). The sites of an array can be different features disposed on the same substrate. Exemplary features include, but are not limited to, wells in a substrate, beads (or other particles) in or on a substrate, protrusions from a substrate, ridges on a substrate, or channels within a substrate. The sites of an array can be separate substrates, each with a different molecule. The different molecules attached to the separate substrates can be identified according to the position of the substrate on a surface to which the substrates are associated, or according to the position of the substrate within a liquid or gel. An exemplary array in which separate substrates are disposed on a surface includes, but is not limited to, beads in wells.

[0051] As used herein, the term "plurality" is intended to mean a population of two or more distinct members. Pluralities can range in size from small, medium, large, to very large. A small-sized plurality can range, for example, from a few members to tens of members. A medium-sized plurality can range, for example, from tens of members to about 100 or hundreds of members. A large plurality can range, for example, from about hundreds of members to about 1,000 members, thousands of members, and tens of thousands of members. A very large plurality can range, for example, from tens of thousands of members to about hundreds of thousands, millions, tens of millions, or hundreds of millions or more members. Thus, pluralities can range in size from 2 to 100 million or more, as well as all sizes measured by the number of members between and above the exemplary ranges above. An exemplary number of features in a microarray is 1.28 cm. 2 An exemplary plurality of nucleic acids may comprise, for example, about 1×10 5 , 5×105 and 1 x 10 6 or more distinct nucleic acid species. Thus, the definition of this term is intended to include all integer values ​​greater than 2. The upper limit of the plurality value can be set, for example, by the theoretical diversity of nucleotide sequences in a nucleic acid sample.

[0052] As used herein, the term "nucleic acid" is intended to be consistent with its use in the art and includes naturally occurring nucleic acids or functional analogs thereof. Particularly useful functional analogs are capable of hybridizing to nucleic acids in a sequence-specific manner or can be used as templates for replicating specific nucleotide sequences. Naturally occurring nucleic acids generally have backbones containing phosphodiester bonds. Analog structures can have alternative backbone linkages, including any of a variety known in the art. Naturally occurring nucleic acids generally have deoxyribose sugars (e.g., found in deoxyribonucleic acid (DNA)) or ribose sugars (e.g., found in ribonucleic acid (RNA)). Nucleic acids can contain any of a variety of analogs of these sugar moieties known in the art. Nucleic acids can include natural or unnatural bases. In this regard, natural deoxyribonucleic acids can have one or more bases selected from the group consisting of adenine, thymine, cytosine, or guanine, and ribonucleic acids can have one or more bases selected from the group consisting of uracil, adenine, cytosine, or guanine. Useful unnatural bases that can be included in nucleic acids are known in the art. The term "target," when used with respect to nucleic acids, is intended as a semantic identifier of the nucleic acid in the context of the methods or compositions described herein and does not necessarily limit the structure or function of the nucleic acid beyond what is otherwise expressly indicated. Specific forms of nucleic acids can include all types of nucleic acids found in living organisms, as well as synthetic nucleic acids, such as polynucleotides produced by chemical synthesis.

[0053] Specific examples of nucleic acids amenable to analysis by incorporation into microarrays generated by the methods provided herein include genomic DNA (gDNA), expressed sequence tags (ESTs), DNA copies messenger RNA (cDNA), RNA copies messenger RNA (cRNA), mitochondrial DNA or genomes, RNA, messenger RNA (mRNA), ribosomal RNA (rRNA), and / or other RNA populations. Fragments and / or portions of these exemplary nucleic acids are also included within the meaning of the term as used herein.

[0054] As used herein, the term "double-stranded," when used in reference to a nucleic acid molecule, means that substantially all of the nucleotides in the nucleic acid molecule are hydrogen bonded to complementary nucleotides. A partially double-stranded nucleic acid can have at least 10%, 25%, 50%, 60%, 70%, 80%, 90%, or 95% of its nucleotides hydrogen bonded to complementary nucleotides.

[0055] As used herein, the term "single-stranded," when used in reference to a nucleic acid molecule, means that essentially none of the nucleotides in the nucleic acid molecule are hydrogen bonded to a complementary nucleotide.

[0056] As used herein, the term "capture primer" or "capture probe" is intended to mean an oligonucleotide having a nucleotide sequence capable of specifically annealing to a single-stranded polynucleotide sequence being analyzed or subjected to nucleic acid interrogation under conditions encountered, for example, in the primer annealing step of an amplification or sequencing reaction. The terms "nucleic acid," "polynucleotide," and "oligonucleotide" are used interchangeably herein. The differences in terminology are not intended to indicate any specific differences in size, sequence, or other properties unless otherwise specified. For clarity of explanation, terms may be used to distinguish one species of nucleic acid from another when describing a particular method or composition that includes several nucleic acid species.

[0057] As used herein, the terms "gene-specific" or "target-specific," when used in reference to a capture probe or other nucleic acid, are intended to mean a capture probe or other nucleic acid that includes a nucleotide sequence specific to a targeted nucleic acid (e.g., a nucleic acid from a tissue sample), i.e., a sequence of nucleotides that can selectively anneal to an identified region of the targeted nucleic acid. A gene-specific capture probe may have a single species of oligonucleotide or may include two or more species with different sequences. Thus, a gene-specific capture probe may have two or more sequences, including 3, 4, 5, 6, 7, 8, 9, or 10 or more different sequences. A gene-specific capture probe may include a gene-specific capture primer sequence and a universal capture probe sequence. Other sequences, such as a sequencing primer sequence, may also be included in the gene-specific capture primer.

[0058] As used herein, "unique molecular index," "unique molecular identifier," or "UMI," when used in reference to a capture probe or other nucleic acid, is intended to refer to a portion of the probe that is useful as a molecular barcode for uniquely tagging each molecule in a sample library. A UMI may be depicted as "NNNN..." in a string of nucleic acid to designate that portion of the oligonucleotide as a UMI. A UMI may be 6-20 nucleotides or longer in length. In some embodiments, a UMI comprises a spatial barcode.

[0059] In comparison, the term "universal," when used with respect to a capture probe or other nucleic acid, is intended to mean a capture probe or nucleic acid that has a common nucleotide sequence among multiple capture probes. The common sequence can be, for example, a sequence complementary to the same adapter sequence. A universal capture probe is applicable to interrogate multiple different polynucleotides without necessarily distinguishing between different species, whereas a gene-specific capture primer is applicable to distinguish between different species.

[0060] As used herein, the term "amplicon," when used with reference to a nucleic acid, refers to the product of copying a nucleic acid, which product has a nucleotide sequence that is the same as or complementary to at least a portion of the nucleotide sequence of the nucleic acid. Amplicons can be generated by any of a variety of amplification methods using a nucleic acid or its amplicon as a template, including, for example, polymerase extension, polymerase chain reaction (PCR), rolling circle amplification (RCA), ligation extension, or ligation chain reaction. An amplicon can be a nucleic acid molecule having a single copy of a particular nucleotide sequence (e.g., a PCR product) or multiple copies of a nucleotide sequence (e.g., a concatemeric product of RCA). A first amplicon of a target nucleic acid can be a complementary copy. Subsequent amplicons are copies made from the target nucleic acid or the first amplicon after the generation of the first amplicon. Subsequent amplicons can have a sequence that is substantially complementary to or substantially identical to the target nucleic acid.

[0061] The number of template copies or amplicons that can be generated can be modulated by appropriate modification of the amplification reaction, including, for example, varying the number of amplification cycles performed, using polymerases of different processivities in the amplification reaction, and / or varying the length of time the amplification reaction is performed, as well as modifying other conditions known in the art to affect amplification yield. The copy number of the nucleic acid template can be at least 1, 10, 100, 200, 500, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, and 10,000 copies, and can vary depending on the particular application.

[0062] "Processivity" refers to the ability of a reverse transcriptase or DNA polymerase to carry out DNA synthesis on a template DNA without frequent dissociation or release of the template strand, and can be measured by the average number of nucleotides added by the enzyme. See, e.g., Zhuang et al., Biochim Biophys Acta. 2010 May;1804(5):1081-1093. In some embodiments, a high-processivity enzyme can process tens to hundreds of bases per second.

[0063] As used herein, the term "complementary" when used with respect to a polynucleotide is intended to mean a polynucleotide comprising a nucleotide sequence that can selectively anneal to an identified region of a target polynucleotide under specific conditions. As used herein, the term "substantially complementary" and grammatical equivalents are intended to mean a polynucleotide comprising a nucleotide sequence that can specifically anneal to an identified region of a target polynucleotide under specific conditions. Annealing refers to the nucleotide base pairing interaction between one nucleic acid and another, resulting in the formation of a duplex, triplex, or other higher-order structure. Primary interactions are typically nucleotide base specific, e.g., A:T, A:U, and G:C, via Watson-Crick and Hoogsteen hydrogen bonding. In certain embodiments, base stacking and hydrophobic interactions may also contribute to the stability of the duplex. Conditions under which a polynucleotide will anneal to a complementary or substantially complementary region of a target nucleic acid are well known in the art, as described, for example, in Nucleic Acid Hybridization, A Practical Approach, Hames and Higgins, eds., IRL Press, Washington, DC (1985) and Wetmur and Davidson, Mol. Biol. 31:349 (1968). Annealing conditions will depend on the particular application and can be routinely determined by one of ordinary skill in the art without undue experimentation.

[0064] As used herein, the term "hybridization" refers to the process by which two single-stranded polynucleotides non-covalently bind to form a stable double-stranded polynucleotide. The resulting double-stranded polynucleotide is a "hybrid" or "double-stranded." Hybridization conditions typically include a salt concentration of less than about 1 M, more usually less than about 500 mM, and can be less than about 200 mM. The hybridization buffer includes a buffered salt solution such as 5% SSPE or other such buffers known in the art. Hybridization temperatures can be as low as 5°C, but are typically greater than 22°C, more typically greater than about 30°C, and typically greater than 37°C. Hybridization is usually performed under stringent conditions, i.e., conditions under which a probe hybridizes to its target subsequence but not to other non-complementary sequences. Stringent conditions are sequence-dependent, vary in different circumstances, and can be routinely determined by one of skill in the art.

[0065] As used herein, the term "dNTP" refers to deoxynucleoside triphosphate. NTP refers to ribonucleotide triphosphate. Purine bases (Pu) include adenine (A), guanine (G), and their derivatives and analogs. Pyrimidine bases (Py) include cytosine (C), thymine (T), uracil (U), and their derivatives and analogs. Examples of such derivatives or analogs include, but are not limited to, those modified with reporter groups, biotinylated, amine-modified, radiolabeled, alkylated, and the like, including phosphorothioates, phosphites, and derivatives modified at ring atoms. Reporter groups can be fluorescent groups such as fluorescein, chemiluminescent groups such as luminol, terbium chelators such as N-(hydroxyethyl)ethylenediaminetriacetic acid, which allow detection by delayed fluorescence, and the like.

[0066] As used herein, the terms "ligation," "ligating," and their grammatical equivalents are intended to mean forming a covalent or covalent linkage between the ends of two or more nucleic acids, e.g., oligonucleotides and / or polynucleotides, typically in a template-driven reaction. The nature of the bond or linkage can vary widely, and ligation can be performed enzymatically or chemically. As used herein, ligation is typically performed enzymatically, forming a phosphodiester bond between the 5' carbon-terminal nucleotide of one oligonucleotide and the 3' carbon of another nucleotide. Template-driven ligation reactions are described in references such as U.S. Pat. Nos. 4,883,750, 5,476,930, 5,593,826, and 5,871,921, which are incorporated herein by reference in their entireties. The term "ligation" also encompasses the non-enzymatic formation of phosphodiester bonds, as well as the formation of non-phosphodiester covalent bonds between the ends of oligonucleotides, such as phosphorothioate bonds, disulfide bonds, and the like.

[0067] As used herein, the term "each," when used in reference to a set of items, is intended to identify each individual item in the set, but does not necessarily refer to every item in the set, unless the context clearly dictates otherwise.

[0068] As used herein, the term "extending," when used with respect to a nucleic acid, is intended to mean the addition of at least one nucleotide or oligonucleotide to a nucleic acid. In certain embodiments, one or more nucleotides can be added to the 3'-end of a nucleic acid, for example, via polymerase catalysis (e.g., DNA polymerase, RNA polymerase, or reverse transcriptase). Chemical or enzymatic methods can be used to add one or more nucleotides to the 3'- or 5'-end of a nucleic acid. One or more oligonucleotides can be added to the 3'- or 5'-end of a nucleic acid, for example, via chemical or enzymatic (e.g., ligase-catalyzed) methods. A nucleic acid can be extended in a template-directed manner, whereby the extension product is complementary to a template nucleic acid hybridized to the nucleic acid being extended.

[0069] Provided herein are arrays and methods for spatial detection and analysis of nucleic acids in tissue samples (e.g., mutation analysis or single nucleotide variation (SNV) detection and indel detection). The arrays described herein can include a substrate having multiple capture probes immobilized thereon, such that each capture probe occupies a different position on the array. Some or all of the multiple capture probes can include a unique position tag (i.e., a spatial address or index sequence). The spatial address can describe the position of the capture probe on the array. The position of the capture probe on the array can be correlated to a position in the tissue sample.

[0070] As used herein, the terms "poly T" or "poly A," when used in reference to a nucleic acid sequence, are intended to mean a series of two or more thiamine (T) or adenine (A) bases, respectively. The poly T or poly A can contain at least about 2, 5, 8, 10, 12, 15, 18, 20, or more T or A bases, respectively. Alternatively, or additionally, the poly T or poly A can contain up to about 30, 20, 18, 15, 12, 10, 8, 5, or 2 T or A bases, respectively.

[0071] As used herein, the terms "tagmentation," "tagment," or "tagmenting" refer to the conversion of nucleic acids, e.g., DNA, into adapter-modified templates in solution ready for clustering and sequencing using transposase-mediated fragmentation and tagging. This process often involves modification of the nucleic acid by a transposome complex containing a transposase enzyme complexed with adapters containing transposon end sequences. Tagging simultaneously results in fragmentation of the nucleic acid and ligation of adapters to the 5' ends of both strands of the double-stranded fragments. Following a purification step to remove the transposase enzyme, additional sequences are added to the ends of the adapted fragments by PCR.

[0072] "Transposase" refers to an enzyme that can form a functional complex with a transposon end-containing composition (e.g., a transposon, a transposon end, a transposon end composition) and catalyze the insertion or transposition of the transposon end-containing composition into a double-stranded target nucleic acid with which it is incubated, e.g., in an in vitro transposition reaction. Transposases provided herein can also include integrases from retrotransposons and retroviruses. Transposases, transposomes, and transposome complexes are generally known to those of skill in the art, as exemplified by the disclosure of U.S. Patent Application Publication No. 2010 / 0120098, the entire contents of which are incorporated herein by reference. While many embodiments described herein refer to Tn5 transposase and / or hyperactive Tn5 transposase, it is understood that any transposition system capable of inserting transposon ends with sufficient efficiency to 5' tag and fragment target nucleic acids for the intended purpose can be used in the present invention. In certain embodiments, a preferred transposition system can insert transposon ends in a random or near-random manner to 5' tag and fragment target nucleic acids.

[0073] As used herein, the term "transposition reaction" refers to a reaction in which one or more transposons are inserted into a target nucleic acid, for example, at random or near-random sites. The essential components of a transposition reaction are a transposase and a DNA oligonucleotide representing the nucleotide sequence of the transposon, including the transferred transposon sequence and its complement (the non-transferred transposon end sequence), as well as other components necessary to form a functional transposition or transposome complex. The DNA oligonucleotide may further include additional sequences (e.g., adapter or primer sequences) if needed or desired. In some embodiments, the methods provided herein are exemplified using transposition complexes formed by hyperactive Tn5 transposase and Tn5-type transposon ends (Goryshin and Reznikoff, 1998, J. Biol. Chem., 273:7367) or by MuA transposase and Mu transposon ends containing R1 and R2 end sequences (Mizuuchi, 1983, Cell, 35:785; Savilahti et al., 1995, EMBO J., 14:4893). However, any transposition system capable of inserting transposon ends in a random or near-random manner with sufficient efficiency to 5'-tag and fragment target DNA for the intended purpose can be used in the present invention.Examples of transposition systems known in the art that can be used in the methods of the present invention include Staphylococcus aureus Tn552 (Colegio et al., 2001, J. Bacterid., 183:2384-8; Kirby et al., 2002, Mol. Microbiol., 43:173-86), TyI (Devine and Boeke, 1994, Nucleic Acids Res., 22:3765-72 and International Patent Application No. WO 95 / 23875), Transposon Tn7 (Craig, 1996, Science. 271:1512; Craig, 1996, Review in: Curr. Top Microbiol. Immunol., 204:27-48), TnIO and ISIO (Kleckner et al., 1996, Curr. Top Microbiol. Immunol., 204:27-48). Immunol., 204:49-82), mariner transposase (Lampe et al., 1996, EMBO J., 15:5470-9), Tci (Plasterk, 1996, Curr Top Microbiol Immunol., 204:125-43), P Element (Gloor, 2004, Methods Mol Biol., 260:97-114), TnJ (Ichikawa and Ohtsubo, 1990, J Biol Chem., 265:18829-32), bacterial insertion sequences (Ohtsubo and Sekine, 1996, Curr. Top. Microbiol. Immunol., 204:1-26), retroviruses (Brown et al., 1989, Proc Natl Acad Sci USA, 86:2525-9), and yeast retrotransposons (Boeke and Corces, 1989, Annu Rev Microbiol. 43:403-34. Methods for inserting transposon ends into target sequences can be performed in vitro using any suitable transposon system for which a suitable in vitro transposition system is available or which can be developed based on knowledge in the art.Generally, an in vitro transposition system suitable for use in the methods provided herein requires, at a minimum, a transposase enzyme of sufficient purity, sufficient concentration, and sufficient in vitro transposition activity, and transposon ends that form a functional complex with the respective transposase capable of catalyzing a transposition reaction. Suitable transposase transposon end sequences that can be used in the present invention include, but are not limited to, wild-type, derivative, or mutant transposon end sequences that form a complex with a transposase selected from wild-type, derivative, or mutant forms of the transposase. As used herein, the term "transposome complex" refers to a transposase enzyme that noncovalently binds to double-stranded nucleic acid. For example, the complex can be a transposase enzyme preincubated with double-stranded transposon DNA under conditions that support noncovalent complex formation. The double-stranded transposon DNA can include, but is not limited to, Tn5 DNA, a portion of Tn5 DNA, a transposon end composition, a mixture of transposon end compositions, or other double-stranded DNA that can interact with a transposase, such as a hyperactive Tn5 transposase.

[0074] As used herein, the term "random" can be used to refer to the spatial arrangement or composition of locations on a surface. For example, the arrays described herein have at least two types of order: one with respect to the spacing and relative positions of features (also called "sites"), and the second with respect to the identity or predetermined knowledge of specific molecular species present in a particular feature. Thus, the features of an array can be randomly spaced so that nearest neighboring features have variable spacing between each other. Alternatively, the spacing between features can be ordered to form a regular pattern, such as, for example, a rectilinear or hexagonal grid. In another aspect, the features of an array can be random with respect to the identity or predetermined knowledge of the gene of interest (e.g., nucleic acid of a particular sequence) occupying each feature, regardless of whether the spacing results in a random or regular pattern. The arrays described herein can be ordered in one respect and random in another respect. For example, in some embodiments described herein, a surface is contacted with a population of nucleic acids under conditions in which the nucleic acids are ordered with respect to their relative positions, but attach to sites that are "randomly arranged" with respect to knowledge of the sequence of the nucleic acid species present at any particular site. Reference to nucleic acids being "randomly distributed" at sites on a surface is intended to refer to a lack of knowledge or pre-determination as to which nucleic acids will be captured at which sites (whether or not the sites are arranged in an ordered pattern).

[0075] As used herein, the term "tissue sample" refers to a piece of tissue obtained from a subject, optionally fixed, sectioned, and mounted on a planar surface, such as a microscope slide. The tissue sample may be a formalin-fixed, paraffin-embedded (FFPE) tissue sample, a fresh tissue sample, a frozen tissue sample, or the like. The methods disclosed herein may be performed before or after staining the tissue sample. For example, after hematoxylin and eosin staining, the tissue sample may be spatially analyzed according to the methods provided herein. The method may include analyzing the histology of the sample (e.g., using hematoxylin and eosin staining) and then spatially analyzing the tissue.

[0076] As used herein, the term "formalin-fixed paraffin-embedded (FFPE) tissue section" refers to a piece of tissue, e.g., a biopsy, obtained from a subject, fixed in formaldehyde (e.g., 3% to 5% formaldehyde in phosphate-buffered saline) or Bouin's solution, embedded in wax, cut into thin sections, and then mounted on a flat surface, e.g., a microscope slide.

[0077] As used herein, the term "subject" encompasses mammals and non-mammals. Examples of mammals include, but are not limited to, any member of the mammalian class: humans, non-human primates such as chimpanzees, and other ape and monkey species, cows, horses, sheep, goats, pigs, rabbits, dogs, cats, rodents, rats, mice, guinea pigs, etc. Examples of non-mammals include, but are not limited to, birds, fish, etc. The term does not denote a particular age or sex.

[0078] In some embodiments, nucleic acids in a tissue sample are transferred to an array and captured thereon. For example, a tissue section is placed in contact with the array, and nucleic acids are captured on the array and tagged by spatial address. The spatially tagged DNA molecules are released from the array and analyzed, for example, by high-throughput next-generation sequencing (NGS), such as sequencing-by-synthesis (SBS). In some embodiments, nucleic acids in a tissue section (e.g., a formalin-fixed, paraffin-embedded (FFPE) tissue section) are transferred to an array and captured thereon by hybridization to a capture probe. In some embodiments, the capture probe may be, for example, a universal capture probe that hybridizes to an adapter region in a nucleic acid sequencing library or the polyA tail of an mRNA. In some embodiments, the capture probe may be, for example, a gene-specific capture probe that hybridizes to a specifically targeted mRNA or cDNA in a sample, such as a TruSeq™ Custom Amplicon (TSCA) oligonucleotide probe (Illumina, Inc.). The capture probe may be a plurality of capture probes, for example a plurality of the same or different capture probes.

[0079] In some embodiments, combinatorial indexing (addressing) systems are used to provide spatial information for the analysis of nucleic acids in tissue samples. Combinatorial indexing systems can involve the use of two or more spatial address sequences (e.g., two, three, four, five, or more spatial address sequences).

[0080] In some embodiments, two spatial address sequences are incorporated into nucleic acids during preparation of a sequencing library. The first spatial address can be used to define a specific location in the X dimension (i.e., a capture site) on the capture array, and the second spatial address sequence can be used to define a location in the Y dimension (i.e., a capture site) on the capture array. During library sequencing, both the X and Y spatial address sequences can be determined, and the sequence information can be analyzed to define a specific location on the capture array.

[0081] In some embodiments, three spatial address sequences are incorporated into nucleic acids during preparation of a sequencing library. The first spatial address can be used to define a specific location in the X dimension (i.e., a capture site) on the capture array, the second spatial address sequence can be used to define a location in the Y dimension (i.e., a capture site) on the capture array, and the third spatial address sequence can be used to define the location of a two-dimensional sample section (e.g., the location of a slice of a tissue sample) in a sample (e.g., a tissue biopsy) to provide positional spatial information in the third dimension (Z dimension) of the sample. During library sequencing, the X, Y, and Z spatial address sequences can be determined, and the sequence information can be analyzed to define a specific location on the capture array.

[0082] In some embodiments, a temporal address sequence (T) is optionally incorporated into the nucleic acid during preparation of a sequencing library. In some embodiments, the temporal address sequence can be combined with two or three spatial address sequences. The temporal address sequence can be used, for example, in the context of a time-course experiment to determine time-dependent changes in gene expression in a tissue sample. Time-dependent changes in gene expression can occur in a tissue sample, for example, in response to a chemical, biological, or physical stimulus (e.g., a toxin, drug, or heat). Nucleic acid samples obtained at different time points from comparable tissue samples (e.g., proximal slices of a tissue sample) can be pooled and sequenced in bulk. An optional first spatial address can be used to define a specific location in the X dimension (i.e., a capture site) on the capture array, an optional second spatial address sequence can be used to define a location in the Y dimension (i.e., a capture site) on the capture array, and an optional third spatial address sequence can define the location of a two-dimensional sample section (e.g., the location of a slice of a tissue sample) in a sample (e.g., a tissue biopsy) to provide positional spatial information in the third dimension (Z dimension) of the sample. During library sequencing, the T, X, Y, and Z address sequences are determined and the sequence information is analyzed to define a specific X, Y (and optionally Z) location on the capture array for each time point (T).

[0083] The address sequences X, Y, and optionally Z and / or T may be contiguous nucleic acid sequences, or the address sequences may be separated by one or more nucleic acids (e.g., 2 or more, 3 or more, 10 or more, 30 or more, 100 or more, 300 or more, or 1,000 or more). In some embodiments, the X, Y, and optionally Z and / or T address sequences may each individually and independently be combinatorial nucleic acid sequences.

[0084] In some embodiments, the length of an address sequence (e.g., X, Y, Z, or T) can each individually and independently be 100 nucleic acids or less, 90 nucleic acids or less, 80 nucleic acids or less, 70 nucleic acids or less, 60 nucleic acids or less, 50 nucleic acids or less, 40 nucleic acids or less, 30 nucleic acids or less, 20 nucleic acids or less, 15 nucleic acids or less, 10 nucleic acids or less, 8 nucleic acids or less, 6 nucleic acids or less, or 4 nucleic acids or less. The lengths of two or more address sequences in a nucleic acid can be the same or different. For example, if the length of address sequence X is 10 nucleic acids, the length of address sequence Y can be, for example, 8 nucleic acids, 10 nucleic acids, or 12 nucleic acids.

[0085] An address sequence (eg, a spatial address sequence such as X or Y) may be a partially or fully degenerate sequence.

[0086] In some embodiments, spatially addressed capture probes on the array may be released from the array onto tissue sections for the creation of spatially addressed sequencing libraries. In some embodiments, the capture probes comprise random primer sequences for in situ synthesis of spatially tagged cDNA from RNA in the tissue sections. In some embodiments, the capture probes are TruSeq™ Custom Amplicon (TSCA) oligonucleotide probes (Illumina, Inc.) for capturing and spatially tagging genomic DNA in tissue sections. Spatially tagged nucleic acid molecules (e.g., cDNA or genomic DNA) are recovered from the tissue sections and processed in a single-tube reaction to create a spatially tagged amplicon library.

[0087] In some embodiments, magnetic nanoparticles can be used to capture nucleic acids (e.g., in situ synthesized cDNA) in tissue samples for the creation of spatially addressed libraries.

[0088] In some embodiments, spatial detection and analysis of nucleic acids in tissue samples can be performed on a droplet actuator.

[0089] Described herein are improved methods and compositions for spatial omics applications that preserve spatial information related to the origin of RNA or DNA in tissues. Examples of spatial omics applications include, but are not limited to, spatial genomics applications, spatial proteomics applications, spatial transcriptomics applications, spatial agronomic applications, spatial epigenomics applications, spatial phenomics applications, spatial ligandomics applications, and spatial multi-omic applications (e.g., transcriptomics and genomics applications).

[0090] Preparation of polynucleotides The present disclosure is based in part on the recognition that the amount of RNA or DNA information that can be isolated from fresh or frozen tissue samples, as well as FFPE tissue samples, needs to be improved to provide information related to the genetic profile of the tissue sample. The present disclosure provides a method for improving the capture of genetic information by increasing the quantity and quality of RNA isolated from tissue samples that can be used in spatial transcriptomics analysis. RNA is polyadenylated in situ as described herein, and the RNA is contacted with polynucleotide kinase (PNK) to modify the 3' phosphate to a hydroxyl group to generate end-repaired total RNA. The end-repaired RNA is mixed with polyadenylation polymerase (PAP) and adenosine nucleotides to generate polyadenylated total RNA. PolyA RNA is captured on a substrate comprising an oligonucleotide containing a polyT sequence. The oligonucleotide containing a polyT sequence may further comprise a capture probe or spatial index sequence, including, but not limited to, one or more of a P7 sequence, an index sequence, and / or a read 2 (Rd2) sequence.

[0091] Total RNA can include ribosomal RNA (rRNA), messenger RNA (MRNA), transfer RNA (tRNA), microRNA, small nucleolar RNA (snoRNA), and small nuclear RNA (snRNA). In various embodiments, the RNA is rRNA and / or mRNA.

[0092] The poly-A tail can be 3 to 50 nucleotides in length, e.g., 5 to 50 nucleotides in length, 10 to 40 nucleotides in length, 15 to 30 nucleotides in length, or 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides in length.

[0093] In some embodiments, total RNA is released from tissue samples after polyadenylation. Release includes tissue lysis or tissue permeabilization. In various embodiments, one or more samples contacted with a solid support can be lysed to release the target nucleic acid. Lysis can be performed using known techniques, such as using one or more of chemical treatment, enzymatic treatment, electroporation, heat, hypotonic treatment, sonication, etc.

[0094] In some embodiments, tissue samples are treated to remove embedding materials (e.g., remove paraffin or formalin) from the sample prior to nucleic acid release, capture, or modification. This can be accomplished by contacting the sample with an appropriate solvent (e.g., xylene and ethanol washes). Treatment can occur before contacting the tissue sample with a solid support described herein, or treatment can occur while the tissue sample is on the solid support. Exemplary methods for engineering tissue for use with solid supports to which nucleic acids are attached are described in U.S. Patent Application Publication No. 2014 / 0066318, incorporated herein by reference.

[0095] Formalin-fixed tissue samples may also be decrosslinked using known techniques. In various embodiments, decrosslinking is performed using, for example, Tris-EDTA (TE) buffer at pH 8, pH 9, or another suitable buffer at an appropriate pH. Decrosslinking may also be performed at elevated temperatures, for example, 70°C.

[0096] The present disclosure is further based in part on the recognition that the efficiency of capturing mRNA transcripts for in situ mRNA transcript library preparation can be improved by using a high-processivity enzyme in either or both of the first and second-strand synthesis reactions. mRNA transcripts isolated from a tissue sample are captured on a substrate and contacted with a high-processivity reverse transcriptase (RT) or a high-processivity DNA polymerase to generate a first-strand cDNA complementary to the mRNA transcript. High-processivity RTs include Superscript IV, thermostable group II intron RT (TGIRT), or Marathon RT. In various embodiments, the first-strand cDNA is contacted with a DNA polymerase to generate a second-strand cDNA complementary to the first-strand cDNA, and optionally, the DNA polymerase is a high-processivity DNA polymerase. In various embodiments, the high-processivity DNA polymerase is Klenow exo-, Bst 3.0, or phi29. In various embodiments, the DNA polymerase lacks both 5' to 3' and 3' to 5' exonuclease activity.

[0097] In some embodiments, mRNA transcripts isolated from a tissue sample are captured on a substrate and contacted with RT to generate a first strand cDNA complementary to the mRNA transcript, hi various embodiments, the first strand cDNA is contacted with a high-processivity RT or a high-processivity DNA polymerase to generate a second strand cDNA complementary to the first strand cDNA.

[0098] In some embodiments, mRNA transcripts isolated from a tissue sample are captured on a substrate and contacted with a highly processive RT or highly processive DNA polymerase having RT activity to generate a first strand cDNA complementary to the mRNA transcript, hi various embodiments, the first strand cDNA is contacted with the highly processive RT or highly processive DNA polymerase to generate a second strand cDNA complementary to the first strand cDNA.

[0099] In some embodiments, mRNA transcripts isolated from a tissue sample are captured on a substrate and contacted with high-processivity RT to generate a first strand cDNA complementary to the mRNA transcript, hi various embodiments, the first strand cDNA is contacted with high-processivity RT or a high-processivity DNA polymerase to generate a second strand cDNA complementary to the first strand cDNA.

[0100] After second strand synthesis, the second strand cDNA is amplified to form a PCR template, and the PCR template is isolated using standard techniques.

[0101] The above methods are also useful for improving the capture efficiency of mRNA transcripts for in situ mRNA transcript library preparation and / or for improving the nucleotide length of polynucleotides used in generating an in situ transcriptome library (e.g., for improving the polynucleotide size of cDNA transcribed from mRNA isolated from a sample and used in generating an in situ transcriptome library).

[0102] The present disclosure is further based in part on the recognition that the in situ polyadenylation methods described herein can be used in combination with high-processivity enzymes for first and / or second strand synthesis to improve spatial transcriptomics RNA library preparation. For example, the present disclosure provides a method for preparing an mRNA transcriptome library from a tissue sample, comprising: contacting total RNA isolated from the sample using the methods described herein with polynucleotide kinase (PNK) to modify 3' phosphates to hydroxyl groups to generate end-repaired total RNA; contacting the end-repaired total RNA with polyadenylate polymerase (PAP) and adenosine nucleotides to generate polyadenylated total RNA; releasing the polyadenylated total RNA from the tissue sample; and synthesizing the polyadenylated total RNA onto a substrate comprising one or more oligonucleotides containing a poly-T sequence. and generating an mRNA library from the PCR template.

[0103] Spatial detection and analysis of nucleic acids in tissue samples According to the methods described herein, spatial detection and analysis of nucleic acids in a tissue sample can be performed using a set of two or more capture probes (e.g., three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, or ten or more capture probes). Typically, at least a first capture probe in a set of capture probes is immobilized on a capture array. In some embodiments, a second capture probe can be immobilized on the same capture array as the first capture probe, e.g., in close proximity to the first capture probe, e.g., at the same capture site. In some embodiments, the second capture probe can be immobilized on particles, such as magnetic particles or magnetic nanoparticles. In some embodiments, the second capture probe can be in a solution used to perform an in situ reaction with nucleic acids in a tissue sample, for example. The capture probes in a capture probe set can individually and independently have a variety of different regions, such as a capture region (e.g., a first universal or gene-specific capture region or a first clustered region), a primer binding region (e.g., an SBS primer region such as an SBS3 or SBS12 region), or a second universal region / clustered sequence such as a P5 or P7 region, a spatial address region (e.g., a partial or combinatorial spatial address region), or a cleavable region.

[0104] Exemplary sequences include the following Rd1 and Rd2 adapter sequences: Second universal adapter - Rd1 SBS3 (long):

[0105] [Table 1] (SEQ ID NO: 7), second universal adapter-Rd1 SBS3 (short chain): ACACTCTTTCCCTACACGAC (SEQ ID NO: 8), first universal adapter-Rd2 SBS12 (long chain):

[0106] [Table 2] (SEQ ID NO: 9), first universal adapter-Rd2 SBS12 (short chain): GTGACTGGAGTTCAGACGTGT (SEQ ID NO: 10).

[0107] In some embodiments, only one capture probe in a set of capture probes comprises a capture region. In some embodiments, two or more capture probes in a set of capture probes comprise a capture region.

[0108] In some embodiments, only one probe in a set of capture probes comprises a spatial address region, such as a complete spatial address region that describes the location of a capture site on a capture array. In some embodiments, two or more probes in a set of capture probes can comprise a spatial address region, e.g., two or more probes can each comprise a partial spatial address region (i.e., combinatorial address region), where each partial address region describes the location of a capture site on a capture array, e.g., along the x-axis or y-axis.

[0109] In some embodiments, a set of capture probes (e.g., first and second capture probes) may include at least one capture probe that includes a capture region and a spatial-address region (e.g., a complete or partial spatial-address region). In some embodiments, a capture probe in a set of capture probes does not include both a capture region and a spatial-address region.

[0110] In some embodiments, the first capture probe is a 5' gene-specific probe that includes a sequence complementary to the first universal adapter sequence and a 5' gene-specific primer.

[0111] In some embodiments, the second capture probe is a 3' gene-specific probe that includes a 3' gene-specific primer, a unique molecular index (UMI), and a second universal adaptor sequence (Rd1 adaptor). In some embodiments, the second capture probe does not include a spatial address region.

[0112] In some embodiments, the capture sites on the substrate are a plurality of capture sites, ie, 2 or more, 10 or more, 30 or more, 100 or more, 300 or more, 1,000 or more, 3,000 or more, 10,000 or more, 30,000 or more, 100,000 or more, 300,000 or more, 1,000,000 or more, 3,000,000 or more, or 10,000,000 or 1,000,000,000 or more capture sites.

[0113] In various embodiments, the capture array or substrate has an area of ​​1 square centimeter (cm 2 ) and includes a capture site density of 1 or more, 2 or more, 10 or more, 30 or more, 100 or more, 300 or more, 1,000 or more, 3,000 or more, 10,000 or more, 100,000 or more, 1,000,000 or more capture sites per 100,000 nanoparticle.

[0114] In various embodiments, the pair of capture probes at the capture site is a plurality of pairs of capture probes, hi some embodiments, the plurality of capture probes is 2 or more, 10 or more, 30 or more, 100 or more, 300 or more, 1,000 or more, 3,000 or more, 10,000 or more, 30,000 or more, 100,000 or more, 300,000 or more, 1,000,000 or more, 3,000,000 or more, or 10,000,000 or more, 100,000,000 or more, or 1,000,000,000 or more capture probes.

[0115] In some embodiments, the pair of capture probes in the capture site of the substrate is a plurality of pairs of capture probes. In some embodiments, each first capture probe in the plurality of pairs of capture probes in the same capture site comprises the same spatial address sequence. In some embodiments, each first capture probe in the plurality of pairs of capture probes in different capture sites comprises a different spatial address sequence.

[0116] In some embodiments, the surface of the capture array is a planar surface, such as a glass surface. In some embodiments, the surface of the capture array comprises one or more wells. In some embodiments, the one or more wells correspond to one or more capture sites. In some embodiments, the surface of the capture array is a bead surface.

[0117] In some embodiments, the capture region in the second capture probe is a gene-specific capture region.In some embodiments, the gene-specific capture region in the second capture probe comprises the sequence of TruSeq™ Custom Amplicon (TSCA) oligonucleotide probe (Illumina, Inc.).For example, the gene-specific capture region in the multiple second capture probes in the capture site can comprise multiple sequences of TSCA oligonucleotide probe.

[0118] In another embodiment, the present disclosure provides nanoparticles or beads comprising the spatially addressable probes disclosed herein. In certain embodiments, the beads comprise the spatially addressable probes disclosed herein. In further embodiments, the beads comprise streptavidin on the surface of the beads. In yet further embodiments, the beads comprise multiple oligos bound to the beads via linkages or reversible linkages. An example of a reversible linkage includes a biotin molecule, such as a ddBio molecule. The oligos bound to the beads typically comprise an adapter sequence, such as a P5 sequence or a P7 sequence. As used herein, a P5 sequence comprises a sequence defined by AAT GAT ACG GCG ACC ACC GA (SEQ ID NO: 1) or AAT GAT ACG GCG ACC ACC GAG ATC TAC AC (SEQ ID NO: 2), and a P7 sequence comprises a sequence defined by CAA GCA GAA GAC GGC ATA CG (SEQ ID NO: 3) or CAA GCA GAA GAC GGC ATA CGA GAT (SEQ ID NO: 4). In some embodiments, the P5 or P7 sequence can further comprise a spacer polynucleotide, which can be 1 to 20, e.g., 1 to 15, or 1 to 10, nucleotides, e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides in length. In some embodiments, the spacer comprises 10 nucleotides. In some embodiments, the spacer comprises 10 nucleotides. In some embodiments, the spacer is a poly-T spacer, such as a 10T spacer. The spacer nucleotide can be included at the 5' end of the polynucleotide or can be attached to a suitable support via linkage to the 5' end of the oligo. Attachment can be achieved by a sulfur-containing nucleophile, such as a phosphorothioate, present at the 5' end of the polynucleotide. In some embodiments, the oligo comprises a poly-T spacer and a 5' phosphorothioate group. Thus, in some embodiments, the P5 sequence comprises 5' phosphorothioate-TTTTTTTTTTAATGATACGGCGACCACCGA-3' (SEQ ID NO: 5), and in some embodiments, the P7 sequence comprises 5' phosphorothioate-TTTTTTTTTTCAAGCAGAAGACGGCATACGA-3' (SEQ ID NO: 6).In certain embodiments, the oligos attached to the beads contain address sequences that, when decoded, can determine the x,y position of the oligo / bead. In further embodiments, the address sequences are 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 nucleotides in length, or any two of the foregoing nucleotide lengths or any range therebetween. In another embodiment, the oligos are attached to beads containing a transposome hybridization region (Tsm hyb). In yet additional embodiments, the oligos contain sequencing primer site sequences. Examples of sequencing primer site sequences include sequences complementary to the R1 and R2 sequencing primers from Illumina™. In further embodiments, the oligos may further comprise one or more linker sequences. In still further embodiments, the oligos may further comprise one or more index sequences. In certain embodiments, oligos may contain one or more unique molecular identifier (UMI) sequences. Unique molecular identifiers (UMIs) are a type of molecular barcoding that allows for error correction and improved accuracy during sequencing. These molecular barcodes are short sequences used to uniquely tag each molecule in a sample library. UMIs are used in a wide range of sequencing applications, often PCR replication in DNA and cDNA. UMI deduplication is also useful for RNA-seq gene expression analysis and other quantitative sequencing methods. As described above, oligos contain moieties or sequences that can specifically bind to polynucleotides from biological samples (e.g., tissue samples). Thus, oligos attached to beads are spatially addressable probes for polynucleotides from biological samples. Moieties or sequences that can specifically bind to polynucleotides from biological samples may be selected for specific omic applications. For example, oligos may contain oligo d(T) sequences for transcriptomics or assays (e.g., RNA-seq assays).Alternatively, the oligos may contain sequences that bind to genomic DNA from a biological sample for genomic applications or assays (e.g., ATAC-seq assays). As provided in the examples presented herein, beads can contain multiple types of oligos with different portions or sequences so that the spatially addressable probes can specifically bind to two or more different types of polynucleotides from a biological sample. The use of multiple types of oligos is ideally suited for multi-omic or multi-assay applications.

[0119] kit Kits and articles of manufacture are also contemplated herein. Such kits may include a carrier, package, or container compartmentalized to receive one or more containers, such as vials, tubes, etc., each containing one of the separate elements used in the methods described herein. Suitable containers include, for example, bottles, vials, syringes, and test tubes. The containers may be formed from a variety of materials, such as glass or plastic. For example, the container can contain one or more spatially addressable probes disclosed herein, optionally in a composition or in combination with another agent disclosed herein (e.g., an array, a bead chip). The container optionally has a sterile access port (e.g., the container can be an intravenous solution bag or vial with a stopper pierceable by a hypodermic needle). Such kits optionally include identifying descriptions or labels or instructions for their use in the methods described herein.

[0120] The kit typically includes one or more additional containers, each containing one or more of a variety of materials (such as reagents and / or devices, optionally in concentrated form) desirable from a commercial and user perspective for use with the spatially addressable probes described herein. Non-limiting examples of such materials include, but are not limited to, buffers, diluents, filters, needles, syringes, carriers, packages, containers, vials, and / or tube labels listing the contents and / or instructions for use, and inserts containing instructions for use. A set of instructions for use is also typically included.

[0121] A label can be on or associated with a container. A label can be present on a container when letters, numbers, or other symbols forming the label are attached, molded, or etched into the container itself, or can be associated with a container when the label is present in a receptacle or carrier that also holds the container, for example, as a package insert. A label can be used to indicate that the contents are to be used for a particular spatial omic application. A label can also indicate instructions for using the contents, such as the methods described herein.

[0122] The following examples are intended to illustrate, but not limit, the disclosure. They are typical of those that might be used, although other procedures known to those skilled in the art may alternatively be used. [Example]

[0123] Example 1 - In situ capture of FFPE RNA for spatial transcriptomics applications The genetic profile of tissue samples can be used to diagnose subjects who have or are at risk of having a disease determined by the genetic profile, and determine treatment.In situ polyadenylation is being investigated as a method to increase RNA capture from FFPE tissue samples.In situ polyadenylation adds a polyA tail to fragmented transcripts, which then creates an area available for capture on a polyT surface.

[0124] Total RNA was extracted and used in this initial experiment. Three conditions were tested: 1.) no treatment, 2.) polyadenylation, and 3.) end repair with polynucleotide kinase (PNK), which converts the 3' phosphate to a hydroxyl for poly(A) addition, followed by polyadenylation (Figure 2).

[0125] In the first experiment (Figure 3), total RNA was extracted from FFPE tissue using the RNeasy FFPE Kit (Qiagen). Total RNA was extracted from fresh-frozen tissue using the RNeasy Mini Kit (Qiagen). 500 ng of total RNA was used for each condition. Samples were treated with + / - end repair polynucleotide kinase (PNK) mix (1x T4 PNK buffer (NEB), 10U T4 PNK (NEB), water) for 30 minutes at 37°C. The reaction was then stopped with 20 mM final EDTA. Samples were purified with RNAClean XP beads (1.8X reaction volume). Samples were then treated with + / - PAP mix (1x yPAP reaction buffer (ThermoFisher), 500 uM ATP, 600 U yPAP, water) and incubated for 20 minutes at 37°C. The reaction was stopped with 5 mM final EDTA. Samples were purified with RNAClean XP beads (1.8X reaction volume). Samples were then hybridized to Illumina RPBX oligo-dT beads according to these parameters: 65°C for 5 minutes, 4°C for 30 seconds, and 23°C for 5 minutes. Samples were washed once with Illumina bead wash buffer (BWB). Samples were then eluted in Illumina elution buffer (ELB). Elution was quantified with the high-sensitivity RNA QUBIT® kit.

[0126] QUBIT concentrations were plotted across conditions (Figure 4). Oligo-dT beads became saturated after PAP, suggesting increased capture of polyA RNA. PAP significantly improved capture of polyA RNA for FFPE and fresh-frozen samples. End repair improved capture by approximately 10%. The expected capture of approximately 2% of mRNA was observed in untreated samples (which comprise 1-5% of total RNA). TapeStation analysis showed capture of 18S and 28S (non-polyA RNA) from the total RNA population, suggesting that polyadenylation acts to improve RNA capture (Figure 5).

[0127] To test PAP in situ, we designed a protocol similar to that shown in Figure 2 (Figure 6). In this experiment, end repair was performed on all PAP samples (Figure 7). Three 10-micron fresh-frozen tissue sections were fixed onto two charged glass slides (one for untreated tissue and one for polyadenylation). The slides were fixed in methanol at -20°C for 30 minutes, treated with isopropanol at room temperature for 1 minute, and then air-dried for 10 minutes. A barrier was then drawn around each fresh-frozen tissue section using a hydrophobic pen. Commercially available FFPE tissue with fixed tissue sections was obtained from Zyagen. The slides were oven-dried at 60°C for 1 hour, followed by a rehydration series as follows: two 10-minute incubations in xylene at room temperature, followed by three 3-minute incubations in 100% ethanol, followed by two 3-minute incubations in 96% ethanol, followed by a 3-minute incubation in 70% ethanol. The surface was then treated with nuclease-free water for 1 minute at room temperature. The slides were then dried at 37°C for 5 minutes. Pre-permeabilization mix (986 μl HBS buffer (Lifetech), 10 μl BSA (20 mg / mL), 4 μl Collagenase I (50 U / μl, Lifetech)) was then added to the tissue and incubated at 37°C for 20 minutes. The pre-permeabilization mix was then removed, and TE (pH 9) was added to the slides to reverse crosslinking. A barrier was then drawn around each FFPE tissue using a hydrophobic pen. The samples were treated with + / - end repair PNK mix (1× T4 PNK buffer (NEB), 10 U T4 PNK (NEB), 40 U Protector RNase Inhibitor (Millipore Sigma), water) for 30 minutes at 37°C. The samples were then washed with 100 μl 0.1× SSC buffer. Each well was then equilibrated with 100 μl of 1× yPAP buffer (1× yPAP reaction buffer, 40 U Protector RNase Inhibitor, water) at room temperature for 30 seconds. The solution was discarded, and the tissue was incubated in 75 μl of yPAP reaction mix (1× yPAP reaction buffer, 1 nM ATP, 600 U PAP, 120 U Protector RNase Inhibitor, water) at 37°C for 25 minutes.The PAP mix was discarded, and the tissue was washed once with 100 μl of 0.1×SSC. Then, 60 μl of tissue digestion mix (100 mM Tris buffer, pH 8, 100 mM NaCl, 5 mM EDTA, 2% SDS, 16 U / mL proteinase K (NEB)) was added to the tissue and incubated at 37°C for 40 minutes. The tissue digestion mix was then removed and added to a strip tube. An additional wash with 50 μl of 0.1×SSC was performed within the barrier and added to the tissue digestion mix of the sample. All samples were then purified by a DNase step using the RNeasy Mini Kit (Qiagen) according to the manufacturer's instructions. Samples were quantified with the High Sensitivity RNA QUBIT Kit, and 50 ng was reserved for a "no capture" control. The remaining RNA was subjected to Invitrogen's mRNA Purification Kit (oligo-dT beads) according to the manufacturer's instructions. The captured RNA was quantified by RT-qPCR and the highly sensitive RNA QUBIT® kit.

[0128] Primer and probe pairs were designed for Kap (mRNA) and 18S (rRNA) to study the fold difference due to polyadenylation. Primer / probe pairs were used with the QuantiNova RT-qPCR kit (Qiagen) according to the manufacturer's instructions. Including end repair with PNK and polyadenylation in the workflow generated more polyA transcripts, leading to greater capture of mRNA (4.7-fold increase for Kap in FFPE tissue) and rRNA (9-fold increase for 18S in FFPE tissue) (Figure 8). Captured RNA was also quantified with QUBIT. Including end repair and polyadenylation in the sample preparation increased RNA capture from fresh-frozen and FFPE tissues, suggesting that in situ polyadenylation was working efficiently (Figure 9).

[0129] RNA-Seq libraries were prepared according to Illumina's RNA Prep with enrichment (L) tagging (without the enrichment step) (Figure 10A). This library preparation uses low-concentration eBLTL for transposition into the fragment library and adds PCR adapters. 17 cycles of indexed PCR using UD indexes were used. TapeStation analysis shows that polyadenylation increases library fragment size. Libraries were normalized, pooled, and sequenced on a Nextseq using 0.8 pM 1% PhiX (Figure 10B).

[0130] PolyA trimming of fastq libraries shows that approximately 50% of the FFPE PAP-treated library yield is transposed polyA, suggesting that polyadenylation is at work. Additionally, the length of the polyA tail can be controlled by a ligation approach. An RNA ligase 2 deletion mutant (used in Illumina's small RNA prep kit, Epicentre) can ligate polyA adapters to the 3' ends of transcripts for enrichment on polyT surfaces (Figure 11).

[0131] Isolated sequences were aligned using the basespace RNA-seq alignment app. Alignment analysis shows that polyadenylation shifts 3'-biased transcript coverage (Figure 12A) and increases insert size (Figure 12B). Polyadenylation also increases the percentage of reads that align to the coding region of FFPE-isolated mRNA (Figure 12C). These sequencing metrics suggest that in situ polyadenylation is effective and may serve as a method to increase capture of FFPE RNA on spatially barcoded substrates.

[0132] Example 2 - Use of high processivity polymerase for mRNA library preparation Traditionally, reverse transcriptase (RT) synthesis has been achieved in a one- or two-step workflow using different polymerases for each step depending on the template type (ssDNA or ssRNA) and priming strategy (oligo-dT, randomizers, or a combination of both). In a two-step workflow where oligo-dT is used as a primer in first-strand RT synthesis and randomizers are used as primers in second-strand synthesis, 3'-bias is expected in aligned transcript coverage in RNA-seq applications. A previously established optimized common practice is to use maxima H, a well-known RTase evaluated to have the highest efficiency (in cDNA yield, not quality) for first-strand RT synthesis, followed by a general DNA polymerase with some strand displacement activity (e.g., Klenow fragment exo-), for second-strand synthesis.

[0133] This approach has encountered problems with its inefficiency in synthesizing good-quality cDNA from permeabilized tissue samples on the grafted flow cell (FC) surface, which may be due to mRNA degradation before and / or during RT and low RT efficiency on the FC surface. Subsequent sequencing of the cDNA region showed evidence of a high polyA fraction, up to more than 60% in base %, indicating that short and / or fragmented cDNA was synthesized.

[0134] Several methods were tested herein to improve the quality of the cDNA data, and after switching the polymerase from Klenow fragment exo- to SSIV in second strand synthesis, a higher fraction of cDNA was observed in the 400-1000 bp region in the SSIV condition compared to the Klenow exo- control (Figure 13).

[0135] Overall, when applied to spatial genomics library preparation, there are several advantages to using a faster processivity enzyme such as SSIV in a two-step workflow. When using SSIV as the RTase for first-strand RT synthesis, the workflow time is reduced from 16-20 hours of overnight incubation to 1 hour, with comparable hands-on time. This not only saves time and improves workflow efficiency, but also reduces concerns about mRNA diffusion during capture, which is a major limiting factor in spatial resolution.

[0136] Contrary to mainstream common practice, using SSIV as the polymerase for second-strand synthesis actually improves cDNA length preferentially to 400-1000 bp, leaving the fraction of mRNA less than 400 bp relatively low compared to the main peak, thus improving the ease of SPRI selection in subsequent library preparation due to easier cleanup (Figure 14). Additionally, using SSIV as either the RTase for first-strand RT synthesis in addition to being the polymerase for second-strand synthesis further improves the length, and therefore the integrity (and possibly complexity), of the cDNA in the final product (Figure 15).

[0137] Subsequent data analysis from the RNA-seq alignment showed that using SSIV as both the RTase for first-strand RT synthesis or the polymerase for second-strand synthesis resulted in the highest mapping fraction of exonic regions, especially coding regions (the captured coding region increased from -52% to -62%), reduced 3' bias (due to the polydT priming strategy), and reduced the median CV of transcript coverage from -1.41 to 1.34 (Tables 1 and 2).

[0138] [Table 3]

[0139] [Table 4]

[0140] In common practice, SSIVs are RTases that can bind both ssDNA and ssRNA, but they require ssDNA as a template, whereas RTases generally bind RNA preferentially over ssDNA. Therefore, they are generally not recommended for use in second-strand synthesis. Researchers also tend to use one RTase instead of two for their workflows. Another previous concern about using SSIVs is the relatively low fidelity of RTases compared to normal DNA polymerases, due in part to their loss of proofreading function and in part to the use of both DNA and RNA double templates. However, the application of SSIVs herein has not revealed any mutational concerns in downstream RNA-seq alignment analysis.

[0141] Unexpectedly, the reduction in 3' bias of median CV of transcript coverage in the RNA-seq alignment analysis results when SSIV was used as both the RTase for first-strand RT synthesis and the polymerase for second-strand synthesis (from -1.41 to 1.34 for tests in closed FC) is informative and can be further investigated.

[0142] The results show that the method described herein offers clear improvements in isolating longer cDNA fragments in the 500-3000 bp range, as measured by a peak shift on the bioanalyzer, but also provides a much lower polyA fraction (-30%). This improved transcript alignment reaches over 89% in RNA-seq alignments (STAR ​​Aligner), of which over 90% are exon transcripts. In particular, the use of SSIV in both first- and second-strand synthesis increases the percentage of coding regions in mapped transcripts from -52% to 62%, while reducing the 3' bias in transcript coverage CV. The use of SSIV as the second-strand synthesis polymerase significantly contributes to improved mRNA transcript delivery and library preparation.

[0143] It is understood, therefore, that the present invention is not limited to the particular embodiments disclosed, but is intended to cover all modifications described above and / or shown in the accompanying drawings that are within the spirit and scope of the present invention as defined by the appended claims. Accordingly, only such limitations as are set forth in the appended claims should be placed on the present disclosure.

Claims

1. 1. A method for isolating RNA from a sample, comprising: (a) contacting the total RNA isolated from the sample with polynucleotide kinase (PNK) to modify 3' phosphates to hydroxyl groups to produce end-repaired total RNA; (b) contacting the end-repaired total RNA with polyadenylate polymerase (PAP) and adenosine nucleotides to produce polyadenylated total RNA; (c) capturing the polyadenylated total RNA on a substrate comprising one or more oligonucleotides containing a poly-T sequence; (d) eluting the polyadenylated total RNA from the substrate.

2. The method of claim 1, further comprising quantifying the total RNA.

3. 1. A method for preparing an RNA library from a tissue sample, comprising: (a) contacting the total RNA isolated from the sample with polynucleotide kinase (PNK) to modify 3' phosphates to hydroxyl groups to produce end-repaired total RNA; (b) contacting the end-repaired total RNA with polyadenylate polymerase (PAP) and adenosine nucleotides to produce polyadenylated total RNA; (c) releasing the polyadenylated total RNA from the tissue sample; (d) capturing the polyadenylated total RNA on a substrate comprising one or more oligonucleotides containing a poly-T sequence; (e) preparing an RNA library from the polyadenylated total RNA using an RNA library preparation kit.

4. The method of any one of claims 1 to 3, wherein the RNA comprises rRNA and / or mRNA.

5. 1. A method for preparing an mRNA transcriptome library from a tissue sample, comprising: (a) contacting the total RNA isolated from the sample with polynucleotide kinase (PNK) to modify 3' phosphates to hydroxyl groups to produce end-repaired total RNA; (b) contacting the end-repaired total RNA with polyadenylate polymerase (PAP) and adenosine nucleotides to produce polyadenylated total RNA; (c) releasing the polyadenylated total RNA from the tissue sample; (d) capturing the polyadenylated total RNA on a substrate comprising one or more oligonucleotides containing a poly-T sequence; (e) depleting the total RNA of ribosomal RNA to leave polyadenylated mRNA; (f) preparing an mRNA library from the polyadenylated mRNA using an mRNA library preparation kit.

6. The method according to any one of claims 1 to 5, wherein the substrate is a bead, a bead array, a spot array, a flow cell, clustered particles arranged on the surface of a chip, a film, or a plate.

7. The method of any one of claims 1 to 6, wherein the sample is a fresh frozen tissue sample or a formalin-fixed paraffin-embedded (FFPE) sample.

8. 8. The method of any one of claims 3 to 7, wherein releasing comprises contacting the sample with a lysis buffer, a permeabilization buffer, and / or a reagent for deparaffinizing an FFPE sample.

9. 9. The method of claim 3, wherein when the sample is an FFPE sample on a slide, the method comprises permeabilizing and collagenase treating the sample on the slide before contacting the RNA with PNK.

10. 10. The method of any one of claims 7 to 9, further comprising de-crosslinking the FFPE sample, optionally wherein the de-crosslinking is performed using TE buffer, pH 9.

11. 11. The method of any one of claims 1 to 10, wherein the polyA tail is 3 to 50 nucleotides.

12. 12. The method of any one of claims 3 to 11, wherein generating the RNA library comprises eluting the polyadenylated total RNA from the substrate and generating the RNA library from the eluted polyadenylated RNA library using an RNA library preparation kit.

13. generating the RNA library, i) contacting the isolated RNA with reverse transcriptase (RT) to produce a first strand cDNA complementary to the RNA; ii) contacting the first strand of cDNA with a reverse transcriptase (RT) or a DNA polymerase to generate a second strand of cDNA that is complementary to the first strand of cDNA; iii) amplifying the second strand cDNA to form a PCR template and isolating the PCR template; iv) generating an RNA library from the PCR template.

14. The method according to any one of claims 3 to 13, wherein the RNA library is an mRNA library.

15. 15. The method of claim 14, wherein the PCR templates are further processed by tagging to generate a spatial transcriptomics library.

16. 16. The method of claim 15, wherein the tagging comprises bead tagging, and the beads comprise a plurality of bead-linked transposomes (BLTs).

17. The BLT is i) a plurality of oligonucleotides comprising a first clustering sequence (P7), a first index sequence, and a Read 1 sequencing primer (Rd1 SP); and ii) a plurality of oligonucleotides comprising a second clustering sequence (P5), a second index sequence, and a Read 2 sequencing primer (Rd2 SP).

18. 1. A method for improving the capture efficiency of mRNA transcripts for in situ mRNA transcript library preparation, comprising: (a) capturing mRNA transcripts from a sample onto a substrate; (b) contacting the substrate with a high-processivity reverse transcriptase (RT) to generate a first strand cDNA complementary to the mRNA transcript; (c) contacting the first strand of cDNA with a DNA polymerase to produce a second strand of cDNA that is complementary to the first strand of cDNA; (d) amplifying the second strand cDNA to form a PCR template and isolating the PCR template.

19. 1. A method for improving the capture efficiency of mRNA transcripts for in situ mRNA transcript library preparation, comprising: (a) capturing mRNA transcripts from a sample onto a substrate; (b) contacting the substrate with reverse transcriptase (RT) to produce a first strand cDNA complementary to the mRNA transcript; (c) contacting the first strand of cDNA with a highly processive reverse transcriptase (RT) or a highly processive DNA polymerase to generate a second strand of cDNA that is complementary to the first strand of cDNA; (d) amplifying the second strand cDNA to form a PCR template and isolating the PCR template.

20. 1. A method for improving the capture efficiency of mRNA transcripts for in situ mRNA transcript library preparation, comprising: (a) capturing mRNA transcripts from a sample onto a substrate; (b) contacting the substrate with a high-processivity reverse transcriptase (RT) to generate a first strand cDNA complementary to the mRNA transcript; (c) contacting the first strand cDNA with the high-processivity reverse transcriptase (RT) or high-processivity DNA polymerase to generate a second strand cDNA complementary to the first strand cDNA; (d) amplifying the second strand cDNA to form a PCR template and isolating the PCR template.

21. 1. A method for improving the nucleotide length of polynucleotides used in generating an in situ transcriptome library, comprising: (a) capturing mRNA transcripts from a sample onto a substrate; (b) contacting the substrate with a high-processivity reverse transcriptase (RT) to generate a first strand cDNA complementary to the mRNA transcript; (c) contacting the first strand of cDNA with a highly processive reverse transcriptase (RT) or a highly processive DNA polymerase to generate a second strand of cDNA that is complementary to the first strand of cDNA; (d) amplifying the second strand cDNA to form a PCR template and isolating the PCR template.

22. 22. The method of any one of claims 18 to 21, wherein the high-processivity RT is Superscript IV, a thermostable group II intron RT (TGIRT), or a Marathon RT.

23. 23. The method of any one of claims 18 to 22, wherein the highly processive DNA polymerase is Klenow exo-, Bst 3.0, or phi29.

24. 1. A method for preparing an mRNA transcriptome library from a tissue sample, comprising: (a) contacting the total RNA isolated from the sample with polynucleotide kinase (PNK) to modify 3' phosphates to hydroxyl groups to produce end-repaired total RNA; (b) contacting the total RNA with polynucleotide kinase (PNK) to modify the 3' phosphate to a hydroxyl group to produce end-repaired total RNA; (c) contacting the end-repaired total RNA with polyadenylate polymerase (PAP) and adenosine nucleotides to produce polyadenylated total RNA; (d) releasing the polyadenylated total RNA from the tissue sample; (e) capturing the polyadenylated total RNA on a substrate comprising one or more oligonucleotides containing a poly-T sequence; (f) depleting the total RNA of ribosomal RNA to leave polyadenylated mRNA; (g) contacting the polyadenylated mRNA with reverse transcriptase (RT) to produce a first strand cDNA complementary to the mRNA transcript; (h) contacting the first strand cDNA with a highly processive reverse transcriptase (RT) or a highly processive DNA polymerase to generate a second strand cDNA complementary to the first strand cDNA, thereby generating a PCR template; (i) eluting the PCR template; (j) generating an mRNA library from the PCR template.

25. The method of any one of claims 18 to 24, wherein the substrate is a bead, a bead array, a spot array, a flow cell, clustered particles arranged on the surface of a chip, a film, or a plate.

26. The method of any one of claims 18 to 25, wherein the sample is a fresh frozen tissue sample or a formalin-fixed paraffin-embedded (FFPE) sample.

27. 27. The method of any one of claims 24 to 26, wherein releasing comprises contacting the sample with a lysis buffer, a permeabilization buffer, and / or a reagent for deparaffinizing an FFPE sample.

28. 28. The method of any one of claims 24 to 27, wherein when the sample is an FFPE sample on a slide, the method comprises permeabilizing and collagenase treating the sample on the slide before contacting the RNA with PNK.

29. 29. The method of any one of claims 26 to 28, further comprising de-crosslinking the FFPE sample, optionally wherein the de-crosslinking is performed using TE buffer, pH 9.

30. 30. The method of any one of claims 24 to 29, wherein the poly-A tail is 3 to 50 nucleotides.

31. 31. The method of any one of claims 24 to 30, wherein generating the RNA library comprises eluting the polyadenylated total RNA from the substrate and generating the RNA library from the eluted polyadenylated RNA library using an RNA library preparation kit.

32. generating the RNA library, i) contacting the isolated RNA with reverse transcriptase (RT) to produce a first strand cDNA complementary to the RNA; ii) contacting the first strand of cDNA with a reverse transcriptase (RT) or a DNA polymerase to generate a second strand of cDNA that is complementary to the first strand of cDNA; iii) amplifying the second strand cDNA to form a PCR template and isolating the PCR template; iv) generating an mRNA library from the PCR template.

33. The method of any one of claims 24 to 32, wherein the RNA library is an mRNA library.

34. 34. The method of claim 33, wherein the PCR templates are further processed by tagging to create a spatial transcriptomics library.

35. 35. The method of claim 34, wherein the tagging comprises bead tagging, and the beads comprise a plurality of bead-linked transposomes (BLTs).

36. The BLT is i) a plurality of oligonucleotides comprising a first clustering sequence (P7), a first index sequence, and a Read 1 sequencing primer (Rd1 SP); and ii) a plurality of oligonucleotides comprising a second clustering sequence (P5), a second index sequence, and a Read 2 sequencing primer (Rd2 SP).

37. 37. The method of any one of claims 24 to 36, wherein the reverse transcriptase is a high processivity reverse transcriptase.

Images