Recombinant receptor-expressing T cells, related polynucleotides, and methods

Abstract

Provided herein are methods for engineering immune cells to target a nucleic acid sequence encoding a portion of a recombinant receptor, e.g., a recombinant T cell receptor (TCR), to a specific genomic locus and / or to regulate gene expression at the genomic locus, as well as cell compositions, kits, and articles of manufacture containing the engineered immune cells, and applications thereof related to cancer immunotherapy, such as adoptive transfer of the engineered T cells. In some aspects, the nucleic acid sequence is integrated in-frame into the locus of the gene encoding the receptor, resulting in expression of the entire recombinant receptor in some aspects.

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Provisional Patent Application No. 62 / 653,553, filed April 5, 2018, entitled "T CELLS EXPRESSING A RECOMBINANT RECEPTOR, RELATED POLYNUCLEOTIDES AND METHODS," the contents of which are incorporated by reference in their entirety.

[0002] INCORPORATION-BY-REFERENCE TO SEQUENCE LISTING This application has been submitted with an electronic Sequence Listing, which is provided as a file entitled 735042015540SeqList.txt, created on April 3, 2019, and is 181 kilobytes in size. The information in the electronic format of the Sequence Listing is incorporated by reference in its entirety.

[0003] Field The present disclosure relates to methods for engineering immune cells to target nucleic acid sequences encoding portions of recombinant receptors to specific genomic loci and / or to regulate expression of genes at genomic loci, cellular compositions containing the engineered immune cells, kits, and articles of manufacture, and their applications in cancer immunotherapy, including adoptive transfer of engineered T cells. In some aspects, the nucleic acid sequence is integrated in-frame into the locus of the gene encoding the receptor, resulting in expression of the entire recombinant receptor in some aspects. [Background technology]

[0004] background Adoptive cell therapy, which utilizes recombinantly expressed T cell receptors (TCRs) or other antigen receptors (e.g., chimeric antigen receptors (CARs)) to recognize tumor antigens, represents an attractive therapeutic modality for the treatment of cancer and other diseases. Expression and function of recombinant TCRs or other antigen receptors can be limited and / or heterogeneous in a population of cells. Improved strategies are needed to achieve high and / or uniform expression levels and function of recombinant receptors. These strategies can facilitate the generation of cells exhibiting desired expression levels and / or properties for use in adoptive immunotherapy, e.g., in the treatment of cancer, infectious diseases, and autoimmune diseases. Summary of the Invention

[0005] overview Provided herein are genetically engineered immune cells that express a recombinant receptor, such as a recombinant T cell receptor (TCR), engineered by targeted integration of a nucleic acid sequence encoding the recombinant receptor. In some aspects, the engineered cells comprise a modified T cell receptor alpha constant (TRAC) locus and / or a modified T cell receptor beta constant (TRBC) locus. In some aspects, the modified TRAC and / or TRBC locus contains a nucleic acid sequence encoding a recombinant TCR, or a portion or chain thereof. In some aspects, the provided genetically engineered cells contain a modified TRAC and / or TRBC locus that contains a fusion of a transgene sequence encoding a portion of the recombinant TCR with the endogenous open reading frame of a gene encoding the constant domain of the TCR. In some aspects, methods of generating engineered T cells, related cell compositions, nucleic acids and kits for use in generating the engineered cells described herein are also provided.

[0006] Provided herein is a genetically engineered T cell containing a modified T cell receptor alpha constant (TRAC) locus. In some embodiments, provided herein is a genetically engineered T cell containing a modified T cell receptor alpha constant (TRAC) locus, wherein the modified TRAC locus contains a nucleic acid encoding a recombinant TCR or a portion thereof, wherein the recombinant TCR or a portion thereof contains (i) a TCR alpha (TCR α) chain comprising a variable alpha (Vα) domain and a constant alpha (Cα) domain, and (ii) a TCR beta (TCR β) chain comprising a variable beta (Vβ) domain and a constant beta (Cβ) domain, and the nucleic acid sequence comprises (a) a transgene sequence encoding the TCR β and Vα domains, and (b) an open reading frame of an endogenous TRAC locus encoding at least a portion of the Cα domain of the recombinant TCR, or a subsequence thereof.

[0007] Provided herein is a genetically engineered T cell containing a modified T cell receptor alpha constant (TRAC) locus. In some aspects, the modified TRAC locus comprises a nucleic acid encoding a recombinant TCR or a portion thereof, the recombinant TCR or portion thereof comprising (i) a TCR alpha (TCRα) chain comprising a variable alpha (Vα) domain and a constant alpha (Cα) domain, and (ii) a TCR beta (TCRβ) chain comprising a variable beta (Vβ) domain and a constant beta (Cβ) domain, the nucleic acid sequence comprising (a) a transgene sequence encoding the TCRβ and Vα domains, and (b) an open reading frame of an endogenous TRAC locus encoding at least a portion of the Cα domain of the recombinant TCR, or a subsequence thereof. In some of any such embodiments, a portion of the Cα is encoded by an open reading frame of the endogenous TRAC locus or a subsequence thereof, and an additional portion of the Cα is encoded by a transgene sequence, the additional portion of the Cα being shorter than the full length of a native Cα; and the Cα encoded by the nucleic acid sequence of (a). Further part ofand / or Cβ region teeth , comprising one or more modifications compared to the native Cα region and / or the native Cβ region, wherein the one or more modifications introduce one or more cysteine ​​residues capable of forming one or more non-native disulfide bridges between the alpha and beta chains, and / or the Cα and / or Cβ of the recombinant TCR comprise one or more non-native cysteines.

[0008] Also provided is a genetically engineered T cell containing a modified T cell receptor alpha constant (TRAC) locus comprising a nucleic acid encoding a recombinant TCR or portion thereof, wherein the recombinant TCR or portion thereof comprises (i) a TCR alpha (TCRα) chain comprising a variable alpha (Vα) domain and a constant alpha (Cα) domain, and (ii) a TCR beta (TCRβ) chain comprising a variable beta (Vβ) domain and a constant beta (Cβ) domain, wherein the nucleic acid sequence comprises (a) a transgene sequence encoding the TCRβ and Vα domains, and (b) an open reading frame of the endogenous TRAC locus encoding at least a portion of the Cα domain of the recombinant TCR, or a subsequence thereof, wherein the transgene sequence comprises one or more heterologous or regulatory regulatory elements, including a heterologous promoter, operably linked to regulate expression of the TCR upon expression from the transfected T cell in the genetically engineered T cell.

[0009] In some embodiments, the transgene sequence is integrated or has been integrated via homology-directed repair (HDR). In some embodiments, the modified TRAC locus contains an in-frame fusion of (i) the transgene sequence and (ii) the open reading frame of the endogenous TRAC locus or a subsequence thereof. In some of these embodiments, the transgene sequence is in-frame with one or more exons of the open reading frame of the endogenous TRAC locus or a subsequence thereof.

[0010] In some embodiments, the transgene sequence does not contain a sequence encoding a 3' untranslated region (3' UTR) or an intron. In some embodiments, the open reading frame or a subsequence thereof contains the 3' UTR of the endogenous TRAC locus. In some embodiments, a portion of Cα is encoded by the open reading frame or a subsequence thereof of the endogenous TRAC locus, and a further portion of Cα is encoded by the transgene sequence, wherein the further portion of Cα is shorter than the full length of the native Cα.

[0011] In some embodiments, the open reading frame or a subsequence thereof contains at least one intron and at least one exon of the endogenous TRAC locus. In some embodiments, the transgene sequence is in frame with one or more exons of the open reading frame of the endogenous TRAC locus or a subsequence thereof.

[0012] In some of any such embodiments, the additional portion of Cα is encoded by a sequence of nucleotides comprising fewer than four exons, fewer than three exons, fewer than two exons, one exon, or less than one complete exon of the open reading frame of the TRAC locus. In some of any such embodiments, the additional portion of Cα is encoded by a sequence of nucleotides that is less than 400, less than 300, less than 250, less than 200, or less than 150 base pairs in length. In some of any such embodiments, the additional portion of Cα is encoded by a portion of exon 1 of the TRAC locus, wherein the portion of exon 1 is shorter than the full length of exon 1 of the open reading frame of the TRAC locus.

[0013] In some embodiments, the transgene sequence is integrated or is integrated downstream of the 5'-most nucleotide of exon 1 of the open reading frame of the endogenous TRAC locus and upstream of the 3'-most nucleotide of exon 1. In some embodiments, at least a portion of Cα is integrated into at least exons 2-4 of the open reading frame of the endogenous TRAC locus, or into at least exons 1-4 of the open reading frame of the endogenous TRAC locus. at least a part of and exons 2–4 to In some embodiments, at least a portion of Cα is encoded by less than the full length of exon 1 of the open reading frame of the endogenous TRAC locus.

[0014] In some embodiments, the encoded TCR alpha chain is capable of dimerizing with a TCR beta chain.

[0015] In some embodiments, the encoded Cα contains a sequence selected from any one of SEQ ID NOs: 14, 15, 19, or 24, or a sequence that exhibits at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to any one of SEQ ID NOs: 14, 15, 19, or 24, or a subsequence thereof.

[0016] In some of any of the embodiments provided herein, the encoded Cα comprises a sequence selected from any one of SEQ ID NOs: 19, 24, and 243-252, or a sequence that exhibits at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to any one of SEQ ID NOs: 19, 24, and 243-252, or a subsequence thereof.

[0017] In some embodiments, the additional portion of Cα is encoded by a transgene sequence. In some embodiments, the additional portion of Cα and / or at least a portion of Cα is encoded by a sequence of nucleotides starting from residue 3 to residue 3155 of the sequence set forth in SEQ ID NO:1, or one or more exons thereof, or a sequence that exhibits at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity to the sequence of nucleotides starting from residue 3 to residue 3155 of the sequence set forth in SEQ ID NO:1, or one or more exons thereof, or a subsequence thereof. In some embodiments, the additional portion of Cα is encoded by a sequence of nucleotides that is less than 400, less than 300, less than 250, less than 200, or less than 150 base pairs in length. In some embodiments, the additional portion of Cα is encoded by a sequence of nucleotides containing fewer than four exons, fewer than three exons, fewer than two exons, one exon, or less than one complete exon of the open reading frame of the TRAC locus. In some embodiments, the additional portion of Cα is encoded by a portion of exon 1 of the TRAC locus, wherein the portion of exon 1 is shorter than the full length of exon 1 of the open reading frame of the TRAC locus. In some embodiments, the additional portion of Cα is encoded by a portion of exon 1 of the TRAC locus, wherein the portion of exon 1 contains a 5' portion of exon 1. In some embodiments, a further portion of Cα contains the sequence set forth in SEQ ID NO:142, or a sequence that exhibits at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to SEQ ID NO:142, or a subsequence thereof.

[0018] In some embodiments, the Cα encoded by the nucleic acid sequence of (a) Further part of and / or Cβ region teeth , containing one or more modifications compared to the native Cα region and / or the native Cβ region, optionally one or more amino acid substitutions, deletions, or insertions, and optionally the one or more modifications introduce one or more cysteine ​​residues capable of forming one or more non-native disulfide bridges between the alpha chain and the beta chain.

[0019] In some of any embodiments, the Cα and / or Cβ of the recombinant TCR comprises one or more non-native cysteines. In some of any embodiments, the introduction of one or more cysteine ​​residues comprises substitution of a non-cysteine ​​residue with a cysteine ​​residue. In some of any embodiments, the encoded Cα region comprises a cysteine ​​at a position corresponding to position 48 in the numbering as shown in any of SEQ ID NO:24; and / or the encoded Cβ region comprises a cysteine ​​at a position corresponding to position 57 in the numbering as shown in SEQ ID NO:20. In some of any embodiments, the encoded Cα comprises a sequence selected from any one of SEQ ID NOs:248-252, or a subsequence thereof.

[0020] In any of the provided embodiments, the engineered T cells can further contain a gene disruption at the TRBC locus. In some embodiments, the engineered T cells further contain a gene disruption at the TRBC1 locus and / or the TRBC2 locus.

[0021] In some embodiments, the Cα encoded by the nucleic acid sequence of (a) Further part of and / or Cβ region teeth , containing one or more modifications compared to the native Cα region and / or the native Cβ region, optionally one or more amino acid substitutions, deletions, or insertions, and optionally the one or more modifications introduce one or more cysteine ​​residues capable of forming one or more non-native disulfide bridges between the alpha chain and the beta chain.

[0022] Provided herein are genetically engineered T cells containing a modified T cell receptor beta constant (TRBC) locus. In some embodiments, provided herein are genetically engineered T cells containing a modified T cell receptor beta constant (TRBC) locus, wherein the modified TRBC locus contains a nucleic acid encoding a recombinant TCR or a portion thereof, wherein the recombinant TCR or a portion thereof contains (i) a TCR beta (TCR β) chain comprising a variable beta (V β) domain and a constant beta (C β) domain, and (ii) a TCR alpha (TCR α) chain comprising a variable alpha (V α) domain and a constant alpha (C α) domain, and the nucleic acid sequence comprises (a) a transgene sequence encoding the TCR α and V β domain, and (b) an open reading frame of an endogenous TRBC locus encoding at least a portion of the C β domain of the recombinant TCR, or a subsequence thereof.

[0023] Also provided herein are genetically engineered T cells containing a modified T cell receptor beta constant (TRBC) locus. In some of any such embodiments, the modified TRBC locus comprises a nucleic acid encoding a recombinant TCR or a portion thereof, the recombinant TCR or portion thereof comprising (i) a TCR beta (TCR β) chain comprising a variable beta (V β) domain and a constant beta (C β) domain, and (ii) a TCR alpha (TCR α) chain comprising a variable alpha (V α) domain and a constant alpha (C α) domain, the nucleic acid sequence comprising (a) a transgene sequence encoding the TCR α and V β domains, and (b) an open reading frame of an endogenous TRBC locus encoding at least a portion of the C β domain of the recombinant TCR, or a subsequence thereof. In some of any such embodiments, a portion of Cβ is encoded by an open reading frame of an endogenous TRBC locus or a subsequence thereof, and a further portion of Cβ is encoded by a transgene sequence, the further portion of Cβ being shorter than the full length of native Cβ; and Cβ encoded by the nucleic acid sequence of (a). Further part of and / or Cα region teeth , comprising one or more modifications compared to the native Cβ region and / or native Cα region, in some cases one or more amino acid substitutions, deletions, or insertions, and in some cases the one or more modifications introduce one or more cysteine ​​residues capable of forming one or more non-native disulfide bridges between the alpha chain and the beta chain.

[0024] In some of such embodiments, the transgene sequence is or has been integrated via homology-directed repair (HDR). In some embodiments, the TRBC locus is the TRBC1 locus and / or the TRBC2 locus. In some embodiments, the modified TRBC locus contains an in-frame fusion of (i) the transgene sequence and (ii) the open reading frame or a subsequence thereof of the endogenous TRBC locus. In some embodiments, the transgene sequence is in-frame with one or more exons or a subsequence thereof of the open reading frame of the endogenous TRBC locus. In some embodiments, the transgene sequence does not contain a sequence encoding a 3' untranslated region (3' UTR) or an intron. In some embodiments, the open reading frame or a subsequence thereof contains the 3' UTR of the endogenous TRBC locus.

[0025] In some embodiments, a portion of Cβ is encoded by an open reading frame or a subsequence thereof of an endogenous TRBC locus, and a further portion of Cβ is encoded by an introduced gene sequence, wherein the further portion of Cβ is shorter than the full length of native Cβ.

[0026] In some embodiments, the open reading frame or a subsequence thereof contains at least one intron and at least one exon of the endogenous TRBC locus. In some embodiments, the transgene sequence is in frame with one or more exons or a subsequence thereof of the open reading frame of the endogenous TRBC locus. In some embodiments, the transgene sequence is integrated or has been integrated downstream of the 5'-most nucleotide of exon 1 and upstream of the 3'-most nucleotide of exon 1 of the open reading frame of the endogenous TRBC locus.

[0027] In some embodiments, at least a portion of Cβ is encoded by at least exons 2-4 of the open reading frame of the endogenous TRBC locus. In some embodiments, at least a portion of Cβ is encoded by exon 1 of the open reading frame of the endogenous TRBC locus. at least a part of and exons 2–4 to In some embodiments, at least a portion of Cβ is encoded by less than the full length of exon 1 of the open reading frame of the endogenous TRBC locus.

[0028] In some of any such embodiments, the additional portion of Cβ is encoded by a sequence of nucleotides comprising fewer than four exons, fewer than three exons, fewer than two exons, one exon, or less than one complete exon of the open reading frame of the TRBC locus. In some of any such embodiments, the additional portion of Cβ is encoded by a sequence of nucleotides that is less than 400, less than 300, less than 250, less than 200, or less than 150 base pairs in length. In some of any such embodiments, the additional portion of Cβ is encoded by a portion of exon 1 of the TRBC locus, wherein the portion of exon 1 is shorter than the full length of exon 1 of the open reading frame of the TRBC locus.

[0029] In some embodiments, the encoded TCR β chain is capable of dimerizing with a TCR α chain.

[0030] In some embodiments, the encoded Cβ contains a sequence selected from any one of SEQ ID NOs: 16, 17, 20, 21, and 25, or a sequence that exhibits at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to any one of SEQ ID NOs: 16, 17, 20, 21, and 25, or a subsequence thereof.

[0031] In some embodiments, the encoded Cβ comprises a sequence selected from any one of SEQ ID NOs:20, 21, 25, and 253-258, or a sequence that exhibits at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to any one of SEQ ID NOs:20, 21, 25, and 253-258, or a subsequence thereof.

[0032] In some embodiments, the additional portion of Cβ and / or at least a portion of Cβ is a sequence that exhibits at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the sequence of nucleotides starting from residue 3 to residue 1445 of the sequence set forth in SEQ ID NO:2 or one or more exons thereof, or a subsequence thereof; or the sequence of nucleotides starting from residue 3 to residue 1445 of the sequence set forth in SEQ ID NO:3 or one or more exons thereof; In some embodiments, the Cα is encoded by a sequence that exhibits at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the sequence of nucleotides beginning at residue 3 to residue 1486 of the sequence set forth in SEQ ID NO:3, or one or more exons thereof, or a subsequence thereof. In some embodiments, the Cα is encoded by a sequence of nucleotides that is less than 400, less than 300, less than 250, less than 200, or less than 150 base pairs in length.

[0033] In some embodiments, the additional portion of Cα is encoded by a sequence of nucleotides containing less than four exons, less than three exons, less than two exons, one exon, or less than one complete exon of the open reading frame of the TRBC locus. In some embodiments, the additional portion of Cα is encoded by a portion of exon 1 of the TRBC locus, wherein the portion of exon 1 is shorter than the full length of exon 1 of the open reading frame of the TRBC locus, or the portion of exon 1 contains a 5' portion of exon 1.

[0034] In some embodiments, the Cβ encoded by the nucleic acid sequence of (a) Further part of and / or Cα region teeth , containing one or more modifications compared to the native Cβ region and / or the native Cα region, optionally one or more amino acid substitutions, deletions, or insertions, and optionally the one or more modifications introduce one or more cysteine ​​residues capable of forming one or more non-native disulfide bridges between the alpha chain and the beta chain.

[0035] In some of any of the embodiments, the introduction of one or more cysteine ​​residues comprises substitution of a non-cysteine ​​residue with a cysteine ​​residue. In some of any of the embodiments, the encoded Cα region comprises a cysteine ​​at a position corresponding to position 48 in the numbering as set forth in any of SEQ ID NO:24; and / or the encoded Cβ region comprises a cysteine ​​at a position corresponding to position 57 in the numbering as set forth in SEQ ID NO:20. In some of any of the embodiments, the encoded Cβ comprises a sequence selected from any one of SEQ ID NOs:253 and 256-258, or a subsequence thereof.

[0036] In some embodiments, the engineered T cells further contain a gene disruption at the TRAC locus.

[0037] In some embodiments, the transgene sequence contains one or more multicistronic elements. In some of such embodiments, the multicistronic element is located between the nucleic acid sequence encoding TCR alpha or a portion thereof and the nucleic acid sequence encoding TCR beta or a portion thereof. In some embodiments, the one or more multicistronic elements are upstream of the nucleic acid sequence encoding the TCR or a portion of the TCR, or the nucleic acid molecule encoding the TCR. In some embodiments, the multicistronic element is or contains a ribosomal skip sequence, optionally T2A, P2A, E2A, or F2A.

[0038] In some embodiments, the transgene sequence contains one or more heterologous control or regulatory elements. In some embodiments, the transgene sequence contains one or more heterologous or regulatory regulatory elements operably linked to regulate expression of the TCR upon expression from the transfected cell in the genetically engineered T cell. In some embodiments, the one or more heterologous control or regulatory elements contain a promoter, enhancer, intron, polyadenylation signal, Kozak consensus sequence, splice acceptor sequence, and / or splice donor sequence.

[0039] In some embodiments, the heterologous control or regulatory element contains a heterologous promoter, such as a heterologous promoter selected from among a constitutive promoter, an inducible promoter, a repressible promoter, and / or a tissue-specific promoter. In some embodiments, the heterologous promoter is or contains the human elongation factor 1 alpha (EF1α) promoter or MND promoter or a variant thereof.

[0040] In some embodiments, the Cα and / or Cβ of the recombinant TCR contain one or more non-native cysteines.

[0041] In any of the provided embodiments, the recombinant TCR may be capable of binding to an antigen associated with, specific for, and / or expressed on a cell or tissue that is associated with a disease, disorder, or condition, e.g., an infectious disease or disorder, an autoimmune disease, an inflammatory disease, a tumor, or a cancer.

[0042] In some embodiments, the antigen is a tumor antigen or a pathogenic antigen, for example, a bacterial antigen or a viral antigen.In some embodiments, the antigen is a viral antigen, and the viral antigen can optionally be derived from hepatitis A, hepatitis B, hepatitis C virus (HCV), human papillomavirus (HPV), hepatitis virus infection, Epstein-Barr virus (EBV), human herpesvirus 8 (HHV-8), human T-cell leukemia virus-1 (HTLV-1), human T-cell leukemia virus-2 (HTLV-2), or cytomegalovirus (CMV).

[0043] In some embodiments, the viral antigen is an antigen from HPV selected from HPV-16, HPV-18, HPV-31, HPV-33, and HPV-35, such as an HPV-16 antigen that is HPV-16 E6 or HPV-16 E7 antigen. In some embodiments, the viral antigen is an EBV antigen selected from Epstein-Barr nuclear antigen (EBNA)-1, EBNA-2, EBNA-3A, EBNA-3B, EBNA-3C, EBNA-leader protein (EBNA-LP), latent membrane proteins LMP-1, LMP-2A, and LMP-2B, EBV-EA, EBV-MA, and EBV-VCA. In some embodiments, the viral antigen is an HTLV antigen that is TAX. In some embodiments, the viral antigen is an HBV antigen that is hepatitis B core antigen or hepatitis B envelope antigen.

[0044] In some embodiments, the antigen is a tumor antigen. In some embodiments, the antigen is a glioma-associated antigen, β-human chorionic gonadotropin, alpha-fetoprotein (AFP), lectin-reactive AFP, thyroglobulin, RAGE-1, MN-CA IX, human telomerase reverse transcriptase, RU1, RU2 (AS), intestinal carboxylesterase, mut hsp70-2, M-CSF, melanin-A / MART-1, WT-1, S-100, MBP, CD63, MUC1 (e.g., MUC1-8), p53, Ras, cyclin B1, HER-2 / neu, carcinoembryonic antigen (CEA), gp100, MAGE-A1, MAGE-A2, MAGE-A3, MAGE-A4, MAGE-A5, MAGE-A6, MAGE-A7, MAGE-A8, MAGE-A9, MAGE-A10, MAGE-A11, MAGE-B1, MAGE-B2, MAGE-B3, MAGE-B4, MAGE-C1, BAGE, GAGE-1, GAGE-2, p15, tyrosinase (e.g., tyrosinase-related protein 1 (TRP-1) or tyrosinase-related protein 1 (TRP-2)), and other proteins. TRP-2), β-catenin, NY-ESO-1, LAGE-1a, PP1, MDM2, MDM4, EGVFvIII, Tax, SSX2, telomerase, TARP, pp65, CDK4, vimentin, S100, eIF-4A1, IFN-inducible p78, melanotransferrin (p97), uroplakin II, prostate-specific antigen (PSA), human kallikrein (huK2), prostate-specific membrane antigen (PSM), and prostatic acid phosphatase (PAP), neutrophil elastase, ephrin B2, BA-46, Bcr-abl, E2A-PRL, H4-RET, IGH-IGK, MYL-RAR, caspase 8, FRa, CD24, CD44, CD133, CD 166, epCAM, CA-125, HE4, Oval, estrogen receptor, progesterone receptor, uPA, PAI-1, CD19, CD20, CD22, ROR1, CD33 / IL3Ra, c-Met, PSMA, glycolipid F77, GD-2, insulin growth factor (IGF)-I, IGF-II, IGF-I receptor, and mesothelin.

[0045] In any of the provided embodiments, the T cells can be primary T cells derived from a subject, and optionally, the subject is a human. In some embodiments, the T cells are CD8+ T cells or subtypes thereof, or CD4+ T cells or subtypes thereof. In some embodiments, the T cells are derived from multipotent or pluripotent cells, optionally iPSCs.

[0046] Also provided herein are compositions containing a plurality of genetically engineered T cells, for example, a plurality of any of the engineered cells provided herein. In some embodiments, compositions are provided containing a plurality of genetically engineered T cells comprising a modified T cell receptor alpha constant (TRAC) locus, wherein the modified TRAC locus comprises a nucleic acid encoding a recombinant TCR or a portion thereof, wherein the recombinant TCR or portion thereof comprises (i) a TCR alpha (TCRα) chain comprising a variable alpha (Vα) domain and a constant alpha (Cα) domain, and (ii) a TCR beta (TCRβ) chain comprising a variable beta (Vβ) domain and a constant beta (Cβ) domain, wherein the nucleic acid sequence comprises (a) a transgene sequence encoding the TCRβ and Vα domains, and (b) an open reading frame of an endogenous TRAC locus encoding at least a portion of the Cα domain of the recombinant TCR, or a subsequence thereof, and wherein the recombinant TCR is capable of binding to an antigen associated with, specific for, and / or expressed on a cell or tissue associated with a disease, disorder, or condition. In some of any such embodiments, at least 70%, 75%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of the engineered cells in the composition comprise a disruption in or a gene disruption in an endogenous T cell receptor alpha constant region (TRAC) gene and / or a T cell receptor beta constant region (TRBC) gene; and at least 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of the engineered cells in the composition do not express, or do not express at detectable levels, a gene product of the endogenous TRAC or TRBC gene. In some of any such embodiments, at least 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, or 90% of the cells in the composition, or more than 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, or 90%, express the recombinant TCR and / or exhibit binding to the antigen.

[0047] Also provided herein is a composition comprising a plurality of genetically engineered T cells comprising a modified T cell receptor alpha constant (TRAC) locus, wherein the modified TRAC locus comprises a nucleic acid encoding a recombinant TCR or a portion thereof, the recombinant TCR or portion thereof comprising (i) a TCR alpha (TCRα) chain comprising a variable alpha (Vα) domain and a constant alpha (Cα) domain, and (ii) a TCR beta (TCRβ) chain comprising a variable beta (Vβ) domain and a constant beta (Cβ) domain, the nucleic acid sequence comprising (a) a transgene sequence encoding the TCRβ and Vα domains, and (b) an open reading frame of the endogenous TRAC locus, or a subsequence thereof, encoding at least a portion of the Cα domain of the recombinant TCR. In some of any such embodiments, a portion of the Cα is encoded by the open reading frame of the endogenous TRAC locus, or a subsequence thereof, and a further portion of the Cα is encoded by the transgene sequence, wherein the further portion of the Cα is shorter than the full length of the native Cα. In some of any such embodiments, the Cα encoded by the nucleic acid sequence of (a) Further part of and / or Cβ region teeth , which contain one or more modifications compared to the native Cα region and / or the native Cβ region, which introduce one or more cysteine ​​residues capable of forming one or more non-native disulfide bridges between the alpha and beta chains.

[0048] Also provided herein is a composition containing a plurality of genetically engineered T cells comprising a modified T cell receptor beta constant (TRBC) locus, wherein the modified TRBC locus comprises a nucleic acid encoding a recombinant TCR or a portion thereof, wherein the recombinant TCR or portion thereof comprises (i) a TCR beta (TCRβ) chain comprising a variable beta (Vβ) domain and a constant beta (Cβ) domain, and (ii) a TCR alpha (TCRα) chain comprising a variable alpha (Vα) domain and a constant alpha (Cα) domain, wherein the nucleic acid sequence comprises (a) a transgene sequence encoding the TCRα and Vβ domains, and (b) an open reading frame of an endogenous TRBC locus, or a subsequence thereof, encoding at least a portion of the Cβ domain of the recombinant TCR, and wherein the recombinant TCR is capable of binding to an antigen associated with, specific for, and / or expressed on a cell or tissue associated with a disease, disorder, or condition. In some of any such embodiments, at least 70%, 75%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of the engineered cells in the composition comprise a disruption in or a gene disruption in the endogenous T cell receptor alpha constant region (TRAC) gene and / or the T cell receptor beta constant region (TRBC) gene. In some of any such embodiments, at least 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of the engineered cells in the composition do not express, or do not express at detectable levels, the gene product of the endogenous TRAC or TRBC gene. In some of any such embodiments, at least 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, or 90% of the cells in the composition, or more than 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, or 90%, express the recombinant TCR and / or exhibit binding to the antigen.

[0049] Also provided herein is a composition containing a plurality of genetically engineered T cells comprising a modified T cell receptor beta constant (TRBC) locus, wherein the modified TRBC locus comprises a nucleic acid encoding a recombinant TCR or a portion thereof, the recombinant TCR or portion thereof comprising (i) a TCR beta (TCRβ) chain comprising a variable beta (Vβ) domain and a constant beta (Cβ) domain, and (ii) a TCR alpha (TCRα) chain comprising a variable alpha (Vα) domain and a constant alpha (Cα) domain, the nucleic acid sequence comprising (a) a transgene sequence encoding the TCRα and Vβ domains, and (b) an open reading frame of an endogenous TRBC locus, or a subsequence thereof, encoding at least a portion of the Cβ domain of the recombinant TCR. In some of any such embodiments, a portion of the Cβ is encoded by the open reading frame of the endogenous TRBC locus, or a subsequence thereof, and a further portion of the Cβ is encoded by the transgene sequence, the further portion of the Cβ being shorter than the full length of the native Cβ. In some of any such embodiments, the Cβ encoded by the nucleic acid sequence of (a) Further part of and / or Cα region teeth , comprising one or more modifications, optionally one or more amino acid substitutions, deletions, or insertions, relative to the native Cβ region and / or native Cα region. In some of any such embodiments, the one or more modifications introduce one or more cysteine ​​residues capable of forming one or more non-native disulfide bridges between the alpha and beta chains.

[0050] In some of either embodiment, the recombinant TCR is capable of binding to an antigen associated with, specific for, and / or expressed on a cell or tissue that is associated with a disease, disorder, or condition.

[0051] In some embodiments, provided herein are compositions containing any of the genetically engineered T cells provided herein. In some of any of the embodiments, the compositions contain CD4+ T cells and / or CD8+ T cells. In some embodiments, the compositions contain CD4+ T cells and CD8+ T cells, and the ratio of CD4+ T cells to CD8+ T cells is 1:3 to 3:1 or about 1:3 to 3:1, optionally 1:1.

[0052] In some embodiments, the composition contains, and at least 70%, 75%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of the engineered cells in the composition contain a gene disruption in or of an endogenous T cell receptor alpha constant region (TRAC) gene and / or T cell receptor beta constant region (TRBC) gene; and / or at least 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of the engineered cells in the composition do not express, or do not express at detectable levels, the gene product of the endogenous TRAC or TRBC gene. In some embodiments, at least 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, or 90% of the cells in the composition, or more than 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, or 90%, express a recombinant TCR and / or exhibit antigen binding (e.g., exhibit binding to an antigen).

[0053] In some embodiments, polynucleotides are provided, such as polynucleotides for use in cell engineering.In some embodiments, the present disclosure provides a polynucleotide that contains: (a) a nucleic acid sequence encoding a portion of a recombinant T cell receptor (TCR), wherein (i) a T cell receptor beta (TCRβ) chain contains a variable beta (Vβ) domain and a constant beta (Cβ) domain, and (ii) a portion of a T cell receptor alpha (TCRα) chain that is shorter than the full-length natural T cell receptor alpha (TCRα) chain; and (b) one or more homology arms linked to the nucleic acid sequence, wherein the sequence is homologous to one or more regions of the open reading frame of the TRAC locus.In some embodiments, the polynucleotide is contained in a viral vector.

[0054] 1. A polynucleotide comprising: (a) a nucleic acid sequence encoding a portion of a recombinant T cell receptor (TCR), the TCR encoding (i) a T cell receptor beta (TCRβ) chain comprising a variable beta (Vβ) domain and a constant beta (Cβ) domain, and (ii) a portion of a T cell receptor alpha (TCRα) chain that is shorter than the full length of a native T cell receptor alpha (TCRα) chain; and (b) one or more homology arms linked to the nucleic acid sequence, the arms comprising a sequence homologous to one or more regions of an open reading frame of a TRAC locus; wherein when a TCR or antigen-binding fragment thereof is expressed from a cell into which the polynucleotide has been introduced: a portion of Cα is encoded by the open reading frame of the endogenous TRAC locus or a subsequence thereof, and a further portion of Cα is encoded by the transgene sequence, wherein the further portion of Cα is shorter than the full length of a native Cα; and Further part of and / or Cβ region butProvided herein is a polynucleotide comprising one or more modifications compared to a native Cα region and / or a native Cβ region, wherein the one or more modifications introduce one or more cysteine ​​residues capable of forming one or more non-native disulfide bridges between the alpha and beta chains. In some aspects, and / or the Cα and / or Cβ of the recombinant TCR comprise one or more non-native cysteines.

[0055] Provided herein is a polynucleotide containing: (a) a nucleic acid sequence encoding a portion of a recombinant T cell receptor (TCR), wherein the polynucleotide encodes (i) a T cell receptor beta (TCRβ) chain comprising a variable beta (Vβ) domain and a constant beta (Cβ) domain, and (ii) a portion of a T cell receptor alpha (TCRα) chain that is shorter than the full length of the native T cell receptor alpha (TCRα) chain; and (b) one or more homology arms linked to the nucleic acid sequence, the arms comprising sequence homologous to one or more regions of an open reading frame of the TRAC locus; wherein the transgene sequence comprises one or more heterologous or regulatory regulatory elements, including a heterologous promoter, operably linked to regulate expression of the TCR upon expression from the transgene in a genetically engineered T cell.

[0056] In some embodiments, the TCR alpha chain comprises a constant alpha region (Cα), at least a portion of which is encoded by an open reading frame of the endogenous TRAC locus or a subsequence thereof when the TCR or antigen-binding fragment thereof is expressed from a cell into which the polynucleotide has been introduced.

[0057] In some embodiments, the nucleic acid sequence of (a) and one of the one or more homology arms together contain a sequence of nucleotides encoding a Cα that is shorter than the full length of a native Cα, and when the TCR or antigen-binding fragment thereof is expressed from a cell into which the polynucleotide has been introduced, at least a portion of the Cα is encoded by the open reading frame of the endogenous TRAC locus or a subsequence thereof.

[0058] In some embodiments, the nucleic acid sequence encoding the TCR β chain is upstream of the nucleic acid sequence encoding a portion of the TCR α chain. In some embodiments, the nucleic acid sequence of (a) does not contain an intron. In some embodiments, the nucleic acid sequence of (a) does not contain a sequence encoding a 3' untranslated region (3' UTR). In some embodiments, the nucleic acid sequence of (a) is a sequence that is foreign or heterologous to the open reading frame of the endogenous genomic TRAC locus of a T cell, optionally a human T cell. In some embodiments, the nucleic acid sequence of (a) is in frame with one or more exons or subsequences thereof of the open reading frame of the TRAC locus contained in one or more homology arms. In some embodiments, one or more exons or subsequences thereof of the open reading frame contain sequences within exon 1 of the open reading frame of the TRAC locus.

[0059] In some embodiments, the TCR α chain is capable of dimerizing with the TCR β chain when produced from a cell into which the polynucleotide has been introduced. In some embodiments, the TCR α chain contains a variable alpha (Vα) domain.

[0060] In some embodiments, a portion of Cα is encoded by an open reading frame or subsequence thereof of the endogenous TRAC locus, and a further portion of Cα is encoded by the nucleic acid sequence of (a), wherein the further portion of Cα is shorter than the full length of native Cα. In some of any of the embodiments, the open reading frame or subsequence thereof comprises at least one intron and at least one exon of the endogenous TRAC locus. In some embodiments, a further portion of Cα is encoded by a sequence of nucleotides starting from residue 3 to residue 3155 of the sequence set forth in SEQ ID NO:1, or one or more exons thereof, or a sequence that exhibits at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the sequence of nucleotides starting from residue 3 to residue 3155 of the sequence set forth in SEQ ID NO:1, or one or more exons thereof, or a subsequence thereof. In some embodiments, Cα is encoded by a sequence of nucleotides that is less than 400, less than 300, less than 250, less than 200, or less than 150 base pairs in length.

[0061] In some embodiments, the additional portion of Cα is encoded by a sequence of nucleotides containing fewer than four exons, fewer than three exons, fewer than two exons, one exon, or less than one complete exon of the open reading frame of the TRAC locus. In some embodiments, the additional portion of Cα is encoded by a portion of exon 1 of the TRAC locus, wherein the portion of exon 1 is shorter than the full length of exon 1 of the open reading frame of the TRAC locus, e.g., the portion of exon 1 contains a 5' portion of exon 1.

[0062] In some of any such embodiments, upon production from a cell into which the polynucleotide has been introduced, the encoded Cα comprises a sequence selected from any one of SEQ ID NOs: 19, 24, and 243-252, or a sequence that exhibits at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to any one of SEQ ID NOs: 19, 24, and 243-252, or a subsequence thereof. In some of any such embodiments, at least a portion of Cα is encoded by the sequence of nucleotides starting from residue 3 to residue 3155 of the sequence set forth in SEQ ID NO:1, or one or more exons thereof, or a sequence that exhibits at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the sequence of nucleotides starting from residue 3 to residue 3155 of the sequence set forth in SEQ ID NO:1, or one or more exons thereof, or a subsequence thereof.

[0063] In some embodiments, a further portion of Cα contains the sequence set forth in SEQ ID NO:142, or a sequence that exhibits at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to SEQ ID NO:142, or a subsequence thereof.

[0064] In some embodiments, the Cα encoded by the nucleic acid sequence of (a) Further part of and / or Cβ region teeth , containing one or more modifications compared to the native Cα region and / or the native Cβ region, optionally one or more amino acid substitutions, deletions, or insertions, and optionally the one or more modifications introduce one or more cysteine ​​residues capable of forming one or more non-native disulfide bridges between the alpha chain and the beta chain.

[0065] In some of any of the embodiments, the introduction of one or more cysteine ​​residues comprises substitution of a non-cysteine ​​residue with a cysteine ​​residue. In some of any of the embodiments, upon production from a cell into which the polynucleotide has been introduced, the encoded Cα region comprises a cysteine ​​at a position corresponding to position 48 in the numbering as shown in any of SEQ ID NO:24; and / or the encoded Cβ region comprises a cysteine ​​at a position corresponding to position 57 in the numbering as shown in SEQ ID NO:20.

[0066] In some of any of the embodiments, upon production from a cell into which the polynucleotide has been introduced, the encoded Cα comprises a sequence selected from any one of SEQ ID NOs:248-252, or a subsequence thereof. In some of any of the embodiments, the portion of the TCR α chain comprises a variable alpha (Vα) domain.

[0067] In some embodiments, the one or more homology arms comprise a 5' homology arm and / or a 3' homology arm. In some embodiments, the 5' homology arm and the 3' homology arm contain nucleic acid sequences homologous to nucleic acid sequences surrounding the target site, the target site being within the TRAC locus, e.g., within exon 1 of the TRAC locus.

[0068] In some embodiments, the 5' homology arm comprises: a) a sequence containing at least 150, 200, 250, 300, 350, 400, 450, 500, 550, or 600 contiguous nucleotides for a sequence exhibiting at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the sequence set forth in SEQ ID NO:124; or b) a sequence containing at least 150, 200, 250, 300, 350, 400, 450, 500, 550, or 600 contiguous nucleotides for a sequence exhibiting at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the sequence set forth in SEQ ID NO:124; or c) a sequence containing 150, 200, 250, 300, 350, 400, 450, 500, 550, or 600 contiguous nucleotides of, or at least 150, 200, 250, 300, 350, 400, 450, 500, 550, or 600 contiguous nucleotides of, the sequence set forth in SEQ ID NO:124; or

[0069] In some embodiments, the 3' homology arm comprises: a) a sequence containing at least 150, 200, 250, 300, 350, 400, 450, 500, 550, or 600 contiguous nucleotides for a sequence exhibiting at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the sequence set forth in SEQ ID NO:125; or b) a sequence containing at least 150, 200, 250, 300, 350, 400, 450, 500, 550, or 600 contiguous nucleotides for a sequence exhibiting at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the sequence set forth in SEQ ID NO:125; or c) a sequence containing 150, 200, 250, 300, 350, 400, 450, 500, 550, or 600 contiguous nucleotides of, or at least 150, 200, 250, 300, 350, 400, 450, 500, 550, or 600 contiguous nucleotides of, the sequence set forth in SEQ ID NO: 125; or

[0070] In some embodiments, provided herein is a polynucleotide containing: (a) a nucleic acid sequence encoding a portion of a recombinant T cell receptor (TCR), the nucleic acid sequence encoding (i) a T cell receptor alpha (TCRα) chain containing a variable alpha (Vα) domain and a constant alpha (Cα) domain, and (ii) a portion of a T cell receptor beta (TCRβ) chain that is shorter than the full-length native T cell receptor beta (TCRβ) chain; and (b) one or more homology arms linked to the nucleic acid sequence, the nucleic acid sequence containing a sequence homologous to one or more regions of an open reading frame of the TCRβ locus. In some such embodiments, the TCRβ chain contains a constant beta (Cβ), and when the TCR or its antigen-binding fragment is expressed from a cell into which the polynucleotide has been introduced, at least a portion of the Cβ is encoded by the open reading frame of the endogenous TRAC locus or a subsequence thereof. In some embodiments, the nucleic acid sequence of (a) and one of the one or more homology arms together contain a sequence of nucleotides encoding a Cβ that is shorter than the full length of native Cβ, and when the TCR or its antigen-binding fragment is expressed from a cell into which the polynucleotide has been introduced, at least a portion of the Cβ is encoded by an open reading frame or a subsequence thereof of the endogenous TRBC locus.

[0071] In some embodiments, the TRBC locus is one or more of TRBC1 or TRBC2.

[0072] In some embodiments, the nucleic acid sequence encoding the TCR α chain is upstream of the nucleic acid sequence encoding a portion of the TCR β chain. In some embodiments, the nucleic acid sequence of (a) does not contain an intron. In some embodiments, the nucleic acid sequence of (a) does not contain a sequence encoding a 3' untranslated region (3' UTR). In some embodiments, the nucleic acid sequence of (a) is a sequence that is foreign or heterologous to the open reading frame of the endogenous genomic TRBC locus of a T cell, optionally a human T cell.

[0073] In some embodiments, the nucleic acid sequence of (a) is in frame with one or more exons or subsequences thereof of the open reading frame of the TRAC locus contained in one or more homology arms. In some embodiments, the one or more exons or subsequences thereof of the open reading frame are or contain sequences within exon 1 of the open reading frame of the TRBC locus.

[0074] In some embodiments, the TCR β chain is capable of dimerizing with the TCR α chain upon production from a cell into which the polynucleotide has been introduced. In some of any of the embodiments, the encoded Cβ upon production from a cell into which the polynucleotide has been introduced comprises a sequence selected from any one of SEQ ID NOs:20, 21, 25, and 253-258, or a sequence that exhibits at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to any one of SEQ ID NOs:20, 21, 25, and 253-258, or a subsequence thereof.

[0075] In some embodiments, the portion of the TCR β chain contains a variable beta (Vβ) domain. In some embodiments, a portion of the Cβ is encoded by an open reading frame or a subsequence thereof of the endogenous TRBC locus, and a further portion of the Cβ is encoded by the nucleic acid sequence of (a), wherein the further portion of the Cβ is shorter than the full length of native Cβ. In some of any of the embodiments, the open reading frame or subsequence thereof includes at least one intron and at least one exon of the endogenous TRBC locus. In some such embodiments, the additional portion of Cβ is a sequence that exhibits at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the sequence of nucleotides starting from residue 3 to residue 1445 of the sequence set forth in SEQ ID NO:2 or one or more exons thereof, or a subsequence thereof; or the sequence of nucleotides starting from residue 3 to residue 1445 of the sequence set forth in SEQ ID NO:3 or one or more exons thereof. The sequence is encoded by a sequence that exhibits at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the sequence of nucleotides beginning with residue 3 through residue 1486 of the sequence set forth in SEQ ID NO:3, or one or more exons thereof, or a subsequence thereof.

[0076] In some such embodiments, the additional portion of Cβ is encoded by a sequence of nucleotides that is less than 400, less than 300, less than 250, less than 200, or less than 150 base pairs in length.

[0077] In some embodiments, the additional portion of Cβ is encoded by a sequence of nucleotides encoding fewer than four exons, fewer than three exons, fewer than two exons, one exon, or less than one complete exon of the open reading frame of the TRBC locus. In some embodiments, the additional portion of Cβ is encoded by a portion of exon 1 of the TRBC locus, wherein the portion of exon 1 is shorter than the full length of exon 1 of the open reading frame of the TRBC locus. In some embodiments, the additional portion of the TCR alpha constant domain is encoded by a portion of exon 1 of the TRAC locus, wherein the portion of exon 1 includes a 5' portion of exon 1.

[0078] In some embodiments, the Cβ encoded by the nucleic acid sequence of (a) Further part of and / or Cα region teeth , containing one or more modifications compared to the native Cβ region and / or the native Cα region, optionally one or more amino acid substitutions, deletions, or insertions, and optionally the one or more modifications introduce one or more cysteine ​​residues capable of forming one or more non-native disulfide bridges between the alpha chain and the beta chain.

[0079] In some of any embodiments, the introduction of one or more cysteine ​​residues comprises substitution of a non-cysteine ​​residue with a cysteine ​​residue. In some of any embodiments, the encoded Cα region comprises a cysteine ​​at a position corresponding to position 48 in the numbering as shown in any of SEQ ID NO:24; and / or the encoded Cβ region comprises a cysteine ​​at a position corresponding to position 57 in the numbering as shown in SEQ ID NO:20. In some of any embodiments, the encoded Cβ comprises a sequence selected from any one of SEQ ID NOs:253 and 256-258, or a subsequence thereof. In some of any embodiments, the portion of the TCR β chain comprises a variable beta (Vβ) domain.

[0080] In some embodiments, one or more homology arms contain a 5' homology arm and / or a 3' homology arm. In some embodiments, the 5' homology arm and the 3' homology arm contain nucleic acid sequences homologous to nucleic acid sequences surrounding the target site, and the target site is within the open reading frame of the TRBC locus. In some embodiments, the target site is within exon 1 of the open reading frame of the TRBC locus.

[0081] In some embodiments, the 5' homology arm and the 3' homology arm are independently at least 10, 20, 30, 40, 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1500, or 2000 nucleotides or at least about 10, 20, 30, 40, 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1500, or 2000 nucleotides. 500, or 2000 nucleotides, or less than or about 10, 20, 30, 40, 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1500, or 2000 nucleotides. In some such embodiments, the 5' homology arm and the 3' homology arm are independently 100 to 1000 or about 100 to 1000 nucleotides, 100 to 750 or about 100 to 750 nucleotides, 100 to 600 or about 100 to 600 nucleotides, 100 to 400 or about 100 to 400 nucleotides, 100 to 300 or about 100 to 300 nucleotides, 100 to 200 or about 100 to 200 nucleotides, 200 to 1000 or about 200 to 1000 nucleotides, 200 to 750 or about 200 to 750 nucleotides, 200 to 600 or about 200 to 600 nucleotides, 200 to 400 or about 200 to 400 nucleotides. nucleotides, 200 to 300 or about 200 to 300 nucleotides, 300 to 1000 or about 300 to 1000 nucleotides, 300 to 750 or about 300 to 750 nucleotides, 300 to 600 or about 300 to 600 nucleotides, 300 to 400 or about 300 to 400 nucleotides, 400 to 1000 or about 400 to 1000 nucleotides, 400 to 750 or about 400 to 750 nucleotides, 400 to 600 or about 400 to 600 nucleotides, 600 to 1000 or about 600 to 1000 nucleotides, 600 to 750 or about 600 to 750 nucleotides, or 750 to 1000 or about 750 to 1000 nucleotides in length.In some embodiments, the 5' homology arm and the 3' homology arm are independently 600 nucleotides in length, about 600 nucleotides in length, or less than about 600 nucleotides in length.

[0082] In some of either embodiments, the nucleic acid sequence of (a) is a sequence that is foreign or heterologous to the open reading frame of the endogenous genomic TRAC locus of the T cell, optionally a human T cell. In some of either embodiments, the 5' homology arm and the 3' homology arm are independently at least 10, 20, 30, 40, 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1500, or 2000 nucleotides or at least about 10, 20, 30, 40, 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1500, or 2000 nucleotides. In some embodiments, the length of the nucleic acid sequence is less than or equal to about 10, 20, 30, 40, 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1500, or 2000 nucleotides. In some of either embodiments, the 5' homology arm and the 3' homology arm are independently from 50 or about 50 to 100 or about 100 nucleotides in length, from 100 or about 100 to 250 or about 250 nucleotides in length, from 250 or about 250 to 500 or about 500 nucleotides in length, from 500 or about 500 to 750 or about 750 nucleotides in length, from 750 or about 750 to 1000 or about 1000 nucleotides in length, or from 1000 or about 1000 to 2000 or about 2000 nucleotides in length. In some of either embodiment, the 5' homology arm and the 3' homology arm are independently 200, 300, 400, 500, 600, 700, or 800 nucleotides in length, or about 200, 300, 400, 500, 600, 700, or 800 nucleotides in length, or any value between any of the foregoing.In some of any of the embodiments, the 5' and 3' homology arms are independently greater than or equal to 300 nucleotides in length, and optionally the 5' and 3' homology arms are independently greater than or equal to 400, 500, or 600 nucleotides in length, or about 400, 500, or 600 nucleotides in length, or any value between any of the foregoing. In some of any of such embodiments, the 5' and 3' homology arms are independently greater than or equal to 300 nucleotides in length.

[0083] In some embodiments, the nucleic acid sequence of (a) contains one or more multicistronic elements. In some embodiments, the multicistronic element is located between the nucleic acid sequence encoding TCR alpha or a portion thereof and the nucleic acid sequence encoding TCR beta or a portion thereof. In some embodiments, the one or more multicistronic elements are upstream of the nucleic acid sequence encoding the TCR or a portion of the TCR, or the nucleic acid molecule encoding the TCR. In some embodiments, the multicistronic element is or contains a ribosomal skip sequence, optionally T2A, P2A, E2A, or F2A.

[0084] In some embodiments, the provided polynucleotide further contains one or more heterologous control or regulatory elements. In some embodiments, the nucleic acid sequence of (a) contains one or more heterologous or regulatory elements, such as promoters, enhancers, introns, polyadenylation signals, Kozak consensus sequences, splice acceptor sequences, and / or splice donor sequences, operably linked to regulate the expression of the TCR upon expression from a cell into which the polynucleotide is introduced. In some embodiments, the heterologous control or regulatory element contains a heterologous promoter, such as a heterologous promoter selected from among a constitutive promoter, an inducible promoter, a repressible promoter, and / or a tissue-specific promoter. In some embodiments, the heterologous promoter is or contains the human elongation factor 1 alpha (EF1α) promoter or the MND promoter or a variant thereof.

[0085] Any of the provided polynucleotides can be contained in a viral vector.In some embodiments, the viral vector is an AAV vector, for example, the AAV vector selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7 or AAV8 vector.In some embodiments, the AAV vector is an AAV2 or AAV6 vector.

[0086] In some embodiments, the viral vector is a retroviral vector or a lentiviral vector.

[0087] In some embodiments, the polynucleotide is a linear polynucleotide. In some embodiments, the linear polynucleotide is a double-stranded polynucleotide or a single-stranded polynucleotide.

[0088] In some embodiments, the polynucleotide contains the structure: [5' homology arm]-[nucleic acid sequence of (a)]-[3' homology arm]. In some embodiments, the polynucleotide contains the structure: [5' homology arm]-[multicistronic element]-[nucleic acid sequence of (a)]-[3' homology arm]. In some embodiments, the polynucleotide contains the structure: [5' homology arm]-[promoter]-[nucleic acid sequence of (a)]-[3' homology arm].

[0089] In some embodiments, the recombinant TCR encoded by the polynucleotide is capable of binding to an antigen associated with, specific for, and / or expressed on a cell or tissue that is associated with a disease, disorder, or condition, e.g., an infectious disease or disorder, an autoimmune disease, an inflammatory disease, a tumor, or a cancer.

[0090] In some embodiments, the antigen is a tumor antigen or a pathogenic antigen. In some of these embodiments, the pathogenic antigen is a bacterial antigen or a viral antigen. In some embodiments, the antigen is a viral antigen, optionally derived from hepatitis A, hepatitis B, hepatitis C virus (HCV), human papillomavirus (HPV), hepatitis virus infection, Epstein-Barr virus (EBV), human herpesvirus 8 (HHV-8), human T-cell leukemia virus-1 (HTLV-1), human T-cell leukemia virus-2 (HTLV-2), or cytomegalovirus (CMV). In some embodiments, the antigen is an antigen derived from HPV selected from HPV-16, HPV-18, HPV-31, HPV-33, and HPV-35, for example, an HPV-16 antigen that is HPV-16 E6 or HPV-16 E7 antigen.

[0091] In some embodiments, the viral antigen is an EBV antigen selected from among Epstein-Barr nuclear antigen (EBNA)-1, EBNA-2, EBNA-3A, EBNA-3B, EBNA-3C, EBNA-leader protein (EBNA-LP), latent membrane proteins LMP-1, LMP-2A, and LMP-2B, EBV-EA, EBV-MA, and EBV-VCA. In some embodiments, the viral antigen is an HTLV antigen that is TAX.

[0092] In some embodiments, the viral antigen is an HBV antigen that is hepatitis B core antigen or hepatitis B envelope antigen.

[0093] In some embodiments, the antigen is a tumor antigen, e.g., the antigen is selected from the group consisting of glioma-associated antigen, β-human chorionic gonadotropin, alpha-fetoprotein (AFP), lectin-reactive AFP, thyroglobulin, RAGE-1, MN-CA IX, human telomerase reverse transcriptase, RU1, RU2 (AS), intestinal carboxylesterase, mut hsp70-2, M-CSF, melanin-A / MART-1, WT-1, S-100, MBP, CD63, MUC1 (e.g., MUC1-8), p53, Ras, cyclin B1, HER-2 / neu, carcinoembryonic antigen (CEA), gp100, MAGE-A1, MAGE-A2, MAGE-A3, MAGE-A4, MAGE-A5, MAGE-A6, MAGE-A7, MAGE-A8, MAGE-A9, MAGE-A10, MAGE-A11, MAGE-B1, MAGE-B2, MAGE-B3, MAGE-B4, MAGE-C1, BAGE, GAGE-1, GAGE-2, p15, tyrosinase (e.g., tyrosinase-related protein 1 (TRP-1) or tyrosinase-related protein 1 (TRP-2)), and other proteins. TRP-2), β-catenin, NY-ESO-1, LAGE-1a, PP1, MDM2, MDM4, EGVFvIII, Tax, SSX2, telomerase, TARP, pp65, CDK4, vimentin, S100, eIF-4A1, IFN-inducible p78, melanotransferrin (p97), uroplakin II, prostate-specific antigen (PSA), human kallikrein (huK2), prostate-specific membrane antigen (PSM), and prostatic acid phosphatase (PAP), neutrophil elastase, ephrin B2, BA-46, Bcr-abl, E2A-PRL, H4-RET, IGH-IGK, MYL-RAR, caspase 8, FRa, CD24, CD44, CD133, CD 166, epCAM, CA-125, HE4, Oval, estrogen receptor, progesterone receptor, uPA, PAI-1, CD19, CD20, CD22, ROR1, CD33 / IL3Ra, c-Met, PSMA, glycolipid F77, GD-2, insulin growth factor (IGF)-I, IGF-II, IGF-I receptor, and mesothelin.

[0094] In some of either embodiments, the polynucleotides provided are at least 2500, 2750, 3000, 3250, 3500, 3750, 4000, 4250, 4500, 4760, 5000, 5250, 5500, 5750, 6000, 7000, 7500, 8000, 9000, or 10000 nucleotides in length, or at least about 2500, 2750, 3000, 3250, 3500, 3750, 4000, 4250, 4500, 4760, 5000, 5250, 5500, 5750, 6000, 7000, 7500, 8000, 9000, or 10000 nucleotides in length, or any value between any of the foregoing. In some of either embodiment, the polynucleotide is from at or about 2500 to at or about 5000 nucleotides, from at or about 3500 to at or about 4500 nucleotides, or from at or about 3750 to at or about 4250 nucleotides in length.

[0095] In some embodiments, provided herein are methods of generating engineered T cells containing a modified TRAC locus, comprising introducing any of the provided nucleotides into a T cell containing a gene disruption in the TRAC locus.

[0096] In some embodiments, provided herein are methods of generating a genetically engineered T cell containing a modified T cell receptor alpha constant (TRAC) locus, comprising the steps of: (a) introducing into a T cell one or more agents capable of inducing a gene disruption at a target site within the T cell's endogenous T cell receptor alpha (TRAC) locus; and (b) introducing into the T cell a polynucleotide containing a transgene encoding a T cell receptor beta (TCRβ) chain and a portion of the T cell receptor alpha (TCRα) chain that is shorter than the full-length native T cell receptor alpha (TCRα) chain, wherein the transgene is targeted for integration into the endogenous TRAC locus via homology-directed repair (HDR), thereby generating a genetically engineered T cell containing a modified TRAC locus.

[0097] In some embodiments, introduction of the template polynucleotide is performed after introduction of one or more agents capable of inducing gene disruption.

[0098] Also provided herein are methods, such as methods for producing genetically engineered T cells. In some embodiments, provided are methods for producing genetically engineered T cells that comprise a modified TRAC locus, comprising: (a) introducing into a T cell one or more agents that can induce gene disruption at a target site within the endogenous T cell receptor alpha constant (TRAC) locus of the T cell; and (b) introducing into the T cell a polynucleotide that comprises a transgene sequence encoding a T cell receptor beta (TCRβ) and a portion of a T cell receptor alpha (TCRα) chain that is shorter than the full-length natural T cell receptor alpha (TCRα) chain; wherein the transgene is targeted for integration into the endogenous TRAC locus via homology-directed repair (HDR), thereby producing a genetically engineered cell that comprises a modified TRAC locus. In some of any such embodiments, upon targeted integration of the transgene: a portion of Cα is encoded by an open reading frame of the endogenous TRAC locus or a subsequence thereof, and an additional portion of Cα is encoded by the transgene sequence, the additional portion of Cα being shorter than the full length of native Cα; and Further part of and / or Cβ region teeth In some embodiments, the recombinant TCR comprises one or more non-native cysteines.

[0099] Also provided is a method of producing a genetically engineered T cell comprising a modified T cell receptor alpha constant (TRAC) locus, comprising introducing into a T cell having a gene disruption within the T cell's endogenous TRAC locus a polynucleotide comprising a transgene sequence encoding a T cell receptor beta (TCRβ) chain and a portion of the T cell receptor alpha (TCRα) chain; wherein the transgene is targeted for integration within the endogenous TRAC locus via homology directed repair (HDR), thereby producing a genetically engineered T cell comprising a modified TRAC locus, wherein upon targeted integration of the transgene: a portion of Cα is encoded by the open reading frame of the endogenous TRAC locus or a subsequence thereof, and a further portion of Cα is encoded by the transgene sequence, wherein the further portion of Cα is shorter than the full length of a native Cα; and Further part of and / or Cβ region but The method also provides a recombinant TCR comprising one or more modifications compared to a native Cα region and / or a native Cβ region, wherein the one or more modifications introduce one or more cysteine ​​residues capable of forming one or more non-native disulfide bridges between the alpha and beta chains, and / or wherein the Cα and / or Cβ of the recombinant TCR comprise one or more non-native cysteines.

[0100] In some embodiments, provided herein is a method for producing a genetically engineered T cell containing a modified T cell receptor alpha constant (TRAC) locus, comprising introducing a polynucleotide containing a transgene encoding a T cell receptor beta (TCRβ) chain and a portion of the T cell receptor alpha (TCRα) chain into a T cell having a gene disruption in the endogenous T cell receptor alpha constant (TRAC) locus, wherein the transgene is targeted for integration into the endogenous TRAC locus via homology-directed repair (HDR), thereby producing a genetically engineered cell containing a modified TRAC locus. In some such embodiments, the gene disruption is induced by one or more agents capable of inducing gene disruption at one or more target sites in the endogenous TRAC locus.

[0101] In some embodiments of the provided methods, the polynucleotide is derived from any of the polynucleotides provided herein.

[0102] In some embodiments of the provided methods, the modified TRAC locus contains a nucleic acid sequence encoding a recombinant TCR or a portion thereof, the nucleic acid sequence containing an in-frame fusion of (i) a transgene sequence and (ii) an open reading frame or a subsequence thereof of the endogenous TRAC locus. In some embodiments, the transgene sequence does not contain a sequence encoding a 3' untranslated region (3' UTR) or an intron. In some embodiments, the open reading frame or a subsequence thereof contains the 3' UTR of the endogenous TRAC locus. In some embodiments, the transgene sequence is in-frame with one or more exons or a subsequence thereof of the open reading frame of the endogenous TRAC locus.

[0103] In some embodiments, a portion of Cα is encoded by the open reading frame of the endogenous TRAC locus or a subsequence thereof, and a further portion of Cα is encoded by a transgene sequence, wherein the further portion of Cα is shorter than the full length of the native Cα. In some embodiments, the open reading frame or subsequence thereof contains at least one intron and at least one exon of the endogenous TRAC locus. In some embodiments, the transgene sequence is in frame with one or more exons or a subsequence thereof of the open reading frame of the endogenous TRAC locus. In some embodiments, the transgene sequence is integrated or has been integrated downstream of the 5'-most nucleotide of exon 1 and upstream of the 3'-most nucleotide of exon 1 of the open reading frame of the endogenous TRAC locus. In some embodiments, at least a portion of Cα is encoded by at least exons 2-4 of the open reading frame of the endogenous TRAC locus.

[0104] In some embodiments of the provided methods, the encoded Cα contains a sequence selected from any one of SEQ ID NOs: 14, 15, 19, or 24, or a sequence that exhibits at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to any one of SEQ ID NOs: 14, 15, 19, or 24, or a subsequence thereof. In some embodiments, a further portion of the Cα contains a sequence set forth in SEQ ID NO: 142, or a sequence that exhibits at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to SEQ ID NO: 142, or a subsequence thereof.

[0105] In some embodiments of the provided methods, the engineered T cells further comprise inducing a gene disruption at the TRBC locus. In some embodiments, the engineered T cells comprise a gene disruption at the TRBC1 locus and / or the TRBC2 locus.

[0106] In some embodiments, provided herein is a method for producing a genetically engineered T cell containing a modified TRBC locus, comprising introducing any of the polynucleotides provided herein into a T cell containing a gene disruption in the TRBC locus.

[0107] In some embodiments, provided herein is a method for generating a genetically engineered T cell containing a modified TRBC locus, comprising: (a) introducing into a T cell one or more agents capable of inducing a gene disruption at a target site within the T cell's endogenous T cell receptor beta (TRBC) locus; and (b) introducing into the T cell a polynucleotide containing a transgene encoding a T cell receptor alpha (TCRα) chain and a portion of the T cell receptor beta (TCRβ) chain that is shorter than the full-length native T cell receptor beta (TCRβ) chain, wherein the transgene is targeted for integration into the endogenous TRBC locus via homology-directed repair (HDR), thereby generating a genetically engineered T cell containing a modified TRBC locus.

[0108] In some embodiments, a method for producing a genetically engineered T cell containing a modified TRBC locus is provided herein, comprising introducing a polynucleotide containing a transgene encoding a T cell receptor alpha (TCRα) chain and a portion of a T cell receptor beta (TCRβ) chain into a T cell having a gene disruption in the endogenous T cell receptor beta (TRBC) locus of the T cell, wherein the transgene is targeted for integration into the endogenous TRBC locus via homology-directed repair (HDR), thereby producing a genetically engineered cell containing a modified TRBC locus. In some such embodiments, the gene disruption is induced by one or more agents capable of inducing gene disruption at one or more target sites in the endogenous TRBC locus. In some embodiments, the transgene sequence is in-frame with one or more exons or subsequences of the open reading frame of the endogenous TRBC locus. In some embodiments, the TRBC locus is the TRBC1 locus and / or the TRBC2 locus.

[0109] In some embodiments, the polynucleotide is any of the polynucleotides provided herein.

[0110] In some embodiments of the provided methods, the modified TRBC locus contains a nucleic acid sequence encoding a recombinant TCR or a portion thereof, the nucleic acid sequence containing an in-frame fusion of (i) a transgene sequence and (ii) an open reading frame or a subsequence thereof of the endogenous TRBC locus. In some embodiments, the transgene sequence does not contain a sequence encoding a 3' untranslated region (3' UTR) or an intron. In some embodiments, the open reading frame or a subsequence thereof contains the 3' UTR of the endogenous TRBC locus. In some embodiments, a portion of Cβ is encoded by the open reading frame or a subsequence thereof of the endogenous TRBC locus, and a further portion of Cβ is encoded by the transgene sequence, the further portion of Cβ being shorter than the full length of native Cβ.

[0111] In some embodiments, the open reading frame or a subsequence thereof contains at least one intron and at least one exon of the endogenous TRBC locus. In some embodiments, the transgene sequence is in frame with one or more exons or a subsequence thereof of the open reading frame of the endogenous TRBC locus. In some embodiments, the transgene sequence is integrated or has been integrated downstream of the 5'-most nucleotide of exon 1 and upstream of the 3'-most nucleotide of exon 1 of the open reading frame of the endogenous TRBC locus.

[0112] In some embodiments of the provided methods, at least a portion of Cβ is encoded by at least exons 2-4 of the open reading frame of the endogenous TRBC locus. In some embodiments, the encoded Cβ contains a sequence selected from any one of SEQ ID NOs: 16, 17, 20, 21, or 25, or a sequence exhibiting at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to SEQ ID NOs: 16, 17, 20, 21, or 25, or a subsequence thereof.

[0113] In some embodiments of the provided methods, the engineered T cells further comprise inducing a gene disruption at the TRAC locus.

[0114] In some embodiments of the provided methods, one or more agents capable of inducing gene disruption contain a DNA-binding protein or a DNA-binding nucleic acid that specifically binds to or hybridizes with a target site. In some embodiments, one or more agents capable of inducing gene disruption contain (a) a fusion protein containing a DNA targeting protein and a nuclease, or (b) an RNA-guided nuclease. In some of these embodiments, the DNA targeting protein or the RNA-guided nuclease contains a zinc finger protein (ZFP), a TAL protein, or a clustered regularly interspaced short palindromic nucleic acid (CRISPR)-associated nuclease (Cas) that is specific to the target site. In some embodiments, one or more agents contain a zinc finger nuclease (ZFN), a TAL effector nuclease (TALEN), or a combination of CRISPR-Cas9 that specifically binds to, recognizes, or hybridizes with a target site.

[0115] In some embodiments, each of the one or more agents contains a guide RNA (gRNA) with a targeting domain that is complementary to at least one target site.In some embodiments, the one or more agents are introduced as a ribonucleoprotein (RNP) complex that contains gRNA and Cas9 protein.In some embodiments, the RNP is introduced via electroporation, particle gun, calcium phosphate transfection, cell compression or squeezing.

[0116] In some embodiments, the one or more agents are introduced as one or more polynucleotides encoding a gRNA and / or a Cas9 protein. is complementary to a target site in the TRAC locus, and A targeting domain containing a sequence selected from TIFF0007630280000001.tif150165. In some embodiments, the gRNA has a targeting domain containing the sequence GAGAAUCAAAAUCGGUGAAU (SEQ ID NO:31).

[0117] In some embodiments, the gRNA comprises: is complementary to a target site in one or both of the TRBC1 and TRBC2 genes; and A targeting domain containing a sequence selected from TIFF0007630280000002.tif128163TIFF0007630280000003.tif150167 In some embodiments, the gRNA has the sequence It has a targeting domain containing TIFF0007630280000004.tif4128.

[0118] In some of any of the embodiments, the T cells are primary T cells from the subject. In some of any of the embodiments, the subject has or is suspected of having a disease or disorder. In some of any of the embodiments, the subject is or is suspected of being healthy.

[0119] In some embodiments of the method, the T cells are CD8+ T cells or subtypes thereof, or CD4+ T cells or subtypes thereof. In some embodiments, the T cells are derived from multipotent or pluripotent cells, optionally iPSCs. In some embodiments of the method, the T cells are autologous to the subject or allogeneic to the subject.

[0120] In some embodiments of the method, the polynucleotide and / or one or more polynucleotides encoding gRNA and / or Cas9 protein are contained in one or more vectors, which are optionally viral vectors, for example, AAV vectors.In some embodiments, the AAV vector is selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7 or AAV8 vectors, for example, AAV2 or AAV6 vectors.In some embodiments, the viral vector is a retroviral vector or a lentiviral vector.

[0121] In some embodiments of the methods, the polynucleotide is a linear polynucleotide, eg, a double-stranded polynucleotide or a single-stranded polynucleotide.

[0122] In some embodiments of the provided method, the introduction of one or more agents capable of inducing gene disruption and the introduction of template polynucleotide are carried out simultaneously or sequentially, in any order.In some embodiments, the introduction of template polynucleotide is carried out after the introduction of one or more agents capable of inducing gene disruption.In some embodiments, the introduction of template polynucleotide is carried out immediately after the introduction of one or more agents capable of inducing gene disruption, or within about 30 seconds, 1 minute, 2 minutes, 3 minutes, 4 minutes, 5 minutes, 6 minutes, 6 minutes, 8 minutes, 9 minutes, 10 minutes, 15 minutes, 20 minutes, 30 minutes, 40 minutes, 50 minutes, 60 minutes, 90 minutes, 2 hours, 3 hours, or 4 hours.

[0123] In some embodiments, provided herein is an engineered T cell or a plurality of engineered T cells generated using any of the methods provided herein.

[0124] In some embodiments, provided herein are compositions containing the engineered T cells or a plurality of engineered cells provided herein. In some embodiments, the provided compositions contain CD4+ T cells and / or CD8+ T cells. In some embodiments, the compositions contain CD4+ T cells and CD8+ T cells, and the ratio of CD4+ T cells to CD8+ T cells is 1:3 to 3:1 or about 1:3 to 3:1, optionally 1:1.

[0125] In some embodiments of the provided compositions, at least 70%, 75%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of the engineered cells in the composition contain a gene disruption in or of an endogenous T cell receptor alpha constant region (TRAC) gene and / or T cell receptor beta constant region (TRBC) gene; and / or at least 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of the engineered cells in the composition do not express, or do not express at detectable levels, the gene product of the endogenous TRAC or TRBC gene.

[0126] In some embodiments of the provided compositions, at least 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, or 90% of the cells in the composition express a recombinant TCR and / or exhibit antigen binding (e.g., exhibit binding to an antigen).

[0127] In some embodiments, provided herein are methods of treatment comprising administering to a subject any of the engineered cells, multiple engineered cells, or compositions provided herein.

[0128] In some embodiments, provided herein is the use of any of the engineered cells, plurality of engineered cells, or compositions provided herein for the treatment of a disease or disorder.

[0129] In some embodiments, provided herein is the use of any of the engineered cells, plurality of engineered cells, or compositions provided herein in the manufacture of a medicament for treating a disease or disorder.

[0130] In some embodiments, provided herein is an engineered cell, a plurality of engineered cells, or a composition of any of the engineered cells, a plurality of engineered cells, or a composition provided herein for use in treating a disease or disorder.

[0131] In some embodiments, provided herein are articles of manufacture or kits containing the polynucleotides provided herein and one or more agents capable of inducing gene disruption at a target site within the TRAC locus.

[0132] In some embodiments, provided herein is an article of manufacture or kit containing: (a) a polynucleotide containing a nucleic acid sequence encoding a T cell receptor beta (TCRβ) chain and a portion of a T cell receptor alpha (TCRα) chain that is shorter than the full-length native T cell receptor alpha (TCRα) chain; and (b) one or more homology arms linked to the nucleic acid sequence, the nucleic acid sequence containing a sequence homologous to one or more regions of the open reading frame of the TRAC locus that encodes the TCRα chain; and one or more agents capable of inducing gene disruption at a target site within the TRAC locus. In some of these embodiments, the polynucleotide is a polynucleotide provided herein.

[0133] In some embodiments, provided herein are articles of manufacture containing the polynucleotides provided herein and one or more agents capable of inducing gene disruption at a target site within the TRBC locus.

[0134] In some embodiments, the present disclosure provides a product comprising: (a) a polynucleotide comprising a nucleic acid sequence encoding a T cell receptor alpha (TCRα) chain and a portion of a T cell receptor beta (TCRβ) chain that is shorter than the full-length natural T cell receptor beta (TCRβ) chain; and (b) one or more homology arms linked to the nucleic acid sequence, the nucleic acid sequence comprising a sequence homologous to one or more regions of the open reading frame of the TRBC locus encoding the TCRβ chain; and one or more agents capable of inducing gene disruption at target site in the TRAC locus.In some embodiments, the TRBC locus is TRBC1 and / or TRBC2.In some embodiments, the polynucleotide is selected from the polynucleotides provided herein.

[0135] In some embodiments, one or more agents capable of inducing gene disruption contain DNA binding proteins or DNA binding nucleic acids that specifically bind or hybridize to target sites.In some embodiments, one or more agents capable of inducing gene disruption contain (a) a fusion protein that contains a DNA targeting protein and a nuclease, or (b) an RNA-guided nuclease.In some of these embodiments, the DNA targeting protein or the RNA-guided nuclease contains a zinc finger protein (ZFP), a TAL protein, or a clustered regularly interspaced short palindromic nucleic acid (CRISPR)-associated nuclease (Cas) that is specific to the target site.In some embodiments, one or more agents contain a zinc finger nuclease (ZFN), a TAL effector nuclease (TALEN), or a combination of CRISPR-Cas9 that specifically binds, recognizes, or hybridizes to target sites.

[0136] In some embodiments, each of the one or more agents contains a guide RNA (gRNA) with a targeting domain that is complementary to at least one target site.In some embodiments, the one or more agents are introduced as a ribonucleoprotein (RNP) complex that contains gRNA and Cas9 protein.In some embodiments, the RNP is introduced via electroporation, particle gun, calcium phosphate transfection, cell compression or squeezing.

[0137] In some embodiments, the one or more agents are introduced as one or more polynucleotides encoding a gRNA and / or a Cas9 protein. is complementary to a target site in the TRAC locus, and A targeting domain containing a sequence selected from TIFF0007630280000005.tif149165. In some embodiments, the gRNA has the sequence It has a targeting domain containing TIFF0007630280000006.tif4128.

[0138] In some embodiments, the gRNA comprises: is complementary to a target site in one or both of the TRBC1 and TRBC2 genes; and A targeting domain containing a sequence selected from TIFF0007630280000007.tif150163 and TIFF0007630280000008.tif128164. In some embodiments, the gRNA has the sequence It has a targeting domain containing TIFF0007630280000009.tif4128.

[0139] In some embodiments, the present invention provides a kit that includes the article of manufacture provided herein and instructions for use.In some of these embodiments, the instructions specify that one or more agents and polynucleotides are introduced into cells.In some embodiments, the instructions specify that one or more agents and polynucleotides are introduced simultaneously or sequentially, in any order.In some embodiments, the instructions specify that the introduction of polynucleotides is carried out after the introduction of one or more agents.In some of these embodiments, the instructions specify that the polynucleotides are introduced immediately after the introduction of one or more agents that can induce gene disruption, or within about 30 seconds, 1 minute, 2 minutes, 3 minutes, 4 minutes, 5 minutes, 6 minutes, 6 minutes, 8 minutes, 9 minutes, 10 minutes, 15 minutes, 20 minutes, 30 minutes, 40 minutes, 50 minutes, 60 minutes, 90 minutes, 2 hours, 3 hours, or 4 hours thereafter.

[0140] In some of any such embodiments, the polynucleotide is introduced 2 hours or about 2 hours after the introduction of the one or more agents.

[0141] In some of any embodiments, the method is performed on a plurality of T cells. In some of any embodiments, the plurality of T cells comprises CD4+ T cells, CD8+ T cells, or CD4+ T cells and CD8+ T cells. In some of any embodiments, the plurality of T cells comprises CD4+ T cells and CD8+ T cells, and the ratio of CD4+ T cells to CD8+ T cells is from at or about 1:3 to 3:1 or about 3:1, optionally from 1:2 or about 1:2 to 2:1 or about 2:1, optionally 1:1 or about 1:1.

[0142] In some of any of the embodiments, prior to the introduction of the one or more agents, the method includes incubating the cells in vitro with a stimulatory agent under conditions to stimulate or activate the one or more T cells. In some of any of the embodiments, the stimulatory agent includes anti-CD3 and / or anti-CD28 antibodies, optionally anti-CD3 / anti-CD28 beads, optionally with a bead-to-cell ratio of 1:1 or about 1:1. In some of any of the embodiments, the method includes removing the stimulatory agent from the one or more immune cells prior to introducing the one or more agents.

[0143] In some of any of the embodiments, the method further comprises incubating the cells with one or more recombinant cytokines before, during, or after the introduction of the one or more agents and / or the introduction of the template polynucleotide, optionally wherein the one or more recombinant cytokines are selected from the group consisting of IL-2, IL-7, and IL-15.

[0144] In some of any of the embodiments, the one or more recombinant cytokines are added at a concentration selected from: IL-2 at a concentration of from at or about 10 U / mL to at or about 200 U / mL, optionally from at or about 50 IU / mL to at or about 100 U / mL; IL-7 at a concentration of from 0.5 ng / mL to 50 ng / mL, optionally from at or about 5 ng / mL to at or about 10 ng / mL; and / or IL-15 at a concentration of from 0.1 ng / mL to 20 ng / mL, optionally from at or about 0.5 ng / mL to at or about 5 ng / mL.

[0145] In some of either embodiments, incubation is carried out for up to or approximately 24 hours, 36 hours, 48 ​​hours, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 days after introduction of the one or more agents and introduction of the template polynucleotide, optionally up to or about 7 days.

[0146] In some of either embodiments, the polynucleotide is at least 2500, 2750, 3000, 3250, 3500, 3750, 4000, 4250, 4500, 4760, 5000, 5250, 5500, 5750, 6000, 7000, 7500, 8000, 9000, or 10000 nucleotides in length, or at least about 2500, 2750, 3000, 3250, 3500, 3750, 4000, 4250, 4500, 4760, 5000, 5250, 5500, 5750, 6000, 7000, 7500, 8000, 9000, or 10000 nucleotides in length, or any value in between any of the foregoing.

[0147] In some of either embodiment, the polynucleotide is from 2500 or about 2500 nucleotides to 5000 or about 5000 nucleotides, from 3500 or about 3500 nucleotides to 4500 or about 4500 nucleotides, or from 3750 or about 3750 nucleotides to 4250 or about 4250 nucleotides in length.

[0148] Also provided are cells produced using any of the methods described herein. In some aspects, compositions comprising such cells are also provided. Kits and articles of manufacture for use in practicing any of the methods provided herein are also provided. Also provided are methods of treatment and therapeutic uses, for example, in the treatment of a disease or disorder, comprising administering any of the cells or cell-containing compositions described herein. [The present invention 1001] A genetically engineered T cell comprising a modified T cell receptor alpha constant (TRAC) locus, wherein the modified TRAC locus comprises a nucleic acid encoding a recombinant TCR or a portion thereof, the recombinant TCR or portion thereof comprising (i) a TCR alpha (TCRα) chain comprising a variable alpha (Vα) domain and a constant alpha (Cα) domain, and (ii) a TCR beta (TCRβ) chain comprising a variable beta (Vβ) domain and a constant beta (Cβ) domain, wherein the nucleic acid sequence comprises (a) a transgene sequence encoding the TCRβ and Vα domains, and (b) an open reading frame of an endogenous TRAC locus encoding at least a portion of the Cα domain of the recombinant TCR, or a subsequence thereof. [The present invention 1002] A genetically engineered T cell comprising a modified T cell receptor alpha constant (TRAC) locus, wherein the modified TRAC locus comprises a nucleic acid encoding a recombinant TCR or a portion thereof, the recombinant TCR or portion thereof comprising (i) a TCR alpha (TCRα) chain comprising a variable alpha (Vα) domain and a constant alpha (Cα) domain, and (ii) a TCR beta (TCRβ) chain comprising a variable beta (Vβ) domain and a constant beta (Cβ) domain, the nucleic acid sequence comprising (a) a transgene sequence encoding the TCRβ and Vα domains, and (b) an open reading frame of an endogenous TRAC locus encoding at least a portion of the Cα domain of the recombinant TCR, or a subsequence thereof; a portion of the Cα is encoded by an open reading frame of the endogenous TRAC locus or a subsequence thereof, and an additional portion of the Cα is encoded by a transgene sequence, the additional portion of the Cα being shorter than the full length of a native Cα; and the further portion of the Cα and / or Cβ region encoded by the nucleic acid sequence of (a) comprises one or more modifications compared to the native Cα region and / or the native Cβ region, wherein the one or more modifications introduce one or more cysteine ​​residues capable of forming one or more non-native disulfide bridges between the alpha and beta chains, and / or the Cα and / or Cβ of the recombinant TCR comprises one or more non-native cysteines; The genetically engineered T cells. [The present invention 1003] 1. A genetically engineered T cell comprising a modified T cell receptor alpha constant (TRAC) locus, wherein the modified TRAC locus comprises a nucleic acid encoding a recombinant TCR or a portion thereof, wherein the recombinant TCR or portion thereof comprises (i) a TCR alpha (TCRα) chain comprising a variable alpha (Vα) domain and a constant alpha (Cα) domain, and (ii) a TCR beta (TCRβ) chain comprising a variable beta (Vβ) domain and a constant beta (Cβ) domain, wherein the nucleic acid sequence comprises (a) a transgene sequence encoding the TCRβ and Vα domains, and (b) an open reading frame of the endogenous TRAC locus encoding at least a portion of the Cα domain of the recombinant TCR, or a subsequence thereof, wherein the transgene sequence comprises one or more heterologous or regulatory regulatory elements, including a heterologous promoter, operably linked to regulate expression of the TCR upon expression from the genetically engineered T cell. [The present invention 1004] 1004. The genetically engineered T cell of any of claims 1001 to 1003, wherein the transgene sequence is integrated via homologous recombination repair (HDR). [The present invention 1005] The genetically engineered T cell of any of claims 1001 to 1004, wherein the modified TRAC locus comprises an in-frame fusion of (i) an introduced gene sequence and (ii) an open reading frame or subsequence thereof of the endogenous TRAC locus, and optionally, the introduced gene sequence is in-frame with one or more exons of the open reading frame of the endogenous TRAC locus or a subsequence thereof. [The present invention 1006] 1006. The genetically engineered T cell of any of claims 1001 to 1005, wherein the transgene sequence does not comprise a 3' untranslated region (3' UTR) or a sequence encoding an intron. [The present invention 1007] The genetically engineered T cell of any of claims 1001 and 1003 to 1006, wherein a portion of Cα is encoded by an open reading frame of the endogenous TRAC locus or a partial sequence thereof, and a further portion of Cα is encoded by an introduced gene sequence, and the further portion of Cα is shorter than the full length of native Cα. [The present invention 1008] 8. The genetically engineered T cell of any of claims 1001 to 1007, wherein the open reading frame or a subsequence thereof comprises at least one intron and at least one exon of the endogenous TRAC locus. [The present invention 1009] The genetically engineered T cell of any of claims 1002, 1007, and 1008, wherein a further portion of Cα is encoded by a sequence of nucleotides comprising fewer than four exons, fewer than three exons, fewer than two exons, one exon, or less than one complete exon of the open reading frame of the TRAC locus. [The present invention 1010] The genetically engineered T cell of any of 1002 and 1007 to 1009, wherein a further portion of Cα is encoded by a sequence of nucleotides that is less than 400, less than 300, less than 250, less than 200, or less than 150 base pairs in length. [The present invention 1011] The genetically engineered T cell of any of 1002 and 1007 to 1010, wherein a further portion of Cα is encoded by a portion of exon 1 of the TRAC locus, and the portion of exon 1 is shorter than the full length of exon 1 of the open reading frame of the TRAC locus. [The present invention 1012] 10. The genetically engineered T cell of any of claims 1001 to 1011, wherein the introduced gene sequence is integrated downstream of the 5'-most nucleotide of exon 1 and upstream of the 3'-most nucleotide of exon 1 of the open reading frame of the endogenous TRAC locus. [The present invention 1013] The genetically engineered T cell of any of claims 1001 to 1002, wherein at least a portion of Cα is encoded by at least a portion of exon 1 and exons 2 to 4 of the open reading frame of the endogenous TRAC locus. [The present invention 1014] 10. The genetically engineered T cell of any of claims 1001 to 1013, wherein the encoded TCR α chain is capable of dimerizing with a TCR β chain. [The present invention 1015] The genetically engineered T cell of any of claims 1001 to 1014, wherein the encoded Cα comprises a sequence selected from any one of SEQ ID NOs: 14, 15, 19, and 24, or a sequence that exhibits at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to any one of SEQ ID NOs: 14, 15, 19, and 24, or a subsequence thereof. [The present invention 1016] 15. The genetically engineered T cell of any of claims 1001 to 1014, wherein the encoded Cα comprises a sequence selected from any one of SEQ ID NOs: 19, 24, and 243-252, or a sequence that exhibits at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to any one of SEQ ID NOs: 19, 24, and 243-252, or a subsequence thereof. [The present invention 1017] At least a portion of Cα the sequence of nucleotides beginning at residue 3 through residue 3155 of the sequence set forth in SEQ ID NO:1, or one or more exons thereof, or a sequence that exhibits at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the sequence of nucleotides beginning at residue 3 through residue 3155 of the sequence set forth in SEQ ID NO:1, or one or more exons thereof, or a subsequence thereof The genetically engineered T cell of any of 1002 and 1007 to 1016, wherein the T cell is encoded by [The present invention 1018] The genetically engineered T cell of any of claims 1002 and 1007 to 1017, wherein a further portion of Cα comprises the sequence set forth in SEQ ID NO: 142, or a sequence that exhibits at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to SEQ ID NO: 142, or a subsequence thereof. [The present invention 1019] The genetically engineered T cell of any of claims 1007 to 1018, wherein the further portion of the Cα and / or Cβ region encoded by the nucleic acid sequence of (a) comprises one or more modifications, optionally one or more amino acid substitutions, deletions, or insertions, compared to the native Cα region and / or native Cβ region, and optionally the one or more modifications introduce one or more cysteine ​​residues capable of forming one or more non-native disulfide bridges between the alpha chain and the beta chain, and / or the Cα and / or Cβ of the recombinant TCR comprises one or more non-native cysteines. [The present invention 1020] 10. The genetically engineered T cell of claim 1002 or claim 1019, wherein the introduction of one or more cysteine ​​residues comprises substitution of a non-cysteine ​​residue with a cysteine ​​residue. [The present invention 1021] The genetically engineered T cell of any of claims 1002, 1019, and 1020, wherein the encoded Cα region contains a cysteine ​​at a position corresponding to position 48 in the numbering as shown in any of SEQ ID NOs:24; and / or the encoded Cβ region contains a cysteine ​​at a position corresponding to position 57 in the numbering as shown in SEQ ID NO:20. [The present invention 1022] The genetically engineered T cell of any of 1002 and 1019 to 1021, wherein the encoded Cα comprises a sequence selected from any one of SEQ ID NOs: 248 to 252, or a subsequence thereof. [The present invention 1023] The genetically engineered T cell of any of claims 1001 to 1022, further comprising a gene disruption at the TRBC locus. [The present invention 1024] A genetically engineered T cell comprising a modified T cell receptor beta constant (TRBC) locus, wherein the modified TRBC locus comprises a nucleic acid encoding a recombinant TCR or a portion thereof, the recombinant TCR or portion thereof comprising (i) a TCR beta (TCRβ) chain comprising a variable beta (Vβ) domain and a constant beta (Cβ) domain, and (ii) a TCR alpha (TCRα) chain comprising a variable alpha (Vα) domain and a constant alpha (Cα) domain, and the nucleic acid sequence comprises (a) a transgene sequence encoding the TCRα and Vβ domains, and (b) an open reading frame of an endogenous TRBC locus encoding at least a portion of the Cβ domain of the recombinant TCR, or a subsequence thereof. [The present invention 1025] A genetically engineered T cell comprising a modified T cell receptor beta constant (TRBC) locus, wherein the modified TRBC locus comprises a nucleic acid encoding a recombinant TCR or a portion thereof, the recombinant TCR or portion thereof comprising (i) a TCR beta (TCRβ) chain comprising a variable beta (Vβ) domain and a constant beta (Cβ) domain, and (ii) a TCR alpha (TCRα) chain comprising a variable alpha (Vα) domain and a constant alpha (Cα) domain, the nucleic acid sequence comprising (a) a transgene sequence encoding the TCRα and Vβ domains, and (b) an open reading frame of an endogenous TRBC locus encoding at least a portion of the Cβ domain of the recombinant TCR, or a subsequence thereof; a portion of Cβ is encoded by an open reading frame of an endogenous TRBC locus or a subsequence thereof, and a further portion of Cβ is encoded by a transgene sequence, the further portion of Cβ being shorter than the full length of native Cβ; and the further portion of Cβ and / or Cα region encoded by the nucleic acid sequence of (a) comprises one or more modifications, optionally one or more amino acid substitutions, deletions, or insertions, compared to the native Cβ region and / or native Cα region, and optionally the one or more modifications introduce one or more cysteine ​​residues capable of forming one or more non-native disulfide bridges between the alpha and beta chains; The genetically engineered T cells. [The present invention 1026] 1026. The genetically engineered T cell of claim 1024 or 1025, wherein the transgene sequence is integrated via homology directed repair (HDR). [The present invention 1027] The genetically engineered T cell of any of claims 1024 to 1026, wherein the TRBC locus is the TRBC1 locus and / or the TRBC2 locus. [The present invention 1028] The genetically engineered T cell of any of claims 1024 to 1027, wherein the modified TRBC locus comprises an in-frame fusion of (i) a transgene and (ii) an open reading frame or a subsequence thereof of the endogenous TRBC locus, and optionally, the transgene sequence is in-frame with one or more exons of the open reading frame of the endogenous TRBC locus or a subsequence thereof. [The present invention 1029] 1029. The genetically engineered T cell of any of claims 1024 to 1028, wherein the transgene sequence does not comprise a 3' untranslated region (3' UTR) or a sequence encoding an intron. [The present invention 1030] The genetically engineered T cell of any of 1024 and 1026 to 1029, wherein a portion of Cβ is encoded by an open reading frame of an endogenous TRBC locus or a partial sequence thereof, and a further portion of Cβ is encoded by an introduced gene sequence, and the further portion of Cβ is shorter than the full length of native Cβ. [The present invention 1031] The genetically engineered T cell of any of claims 1024 to 1030, wherein the open reading frame or a subsequence thereof comprises at least one intron and at least one exon of the endogenous TRBC locus. [The present invention 1032] The genetically engineered T cell of any of claims 1025, 1030, and 1031, wherein a further portion of Cβ is encoded by a sequence of nucleotides comprising fewer than four exons, fewer than three exons, fewer than two exons, one exon, or less than one complete exon of the open reading frame of the TRBC locus. [The present invention 1033] The genetically engineered T cell of any of 1025 and 1030 to 1032, wherein a further portion of Cβ is encoded by a sequence of nucleotides that is less than 400, less than 300, less than 250, less than 200, or less than 150 base pairs in length. [The present invention 1034] The genetically engineered T cell of any of 1025 and 1030 to 1033 of the present invention, wherein a further portion of Cβ is encoded by a portion of exon 1 of the TRBC locus, and the portion of exon 1 is shorter than the full length of exon 1 of the open reading frame of the TRBC locus. [This invention 1035] The genetically engineered T cell of any of claims 1024 to 1034, wherein the transgene sequence is integrated downstream of the 5'-most nucleotide of exon 1 and upstream of the 3'-most nucleotide of exon 1 of the open reading frame of the endogenous TRBC locus. [The present invention 1036] The genetically engineered T cell of any of claims 1024 to 1035, wherein at least a portion of Cβ is encoded by at least a portion of exon 1 and exons 2 to 4 of the open reading frame of the endogenous TRBC locus. [This invention 1037] 1036. The genetically engineered T cell of any of claims 1024 to 1036, wherein the encoded TCR β chain is capable of dimerizing with a TCR α chain. [The present invention 1038] 10. The genetically engineered T cell of any of claims 1024 to 1037, wherein the encoded Cβ comprises a sequence selected from any one of SEQ ID NOs: 16, 17, 21, and 25, or a sequence that exhibits at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to any one of SEQ ID NOs: 16, 17, 21, and 25, or a subsequence thereof. [This invention 1039] 1024-1038. The genetically engineered T cell of any of claims 1024-1038, wherein the encoded Cβ comprises a sequence selected from any one of SEQ ID NOs: 20, 21, 25, and 253-258, or a sequence that exhibits at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to any one of SEQ ID NOs: 20, 21, 25, and 253-258, or a subsequence thereof. [The present invention 1040] At least a portion of Cβ is a sequence that exhibits at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the sequence of nucleotides starting from residue 3 to residue 1445 of the sequence set forth in SEQ ID NO:2 or one or more exons thereof, or a subsequence thereof; or the sequence of nucleotides beginning at residue 3 through residue 1486 of the sequence set forth in SEQ ID NO:3, or one or more exons thereof, or a sequence that exhibits at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the sequence of nucleotides beginning at residue 3 through residue 1486 of the sequence set forth in SEQ ID NO:3, or one or more exons thereof, or a subsequence thereof The genetically engineered T cell of any of 1025 and 1030 to 1039, wherein the T cell is encoded by [This invention 1041] The genetically engineered T cell of any of 1025 and 1030 to 1039, wherein the further portion of Cβ and / or Cα region encoded by the nucleic acid sequence of (a) comprises one or more modifications, optionally one or more amino acid substitutions, deletions, or insertions, compared to the native Cβ region and / or native Cα region, and optionally the one or more modifications introduce one or more cysteine ​​residues capable of forming one or more non-native disulfide bridges between the alpha chain and the beta chain. [The present invention 1042] The genetically engineered T cell of invention 1025 and invention 1041, wherein the introduction of one or more cysteine ​​residues comprises substitution of a non-cysteine ​​residue with a cysteine ​​residue. [This invention 1043] The genetically engineered T cell of any of the present inventions 1025, 1041, and 1042, wherein the encoded Cα region contains a cysteine ​​at a position corresponding to position 48 in the numbering as shown in any of SEQ ID NOs:24; and / or the encoded Cβ region contains a cysteine ​​at a position corresponding to position 57 in the numbering as shown in SEQ ID NO:20. [This invention 1044] The genetically engineered T cell of any of claims 1025 and 1041 to 1043, wherein the encoded Cβ comprises a sequence selected from any one of SEQ ID NOs: 253 and 256 to 258, or a subsequence thereof. [This invention 1045] The genetically engineered T cell of any of claims 1024 to 1044, further comprising a gene disruption at the TRAC locus. [The present invention 1046] 1046. The genetically engineered T cell of any of claims 1001 to 1045, wherein the transgene sequence comprises one or more multicistronic elements. [This invention 1047] 1046. The genetically engineered T cell of the present invention, wherein the multicistronic element is located between a nucleic acid sequence encoding TCR alpha or a portion thereof and a nucleic acid sequence encoding TCR beta or a portion thereof, and / or upstream of a nucleic acid sequence encoding a TCR or a portion of a TCR. [This invention 1048] 1048. The genetically engineered T cell of claim 1046 or 1047, wherein said multicistronic element is or comprises a ribosomal skip sequence, optionally T2A, P2A, E2A, or F2A. [This invention 1049] 9. The genetically engineered T cell of any of claims 1001 to 1048, wherein the transgene sequence comprises one or more heterologous or regulatory regulatory elements operably linked to regulate expression of the TCR upon expression from the genetically engineered T cell into which it has been transduced. [The present invention 1050] 1049. The genetically engineered T cell of the present invention, wherein the heterologous control or regulatory element comprises a heterologous promoter. [This invention 1051] 1050. The genetically engineered T cell of the present invention, wherein said heterologous promoter is selected from among a constitutive promoter, an inducible promoter, a repressible promoter, and / or a tissue-specific promoter. [This invention 1052] 1052. The genetically engineered T cell of claim 1051, wherein said heterologous promoter is or comprises a human elongation factor 1 alpha (EF1α) promoter or an MND promoter or a variant thereof. [This invention 1053] The genetically engineered T cell of any of claims 1001 to 1052, wherein the recombinant TCR is capable of binding to an antigen associated with, specific for, and / or expressed on a cell or tissue that is associated with a disease, disorder, or condition. [This invention 1054] The genetically engineered T cell of claim 1053, wherein said disease, disorder, or condition is an infectious disease or disorder, an autoimmune disease, an inflammatory disease, a tumor, or a cancer. [This invention 1055] The genetically engineered T cell of any of claims 1001 to 1054, wherein said T cell is a primary T cell derived from a subject, and optionally, said subject is a human. [The present invention 1056] The genetically engineered T cell of any of claims 1001 to 1055, wherein the T cell is a CD8+ T cell or a subtype thereof. [This invention 1057] The genetically engineered cell of any one of claims 1001 to 1055, wherein the T cell is a CD4+ T cell or a subtype thereof. [This invention 1058] 8. The genetically engineered cell of any of claims 1001 to 1057, wherein said T cell is derived from a multipotent or pluripotent cell, optionally an iPSC. [This invention 1059] A plurality of genetically engineered T cells according to any one of claims 1001 to 1058. A composition comprising: [The present invention 1060] Genetically engineered T cells containing an altered T cell receptor alpha constant (TRAC) locus a modified TRAC locus comprising a nucleic acid encoding a recombinant TCR or portion thereof, the recombinant TCR or portion thereof comprising (i) a TCR alpha (TCRα) chain comprising a variable alpha (Vα) domain and a constant alpha (Cα) domain, and (ii) a TCR beta (TCRβ) chain comprising a variable beta (Vβ) domain and a constant beta (Cβ) domain, the nucleic acid sequence comprising (a) a transgene sequence encoding the TCRβ and Vα domains, and (b) an open reading frame of an endogenous TRAC locus encoding at least a portion of the Cα domain of the recombinant TCR, or a subsequence thereof, and the recombinant TCR is capable of binding to an antigen associated with, specific for, and / or expressed on a cell or tissue that is associated with a disease, disorder, or condition; at least 70%, 75%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of the engineered cells in the composition comprise a gene disruption in or of an endogenous T cell receptor alpha constant region (TRAC) gene and / or T cell receptor beta constant region (TRBC) gene; at least 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of the engineered cells in the composition do not express, or do not express at detectable levels, the gene product of the endogenous TRAC or TRBC gene; and / or at least 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, or 90% of the cells in the composition, or more than 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, or 90%, express the recombinant TCR and / or exhibit binding to the antigen; The composition. [The present invention 1061] Genetically engineered T cells containing an altered T cell receptor alpha constant (TRAC) locus a modified TRAC locus comprising a nucleic acid encoding a recombinant TCR or a portion thereof, the recombinant TCR or portion thereof comprising (i) a TCR alpha (TCRα) chain comprising a variable alpha (Vα) domain and a constant alpha (Cα) domain, and (ii) a TCR beta (TCRβ) chain comprising a variable beta (Vβ) domain and a constant beta (Cβ) domain, the nucleic acid sequence comprising (a) a transgene sequence encoding the TCRβ and Vα domains, and (b) an open reading frame of an endogenous TRAC locus encoding at least a portion of the Cα domain of the recombinant TCR, or a subsequence thereof; a portion of the Cα is encoded by an open reading frame of the endogenous TRAC locus or a subsequence thereof, and an additional portion of the Cα is encoded by a transgene sequence, the additional portion of the Cα being shorter than the full length of a native Cα; and the additional portion of the Cα and / or Cβ region encoded by the nucleic acid sequence of (a) comprises one or more modifications compared to the native Cα region and / or native Cβ region, wherein the one or more modifications introduce one or more cysteine ​​residues capable of forming one or more non-native disulfide bridges between the alpha and beta chains; The composition. [This invention 1062] Genetically engineered T cells containing an altered T cell receptor beta constant (TRBC) locus a modified TRBC locus comprising a nucleic acid encoding a recombinant TCR or a portion thereof, the recombinant TCR or portion thereof comprising (i) a TCR beta (TCRβ) chain comprising a variable beta (Vβ) domain and a constant beta (Cβ) domain, and (ii) a TCR alpha (TCRα) chain comprising a variable alpha (Vα) domain and a constant alpha (Cα) domain, the nucleic acid sequence comprising (a) a transgene sequence encoding the TCRα and Vβ domains, and (b) an open reading frame of an endogenous TRBC locus encoding at least a portion of the Cβ domain of the recombinant TCR, or a subsequence thereof, and the recombinant TCR is capable of binding to an antigen associated with, specific for, and / or expressed on a cell or tissue that is associated with a disease, disorder, or condition; at least 70%, 75%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of the engineered cells in the composition comprise a gene disruption in or of an endogenous T cell receptor alpha constant region (TRAC) gene and / or T cell receptor beta constant region (TRBC) gene; at least 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of the engineered cells in the composition do not express, or do not express at detectable levels, the gene product of the endogenous TRAC or TRBC gene; and / or at least 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, or 90% of the cells in the composition express the recombinant TCR and / or exhibit binding to the antigen, The composition. [This invention 1063] Genetically engineered T cells containing an altered T cell receptor beta constant (TRBC) locus a modified TRBC locus comprising a nucleic acid encoding a recombinant TCR or a portion thereof, the recombinant TCR or portion thereof comprising (i) a TCR beta (TCRβ) chain comprising a variable beta (Vβ) domain and a constant beta (Cβ) domain, and (ii) a TCR alpha (TCRα) chain comprising a variable alpha (Vα) domain and a constant alpha (Cα) domain, the nucleic acid sequence comprising (a) a transgene sequence encoding the TCRα and Vβ domains, and (b) an open reading frame of an endogenous TRBC locus encoding at least a portion of the Cβ domain of the recombinant TCR, or a subsequence thereof; a portion of Cβ is encoded by an open reading frame of an endogenous TRBC locus or a subsequence thereof, and a further portion of Cβ is encoded by a transgene sequence, the further portion of Cβ being shorter than the full length of native Cβ; and the further portion of Cβ and / or Cα region encoded by the nucleic acid sequence of (a) comprises one or more modifications, optionally one or more amino acid substitutions, deletions, or insertions, compared to the native Cβ region and / or native Cα region, and optionally the one or more modifications introduce one or more cysteine ​​residues capable of forming one or more non-native disulfide bridges between the alpha and beta chains; The composition. [This invention 1064] The composition of invention 1061 or invention 1063, wherein the recombinant TCR is capable of binding to an antigen associated with, specific for, and / or expressed on a cell or tissue associated with a disease, disorder, or condition. [This invention 1065] The composition of any of claims 1059 to 1064, comprising CD4+ T cells and / or CD8+ T cells. [The present invention 1066] 1066. The composition of any of claims 1059 to 1065, comprising CD4+ T cells and CD8+ T cells, wherein the ratio of CD4+ T cells to CD8+ T cells is 1:3 to 3:1 or about 1:3 to 3:1, optionally 1:1. [This invention 1067] at least 70%, 75%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of the engineered cells in the composition comprise a gene disruption in or of the endogenous T cell receptor alpha constant region (TRAC) gene and / or the T cell receptor beta constant region (TRBC) gene; and / or At least 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of the engineered cells in the composition do not express, or do not express at detectable levels, the gene product of the endogenous TRAC or TRBC gene; Any of compositions 1059, 1061, and 1063 to 1066 of the present invention. [The present invention 1068] 10. The composition of any of claims 1059, 1061, and 1063-1067, wherein at least 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, or 90% of the cells in the composition express a recombinant TCR and / or exhibit binding to an antigen. [The present invention 1069] (a) a nucleic acid sequence encoding a portion of a recombinant T cell receptor (TCR), the nucleic acid sequence encoding (i) a T cell receptor beta (TCRβ) chain including a variable beta (Vβ) domain and a constant beta (Cβ) domain, and (ii) a portion of a T cell receptor alpha (TCRα) chain that is shorter than the full length of the native T cell receptor alpha (TCRα) chain; and (b) one or more homology arms linked to the nucleic acid sequence, the homology arms comprising a sequence homologous to one or more regions of the open reading frame of the TRAC locus 1. A polynucleotide comprising the following: [The present invention 1070] (a) a nucleic acid sequence encoding a portion of a recombinant T cell receptor (TCR), the nucleic acid sequence encoding (i) a T cell receptor beta (TCRβ) chain including a variable beta (Vβ) domain and a constant beta (Cβ) domain, and (ii) a portion of a T cell receptor alpha (TCRα) chain that is shorter than the full length of the native T cell receptor alpha (TCRα) chain; and (b) one or more homology arms linked to the nucleic acid sequence, the homology arms comprising a sequence homologous to one or more regions of the open reading frame of the TRAC locus A polynucleotide comprising: When the TCR or antigen-binding fragment thereof is expressed from a cell into which the polynucleotide has been introduced: a portion of the Cα is encoded by an open reading frame of the endogenous TRAC locus or a subsequence thereof, and an additional portion of the Cα is encoded by a transgene sequence, the additional portion of the Cα being shorter than the full length of a native Cα; and the further portion of the Cα and / or Cβ region encoded by the nucleic acid sequence of (a) comprises one or more modifications compared to the native Cα region and / or the native Cβ region, wherein the one or more modifications introduce one or more cysteine ​​residues capable of forming one or more non-native disulfide bridges between the alpha and beta chains, and / or the Cα and / or Cβ of the recombinant TCR comprises one or more non-native cysteines; The polynucleotide. [This invention 1071] (a) a nucleic acid sequence encoding a portion of a recombinant T cell receptor (TCR), the nucleic acid sequence encoding (i) a T cell receptor beta (TCRβ) chain including a variable beta (Vβ) domain and a constant beta (Cβ) domain, and (ii) a portion of a T cell receptor alpha (TCRα) chain that is shorter than the full length of the native T cell receptor alpha (TCRα) chain; and (b) one or more homology arms linked to the nucleic acid sequence, the homology arms comprising a sequence homologous to one or more regions of the open reading frame of the TRAC locus A polynucleotide comprising: the transgene sequence comprises one or more heterologous or regulatory regulatory elements, including a heterologous promoter, operably linked to regulate expression of the TCR upon expression from the transfected cell in the engineered T cell; The polynucleotide. [This invention 1072] the TCR alpha chain comprises a constant alpha region (Cα), at least a portion of which is encoded by an open reading frame of the endogenous TRAC locus or a subsequence thereof when the TCR or antigen-binding fragment thereof is expressed from a cell into which the polynucleotide has been introduced; and / or the nucleic acid sequence of (a) and one of the one or more homology arms together comprise a sequence of nucleotides encoding a Cα that is shorter than the full length of a native Cα, and at least a portion of the Cα is encoded by an open reading frame of the endogenous TRAC locus or a subsequence thereof when the TCR or antigen-binding fragment thereof is expressed from a cell into which the polynucleotide has been introduced. A polynucleotide of any one of 1069 to 1071 of the present invention. [This invention 1073] The polynucleotide of any of 1069 to 1072 of the present invention, wherein a nucleic acid sequence encoding a TCR β chain is located upstream of a nucleic acid sequence encoding a portion of a TCR α chain. [This invention 1074] The polynucleotide of any one of claims 1069 to 1073, wherein the nucleic acid sequence of (a) does not contain a sequence encoding a 3' untranslated region (3' UTR) or an intron. [This invention 1075] Any of the polynucleotides of claims 1069 to 1074, wherein the nucleic acid sequence of (a) is in frame with one or more exons or subsequences thereof of the open reading frame of the TRAC locus contained in one or more homology arms. [This invention 1076] A polynucleotide of any of 1069 and 1071 to 1075 of the present invention, wherein a portion of Cα is encoded by the open reading frame of the endogenous TRAC locus or a partial sequence thereof, and a further portion of Cα is encoded by the nucleic acid sequence of (a), and the further portion of Cα is shorter than the full length of natural Cα. [This invention 1077] 1077. The polynucleotide of any of claims 1069 to 1076, wherein the open reading frame or a subsequence thereof comprises at least one intron and at least one exon of the endogenous TRAC locus. [This invention 1078] The polynucleotide of any of claims 1070, 1076, and 1077, wherein a further portion of Cα is encoded by a sequence of nucleotides comprising fewer than four exons, fewer than three exons, fewer than two exons, one exon, or less than one complete exon of the open reading frame of the TRAC locus. [This invention 1079] The polynucleotide of any of 1070 and 1076 to 1078, wherein the further portion of Cα is encoded by a sequence of nucleotides that is less than 400, less than 300, less than 250, less than 200, or less than 150 base pairs in length. [The present invention 1080] Any of the polynucleotides 1070 and 1076 to 1079 of the present invention, wherein a further portion of Cα is encoded by a portion of exon 1 of the TRAC locus, and the portion of exon 1 is shorter than the full length of exon 1 of the open reading frame of the TRAC locus. [This invention 1081] The polynucleotide of any one of 1069 to 1080, which is capable of dimerizing a TCR α chain with a TCR β chain when produced from a cell into which the polynucleotide has been introduced. [This invention 1082] The polynucleotide of any of claims 1069 to 1081, wherein when produced from a cell into which the polynucleotide has been introduced, the encoded Cα comprises a sequence selected from any one of SEQ ID NOs: 19, 24, and 243 to 252, or a sequence that exhibits at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to any one of SEQ ID NOs: 19, 24, and 243 to 252, or a subsequence thereof. [This invention 1083] At least a portion of Cα the sequence of nucleotides beginning at residue 3 through residue 3155 of the sequence set forth in SEQ ID NO:1, or one or more exons thereof, or a sequence that exhibits at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the sequence of nucleotides beginning at residue 3 through residue 3155 of the sequence set forth in SEQ ID NO:1, or one or more exons thereof, or a subsequence thereof Any of the polynucleotides 1070 and 1076 to 1082 of the present invention, encoded by [This invention 1084] A polynucleotide of any of 1070 and 1076 to 1083 of the present invention, wherein a further portion of Cα comprises the sequence set forth in SEQ ID NO: 142, or a sequence exhibiting at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to SEQ ID NO: 142, or a subsequence thereof. [This invention 1085] The polynucleotide of any of 1076 to 1084 of the present invention, wherein the further portion of the Cα and / or Cβ region encoded by the nucleic acid sequence of (a) comprises one or more modifications, optionally one or more amino acid substitutions, deletions, or insertions, compared to the native Cα region and / or native Cβ region, and optionally the one or more modifications introduce one or more cysteine ​​residues capable of forming one or more non-native disulfide bridges between the alpha chain and the beta chain. [The present invention 1086] The polynucleotide of invention 1070 and invention 1085, wherein the introduction of one or more cysteine ​​residues comprises substitution of a non-cysteine ​​residue with a cysteine ​​residue. [This invention 1087] Any of the polynucleotides 1070, 1085, and 1086 of the present invention, wherein, when produced from a cell into which the polynucleotide has been introduced, the encoded Cα region contains a cysteine ​​at a position corresponding to position 48 in the numbering as shown in any of SEQ ID NO:24; and / or the encoded Cβ region contains a cysteine ​​at a position corresponding to position 57 in the numbering as shown in SEQ ID NO:20. [This invention 1088] A polynucleotide of any of 1070 and 1085 to 1087 of the present invention, wherein when produced from a cell into which the polynucleotide has been introduced, the encoded Cα comprises a sequence selected from any one of SEQ ID NOs: 248 to 252, or a partial sequence thereof. [This invention 1089] The polynucleotide of any of claims 1069 to 1088, wherein the portion of the TCR alpha chain comprises a variable alpha (Vα) domain. [The present invention 1090] The polynucleotide of any of claims 1069 to 1089, wherein the one or more homology arms comprise a 5' homology arm and / or a 3' homology arm. [This invention 1091] The polynucleotide of claim 1090, wherein the 5' homology arm and the 3' homology arm comprise nucleic acid sequences homologous to nucleic acid sequences surrounding a target site, the target site being within the TRAC locus. [This invention 1092] 1091. The polynucleotide of the present invention, wherein the target site is within exon 1 of the TRAC locus. [This invention 1093] The 5' homology arm is a) a sequence that exhibits at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity to the sequence set forth in SEQ ID NO:124 for, or comprising at least 150, 200, 250, 300, 350, 400, 450, 500, 550, or 600 contiguous nucleotides; b) a sequence comprising 150, 200, 250, 300, 350, 400, 450, 500, 550, or 600 consecutive nucleotides of, or at least 150, 200, 250, 300, 350, 400, 450, 500, 550, or 600 consecutive nucleotides of, the sequence set forth in SEQ ID NO:124; or c) the sequence shown in SEQ ID NO:124 The polynucleotide of any one of 1090 to 1092 of the present invention, comprising: [This invention 1094] The 3' homology arm is a) a sequence that exhibits at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity to the sequence set forth in SEQ ID NO:125 for, or comprising at least 150, 200, 250, 300, 350, 400, 450, 500, 550, or 600 contiguous nucleotides; b) a sequence comprising 150, 200, 250, 300, 350, 400, 450, 500, 550, or 600 consecutive nucleotides of, or at least 150, 200, 250, 300, 350, 400, 450, 500, 550, or 600 consecutive nucleotides of, the sequence set forth in SEQ ID NO: 125; or c) the sequence shown in SEQ ID NO:125 The polynucleotide of any one of 1090 to 1093 of the present invention, comprising: [This invention 1095] (a) a nucleic acid sequence encoding a portion of a recombinant T cell receptor (TCR), the nucleic acid sequence encoding (i) a T cell receptor alpha (TCRα) chain including a variable alpha (Vα) domain and a constant alpha (Cα) domain, and (ii) a portion of a T cell receptor beta (TCRβ) chain that is shorter than the full length of the native TCRβ chain; and (b) one or more homology arms linked to the nucleic acid sequence, the homology arms comprising a sequence homologous to one or more regions of the open reading frame of the TRBC locus; A polynucleotide comprising: [This invention 1096] The polynucleotide of the present invention 1095, wherein the TCR β chain comprises a constant beta (Cβ), and when the TCR or its antigen-binding fragment is expressed from a cell into which the polynucleotide has been introduced, at least a portion of the Cβ is encoded by an open reading frame of the endogenous TRAC locus or a partial sequence thereof, and / or the nucleic acid sequence of (a) and one of the one or more homology arms together comprise a sequence of nucleotides encoding a Cβ that is shorter than the full length of native Cβ, and when the TCR or its antigen-binding fragment is expressed from a cell into which the polynucleotide has been introduced, at least a portion of the Cβ is encoded by an open reading frame of the endogenous TRBC locus or a partial sequence thereof. [This invention 1097] The polynucleotide of invention 1095 or invention 1096, wherein the TRBC locus is one or more of TRBC1 or TRBC2. [This invention 1098] The polynucleotide of any of 1095 to 1097, wherein a nucleic acid sequence encoding a TCR α chain is upstream of a nucleic acid sequence encoding a portion of a TCR β chain. [This invention 1099] The polynucleotide of any one of 1095 to 1098, wherein the nucleic acid sequence of (a) does not contain a sequence encoding a 3' untranslated region (3' UTR) or an intron. [The present invention 1100] Any of the polynucleotides 1095 to 1099 of the present invention, wherein the nucleic acid sequence of (a) is in frame with one or more exons or subsequences thereof of the open reading frame of the TRAC locus contained in one or more homology arms. [The present invention 1101] Any of the polynucleotides of 1095 to 1100 of the present invention, wherein a portion of Cβ is encoded by an open reading frame of an endogenous TRBC locus or a partial sequence thereof, and a further portion of Cβ is encoded by the nucleic acid sequence of (a), and the further portion of Cβ is shorter than the full length of native Cβ. [The present invention 1102] The polynucleotide of any of claims 1095 to 1101, wherein the open reading frame or a subsequence thereof comprises at least one intron and at least one exon of an endogenous TRBC locus. [The present invention 1103] The polynucleotide of invention 1101 or invention 1102, wherein a further portion of Cβ is encoded by a sequence of nucleotides encoding less than four exons, less than three exons, less than two exons, one exon, or less than one complete exon of the open reading frame of the TRBC locus. [The present invention 1104] The polynucleotide of any of claims 1101 to 1103, wherein the further portion of Cβ is encoded by a sequence of nucleotides that is less than 400, less than 300, less than 250, less than 200, or less than 150 base pairs in length. [This invention 1105] A polynucleotide of any of 1101 to 1104 of the present invention, wherein a further portion of Cβ is encoded by a portion of exon 1 of the TRBC locus, and the portion of exon 1 is shorter than the full length of exon 1 of the open reading frame of the TRBC locus. [The present invention 1106] The polynucleotide of any one of 1095 to 1105 of the present invention, which is capable of dimerizing a TCR β chain with a TCR α chain when produced from a cell into which the polynucleotide has been introduced. [This invention 1107] The polynucleotide of any of claims 1069 to 1106, wherein when produced from a cell into which the polynucleotide has been introduced, the encoded Cβ comprises a sequence selected from any one of SEQ ID NOs: 20, 21, 25, and 253 to 258, or a sequence that exhibits at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to any one of SEQ ID NOs: 20, 21, 25, and 253 to 258, or a subsequence thereof. [This invention 1108] At least a portion of Cβ is a sequence that exhibits at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the sequence of nucleotides starting from residue 3 to residue 1445 of the sequence set forth in SEQ ID NO:2 or one or more exons thereof, or a subsequence thereof; or the sequence of nucleotides beginning at residue 3 through residue 1486 of the sequence set forth in SEQ ID NO:3, or one or more exons thereof, or a sequence that exhibits at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the sequence of nucleotides beginning at residue 3 through residue 1486 of the sequence set forth in SEQ ID NO:3, or one or more exons thereof, or a subsequence thereof Any of the polynucleotides 1101 to 1107 of the present invention, encoded by [This invention 1109] The polynucleotide of any of 1101 to 1108, wherein the further portion of Cβ and / or Cα region encoded by the nucleic acid sequence of (a) comprises one or more modifications, optionally one or more amino acid substitutions, deletions, or insertions, compared to the native Cβ region and / or native Cα region, and optionally the one or more modifications introduce one or more cysteine ​​residues capable of forming one or more non-native disulfide bridges between the alpha chain and the beta chain. [The present invention 1110] 1109. The polynucleotide of claim 1109, wherein the introduction of one or more cysteine ​​residues comprises substitution of a non-cysteine ​​residue with a cysteine ​​residue. [The present invention 1111] The polynucleotide of invention 1109 or invention 1110, wherein the encoded Cα region contains a cysteine ​​at a position corresponding to position 48 in the numbering as shown in any of SEQ ID NO:24; and / or the encoded Cβ region contains a cysteine ​​at a position corresponding to position 57 in the numbering as shown in SEQ ID NO:20. [The present invention 1112] The polynucleotide of any one of claims 1109 to 1111, wherein the encoded Cβ comprises a sequence selected from any one of SEQ ID NOs: 253 and 256 to 258, or a partial sequence thereof. [The present invention 1113] The polynucleotide of any of 1095 to 1112, wherein the portion of the TCR β chain comprises a variable beta (Vβ) domain. [This invention 1114] The polynucleotide of any of claims 1095 to 1113, wherein the one or more homology arms comprise a 5' homology arm and / or a 3' homology arm. [This invention 1115] The polynucleotide of the present invention 1114, wherein the 5' homology arm and the 3' homology arm comprise nucleic acid sequences homologous to nucleic acid sequences surrounding a target site, the target site being within the open reading frame of the TRBC locus. [The present invention 1116] The polynucleotide of the present invention 1115, wherein the target site is within exon 1 of the open reading frame of the TRBC locus. [This invention 1117] The polynucleotide of any of claims 1069 to 1116, wherein the nucleic acid sequence of (a) is a sequence that is foreign or heterologous to the open reading frame of the endogenous genomic TRAC locus of a T cell, optionally a human T cell. [This invention 1118] The polynucleotide of any of 1090-1094 and 1114-1117, wherein the 5' homology arm and the 3' homology arm are independently from 50 or about 50 to 100 or about 100 nucleotides in length, from 100 or about 100 to 250 or about 250 nucleotides in length, from 250 or about 250 to 500 or about 500 nucleotides in length, from 500 or about 500 to 750 or about 750 nucleotides in length, from 750 or about 750 to 1000 or about 1000 nucleotides in length, or from 1000 or about 1000 to 2000 or about 2000 nucleotides in length. [This invention 1119] The 5' homology arm and the 3' homology arm may be independently from 100 or about 100 to 1000 or about 1000 nucleotides, 100 to 750 nucleotides, 100 to 600 nucleotides, 100 to 400 nucleotides, 100 to 300 nucleotides, 100 to 200 nucleotides, 200 to 1000 nucleotides, 200 to 750 nucleotides, 200 to 600 nucleotides, 200 to 400 nucleotides, 200 to 300 nucleotides. Any of the polynucleotides 1090 to 1094 and 1114 to 1118 of the present invention, which has a length of 300 to 1000 nucleotides, 300 to 750 nucleotides, 300 to 600 nucleotides, 300 to 400 nucleotides, 400 to 1000 nucleotides, 400 to 750 nucleotides, 400 to 600 nucleotides, 600 to 1000 nucleotides, 600 to 750 nucleotides, or 750 to 1000 nucleotides. [The present invention 1120] The polynucleotide of any of 1090-1094 and 1114-1119, wherein the 5' homology arm and the 3' homology arm are independently 200, 300, 400, 500, 600, 700, or 800 nucleotides in length, or about 200, 300, 400, 500, 600, 700, or 800 nucleotides in length, or any value between any of the foregoing. [This invention 1121] The polynucleotide of any of 1090-1094 and 1114-1120, wherein the 5' homology arm and the 3' homology arm are independently greater than 300 or about 300 nucleotides in length, and optionally the 5' homology arm and the 3' homology arm are independently 400, 500, or 600 nucleotides in length, or about 400, 500, or 600 nucleotides in length, or any value between any of the foregoing. [This invention 1122] The polynucleotide of any of 1090-1094 and 1114-1121, wherein the 5' homology arm and the 3' homology arm are independently 600 nucleotides in length, about 600 nucleotides in length, or less than about 600 nucleotides in length. [This invention 1123] The polynucleotide of any of 1090-1094 and 1114-1122, wherein the 5' homology arm and the 3' homology arm are independently greater than or equal to about 300 nucleotides in length. [This invention 1124] The polynucleotide of any one of 1069 to 1123, wherein the nucleic acid sequence of (a) comprises one or more multicistronic elements. [Invention 1125] The polynucleotide of the present invention 1124, wherein the multicistronic element is located between a nucleic acid sequence encoding TCR alpha or a portion thereof and a nucleic acid sequence encoding TCR beta or a portion thereof, and / or is upstream of a nucleic acid sequence encoding a TCR or a portion of a TCR. [The present invention 1126] The polynucleotide of invention 1124 or invention 1125, wherein said multicistronic element is or comprises a ribosomal skip sequence, optionally T2A, P2A, E2A, or F2A. [This invention 1127] The polynucleotide of any of claims 1069 to 1126, wherein the nucleic acid sequence of (a) comprises one or more heterologous or regulatory regulatory elements operably linked to regulate expression of the TCR upon expression from a cell into which the polynucleotide has been introduced. [This invention 1128] The polynucleotide of the invention 1127, wherein the heterologous control or regulatory element comprises a heterologous promoter. [This invention 1129] The polynucleotide of the present invention, wherein the heterologous promoter is selected from among a constitutive promoter, an inducible promoter, a repressible promoter, and / or a tissue-specific promoter. [The present invention 1130] The polynucleotide of invention 1128 or invention 1129, wherein said heterologous promoter is or comprises a human elongation factor 1 alpha (EF1α) promoter or an MND promoter or a variant thereof. [This invention 1131] A polynucleotide of any one of 1069 to 1130 of the present invention, which is contained in a viral vector. [This invention 1132] 1131. The polynucleotide of the present invention, wherein the viral vector is an AAV vector, optionally selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, or AAV8 vectors. [This invention 1133] The polynucleotide of the present invention 1132, wherein the AAV vector is an AAV2 or AAV6 vector. [This invention 1134] A polynucleotide of any one of 1069 to 1133 of the present invention, comprising the structure: [5' homology arm]-[nucleic acid sequence of (a)]-[3' homology arm]. [This invention 1135] A polynucleotide according to any one of claims 1124 to 1134 of the present invention, comprising the following structure: [5' homology arm]-[multicistronic element]-[nucleic acid sequence of (a)]-[3' homology arm]. [This invention 1136] A polynucleotide according to any one of claims 1128 to 1134, comprising the following structure: [5' homology arm]-[heterologous promoter]-[nucleic acid sequence of (a)]-[3' homology arm]. [This invention 1137] The polynucleotide of any of claims 1069 to 1136, wherein the encoded recombinant TCR is capable of binding to an antigen associated with, specific for, and / or expressed on a cell or tissue that is associated with a disease, disorder, or condition. [This invention 1138] The polynucleotide of claim 1137, wherein said disease, disorder, or condition is an infectious disease or disorder, an autoimmune disease, an inflammatory disease, a tumor, or a cancer. [This invention 1139] 1069-1138. The polynucleotide of any of claims 1069-1138, which is at least 2500, 2750, 3000, 3250, 3500, 3750, 4000, 4250, 4500, 4760, 5000, 5250, 5500, 5750, 6000, 7000, 7500, 8000, 9000, or 10000 nucleotides in length, or about 2500, 2750, 3000, 3250, 3500, 3750, 4000, 4250, 4500, 4760, 5000, 5250, 5500, 5750, 6000, 7000, 7500, 8000, 9000, or 10000 nucleotides in length, or any value between any of the foregoing. [The present invention 1140] The polynucleotide of any of claims 1069 to 1139, which is from 2500 or about 2500 to 5000 or about 5000 nucleotides, from 3500 or about 3500 to 4500 or about 4500 nucleotides, or from 3750 or about 3750 to 4250 or about 4250 nucleotides in length. [This invention 1141] A method for producing genetically engineered T cells containing a modified TRAC locus, comprising the step of introducing any of the polynucleotides 1069 to 1094 or 1117 to 1140 of the present invention into T cells containing a gene disruption in the TRAC locus. [This invention 1142] (a) introducing into a T cell one or more agents capable of inducing a gene disruption at a target site within the endogenous T cell receptor alpha constant (TRAC) locus of the T cell; and (b) introducing into the T cells a polynucleotide comprising a transgene sequence encoding a T cell receptor beta (TCRβ) chain and a portion of a T cell receptor alpha (TCRα) chain that is shorter than a full-length native TCRα chain. 1. A method of generating a genetically engineered T cell comprising a modified TRAC locus, comprising: The introduction of the template polynucleotide is followed by the introduction of one or more agents capable of inducing gene disruption; and the transgene is targeted for integration within the endogenous TRAC locus via homology-directed repair (HDR), thereby generating a genetically engineered cell containing a modified TRAC locus; The method. [This invention 1143] 1. A method for generating a genetically engineered T cell comprising a modified T cell receptor alpha constant (TRAC) locus, comprising introducing into a T cell having a gene disruption within the T cell's endogenous TRAC locus a polynucleotide comprising a transgene sequence encoding a T cell receptor beta (TCRβ) chain and a portion of the T cell receptor alpha (TCRα) chain, wherein the transgene is targeted for integration into the endogenous TRAC locus via homology-directed repair (HDR), thereby generating a genetically engineered T cell comprising a modified TRAC locus. [This invention 1144] (a) introducing into a T cell one or more agents capable of inducing a gene disruption at a target site within the endogenous T cell receptor alpha constant (TRAC) locus of the T cell; and (b) introducing into the T cells a polynucleotide comprising a transgene sequence encoding a T cell receptor beta (TCRβ) chain and a portion of a T cell receptor alpha (TCRα) chain that is shorter than a full-length native TCRα chain. 1. A method of generating a genetically engineered T cell comprising a modified TRAC locus, comprising: The transgene is targeted for integration within the endogenous TRAC locus via homology directed repair (HDR), thereby generating a genetically engineered cell containing a modified TRAC locus, wherein upon targeted integration of the transgene: a portion of the Cα is encoded by an open reading frame of the endogenous TRAC locus or a subsequence thereof, and an additional portion of the Cα is encoded by a transgene sequence, the additional portion of the Cα being shorter than the full length of a native Cα; and the further portion of the Cα and / or Cβ region encoded by the nucleic acid sequence of (a) comprises one or more modifications compared to the native Cα region and / or the native Cβ region, wherein the one or more modifications introduce one or more cysteine ​​residues capable of forming one or more non-native disulfide bridges between the alpha and beta chains, and / or the Cα and / or Cβ of the recombinant TCR comprises one or more non-native cysteines; The method. [Invention 1145] 1. A method of generating a genetically engineered T cell comprising a modified T cell receptor alpha constant (TRAC) locus, comprising introducing into a T cell having a gene disruption in the T cell's endogenous T cell receptor alpha constant (TRAC) locus a polynucleotide comprising a transgene sequence encoding a T cell receptor beta (TCRβ) chain and a portion of the T cell receptor alpha (TCRα) chain, The transgene is targeted for integration within the endogenous TRAC locus via homology directed repair (HDR), thereby generating a genetically engineered cell containing a modified TRAC locus, wherein upon targeted integration of the transgene: a portion of the Cα is encoded by an open reading frame of the endogenous TRAC locus or a subsequence thereof, and an additional portion of the Cα is encoded by a transgene sequence, the additional portion of the Cα being shorter than the full length of a native Cα; and the further portion of the Cα and / or Cβ region encoded by the nucleic acid sequence of (a) comprises one or more modifications compared to the native Cα region and / or the native Cβ region, wherein the one or more modifications introduce one or more cysteine ​​residues capable of forming one or more non-native disulfide bridges between the alpha and beta chains, and / or the Cα and / or Cβ of the recombinant TCR comprises one or more non-native cysteines; The method. [Invention 1146] Any of the methods of inventions 1141, 1143, and 1145, wherein the gene disruption is induced by one or more agents capable of inducing gene disruption of one or more target sites within the endogenous TRAC locus. [This invention 1147] The method of any one of claims 1141 to 1146, wherein the polynucleotide is any one of the polynucleotides of claims 1069 to 1094 or 1117 to 1140. [Invention 1148] 1141. The method of any of claims 1141 to 1147, wherein the modified TRAC locus comprises a nucleic acid sequence encoding a recombinant TCR or a portion thereof, the nucleic acid sequence comprising an in-frame fusion of (i) a transgene sequence and (ii) an open reading frame of the endogenous TRAC locus or a subsequence thereof, and optionally the transgene sequence is in-frame with one or more exons of the open reading frame of the endogenous TRAC locus or a subsequence thereof. [This invention 1149] The method of any of claims 1141 to 1148, further comprising inducing a gene disruption at the TRBC locus in the engineered T cell. [This invention 1150] A method for producing genetically engineered T cells containing a modified TRBC locus, comprising the step of introducing any one of the polynucleotides 1095 to 1140 of the present invention into T cells containing a gene disruption in the TRBC locus. [This invention 1151] (a) introducing into a T cell one or more agents capable of inducing gene disruption at a target site within the T cell's endogenous T cell receptor beta constant (TRBC) locus; and (b) introducing into the T cells a polynucleotide comprising a transgene sequence encoding a T cell receptor alpha (TCRα) chain and a portion of a T cell receptor beta (TCRβ) chain that is shorter than a full-length native TCRβ chain. 1. A method for generating genetically engineered T cells comprising a modified TRBC locus, comprising: the transgene is targeted for integration into the endogenous TRBC locus via homology-directed repair (HDR), thereby generating a genetically engineered cell containing a modified TRBC locus; The method. [This invention 1152] A method for producing a genetically engineered T cell comprising a modified T cell receptor beta constant (TRBC) locus, comprising introducing into a T cell having a gene disruption within the T cell's endogenous TRBC locus a polynucleotide comprising a transgene sequence encoding a T cell receptor alpha (TCRα) chain and a portion of the T cell receptor beta (TCRβ) chain, wherein the transgene is targeted for integration into the endogenous TRBC locus via homology-directed repair (HDR), thereby producing a genetically engineered T cell comprising a modified TRBC locus. [This invention 1153] The method of claim 1150 and claim 1152, wherein the gene disruption is induced by one or more agents capable of inducing gene disruption of one or more target sites within the endogenous TRBC locus. [This invention 1154] The method of any of claims 1150 to 1153, wherein the TRBC locus is the TRBC1 locus and / or the TRBC2 locus. [This invention 1155] The method of any one of claims 1151 to 1154, wherein the polynucleotide is any one of claims 1095 to 1140. [Invention 1156] Any of the methods of claims 1151 to 1155, wherein the modified TRBC locus comprises a nucleic acid sequence encoding a recombinant TCR or a portion thereof, the nucleic acid sequence comprising an in-frame fusion of (i) a transgene sequence and (ii) an open reading frame or a subsequence thereof of the endogenous TRBC locus, and optionally the transgene sequence is in-frame with one or more exons of the open reading frame or a subsequence thereof of the endogenous TRBC locus. [This invention 1157] The method of any of claims 1151 to 1156, wherein the engineered T cell further comprises inducing a gene disruption at the TRAC locus. [This invention 1158] Any of the methods of 1142 and 1144 to 1157, wherein the one or more agents capable of inducing gene disruption comprise a DNA-binding protein or a DNA-binding nucleic acid that specifically binds to or hybridizes to the target site. [This invention 1159] The method of any of claims 1142 and 1144-1158, wherein the one or more agents comprise a zinc finger protein (ZFP), a TAL protein, or a clustered regularly interspaced short palindromic nucleic acid (CRISPR)-associated nuclease (Cas) specific for the target site. [The present invention 1160] The method of any of claims 1142 and 1144 to 1159, wherein the one or more agents comprise a CRISPR-Cas9 combination, and a guide RNA (gRNA) having a targeting domain that is complementary to at least one target site. [This invention 1161] 1160. The method of claim 1160, wherein said one or more agents are introduced as a ribonucleoprotein (RNP) complex comprising a gRNA and a Cas9 protein. [This invention 1162] 1161. The method of claim 1161, wherein the concentration of RNP is from 1 μM or about 1 μM to 5 μM or about 5 μM, optionally wherein the concentration of RNP is 2 μM or about 2 μM. [This invention 1163] The method of claim 1161 or claim 1162, wherein the RNP is introduced via electroporation. [This invention 1164] gRNA, is complementary to a target site in the TRAC locus, and TIFF0007630280000010.tif151165 A targeting domain comprising a sequence selected from the group consisting of: Any of the methods of the present inventions 1160 to 1163, comprising: [Invention 1165] The gRNA sequence TIFF0007630280000011.tif4128 The method of claim 1164, having a targeting domain comprising: [Invention 1166] gRNA, is complementary to a target site in one or both of the TRBC1 and TRBC2 genes; and TIFF0007630280000012.tif85163TIFF0007630280000013.tif194164 A targeting domain comprising a sequence selected from the group consisting of: Any of the methods of the present inventions 1160 to 1163, comprising: [This invention 1167] The gRNA sequence TIFF0007630280000014.tif4128 The method of claim 1166, having a targeting domain comprising: [Invention 1168] The method of any of claims 1141 to 1167, wherein said T cells are primary T cells derived from the subject. [This invention 1169] The method of claim 1168, wherein said subject has or is suspected of having said disease or disorder condition. [This invention 1170] The method of claim 1168, wherein the subject is healthy or suspected to be healthy. [This invention 1171] The method of any one of claims 1141 to 1170, wherein said T cells are CD8+ T cells or subtypes thereof. [This invention 1172] The method of any one of claims 1141 to 1170, wherein said T cells are CD4+ T cells or subtypes thereof. [This invention 1173] The method of any of claims 1141 to 1167, wherein said T cells are derived from multipotent or pluripotent cells, optionally iPSCs. [This invention 1174] The method of any of claims 1168 to 1173, wherein said T cells comprise T cells that are autologous to the subject. [This invention 1175] The method of any of claims 1168 to 1173, wherein said T cells comprise T cells that are allogeneic to the subject. [Invention 1176] The method of any one of claims 1141 to 1175, wherein the polynucleotide is contained in a viral vector. [This invention 1177] 1176. The method of claim 1176, wherein the vector is an AAV vector, optionally selected from among an AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, or AAV8 vector. [This invention 1178] 1177. The method of claim 1177, wherein the AAV vector is an AAV2 or AAV6 vector. [This invention 1179] Any of the methods of claims 1141 to 1178, wherein the recombinant TCR is capable of binding to an antigen associated with, specific for, and / or expressed on a cell or tissue that is associated with a disease, disorder, or condition. [This invention 1180] Any of the methods of claims 1144 to 1179, wherein the introduction of one or more agents capable of inducing gene disruption and the introduction of the template polynucleotide are carried out simultaneously or sequentially, in any order. [This invention 1181] The method of any of claims 1144 to 1180, wherein the introduction of the template polynucleotide is performed after the introduction of one or more agents capable of inducing gene disruption. [This invention 1182] 1181. The method of claim 1181, wherein the template polynucleotide is introduced immediately after, or within 30 seconds, 1 minute, 2 minutes, 3 minutes, 4 minutes, 5 minutes, 6 minutes, 6 minutes, 8 minutes, 9 minutes, 10 minutes, 15 minutes, 20 minutes, 30 minutes, 40 minutes, 50 minutes, 60 minutes, 90 minutes, 2 hours, 3 hours, or 4 hours thereafter, or within about 30 seconds, 1 minute, 2 minutes, 3 minutes, 4 minutes, 5 minutes, 6 minutes, 6 minutes, 8 minutes, 9 minutes, 10 minutes, 15 minutes, 20 minutes, 30 minutes, 40 minutes, 50 minutes, 60 minutes, 90 minutes, 2 hours, 3 hours, or 4 hours thereafter, optionally 2 hours or about 2 hours after introduction of the one or more agents capable of inducing gene disruption. [This invention 1183] The method of any one of claims 1141 to 1182, which is carried out on a plurality of T cells. [This invention 1184] 1184. The method of claim 1183, wherein said plurality of T cells comprises CD4+ T cells, CD8+ T cells, or CD4+ T cells and CD8+ T cells. [This invention 1185] The method of claim 1183 or claim 1184, wherein the plurality of T cells comprises CD4+ T cells and CD8+ T cells, and the ratio of CD4+ T cells to CD8+ T cells is from at or about 1:3 to 3:1 or about 3:1, optionally from 1:2 or about 1:2 to 2:1 or about 2:1, optionally 1:1 or about 1:1. [Invention 1186] Any of the methods of 1142 and 1144 to 1185 of the present invention, comprising, prior to the introduction of the one or more agents, incubating the cells in vitro with a stimulatory agent under conditions to stimulate or activate the one or more T cells. [This invention 1187] 1186. The method of claim 1186, wherein said stimulatory agent comprises anti-CD3 and / or anti-CD28 antibodies, optionally anti-CD3 / anti-CD28 beads, and optionally the ratio of beads to cells is 1:1 or about 1:1. [This invention 1188] The method of claim 1186 or claim 1187, comprising the step of removing a stimulatory agent from the one or more immune cells prior to introducing the one or more agents. [This invention 1189] Any of the methods of inventions 1142 and 1144 to 1185, further comprising the step of incubating the cells with one or more recombinant cytokines before, during, or after the introduction of the one or more agents and / or the introduction of the template polynucleotide, optionally wherein the one or more recombinant cytokines are selected from the group consisting of IL-2, IL-7, and IL-15. [This invention 1190] 1189. The method of claim 1189, wherein said one or more recombinant cytokines are added at a concentration selected from: IL-2 at a concentration of from 10 U / mL or about 10 U / mL to 200 U / mL or about 200 U / mL, optionally from 50 IU / mL or about 50 IU / mL to 100 U / mL or about 100 U / mL; IL-7 at a concentration of from 0.5 ng / mL to 50 ng / mL, optionally from 5 ng / mL or about 5 ng / mL to 10 ng / mL or about 10 ng / mL; and / or IL-15 at a concentration of from 0.1 ng / mL to 20 ng / mL, optionally from 0.5 ng / mL or about 0.5 ng / mL to 5 ng / mL or about 5 ng / mL. [This invention 1191] 1189 or 1190, wherein the incubation is carried out for up to or about 24 hours, 36 hours, 48 ​​hours, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 days after introduction of the one or more agents and introduction of the template polynucleotide, optionally for up to or about 7 days. [This invention 1192] 1141 to 1191, wherein the polynucleotide is at least 2500, 2750, 3000, 3250, 3500, 3750, 4000, 4250, 4500, 4760, 5000, 5250, 5500, 5750, 6000, 7000, 7500, 8000, 9000, or 10000 nucleotides in length, or about 2500, 2750, 3000, 3250, 3500, 3750, 4000, 4250, 4500, 4760, 5000, 5250, 5500, 5750, 6000, 7000, 7500, 8000, 9000, or 10000 nucleotides in length, or any value between any of the foregoing. [This invention 1193] 3. The method of any of claims 1141 to 1192, wherein the polynucleotide is from 2500 or about 2500 nucleotides to 5000 or about 5000 nucleotides, from 3500 or about 3500 nucleotides to 4500 or about 4500 nucleotides, or from 3750 or about 3750 nucleotides to 4250 or about 4250 nucleotides in length. [This invention 1194] An engineered T cell or a plurality of engineered T cells produced using the method of any of claims 1141 to 1193. [This invention 1195] A composition comprising an engineered T cell or a plurality of engineered cells of the present invention. [This invention 1196] The composition of the present invention 1195, comprising CD4+ T cells and / or CD8+ T cells. [This invention 1197] The composition of invention 1195 or invention 1196, comprising CD4+ T cells and CD8+ T cells, wherein the ratio of CD4+ T cells to CD8+ T cells is 1:3 to 3:1 or about 1:3 to 3:1, optionally 1:1. [This invention 1198] at least 70%, 75%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of the engineered cells in the composition comprise a gene disruption in or of the endogenous T cell receptor alpha constant region (TRAC) gene and / or the T cell receptor beta constant region (TRBC) gene; and / or At least 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of the engineered cells in the composition do not express, or do not express at detectable levels, the gene product of the endogenous TRAC or TRBC gene; Any of the compositions of 1195 to 1197 of the present invention. [This invention 1199] 9. The composition of any of claims 1195 to 1198, wherein at least 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, or 90% of the cells in the composition express a recombinant TCR and / or exhibit binding to an antigen. [The present invention 1200] A method of treatment comprising the step of administering to a subject the engineered cell, a plurality of engineered cells, or a composition of any of claims 1194 to 1199. [The present invention 1201] 1194-1199. Use of the engineered cell, the engineered cells, or the composition of any of claims 1194-1199 for the treatment of a disease or disorder. [This invention 1202] 1194-1199. Use of an engineered cell, a plurality of engineered cells, or a composition of any of claims 1194-1199 in the manufacture of a medicament for treating a disease or disorder. [This invention 1203] 1199. The engineered cell, a plurality of engineered cells, or a composition of any of claims 1194-1199 for use in treating a disease or disorder. [The present invention 1204] Any one of the polynucleotides 1069 to 1094 or 1117 to 1140 of the present invention; one or more agents capable of inducing gene disruption at a target site within the TRAC locus; Manufactured articles, including: [This invention 1205] (a) a nucleic acid sequence encoding a T cell receptor beta (TCRβ) chain and a portion of a T cell receptor alpha (TCRα) chain that is shorter than the full-length native TCRα chain; and (b) one or more homology arms linked to the nucleic acid sequence, the homology arms comprising a sequence homologous to one or more regions of the open reading frame of the TRAC locus encoding the TCR alpha chain a polynucleotide comprising: one or more agents capable of inducing gene disruption at a target site within the TRAC locus; Manufactured articles, including: [This invention 1206] The article of manufacture of invention 1205, wherein the polynucleotide comprises any one of polynucleotides of inventions 1069 to 1094 or 1117 to 1140. [This invention 1207] Any one of the polynucleotides 1095 to 1140 of the present invention, one or more agents capable of inducing gene disruption at a target site within the TRBC locus; Manufactured articles, including: [This invention 1208] (a) a nucleic acid sequence encoding a T cell receptor alpha (TCRα) chain and a portion of a T cell receptor beta (TCRβ) chain that is shorter than the full-length native TCRβ chain; and (b) one or more homology arms linked to the nucleic acid sequence, the homology arms comprising a sequence homologous to one or more regions of the open reading frame of the TRBC locus encoding the TCR β chain; a polynucleotide comprising: one or more agents capable of inducing gene disruption at a target site within the TRAC locus; Manufactured articles, including: [This invention 1209] The article of manufacture of invention 1207 or 1208, wherein the polynucleotide comprises any one of polynucleotides of inventions 1095 to 1140. [The present invention 1210] A kit comprising any one of the articles of manufacture of the present inventions 1204 to 1209 and instructions for use. [Brief explanation of the drawings]

[0149] [Figure 1A] 1A and 1B show histograms depicting cell surface staining of CD8, Vbeta22 (recombinant TCR-specific staining; FIG. 1A ), and peptide-MHC tetramers (FIG. 1B ) complexed with the antigen recognized by the recombinant TCR (HPV 16 E7(11-19) peptide; referred to as “HPV E7(11)”), as assessed by flow cytometry, in T cells that were subjected to knockout of endogenous TCR-encoding genes (TRAC and TRBC) and engineered to express an exemplary recombinant anti-HPV 16 E7 T cell receptor (TCR) using various constructs for HDR-mediated expression and targeted integration at the TRAC locus: the complete sequence of recombinant TCR α and TCR β chains linked to the EF1α promoter ("SV40 pA EF1α E7 TCR"), or the complete sequence of recombinant TCR α and TCR β chains linked to the MND promoter ("SV40 pA MND E7"). Polynucleotides encoding a recombinant TCR beta chain and a partial sequence of a recombinant TCR alpha chain ("MND E7 TCR 3' arm") linked to an MND promoter for in-frame integration with exon 1 sequence of the endogenous TRAC gene, or a polynucleotide encoding a recombinant TCR beta chain and a partial sequence of a recombinant TCR alpha chain ("P2A E7 TCR 3' arm") linked to an endogenous TRAC promoter via an upstream P2A ribosomal skip sequence for in-frame integration with exon 1 sequence of the endogenous TRAC gene. Mock-transfected T cells ("Mock") were evaluated as a control. [Figure 1B] See legend to Figure 1A. [Figure 2]FIG. 2 shows a graph illustrating the results of a cytolytic assay of T cells expressing an exemplary recombinant TCR co-cultured with target cells at a 5:1 effector-to-target (E:T) ratio, as assessed by lysis of NucLight Red-labeled target cells over time, in T cells engineered to express an exemplary recombinant anti-HPV 16 E7 T cell receptor (TCR) and subjected to knockout of endogenous TCR-encoding genes (TRAC and TRBC) using various constructs for HDR-directed expression and targeted integration at the TRAC locus: the complete sequence of recombinant TCR α and TCR β chains linked to the EF1α promoter ("SV40 pA EF1α E7 TCR"), or the complete sequence of recombinant TCR α and TCR β chains linked to the MND promoter ("SV40 pA MND E7"). Polynucleotides encoding a recombinant TCR beta chain and a partial sequence of a recombinant TCR alpha chain ("MND E7 TCR 3' arm") linked to the MND promoter for in-frame integration with exon 1 sequence of the endogenous TRAC gene, or a polynucleotide encoding a recombinant TCR beta chain and a partial sequence of a recombinant TCR alpha chain ("P2A E7 TCR 3' arm") linked to the endogenous TRAC promoter via an upstream P2A ribosomal skip sequence for in-frame integration with exon 1 sequence of the endogenous TRAC gene. Mock-transfected T cells ("Mock") and cells expressing a reference TCR ("E7 Reference Mouse") were used as controls. [Figure 3A] Figures 3A-3B illustrate the integration results at various time points for the various homology arm lengths tested, as assessed by changes in GFP patterns at 24, 48, and 72 hours (Figure 3A), and at 96 hours or 7 days (Figure 3B) after transduction of AAV preparations containing HDR template polynucleotides. [Figure 3B] See legend to Figure 3A. [Figure 4A]Figures 4A-4B illustrate the changes in integration rates for HDR with various homology arm lengths at 24, 48, 72, and 96 hours or day 7 for four different donors, donors 1 and 2 (Figure 4A), and donors 3 and 4 (Figure 4B). [Figure 4B] See legend to Figure 4A. DETAILED DESCRIPTION OF THE INVENTION

[0150] Detailed Description Provided herein are genetically engineered immune cells that express a recombinant receptor, such as a recombinant T cell receptor (TCR). In some embodiments, the genetically engineered immune cells provided are T cells comprising a modified T cell receptor alpha constant (TRAC) locus or a modified T cell receptor beta constant (TRBC) locus, which comprises a nucleic acid encoding a recombinant TCR or a portion thereof. In some embodiments, the nucleic acid sequence is or comprises a fusion of a transgene with an open reading frame of an endogenous TRAC locus encoding a T cell receptor alpha (TCRα) constant domain, or a subsequence thereof. In certain embodiments, the transgene encodes a T cell receptor beta (TCRβ) chain and a portion of the T cell receptor alpha (TCRα) chain, the portion being shorter than a full-length TCRα chain, e.g., a full-length native TCRα chain. In certain embodiments, the nucleic acid sequence is or comprises a fusion of a transgene with an open reading frame of an endogenous TRBC locus encoding a T cell receptor beta (TCRβ) constant domain, or a subsequence thereof. In certain embodiments, the transgene encodes a portion of the TCR alpha and beta chains, and a portion of the TCR beta chain, which portion is shorter than the full-length TCR beta chain, e.g., the full-length TCR beta chain. Also provided are related cell compositions, methods for generating or making engineered cells, nucleic acids and kits for use in generating engineered cells, as described herein.

[0151] T cell-based therapies, such as adoptive T cell therapies (including those involving the administration of engineered cells expressing recombinant TCRs specific to a disease or disorder of interest), can be effective in treating cancer and other diseases and disorders. In certain situations, available approaches for generating engineered cells for adoptive cell therapy may not always be completely satisfactory. In some situations, optimal efficacy may depend on the ability of the administered cells to express the recombinant TCR, as well as uniform, homogeneous, and / or consistent expression of the receptor among cells, such as immune cells and / or populations of cells in a therapeutic cell composition.

[0152] In certain aspects, currently available methods, such as viral transduction, are not entirely satisfactory. For example, in some aspects, the efficiency of recombinant TCR expression is limited among certain cells or certain cell populations engineered using currently available methods. In some cases, the recombinant TCR is expressed only in certain cells within a population of cells, and the level of recombinant TCR expression can vary widely among cells in the population. In certain aspects, the level of recombinant TCR expression can be difficult to predict, regulate, and / or control. In some aspects, random integration of a nucleic acid sequence encoding a recombinant TCR into the genome of a cell can, in some cases, result in harmful and / or unwanted effects due to integration of the nucleic acid sequence into an undesired location in the genome, for example, into an essential gene or a gene important in regulating cellular activity. In some cases, random or semi-random integration of a nucleic acid sequence encoding a receptor can result in atypical, uncontrolled, unregulated, and / or suboptimal expression or antigen binding, oncogenic transformation, and transcriptional silencing of the nucleic acid sequence, depending on the site of integration and / or the copy number of the nucleic acid sequence. In some aspects, insertion of a recombinant TCR into the T cell genome can result in mispairing between the recombinant TCR chain and the native TCR chain, thereby reducing the amount of functional recombinant TCR expressed by the cell.

[0153] In some aspects, variable integration of the recombinant receptor-encoding sequence can result in inconsistent expression, variable nucleic acid copy number, possible insertional mutagenesis, and / or variability in receptor expression, and / or gene disruption within a cellular composition, such as a therapeutic cellular composition. In some aspects, the use of certain random integration vectors, such as certain lentiviral vectors, requires the performance of a replication-competent lentivirus (RCL) assay.

[0154] In some embodiments, targeted gene disruption of one or more endogenous TCR loci can result in a reduced risk or chance of mispairing between the engineered or recombinant TCR and the endogenous TCR chain. Mispaired TCRs, in some aspects, can create new TCRs, potentially resulting in a higher risk of undesired or unintended antigen recognition and / or side effects, and / or can reduce the expression level of the desired engineered or recombinant TCR. In some aspects, reducing or inhibiting endogenous TCR expression can increase the expression of engineered or recombinant TCRs in T cells or T cell compositions compared to cells in which TCR expression is not reduced or inhibited. In some embodiments, recombinant TCR expression can be increased by 1.5-fold, 2-fold, 3-fold, 4-fold, 5-fold, or more. For example, in some cases, suboptimal expression of engineered or recombinant TCRs may occur due to competition with endogenous TCRs and / or with TCRs with mispaired chains for signaling domains, such as the invariant CD3 signaling molecule, which are involved in enabling expression of the complex on the cell surface. In some aspects, currently available methods for delivery of transgenes encoding recombinant receptors, such as recombinant TCRs, may exhibit inefficient integration and / or reduced expression of the recombinant receptor. In some aspects, the efficiency of integration and / or expression of recombinant receptors within a population may be low and / or variable.

[0155] In some aspects, the development of humanized and / or fully human recombinant TCRs presents technical challenges. For example, in some aspects, humanized and / or fully human recombinant TCR receptors may compete with the endogenous TCR complex and form mispairings with the endogenous TCR α or TCR β chain, which may, in certain aspects, reduce the signal transduction, activity, and / or expression of the recombinant TCR. One way to address these challenges is to design a recombinant TCR with a mouse constant domain to prevent mispairing with the endogenous human TCR α or TCR β chain. However, the use of a recombinant TCR with a mouse sequence may, in some aspects, present a risk of immune response. The provided polynucleotides, reagents, articles of manufacture, kits, and methods address these challenges by inserting a portion of the recombinant TCR in-frame into the endogenous TCR gene, resulting in a modified locus encoding the complete recombinant TCR. In certain aspects, this insertion serves to disrupt expression of endogenous TCR genes while allowing expression of fully humanized and / or human recombinant TCRs and reducing the likelihood of competition from or mispairing with endogenous TCR chains.

[0156] In some aspects, the provided embodiments also enable the use of smaller, engineered nucleic acid sequence fragments to encode the TCR α or TCR β chain, or portions thereof, of a recombinant TCR, compared to existing methods, by utilizing part or all of the open reading frame sequence of an endogenous gene encoding the TCR α or TCR β constant domain. In some aspects, the provided embodiments may allow for the accommodation of larger homology arms and / or nucleic acid sequences encoding additional molecules, compared to conventional embodiments that require the full length of a recombinant TCR in an introduced polynucleotide, such that the length requirements for the nucleic acid sequence encoding the recombinant TCR or portion thereof are reduced. In some aspects, the generation, delivery, and / or targeting efficiency by homology-directed repair (HDR) of nucleic acid sequences, e.g., transgene sequences, may be facilitated or improved using the provided embodiments.

[0157] In some embodiments, the present invention provides a method for generating or producing genetically engineered cells that comprise a modified TRAC or TRBC locus that comprises a nucleic acid sequence encoding a recombinant TCR.In some aspects, the modified TRAC or TRBC locus in the genetically engineered cell comprises a transgene sequence (also referred to herein as a foreign or heterologous nucleic acid sequence) that encodes a portion of a recombinant TCR, which is integrated into the endogenous TRAC or TRBC locus that normally encodes a TCRα or TCRβ constant domain.In some embodiments, the method comprises using a template polynucleotide that contains a transgene that encodes a portion of a recombinant TCR to induce targeted gene disruption and homology-dependent repair (HDR), thereby targeting the integration of the transgene at the TRAC or TRBC locus.Also provided are cells and cell compositions produced by the method.

[0158] In some embodiments, the provided polynucleotides, transgenes, and / or vectors, when delivered into immune cells, result in the expression of a recombinant TCR that can regulate T cell activity, and in some cases, T cell differentiation or homeostasis. The resulting engineered cells or cell compositions can be used in adoptive cell therapy.

[0159] Thus, the provided embodiments can facilitate the creation of engineered cells that exhibit improved expression, function, and uniformity of expression, and / or other desirable characteristics or properties, and ultimately greater potency. The provided embodiments can also reduce the length of the polynucleotide, transgene, and / or vector required to deliver a recombinant TCR to a cell, e.g., to allow sufficient space for packaging additional elements and / or transgenes within the same vector, e.g., a viral vector.

[0160] Also provided are methods for manipulating, preparing, and producing engineered cells, as well as kits and devices for generating or producing engineered cells. Viral vectors containing polynucleotides, such as nucleic acid sequences encoding portions of chimeric receptors, and methods for introducing such polynucleotides into cells, for example, by transduction or physical delivery such as electroporation, are provided. Also provided are compositions, methods, kits, and devices containing engineered cells for administering cells and compositions to a subject, for example, for adoptive cell therapy. In some aspects, cells are isolated from a subject, manipulated, and administered to the same subject. In other aspects, cells are isolated from a subject, manipulated, and administered to another subject.

[0161] All publications, including patent documents, scientific articles, and databases, referred to in this application are incorporated by reference in their entirety for all purposes to the same extent as if each individual publication were individually incorporated by reference. To the extent that a definition set forth herein conflicts or otherwise contradicts a definition set forth in a patent, application, published application, or other publication incorporated herein by reference, the definition set forth herein shall take precedence over the definition incorporated herein by reference.

[0162] The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described.

[0163] I. Methods for generating cells expressing recombinant receptors by homology-directed repair (HDR) Provided herein are methods for generating genetically engineered immune cells, e.g., genetically engineered T cells for adoptive cell therapy, as well as related compositions, methods, uses, and kits and articles of manufacture used to perform the methods. Also provided are genetically engineered immune cells that express a recombinant receptor, such as a recombinant T cell receptor (TCR), including genetically engineered immune cells generated by any of the provided methods, and compositions containing such cells. Immune cells are generally engineered to express a recombinant molecule, such as a recombinant receptor, e.g., a recombinant T cell receptor (TCR). In some aspects, provided embodiments include specifically targeting a nucleic acid sequence encoding a portion of a recombinant receptor, e.g., a TCR, to one or more target sites within a particular locus, e.g., an endogenous TCR locus. In some embodiments, the nucleic acid sequence is integrated in-frame within the TCR locus to generate a modified locus encoding a complete recombinant TCR.

[0164] In some embodiments, methods are provided for producing genetically engineered immune cells, e.g., genetically engineered T cells for adoptive cell therapy. In some embodiments, the provided methods include introducing into the immune cells one or more agents (also referred to throughout as "one or more agents" or "agents" in connection with aspects of the provided methods) that can induce genetic disruption of one or more target sites (also known as "target positions," "target DNA sequences," or "target locations") within a gene encoding a domain or region of the T cell receptor alpha (TCRα) chain and / or one or more genes encoding a domain or region of the T cell receptor beta (TCRβ) chain; and introducing into the immune cells a polynucleotide, e.g., a template polynucleotide, that includes a transgene encoding a recombinant receptor or a chain thereof that is targeted to one or approximately one of the at least one target site via homology-directed repair (HDR).

[0165] In some embodiments, the present invention provides a method for producing or creating genetically engineered cells that comprise modified TRAC or TRBC locus, which comprises a nucleic acid sequence encoding recombinant TCR.In some aspects, the modified TRAC or TRBC locus in genetically engineered cells comprises a transgene sequence (also referred to herein as foreign or heterologous nucleic acid sequence) that encodes a portion of recombinant TCR, which is integrated into the endogenous TRAC or TRBC locus that normally encodes TCRα or TCRβ constant domain.In some embodiments, the method comprises: using a template polynucleotide that contains a transgene that encodes a portion of recombinant TCR to induce targeted gene disruption and homology-dependent repair (HDR), thereby targeting the integration of the transgene at TRAC or TRBC locus.Also provided are cells and cell compositions produced by the method.

[0166] In some embodiments, the transgene sequence encoding a portion of the recombinant TCR contains a sequence of nucleotides encoding a TCR beta chain and a portion of the TCR alpha chain. In some embodiments, the portion of the TCR alpha chain encoded by the transgene sequence comprises less than the full length of the TCR alpha chain. In certain embodiments, the portion of the TCR alpha chain contains a TCR alpha variable domain and a full-length TCR constant domain, e.g., a portion of the TCR alpha constant domain that is shorter than the full-length native TCR alpha constant domain, or does not contain a sequence encoding the TCR alpha constant domain. In some aspects, upon integration of the transgene sequence into the endogenous TRAC locus, the resulting modified TRAC locus encodes a recombinant TCR receptor that is encoded by a fusion of the transgene with the open reading frame of the endogenous TRAC locus or a subsequence thereof, targeted by the HDR. In some embodiments, the encoded recombinant TCR contains a functional TCR alpha chain that can bind to a TCR alpha chain, e.g., a TCR beta chain.

[0167] In certain embodiments, the transgene sequence encoding a portion of the recombinant TCR contains a sequence of nucleotides encoding a portion of the TCR α chain and / or the TCR β chain. In some embodiments, the portion of the TCR β chain encoded by the transgene sequence is shorter than or less than the full length of the TCR β chain. In certain embodiments, the portion of the TCR β chain contains a TCR β variable domain and a full-length TCR constant domain, for example, a portion of the TCR β constant domain that is shorter than the full-length native TCR α constant domain, or does not contain a sequence encoding the TCR β constant domain. In some aspects, upon integration of the transgene sequence into the endogenous TRBC locus, for example, the TRBC1 and / or TRBC2 locus, the resulting modified TRBC locus encodes a recombinant TCR receptor encoded by a fusion of the transgene and the open reading frame of the endogenous TRBC locus or a subsequence thereof, targeted by the HDR. In some embodiments, the encoded recombinant TCR contains a functional TCR β chain that can bind to a TCR β chain, for example, a TCR α chain.

[0168] In some embodiments, the polynucleotide, e.g., the template polynucleotide, comprises a nucleic acid sequence encoding a recombinant receptor or its chain, e.g., a recombinant TCR or its chain, fragment and / or portion. In certain embodiments, the nucleic acid sequence is targeted to a target site within a locus encoding an endogenous receptor, e.g., an endogenous TCR gene. In certain embodiments, the nucleic acid sequence is targeted for in-frame integration within the endogenous locus. In certain embodiments, in-frame integration results in a recombinant receptor coding sequence containing a nucleic acid sequence encoding a portion and / or fragment of the recombinant receptor in frame with a portion and / or fragment of the locus encoding the remaining portion and / or fragment of the receptor, e.g., to integrate the foreign and endogenous nucleic acid sequences to arrive at a coding sequence encoding a complete, entire, and / or full-length recombinant receptor. In certain embodiments, the integration genetically disrupts the expression of the endogenous receptor encoded by the gene at the target site. In certain embodiments, a transgene encoding a portion of the recombinant receptor is targeted into the locus via HDR.

[0169] In certain embodiments, the recombinant receptor is a recombinant TCR or chain thereof containing one or more variable domains and one or more constant domains. In certain embodiments, the transgene encodes a portion and / or fraction of the recombinant TCR that does not include the TCR constant domain, and the transgene is integrated in frame with a sequence, e.g., a genomic DNA sequence, encoding an endogenous TCR constant domain. In certain embodiments, the integration results in a coding sequence that encodes a complete, entire, and / or full-length recombinant TCR or chain thereof. In some embodiments, the coding sequence contains a transgene sequence encoding a portion or fragment of the TCR or chain thereof and an endogenous sequence encoding an endogenous TCR constant domain.

[0170] In some embodiments, the transgene encodes a portion and / or fragment of the recombinant receptor, including a portion and / or fraction of a constant domain, e.g., a portion or fragment of a constant domain that is completely or partially identical to an endogenous TCR constant domain. In some embodiments, the transgene is integrated in frame with a sequence, e.g., a genomic DNA sequence, that encodes a portion and / or fragment of an endogenous TCR constant domain that is not encoded by the transgene. In particular embodiments, the integration results in a coding sequence that encodes a complete, entire, and / or full-length recombinant TCR or chain thereof and that contains the transgene sequence and endogenous sequence encoding an endogenous portion or fragment of the TCR constant domain.

[0171] In some embodiments, provided methods include introducing one or more agents into immune cells, each of which can independently induce gene disruption of a target site within a T cell receptor alpha constant (TRAC) gene and / or a T cell receptor beta constant (TRBC) gene, thereby inducing gene disruption of at least one target site; and introducing a template polynucleotide comprising a transgene encoding a recombinant T cell receptor (TCR) or an antigen-binding fragment thereof or a chain thereof into the immune cells, wherein the transgene encoding the recombinant TCR or an antigen-binding fragment or chain thereof is targeted for integration at or near one of the at least one target site via homology-directed repair (HDR). In certain embodiments, integration at or near the target site is in-frame with a portion of the coding sequence of the TRAC or TRBC gene, e.g., a portion of the coding sequence downstream, e.g., immediately downstream and / or 3'-proximal to the target site.

[0172] In some embodiments, one of the at least one target site is in the T cell receptor alpha constant (TRAC) gene. In some embodiments, one of the at least one target site is in the T cell receptor beta constant 1 (TRBC1) or T cell receptor beta constant 2 (TRBC2) gene. In some embodiments, the one or more target sites are in the TRAC gene and one or both of the TRBC1 and TRBC2 genes.

[0173] In some embodiments, provided methods include introducing a template polynucleotide comprising a transgene encoding a recombinant receptor into an immune cell having a genetic disruption of one or more target sites within a gene encoding a domain or region of the T cell receptor alpha (TCRα) chain and / or one or more genes encoding a domain or region of the T cell receptor beta (TCRβ) chain, wherein the transgene encoding the recombinant receptor or chain thereof is targeted via HDR to or near one of the at least one target site.

[0174] In provided embodiments, the term "introducing" encompasses various methods of introducing DNA into cells, either in vitro or in vivo, including transformation, transduction, transfection (e.g., electroporation), and infection. Vectors are useful for introducing DNA encoding a molecule into cells. Possible vectors include plasmid vectors and viral vectors. Viral vectors include retroviral vectors, lentiviral vectors, or other vectors, such as adenoviral vectors or adeno-associated vectors. Methods such as electroporation can also be used to introduce or deliver proteins or ribonucleoproteins (RNPs) containing, for example, the Cas9 protein in a complex with a targeting gRNA, into cells of interest.

[0175] In some cases, embodiments provided herein involve targeted gene disruption, e.g., DNA cleavage, in one or more endogenous TCR loci (e.g., endogenous genes encoding the TCR alpha and / or TCR beta chains) by gene editing techniques combined with targeted knock-in of a nucleic acid encoding a recombinant receptor (e.g., a recombinant TCR or CAR) by homology-directed repair (HDR). In some embodiments, the HDR process requires a break, e.g., a double-strand break, in the DNA at a targeted location in the genome. In some embodiments, the DNA cleavage occurs as a result of a process during gene editing, e.g., the DNA cleavage is caused by a targeted nuclease used in gene editing.

[0176] In some embodiments, embodiments include using gene editing methods and / or targeted nucleases to create targeted DNA cleavage, followed by HDR based on a template polynucleotide, e.g., one or more template polynucleotides comprising a homologous sequence and one or more transgenes, e.g., a nucleic acid encoding a recombinant receptor or chain thereof and / or other exogenous or recombinant nucleic acid, to specifically target and integrate the nucleic acid sequence encoding the recombinant receptor or chain thereof and / or other exogenous or recombinant nucleic acid at or near the point of DNA breakage.

[0177] In some embodiments, targeted gene disruption and targeted integration of nucleic acid encoding a recombinant receptor by HDR occurs at one or more target sites (also known as "target positions," "target DNA sequences," or "target locations") of an endogenous gene encoding one or more domains, regions, and / or chains of an endogenous T cell receptor (TCR). In some embodiments, targeted gene disruption is induced in the TCR alpha gene. In some embodiments, targeted gene disruption is induced in the TCR beta gene. In some embodiments, targeted gene disruption is induced in the endogenous TCR alpha gene and the endogenous TCR beta gene. The endogenous TCR gene can include one or more of the genes encoding the TCR alpha constant domain (encoded by TRAC in humans) and / or the TCR beta constant domain (encoded by TRBC1 or TRBC2 in humans). In certain embodiments, a polynucleotide, e.g., a template polynucleotide, contains a nucleic acid sequence encoding a portion and / or fragment of a recombinant TCR containing a portion and / or fragment of a TCR alpha chain. In some embodiments, the portion and / or fragment of the TCR alpha chain contains the complete, entire, and / or full-length TCR alpha variable domain and a portion and / or fraction of the TCR alpha constant domain. In certain embodiments, the nucleic acid sequence is integrated in-frame into a target site within the TRAC gene. In some embodiments, the in-frame integration results in a coding sequence encoding the complete, entire, and / or full-length recombinant TCR or chain thereof. In certain embodiments, the complete, entire, and / or full-length recombinant receptor contains the complete, entire, and / or full-length TCR alpha chain. In some embodiments, the complete, entire, and / or full-length recombinant receptor contains the complete, entire, and / or full-length TCR alpha constant domain.

[0178] In certain embodiments, the polynucleotide, e.g., the template polynucleotide, encodes a recombinant TCR or a portion and / or fragment of a chain thereof, containing a portion or fragment of the TCR β chain. In some embodiments, the portion and / or fragment of the TCR β chain contains a portion and / or fragment of the TCR β constant domain. In certain embodiments, the transgene is integrated in-frame into a target site within a TRBC gene, e.g., TRBC1 and / or TRBC2. In some embodiments, the in-frame integration results in a coding sequence encoding an entire, complete, and / or full-length recombinant TCR or a chain thereof. In certain embodiments, the entire, complete, and / or full-length recombinant receptor contains an entire, complete, and / or full-length TCR β chain. In some embodiments, the entire, complete, and / or full-length recombinant receptor contains an entire, complete, and / or full-length TCR β constant domain.

[0179] In some embodiments, template polynucleotide is introduced into engineered cell before, simultaneously with, or after the introduction of the agent that can induce target gene disruption.In the presence of target gene disruption, for example, DNA breakage, template polynucleotide can be used as DNA repair template, and based on the homology between the endogenous gene sequence around target site and the 5' and / or 3' homology arm contained in template polynucleotide, HDR can effectively copy and integrate the nucleic acid sequence encoding transgene (for example, recombinant receptor) at or near the site of target gene disruption.

[0180] In some embodiments, gene editing and HDR process are carried out simultaneously and / or in one experimental reaction.In some embodiments, gene editing and HDR process are carried out consecutively or sequentially in one or consecutive experimental reaction.In some embodiments, gene editing and HDR process are carried out simultaneously or at different times in separate experimental reactions.

[0181] Immune cells can include a population of cells including T cells. Such cells can be obtained from a subject, for example, a peripheral blood mononuclear cell (PBMC) sample, an unfractionated T cell sample, a lymphocyte sample, a white blood cell sample, an apheresis product, or a leukapheresis product. In some embodiments, T cells can be separated or selected to enrich the T cells in the population using positive or negative selection and enrichment methods. In some embodiments, the population comprises CD4+, CD8+, or CD4+ and CD8+ T cells. In some embodiments, the steps of introducing a polynucleotide template and introducing an agent (e.g., Cas9 / gRNA RNP) can occur simultaneously or sequentially in any order. In certain embodiments, the polynucleotide template is introduced into immune cells after inducing gene disruption by introducing an agent (e.g., Cas9 / gRNA RNP). In some embodiments, the cells are cultured or incubated under conditions that stimulate cell expansion and / or proliferation prior to, during, and / or following the introduction of the polynucleotide template and one or more agents (e.g., Cas9 / gRNA RNP).

[0182] In certain embodiments of the provided methods, the introduction of the template polynucleotide is performed after the introduction of one or more agents capable of inducing gene disruption. Depending on the specific agent used to induce gene disruption, any method for introducing one or more agents can be used as described. In some aspects, the disruption is performed by gene editing, for example, using an RNA-guided nuclease, such as a clustered regularly interspersed short palindromic nucleic acid (CRISPR)-Cas system, specific for the TRAC or TRBC locus to be disrupted, for example, a CRISPR-Cas9 system. In some embodiments, an agent comprising Cas9 and a guide RNA (gRNA) comprising a targeting domain that targets a region of the TRAC or TRBC locus is introduced into the cell. In some embodiments, the agent is or comprises a ribonucleoprotein (RNP) complex (Cas9 / gRNA RNP) of Cas9 and a gRNA comprising a targeting domain that targets TRAC / TRBC. In some embodiments, the introduction comprises contacting the agent, or a portion thereof, with the cells in vitro, which may include culturing or incubating the cells and agent for 24, 36, or 48 hours, or for up to 3, 4, 5, 6, 7, or 8 days. In some embodiments, the introduction can further comprise delivering the agent into the cells. In various embodiments, the methods, compositions, and cells disclosed herein utilize direct delivery of a ribonucleoprotein (RNP) complex of Cas9 and gRNA into the cells, e.g., by electroporation. In some embodiments, the RNP complex comprises a gRNA modified to include a 3' polyA tail and a 5' anti-reverse cap analog (ARCA) cap. In some cases, electroporation of the cells to be modified comprises cold-shocking the cells, e.g., at 32°C, after electroporation and prior to plating.

[0183] In such aspects of the provided methods, the template polynucleotide is introduced into the cell after the introduction of one or more agents, such as Cas9 / gRNA RNP, introduced, for example, via electroporation. In some embodiments, the template polynucleotide is introduced immediately after the introduction of one or more agents capable of inducing gene disruption. In some embodiments, the template polynucleotide is introduced into the cell within at or about 30 seconds, within at or about 1 minute, within at or about 2 minutes, within at or about 3 minutes, within at or about 4 minutes, within at or about 5 minutes, within at or about 6 minutes, within at or about 6 minutes, within at or about 6 minutes, within at or about 8 minutes, within at or about 8 minutes, within at or about 9 minutes, within at or about 10 minutes, within at or about 15 minutes, within at or about 15 minutes, within at or about 20 minutes, within at or about 30 minutes, within at or about 40 minutes, within at or about 40 minutes, within at or about 50 minutes, within at or about 60 minutes, within at or about 60 minutes, within at or about 90 minutes, within at or about 2 hours, within at or about 2 hours, within at or about 3 hours, or within at or about 4 hours after introduction of one or more agents capable of inducing gene disruption. In some embodiments, the template polynucleotide is incubated for at or about 15 minutes to at or about 4 hours after introduction of the one or more agents, e.g., between at or about 15 minutes and 3 hours or about 3 hours, between 15 minutes and about 15 minutes to at or about 2 hours, between 15 minutes and about 15 minutes to at or about 1 hour, between 15 minutes and about 15 minutes to at or about 30 minutes, between 30 minutes and at or about 30 minutes to at or about 4 hours, between 30 minutes and at or about 30 minutes to at or about 3 hours, The antibody is introduced into the cells for a period of time between 30 minutes or about 30 minutes and 2 hours or about 2 hours, between 30 minutes or about 30 minutes and 1 hour or about 1 hour, between 1 hour or about 1 hour and 4 hours or about 4 hours, between 1 hour or about 1 hour and 3 hours or about 3 hours, between 1 hour or about 1 hour and 2 hours or about 2 hours, between 2 hours or about 2 hours and 4 hours or about 4 hours, between 2 hours or about 2 hours and 3 hours or about 3 hours, or between 3 hours or about 3 hours and 4 hours or about 4 hours.In some embodiments, the template polynucleotide is introduced into the cell at or about 2 hours after introduction of one or more agents, e.g., Cas9 / gRNA RNP, introduced, e.g., via electroporation.

[0184] Depending on the specific method used to deliver template polynucleotide to cells, any method for introducing template polynucleotide can be used as described.Exemplary methods include those for transferring nucleic acid encoding receptor, including those via virus, such as retrovirus or lentivirus, transduction, transposon, and electroporation.In certain embodiments, viral transduction methods are used.In some embodiments, template polynucleotide can be transferred or introduced into cells using recombinant infectious virus particles, such as vectors derived from Simian Virus 40 (SV40), adenovirus, or adeno-associated virus (AAV). In some embodiments, the recombinant nucleic acid is transferred into T cells using a recombinant lentiviral or retroviral vector, e.g., a gamma-retroviral vector (see, e.g., Koste et al. (2014) Gene Therapy 2014 Apr 3. doi: 10.1038 / gt.2014.25; Carlens et al. (2000) Exp Hematol 28(10): 1137-46; Alonso-Camino et al. (2013) Mol Ther Nucl Acids 2, e93; Park et al., Trends Biotechnol. 2011 November 29(11): 550-557). In certain embodiments, the viral vector is an AAV, such as AAV2 or AAV6.

[0185] In some embodiments, prior to, during, or following contacting the cells with an agent, and / or prior to, during, or following delivery (e.g., electroporation), the provided methods comprise incubating the cells in the presence of a cytokine, a stimulatory agent, and / or an agent capable of inducing proliferation, stimulation, or activation of immune cells (e.g., T cells). In some embodiments, at least a portion of the incubation is in the presence of a stimulatory agent that is or includes an antibody specific for CD3, an antibody specific for CD28, and / or a cytokine, e.g., anti-CD3 / anti-CD28 beads. In some embodiments, at least a portion of the incubation is in the presence of one or more cytokines, e.g., recombinant IL-2, recombinant IL-7, and / or recombinant IL-15. In some embodiments, incubation extends for up to 8 days, e.g., 24 hours, 36 hours, or 48 hours, or up to 3, 4, 5, 6, 7, or 8 days, before or after introduction of one or more agents, e.g., Cas9 / gRNA RNP, and template polynucleotide, via electroporation.

[0186] In some embodiments, the methods include activating or stimulating the cells with a stimulatory agent (e.g., an anti-CD3 / anti-CD28 antibody) prior to introducing an agent, e.g., the Cas9 / gRNA RNP, and the polynucleotide template. In some embodiments, incubation in the presence of the stimulatory agent (e.g., anti-CD3 / anti-CD28) is for 6 to 96 hours, e.g., 24 to 48 hours, or 24 to 36 hours, prior to introduction of one or more agents, e.g., the Cas9 / gRNA RNP, e.g., via electroporation. In some embodiments, incubation with the stimulatory agent can further include the presence of one or more cytokines, e.g., recombinant IL-2, recombinant IL-7, and / or recombinant IL-15. In some embodiments, incubation is carried out in the presence of a recombinant cytokine, such as IL-2 (e.g., 1 U / mL to 500 U / mL, e.g., 10 U / mL to 200 U / mL, e.g., at least or about 50 U / mL or 100 U / mL), IL-7 (e.g., 0.5 ng / mL to 50 ng / mL, e.g., 1 ng / mL to 20 ng / mL, e.g., at least or about 5 ng / mL or 10 ng / mL), or IL-15 (e.g., 0.1 ng / mL to 50 ng / mL, e.g., 0.5 ng / mL to 25 ng / mL, e.g., at least or about 1 ng / mL or 5 ng / mL). In some embodiments, the stimulatory agent (e.g., anti-CD3 / anti-CD28 antibody) is washed or removed from the cells prior to introducing or delivering into the cells an agent Cas9 / gRNA RNP and / or polynucleotide template capable of inducing gene disruption. In some embodiments, the cells are rested prior to introducing the agent, e.g., by removing any stimulating or activating agents, hi some embodiments, stimulating or activating agents and / or cytokines are not removed prior to introducing the agent.

[0187] In some embodiments, following introduction of an agent, e.g., Cas9 / gRNA, and / or polynucleotide template, the cells are incubated, cultured, or incubate in the presence of one or more recombinant cytokines, e.g., recombinant IL-2, recombinant IL-7, and / or recombinant IL-15. In some embodiments, incubation is in the presence of a recombinant cytokine, e.g., IL-2 (e.g., 1 U / mL to 500 U / mL, e.g., 10 U / mL to 200 U / mL, e.g., at least or about 50 U / mL or 100 U / mL), IL-7 (e.g., 0.5 ng / mL to 50 ng / mL, e.g., 1 ng / mL to 20 ng / mL, e.g., at least or about 5 ng / mL or 10 ng / mL), or IL-15 (e.g., 0.1 ng / mL to 50 ng / mL, e.g., 0.5 ng / mL to 25 ng / mL, e.g., at least or about 1 ng / mL or 5 ng / mL). The cells can be incubated or cultured under conditions to induce cell proliferation or expansion. In some embodiments, the cells can be incubated or cultured until a threshold cell number for harvesting, eg, a therapeutically effective amount, is achieved.

[0188] In some embodiments, incubation during any part of the process or the entire process can be at a temperature of 30°C ± 2°C to 39°C ± 2°C, e.g., at least or about at least 30°C ± 2°C, 32°C ± 2°C, 34°C ± 2°C, or 37°C ± 2°C. In some embodiments, at least a portion of the incubation is at 30°C ± 2°C and at least a portion of the incubation is at 37°C ± 2°C.

[0189] In some embodiments, upon targeted integration, the nucleic acid sequence present at the modified TRAC or TRBC locus comprises a fusion of a transgene targeted by HDR with an open reading frame or a subsequence thereof from the endogenous TRAC or TRBC locus. In some aspects, the nucleic acid sequence present at the modified TRAC or TRBC locus comprises a transgene integrated at the endogenous TRAC or TRBC locus containing an open reading frame encoding a TCR alpha or TCR beta constant domain. In some aspects, upon targeted integration or fusion, e.g., in-frame fusion, a portion of the exogenous sequence and a portion of the open reading frame from the endogenous TRAC or TRBC locus together encode a recombinant TCR alpha or TCR beta chain. Thus, provided embodiments utilize a portion or all of the open reading frame sequence from the endogenous TRAC or TRBC locus to encode the complete TCR alpha or TCR beta chain of the recombinant TCR.

[0190] In certain embodiments, the nucleic acid sequence present at the modified TRAC locus is or comprises a fusion of a transgene targeted by HDR with the open reading frame of the endogenous TRAC locus or a subsequence thereof. In certain embodiments, the nucleic acid sequence present at the modified TRAC locus comprises a transgene integrated at the endogenous TRAC locus containing an open reading frame encoding a TCR alpha constant domain. In certain embodiments, upon targeted integration or fusion, e.g., in-frame fusion, a portion of the foreign sequence and a portion of the open reading frame of the endogenous TRAC locus together encode a recombinant TCR alpha chain and / or a protein containing the TCR alpha constant domain. In certain embodiments, the protein containing the TCR alpha chain and / or the TCR alpha constant domain contains a functional TCR alpha constant domain, e.g., a TCR alpha constant domain capable of binding to a TCR beta chain.

[0191] In some embodiments, the nucleic acid sequence present in the modified TRBC locus, for example, the modified TRBC1 and / or TRBC2 locus, is or includes a fusion of a transgene targeted by HDR with the open reading frame of the endogenous TRBC locus or a subsequence thereof. In certain embodiments, the nucleic acid sequence present in the modified TRBC locus includes a transgene integrated at the endogenous TRBC locus containing an open reading frame encoding a TCR β constant domain. In certain embodiments, upon targeted integration or fusion, for example, in-frame fusion, a portion of the exogenous sequence and a portion of the open reading frame of the endogenous TRBC locus together encode a recombinant TCR β chain and / or a protein containing a TCR β constant domain. In certain embodiments, the protein containing a TCR β chain and / or a TCR β constant domain contains a functional TCR β constant domain, for example, a TCR β constant domain capable of binding to a TCR β chain.

[0192] A. Gene disruption In some embodiments, one or more targeted gene disruptions are induced in the endogenous TCR alpha gene and / or the endogenous TCR beta gene. In some embodiments, the targeted gene disruptions are induced in one or more of the genes encoding the TCR alpha constant domain (also known as the TCR alpha constant region; encoded by TRAC in humans) and / or the TCR beta constant domain (also known as the TCR beta constant region; encoded by TRBC1 or TRBC2 in humans). In some embodiments, the targeted gene disruptions are induced in the TRAC, TRBC1, and TRBC2 loci. In some embodiments, the targeted gene disruptions are induced in introns, for example, introns of TRAC, TRBC1, or TRBC2. In some embodiments, the targeted gene disruptions are induced in exons, for example, exons of TRAC, TRBC1, or TRBC2.

[0193] In some embodiments, targeted gene disruption results in DNA breaks or nicks. In some embodiments, the action of cellular DNA repair mechanisms at the site of DNA breaks can result in knockout, insertion, missense, or frameshift mutations, such as biallelic frameshift mutations, or deletion of all or part of a gene. In some embodiments, gene disruption can be targeted to one or more exons of a gene or part thereof, for example, within the first or second exon. In some embodiments, a DNA-binding protein or DNA-binding nucleic acid that specifically binds or hybridizes to a sequence in a region near at least one of the target sites is used for targeted disruption. In some aspects, in the absence of an exogenous template polynucleotide for HDR, disruption or targeted gene disruption results in deletion, mutation, and / or insertion within an exon of a gene. In some embodiments, a template polynucleotide, for example, a template polynucleotide comprising a nucleic acid sequence encoding a recombinant receptor and a homologous sequence, can be introduced for targeted integration of the sequence encoding the recombinant receptor at or near the site of gene disruption by HDR, such as any integration described in Section IB of this specification.

[0194] In some embodiments, gene disruption is caused by introducing one or more agents that can induce gene disruption.In some embodiments, such agents include DNA-binding proteins or DNA-binding nucleic acids that specifically bind or hybridize to genes.In some embodiments, the agents include fusion proteins that include various components, such as DNA targeting proteins and nucleases or RNA-guided nucleases.In some embodiments, the agents can target one or more target locations, for example, in the TRAC gene and one or both of the TRBC1 gene and the TRBC2 gene.

[0195] In some embodiments, gene disruption occurs at a target site (also referred to as a "target position," "target DNA sequence," or "target location," and / or known as a "target position," "target DNA sequence," or "target location"). In some embodiments, the target site is or includes a site on target DNA (e.g., genomic DNA) that is modified by one or more agents capable of inducing gene disruption, such as a Cas9 molecule complexed with a gRNA that specifies the target site. For example, in some embodiments, the target site may include a location where cleavage or DNA breakage occurs in the DNA of, for example, the endogenous TRAC or TRBC locus. In some aspects, integration of a nucleic acid sequence by HDR can occur at or near the target site or target sequence. In some embodiments, the target site may be a site between two nucleotides, e.g., adjacent nucleotides, on DNA where one or more nucleotides are added. The target site may include one or more nucleotides that are changed by a template polynucleotide. In some embodiments, the target site is within a target sequence (e.g., a sequence to which a gRNA binds). In some embodiments, the target site is upstream or downstream of the target sequence.

[0196] 1. Target sites in genes encoding endogenous T cell receptors (TCRs) In some embodiments, the targeted gene disruption occurs in an endogenous gene encoding one or more domains, regions, and / or chains of an endogenous T cell receptor (TCR). In some embodiments, the gene disruption is targeted to the endogenous locus encoding TCR alpha and / or TCR beta. In some embodiments, the gene disruption is targeted to the gene encoding the TCR alpha constant domain (TRAC in humans) and / or the TCR beta constant domain (TRBC1 or TRBC2 in humans).

[0197] In some embodiments, a "T cell receptor" or "TCR" is a molecule that includes variable α and β chains (also known as TCRα and TCRβ, respectively) or variable γ and δ chains (also known as TCRγ and TCRδ, respectively), or antigen-binding portions thereof, including endogenous TCRs, and is capable of specifically binding to peptides bound to MHC molecules. In some embodiments, the TCR is in the αβ form. Typically, TCRs, which exist in the αβ and γδ forms, are generally structurally similar, although T cells that express them may have different anatomical locations or functions. Typically, one T cell expresses one type of TCR. TCRs can be found on the cell surface or in a soluble form. Generally, TCRs are found on the surface of T cells (or T lymphocytes), which are generally responsible for recognizing antigens bound to major histocompatibility complex (MHC) molecules.

[0198] In some embodiments, a TCR can include variable and constant domains (also known as constant regions), a transmembrane domain, and / or a short cytoplasmic tail (see, e.g., Janeway et al., Immunobiology: The Immune System in Health and Disease, 3 rd Ed., Current Biology Publications, p. 4:33, 1997). In some embodiments, a TCR chain comprises one or more constant domains. For example, the extracellular portion of a given TCR chain (e.g., a TCR α chain or a TCR β chain) comprises two immunoglobulin-like domains, e.g., variable domains (e.g., Vα or Vβ; typically, according to Kabat numbering, Kabat et al., "Sequences of Proteins of Immunological Interest," U.S. Dept. Health and Human Services, Public Health Service National Institutes of Health, 1991, 5 thThe extracellular portion of a TCR can include an α chain constant domain (e.g., amino acids 1-116, based on Kabat numbering) adjacent to the cell membrane (e.g., an α chain constant domain or TCR Cα, typically at chain positions 117-259, based on Kabat numbering, or a β chain constant domain or TCR Cβ, typically at chain positions 117-295, based on Kabat numbering). For example, in some cases, the extracellular portion of a TCR formed by the two chains includes two membrane-proximal constant domains and two membrane-distal variable domains.

[0199] In some embodiments, the endogenous TCR Cα is encoded by the TRAC gene (IMGT nomenclature). An exemplary nucleotide sequence of the human T cell receptor alpha constant chain (TRAC) locus is set forth in SEQ ID NO: 1 (NCBI Reference Sequence: NG_001332.3, TRAC). In some embodiments, the encoded endogenous Cα comprises the amino acid sequence set forth in SEQ ID NO: 19 or 24 (UniProtKB Accession No. P01848 or Genbank Accession No. CAA26636.1).

[0200] In humans, an exemplary genomic locus for TRAC contains an open reading frame containing four exons and three introns. An exemplary mRNA transcript for TRAC can span the sequence corresponding to the forward strand coordinates of chromosome 14: 22,547,506-22,552,154 for human genome version GRCh38 (UCSC Genome Browser on Human Dec. 2013 (GRCh38 / hg38) Assembly). Table 1 lists the coordinates of the exons and introns and untranslated regions of the open reading frame of an exemplary human TRAC locus transcript.

[0201] Table 1. Exon and intron coordinates of an exemplary human TRAC locus (GRCh38, chromosome 14, forward strand). TIFF0007630280000015.tif43169

[0202] In certain embodiments, the gene disruption is targeted to, near, or within the TRAC locus. In certain embodiments, the gene disruption is targeted to, near, or within the open reading frame of the TRAC locus. In certain embodiments, the gene disruption is targeted to, near, or within the open reading frame encoding the TCR alpha constant domain. In some embodiments, the gene disruption is targeted to the nucleic acid sequence set forth in SEQ ID NO: 1, or SEQ ID NO: The nucleic acid sequence may be targeted to, near, or within a locus having 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, or 99.9% sequence identity to all or a portion of the nucleic acid sequence set forth in NO:1, for example, 500, 1,000, 1,500, 2,000, 2,500, 3,000, 3,500, or 4,000, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, or 99.9% sequence identity over at least 500, 1,000, 1,500, 2,000, 2,500, 3,000, 3,500, or 4,000 consecutive nucleotides.

[0203] In humans, an exemplary genomic locus for TRBC1 contains an open reading frame containing four exons and three introns. An exemplary mRNA transcript for TRBC1 can span the sequence corresponding to the forward strand coordinates of chromosome 7: 142,791,694 to 142,793,368, relative to human genome version GRCh38 (UCSC Genome Browser on Human Dec. 2013 (GRCh38 / hg38) Assembly). Table 2 lists the coordinates of the exons and introns and untranslated regions of the open reading frame of an exemplary human TRBC1 locus transcript.

[0204] Table 2. Exon and intron coordinates of an exemplary human TRBC1 locus (GRCh38, chromosome 7, forward strand) TIFF0007630280000016.tif43169

[0205] In humans, an exemplary genomic locus for TRBC2 contains an open reading frame comprising four exons and three introns. An exemplary mRNA transcript for TRBC2 can span a sequence corresponding to the forward strand coordinates of chromosome 7: 142,801,041 to 142,802,748, relative to human genome version GRCh38 (UCSC Genome Browser on Human Dec. 2013 (GRCh38 / hg38) Assembly). Table 3 lists the coordinates of the exons and introns and untranslated regions of the open reading frame of a transcript of an exemplary human TRBC2 locus.

[0206] Table 3. Exon and intron coordinates of an exemplary human TRBC2 locus (GRCh38, chromosome 7, forward strand) TIFF0007630280000017.tif43169

[0207] In some aspects, the transgene (e.g., exogenous nucleic acid sequence) in the template polynucleotide can be used to guide the location of the target site and / or homology arm. In some aspects, the target site of the gene disruption can be used as a guide for designing the template polynucleotide and / or homology arm used in HDR. In some embodiments, the gene disruption can be targeted near the desired site of targeted integration of the transgene sequence (e.g., encoding a recombinant TCR or a portion thereof). In some aspects, the target site is within an exon of the open reading frame of the TRAC, TRBC1, and / or TRBC2 locus. In some aspects, the target site is within an intron of the open reading frame of the TRAC, TRBC1, and / or TRBC2 locus.

[0208] In some embodiments, the endogenous TCR Cβ is encoded by the TRBC1 or TRBC2 gene (IMGT nomenclature). An exemplary nucleotide sequence of the human T cell receptor beta constant chain 1 (TRBC1) locus is set forth in SEQ ID NO:2 (NCBI Reference Sequence: NG_001333.2, TRBC1); an exemplary nucleotide sequence of the human T cell receptor beta constant chain 2 (TRBC2) locus is set forth in SEQ ID NO:3 (NCBI Reference Sequence: NG_001333.2, TRBC2). In some embodiments, the encoded Cβ has or comprises the amino acid sequence set forth in SEQ ID NO:20, 21, or 25 (Uniprot Accession Nos. P01850, A0A5B9, or A0A0G2JNG9). In some embodiments, the gene disruption is targeted to, near, or within the TRBC1 locus. In certain embodiments, the gene disruption is targeted to, near, or within the open reading frame of the TRBC1 locus. In certain embodiments, the gene disruption is targeted to, near, or within the open reading frame encoding the TCR beta constant domain. In some embodiments, the gene disruption is targeted to the nucleic acid sequence set forth in SEQ ID NO:2, or SEQ ID NO: The nucleic acid sequence may be targeted to, near, or within a locus having 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, or 99.9% sequence identity over, or at least, 500, 1,000, 1,500, 2,000, 2,500, 3,000, 3,500, or 4,000 consecutive nucleotides of, all or a portion of, the nucleic acid sequence set forth in NO:2.

[0209] In certain embodiments, the gene disruption is targeted to, near, or within the TRBC2 locus. In certain embodiments, the gene disruption is targeted to, near, or within the open reading frame of the TRBC2 locus. In certain embodiments, the gene disruption is targeted to, near, or within the open reading frame of the TRBC2 locus. In some embodiments, the gene disruption is targeted to, near, or within the open reading frame encoding the TCR beta constant domain. In some embodiments, the gene disruption is targeted to the nucleic acid sequence set forth in SEQ ID NO:3, or SEQ ID NO:4. The nucleic acid sequence may be targeted to, near, or within a locus having a sequence with 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, or 99.9% sequence identity over, or at least, 500, 1,000, 1,500, 2,000, 2,500, 3,000, 3,500, or 4,000 consecutive nucleotides to all or a portion of the nucleic acid sequence set forth in NO:3.

[0210] In some embodiments, gene disruption, e.g., DNA cleavage, is targeted to the beginning of the coding region (e.g., within 500 bp of the initial coding region, e.g., from the start codon, or the remaining coding sequence downstream of the first 500 bp of the start codon), or in close proximity to the beginning. In some embodiments, gene disruption, e.g., DNA cleavage, is targeted to the initial coding region of a gene of interest, e.g., TRAC, TRBC1, and / or TRBC2, where the initial coding region includes the sequence immediately after the transcription start point, within the first exon of the coding sequence, or within 500 bp (e.g., less than 500, 450, 400, 350, 300, 250, 200, 150, 100, or 50 bp) of the transcription start point, or within 500 bp (e.g., less than 500, 450, 400, 350, 300, 250, 200, 150, 100, or 50 bp) of the start codon.

[0211] In some embodiments, the target site is within an exon of the endogenous TRAC locus. In certain embodiments, the target site is within an intron of the endogenous TRAC locus. In some aspects, the target site is within a regulatory or control element of the TRAC locus, such as a promoter, a 5' untranslated region (UTR), or a 3' UTR. In certain embodiments, the target site is within the open reading frame of the endogenous TRAC locus. In certain embodiments, the target site is within an exon in the open reading frame of the TRAC locus.

[0212] In certain embodiments, gene disruption (for example, DNA break) is targeted to or within the open reading frame of gene or locus of interest, for example, TRAC, TRBC1, and / or TRBC2.In some embodiments, gene disruption is targeted to or within the intron of the open reading frame of gene or locus of interest.In some embodiments, gene disruption is targeted to or within the exon of the open reading frame of gene or locus of interest.

[0213] In certain embodiments, gene disruption (for example, DNA cleavage) is targeted to intron or in intron.In certain embodiments, gene disruption (for example, DNA cleavage) is targeted to exon or in exon.In some embodiments, gene disruption (for example, DNA cleavage) is targeted to exon or in exon of gene of interest, for example, TRAC, TRBC1 and / or TRBC2.

[0214] In certain embodiments, the gene disruption, e.g., DNA break, is targeted within an exon of a TRBC gene, open reading frame, or locus, e.g., TRBC1 and / or TRBC2. In certain embodiments, the gene disruption is within the first, second, third, or fourth exon of a TRBC1 and / or TRBC2 gene, open reading frame, or locus. In some embodiments, the gene disruption is within the first exon of a TRBC1 and / or TRBC2 gene, open reading frame, or locus. In certain embodiments, the gene disruption is within the first, second, third, or fourth exon of a TRBC1 and / or TRBC2 gene, open reading frame, or locus. In some embodiments, the gene disruption is between the 5'-most nucleotide of exon 1 and the upstream of the 3'-most nucleotide of exon 1. In certain embodiments, the gene disruption is within the first exon of a TRBC gene, open reading frame, or locus. In some embodiments, the gene disruption is within 400 bp, 350 bp, 300 bp, 250 bp, 200 bp, 150 bp, 100 bp, or 50 bp downstream of the 5' end of the first exon in the TRBC1 and / or TRBC2 gene, open reading frame, or locus. In certain embodiments, the gene disruption is within 1 bp to 400 bp, 50 to 300 bp, 100 bp to 200 bp, or 100 bp to 150 bp, inclusive, downstream of the 5' end of the first exon in the TRBC1 and / or TRBC2 gene, open reading frame, or locus. In certain embodiments, the gene disruption is within 100 bp to 150 bp, inclusive, downstream of the 5' end of the first exon in the TRBC1 and / or TRBC2 gene, open reading frame, or locus.

[0215] In certain embodiments, the gene disruption, e.g., DNA break, is targeted within an exon of the TRBC gene, open reading frame, or locus, e.g., TRBC1 and / or TRBC2. In certain embodiments, the gene disruption is within the first, second, third, or fourth exon of the TRBC gene, open reading frame, or locus. In some embodiments, the gene disruption is within the first exon of the TRBC gene, open reading frame, or locus. In certain embodiments, the gene disruption is within the first, second, third, or fourth exon of the TRBC gene, open reading frame, or locus. In some embodiments, the gene disruption is between the 5' nucleotide of exon 1 and the 3' nucleotide upstream of exon 1. In certain embodiments, the gene disruption is within the first exon of the TRBC gene, open reading frame, or locus. In some embodiments, the gene disruption is within 400 bp, 350 bp, 300 bp, 250 bp, 200 bp, 150 bp, 100 bp, or 50 bp downstream of the 5' end of the first exon in the TRBC gene, open reading frame, or locus. In certain embodiments, the gene disruption is within 1 bp to 400 bp, 50 to 300 bp, 100 bp to 200 bp, or 100 bp to 150 bp, inclusive, downstream of the 5' end of the first exon in the TRBC gene, open reading frame, or locus. In certain embodiments, the gene disruption is within 100 bp to 150 bp, inclusive, downstream of the 5' end of the first exon in the TRBC gene, open reading frame, or locus.

[0216] 2. Gene disruption method The method for causing gene disruption, including those described herein, can comprise the use of one or more agents capable of inducing gene disruption, such as gene disruption, cleavage and / or double-strand break (DSB) or nick at target site or target location in endogenous DNA, thereby repairing the break by error-causing process such as non-homologous end joining (NHEJ), or repair using repair template HDR, resulting in gene knockout and / or insertion of the sequence of interest (for example, the transgene encoding a part of an exogenous nucleic acid sequence or chimeric receptor) at or near target site or position.Also provided herein are one or more agents capable of inducing gene disruption for use in the methods provided herein.In some aspects, one or more agents can be used in combination with the template nucleotide provided herein for homology-directed repair (HDR)-mediated targeting integration of transgene sequence (for example, as described herein in section IB).

[0217] In some embodiments, one or more agents that can induce gene disruption comprise specific site or position in genome, for example, DNA binding protein or DNA binding nucleic acid that specifically binds or hybridizes to target site or target location.In some aspects, targeted gene disruption of the endogenous gene encoding TCR, for example, DNA cutting or cleavage, is achieved using protein or nucleic acid, and said protein or nucleic acid is bound or complexed with gene editing nuclease, for example, in chimeric or fusion protein.In some embodiments, one or more agents that can induce gene disruption comprise RNA-guided nuclease, or the fusion protein that comprises DNA targeting protein and nuclease.

[0218] In some embodiments, the agent comprises various components, for example, an RNA-guided nuclease, or a fusion protein comprising a DNA targeting protein and a nuclease. In some embodiments, targeted gene disruption is carried out using a DNA targeting molecule comprising a DNA binding protein, for example, one or more zinc finger proteins (ZFPs) or transcription activator-like effectors (TALEs), fused to a nuclease, for example, an endonuclease. In some embodiments, targeted gene disruption is carried out using an RNA-guided nuclease, for example, a clustered regularly interspaced short palindromic nucleic acid (CRISPR)-associated nuclease (Cas) system (including Cas and / or Cfp1). In some embodiments, targeted gene disruption is carried out using an agent that can induce gene disruption, such as sequence-specific or targeted nuclease, including DNA-binding targeted nuclease and gene editing nuclease, such as zinc finger nuclease (ZFN) and transcription activator-like effector nuclease (TALEN), and RNA-guided nuclease, such as CRISPR-associated nuclease (Cas) system, which is specifically designed to target at least one target site, gene sequence, or part thereof.Exemplary ZFN, TALE, and TALEN are described, for example, in Lloyd et al., Frontiers in Immunology, 4(221): 1-7 (2013).

[0219] The binding domains of zinc finger proteins (ZFPs), transcription activator-like effectors (TALEs), and CRISPR systems can be "modified" to bind to predetermined nucleotide sequences, for example, by modifying the recognition helix region of naturally occurring ZFPs or TALEs (changing one or more amino acids). Modified DNA binding proteins (ZFPs or TALEs) are proteins that do not occur in nature. Rational design criteria include the application of substitution rules and computerized algorithms to process information in databases that store information on the design and binding data of existing ZFPs and / or TALEs. For example, see U.S. Patent Nos. 6,140,081; 6,453,242; and 6,534,261. See also WO98 / 53058; WO98 / 53059; WO98 / 53060; WO02 / 016536, and WO03 / 016496 and U.S. Patent Application Publication No. 20110301073.

[0220] In some embodiments, one or more agents specifically target at least one target site, e.g., at or near a gene of interest, e.g., TRAC, TRBC1, and / or TRBC2. In some embodiments, the agent comprises a ZFN, TALEN, or CRISPR / Cas9 combination that specifically binds to, recognizes, or hybridizes to the target site. In some embodiments, the CRISPR / Cas9 system comprises a modified crRNA / tracr RNA ("single guide RNA") to guide specific cleavage. In some embodiments, the agent comprises a nuclease based on the Argonaute system (e.g., derived from T. thermophilus and known as "TtAgo" (Swarts et al. (2014) Nature 507(7491): 258-261). Targeted cleavage using any of the nuclease systems described herein can be exploited to insert a transgene sequence, e.g., a nucleic acid sequence encoding a recombinant receptor, into a specific target location, e.g., of an endogenous TCR gene, using either HDR or NHEJ-mediated processes.

[0221] In some embodiments, a "zinc finger DNA-binding protein" (or binding domain) is a protein or domain within a larger protein that binds to DNA in a sequence-specific manner via one or more zinc fingers, which are regions of amino acid sequence within the binding domain whose structure is stabilized through the coordination of zinc ions. The term zinc finger DNA-binding protein is often abbreviated as zinc finger protein or ZFP. Among ZFPs are artificial ZFP domains, typically 9-18 nucleotides in length, that target specific DNA sequences and are generated by the assembly of individual fingers. ZFPs include those with two, three, four, five, or six fingers, where a single finger domain is approximately 30 amino acids in length and contains an alpha helix containing two invariant histidine residues coordinated via zinc to two cysteines in a single beta turn. Generally, the sequence specificity of ZFPs can be altered by making amino acid substitutions at four helical positions (-1, 2, 3, and 6) on the zinc finger recognition helix. Thus, for example, the ZFP or ZFP-containing molecule is not naturally occurring and has been engineered, eg, to bind to a selected target site.

[0222] In some cases, the DNA targeting molecule is or comprises a zinc finger DNA binding domain that is fused with a DNA cleavage domain to form a zinc finger nuclease (ZFN).For example, the fusion protein comprises a cleavage domain (or cleavage half-domain) derived from at least one type IIS restriction enzyme, and one or more zinc finger binding domains, which may be modified or unmodified.In some cases, the cleavage domain is derived from type IIS restriction endonuclease FokI, which generally catalyzes double-stranded cleavage of DNA at 9 nucleotides from its recognition site on one strand and 13 nucleotides from its recognition site on the other strand. For example, see U.S. Patent No. 5,356,802; 5,436,150 and 5,487,994; Li et al. (1992) Proc. Natl. Acad. Sci. USA 89:4275-4279; Li et al. (1993) Proc. Natl. Acad. Sci. USA 90:2764-2768; Kim et al. (1994a) Proc. Natl. Acad. Sci. USA 91:883-887; Kim et al. (1994b) J. Biol. Chem. 269: 978-982.Some gene-specific modified zinc fingers are commercially available.For example, a platform called CompoZr for zinc finger construction is available, which provides zinc fingers that are specifically targeted to thousands of targets. See, for example, Gaj et al., Trends in Biotechnology, 2013, 31(7), 397-405. In some cases, commercially available zinc fingers are used or custom designed.

[0223] In some embodiments, for example, one or more target sites within the TRAC, TRBC1, and / or TRBC2 genes can be targeted for gene disruption by modified ZFNs. Exemplary ZFNs that target endogenous T cell receptor (TCR) genes include those described in, for example, US2015 / 0164954, US2011 / 0158957, US2015 / 0056705, US8956828, and Torikawa et al. (2012) Blood 119:5697-5705, the disclosures of which are incorporated by reference in their entireties, or those described in any of SEQ ID NOs: 213-224 (TRAC) or SEQ ID NOs: 225 and 226 (TRBC).

[0224] Transcription activator-like effectors (TALEs) are proteins derived from the bacterial species Xanthomonas that contain multiple repeats, each containing two residues (RVDs) at positions 12 and 13 that are specific for each nucleotide base of a nucleic acid target sequence. Binding domains with similar modular base-per-base nucleic acid binding properties (MBBBDs) can also be derived from different bacterial species. The new modular proteins have the advantage of exhibiting more sequence diversity than TAL repeats. In some embodiments, the RVDs involved in recognizing different nucleotides are: HD for recognizing C, NG for recognizing T, NI for recognizing A, NN for recognizing G or A, NS for recognizing A, C, G, or T, HG for recognizing T, IG for recognizing T, NK for recognizing G, HA for recognizing C, ND for recognizing C, HI for recognizing C, HN for recognizing G, NA for recognizing G, SN for recognizing G or A, and YG for recognizing T, TL for recognizing A, VT for recognizing A or G, and SW for recognizing A. In some embodiments, the critical amino acids 12 and 13 can be mutated to other amino acid residues to modulate their specificity for the nucleotides A, T, C, and G, and in particular to enhance this specificity.

[0225] In some embodiments, a "TALE DNA binding domain" or "TALE" is a polypeptide comprising one or more TALE repeat domains / units. The repeat domains, each containing a repeat variable dipeptide (RVD), are responsible for binding of the TALE to its cognate target DNA sequence. A single "repeat unit" (also referred to as a "repeat") is typically 33-35 amino acids in length and exhibits at least some sequence homology to other TALE repeat sequences within naturally occurring TALE proteins. TALE proteins can be engineered to bind to target sites using canonical or non-canonical RVDs within the repeat unit. See, e.g., U.S. Patent Nos. 8,586,526 and 9,458,205.

[0226] In some embodiments, a "TALE nuclease" (TALEN) is a fusion protein comprising a nucleic acid binding domain, typically derived from a transcription activator-like effector (TALE), and a nuclease catalytic domain that cleaves a nucleic acid target sequence. Catalytic domains include nuclease domains or domains with endonuclease activity, such as I-TevI, ColE7, NucA, and Fok-I. In certain embodiments, the TALE domain can be fused to a meganuclease, such as I-CreI and I-OnuI, or functional variants thereof. In some embodiments, the TALEN is a monomeric TALEN. A monomeric TALEN is a TALEN that does not require dimerization for specific recognition and cleavage, such as fusion of engineered TAL repeats to the catalytic domain of I-TevI, as described in WO2012138927. TALENs have been described and used for gene targeting and genetic modification (see, e.g., Boch et al. (2009) Science 326(5959): 1509-12; Moscou and Bogdanove (2009) Science 326(5959): 1501; Christian et al. (2010) Genetics 186(2): 757-61; Li et al. (2011) Nucleic Acids Res 39(1): 359-72).

[0227] In some embodiments, TRAC, TRBC1, and / or TRBC2 genes can be targeted for gene disruption by modified TALEN. Exemplary TALENs that target endogenous T cell receptor (TCR) genes include those described in, for example, WO2017 / 070429, WO2015 / 136001, US20170016025, and US20150203817, the disclosures of which are incorporated by reference in their entirety.

[0228] In some embodiments, "TtAgo" refers to a prokaryotic Argonaute protein believed to be involved in gene silencing. TtAgo is derived from the bacterium Thermus thermophilus. See, e.g., Swarts et al. (2014) Nature 507(7491): 258-261; G. Sheng et al., (2013) Proc. Natl. Acad. Sci. USA 111, 652. The "TtAgo system" refers to all the components required, including guide DNA, for cleavage by the TtAgo enzyme.

[0229] In some embodiments, the engineered zinc finger proteins, TALE proteins, or CRISPR / Cas systems are not found in nature, and their production primarily results from experimental processes such as phage display, interaction traps, or hybrid selection. See, e.g., U.S. Patent Nos. 5,789,538; 5,925,523; 6,007,988; 6,013,453; 6,200,759; WO95 / 19431; WO96 / 06166; WO98 / 53057; WO98 / 54311; WO00 / 27878; WO01 / 60970; WO01 / 88197 and WO02 / 099084.

[0230] Zinc finger and TALE DNA binding domains can be engineered to bind to a predetermined nucleotide sequence, for example, through modification of the recognition helix region of naturally occurring zinc finger proteins (changing one or more amino acids) or by modifying amino acids involved in DNA binding (the repeat variable dipeptide or RVD region). Thus, engineered zinc finger proteins or TALE proteins are non-naturally occurring proteins. A non-limiting example of a method for engineering zinc finger proteins and TALEs is design and selection. Designed proteins are non-naturally occurring proteins whose design / composition results from rational criteria. Rational criteria for design include substitution rules and the application of computerized algorithms to process information in databases that store information on existing ZFP or TALE designs (canonical and non-canonical RVDs) and binding data. See, for example, U.S. Patent Nos. 9,458,205; 8,586,526; 6,140,081; 6,453,242; and 6,534,261. See also WO98 / 53058; WO98 / 53059; WO98 / 53060; WO02 / 016536, and WO03 / 016496.

[0231] Various methods and compositions have been described for the targeted cleavage of genomic DNA.Such targeted cleavage events can be used to induce targeted mutagenesis, induce targeted deletion of cellular DNA sequences, and promote targeted recombination at predetermined chromosomal loci.For example, see U.S. Patent Nos. 9,255,250; 9,200,266; 9,045,763; 9,005,973; 9,150,847; 8,956,828; 8,945,868; 8,703,489; 8,586,526, the disclosures of which are incorporated by reference in their entirety. No. 6,534,261; No. 6,599,692; No. 6,503,717; No. 6,689,558; No. 7,067,317; No. 7,262, No. 054; No. 7,888,121; No. 7,972,854; No. 7,914,796; No. 7,951,925; No. 8,110,379; No. 8,4 09,861; U.S. Patent Publication Nos. 20030232410; 20050208489; 20050026157; 20050064474; 20060063231; 20080159996; 201000218264; 20120017290; 20110265198 See No. 20130137104; No. 20130122591; No. 20130177983; No. 20130196373; No. 20140120622; No. 20150056705; No. 20150335708; No. 20160030477 and No. 20160024474. Also provided are one or more agents that can introduce gene disruption. Also provided are polynucleotides (e.g., nucleic acid molecules) that encode one or more components of one or more agents that can induce gene disruption.

[0232] a. Crispr / Cas9 In some embodiments, targeted gene disruption, e.g., DNA cleavage, of endogenous genes encoding TCRs, e.g., human TRAC and TRBC1 or TRBC2, is performed using clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-associated (Cas) proteins. See Sander and Joung, (2014) Nature Biotechnology, 32(4): 347-355.

[0233] Generally, a "CRISPR system" refers collectively to the transcripts and other elements involved in directing the expression or activity of CRISPR-associated ("Cas") genes, e.g., sequences encoding Cas genes, tracr (trans-activating CRISPR) sequences (e.g., tracrRNA or active partial tracrRNA), tracr mate sequences (which, in endogenous CRISPR systems, encompass "direct repeats" and tracrRNA-processed partial direct repeats), guide sequences (also referred to as "spacers" in endogenous CRISPR systems), and / or other sequences and transcripts from a CRISPR locus.

[0234] In some aspects, a CRISPR / Cas nuclease or CRISPR / Cas nuclease system comprises a non-coding guide RNA (gRNA) that binds to DNA in a sequence-specific manner and a Cas protein (e.g., Cas9) that has nuclease functionality.

[0235] 1) Guide RNA (gRNA) In some embodiments, the one or more agents include at least one of the following: a guide RNA (gRNA) having a targeting domain complementary to a target site in the TRAC gene; a gRNA having a targeting domain complementary to a target site in one or both of the TRBC1 and TRBC2 genes; or at least one nucleic acid encoding a gRNA.

[0236] In some aspects, the term "gRNA molecule" refers to a nucleic acid that facilitates the specific targeting or homing of a gRNA molecule / Cas9 molecule complex to a target nucleic acid, e.g., a locus on the genomic DNA of a cell. The gRNA molecule may be a single molecule (having a single RNA molecule), sometimes referred to herein as a "chimeric" gRNA, or may be modular (comprising more than one, typically two separate RNA molecules). Generally, a guide sequence, e.g., a guide RNA, is any polynucleotide sequence that includes at least one sequence portion that has sufficient complementarity with a target polynucleotide sequence, e.g., the human TRAC, TRBC1, and / or TRBC2 gene, to hybridize with the target sequence at the target site and direct sequence-specific binding of a CRISPR complex to the target sequence. In some embodiments, in the formation of a CRISPR complex, the term "target sequence" generally refers to a sequence to which the guide sequence is designed to have complementarity, and hybridization between the target sequence and a domain, e.g., the targeting domain, of the guide RNA facilitates the formation of a CRISPR complex. Complete complementarity is not necessarily required, as long as there is sufficient complementarity to cause hybridization and promote the formation of CRISPR complex.Generally, guide sequence is selected so as to reduce the degree of secondary structure in guide sequence.Secondary structure can be determined by any suitable polynucleotide folding algorithm.

[0237] In some embodiments, guide RNA (gRNA) specific to a target locus of interest (e.g., human TRAC, TRBC1, and / or TRBC2 locus) is used with an RNA-guided nuclease, such as Cas, to induce DNA cleavage at a target site or location. Methods and exemplary targeting domains for designing gRNAs can include those described in, for example, International PCT Publication Nos. WO2015 / 161276, WO2017 / 193107, and WO2017 / 093969, US2016 / 272999, and US2015 / 056705.

[0238] Some exemplary gRNA structures with domains depicted thereon are described in WO2015 / 161276, e.g., in Figures 1A-1G therein. Without wishing to be bound by theory, regions of high complementarity with respect to the three-dimensional shape of the active form of the gRNA, or intra- or inter-strand interactions, may be depicted as double-stranded in WO2015 / 161276, e.g., in Figures 1A-1G therein, and in other depictions provided herein.

[0239] In some cases, the gRNA is a unimolecular or chimeric gRNA that comprises from 5' to 3' the following: a targeting domain that targets a target site or position within the sequence of, for example, the TRAC locus (an exemplary nucleotide sequence of the human TRAC locus is set forth in SEQ ID NO: 1; NCBI Reference Sequence: NG_001332.3, TRAC; an exemplary genomic sequence is set forth in Table 1 herein); a first complementarity domain; a linking domain; a second complementarity domain (which is complementary to the first complementarity domain); a proximal domain; and, optionally, a tail domain. In some cases, the gRNA is a unimolecular or chimeric gRNA that comprises the following from 5' to 3': a targeting domain that targets a target site or position within the sequence of, for example, the TRBC1 or TRBC2 locus (an exemplary nucleotide sequence of the human TRBC1 locus is set forth in SEQ ID NO:2; NCBI Reference Sequence: NG_001333.2, TRBC1; an exemplary genomic sequence is set forth in Table 2 herein; an exemplary nucleotide sequence of the human TRBC2 locus is set forth in SEQ ID NO:3; NCBI Reference Sequence: NG_001333.2, TRBC2; an exemplary genomic sequence is set forth in Table 3 herein); a first complementarity domain; a linking domain; a second complementarity domain (which is complementary to the first complementarity domain); a proximal domain; and, optionally, a tail domain.

[0240] In other cases, the gRNA is a modular gRNA comprising a first and a second strand. In these cases, the first strand preferably comprises, from 5' to 3', a targeting domain (which may be, for example, a targeting domain for the TRAC locus (an exemplary nucleotide sequence for the human TRAC locus is set forth in SEQ ID NO: 1; NCBI Reference Sequence: NG_001332.3, TRAC; an exemplary genomic sequence is set forth in Table 1 herein), or a targeting domain for the TRBC1 or TRBC2 locus (an exemplary nucleotide sequence for the human TRBC1 locus is set forth in SEQ ID NO: 2; NCBI Reference Sequence: NG_001333.2, TRBC11; an exemplary genomic sequence is set forth in Table 2 herein; an exemplary nucleotide sequence for the human TRBC2 locus is set forth in SEQ ID NO: TRBC2 (NO:3; NCBI Reference Sequence: NG_001333.2, described in TRBC2); and a first complementarity domain. The second strand generally comprises, from 5' to 3', the following: optionally, a 5' extension domain; a second complementarity domain; a proximal domain; and optionally, a tail domain.

[0241] A) Targeting domain Examples of targeting domain configurations include those described in WO2015 / 161276, for example, in Figures 1A-1G therein. The targeting domain comprises a nucleotide sequence that is complementary to a target sequence on a target nucleic acid, e.g., at least 80, 85, 90, 95, 98, or 99% complementary, e.g., fully complementary. The strand of the target nucleic acid that contains the target sequence is referred to herein as the "complementary strand" of the target nucleic acid. Guidance on the selection of targeting domains can be found, for example, in Fu Y et al., Nat Biotechnol 2014 (doi: 10.1038 / nbt.2808) and Sternberg SH et al., Nature 2014 (doi: 10.1038 / nature13011).

[0242] The targeting domain is a portion of an RNA molecule and therefore contains the base uracil (U), whereas any DNA encoding a gRNA molecule contains the base thymine (T). Without wishing to be bound by theory, in some embodiments, the complementarity of the targeting domain and the target sequence is believed to contribute to the specificity of the interaction between the gRNA molecule / Cas9 molecule complex and the target nucleic acid. It is understood that in a targeting domain-target sequence pair, the uracil base in the targeting domain pairs with the adenine base in the target sequence. In some embodiments, the targeting domain itself comprises, in the 5' to 3' direction, any secondary domains and a core domain. In some embodiments, the core domain is fully complementary to the target sequence. In some embodiments, the targeting domain is 5 to 50 nucleotides in length. The strand of the target nucleic acid to which the targeting domain is complementary is referred to herein as the complementary strand. Some or all of the nucleotides in the domain may have modifications, for example, to reduce susceptibility to degradation or to improve biocompatibility. As a non-limiting example, the backbone of the targeting domain can be modified with phosphorothioates or other modifications. In some cases, the nucleotides of the targeting domain can include 2' modifications, e.g., 2-acetylations, e.g., 2' methylations, or other modifications.

[0243] In various embodiments, the targeting domain is 16 to 26 nucleotides in length (i.e., it is 16 nucleotides in length, or 17 nucleotides in length, or 18, 19, 20, 21, 22, 23, 24, 25, or 26 nucleotides in length).

[0244] B) Exemplary Targeting Domains For targeting the gene disruption of human TRAC, TRBC1 or TRBC2, exemplary targeting domains comprised in gRNA include, for example, those described in WO2015 / 161276, WO2017 / 193107, WO2017 / 093969, US2016 / 272999 and US2015 / 056705, or targeting domains that can bind to the aforementioned targeting sequences.For targeting the gene disruption of human TRAC locus using Cas9 of Streptococcus pyogenes (S. pyogenes) or Staphylococcus aureus (S. aureus), exemplary targeting domains comprised in gRNA can include any of those listed in Table 4.

[0245] Table 4. Exemplary TRAC gRNA targeting domain sequences TIFF0007630280000018.tif86166TIFF0007630280000019.tif131166

[0246] For targeting gene disruption of the human TRBC1 or TRBC2 locus using Streptococcus pyogenes or Staphylococcus aureus Cas9, exemplary targeting domains included within the gRNA can include any of those listed in Table 5.

[0247] Table 5: Exemplary TRBC1 or TRBC2 gRNA targeting domain sequences TIFF0007630280000020.tif73166TIFF0007630280000021.tif236166TIFF0007630280000022.tif92166

[0248] In some embodiments, the gRNA for targeting TRAC, TRBC1, and / or TRBC2 can be any of those described herein or elsewhere, for example, WO2015 / 161276, WO2017 / 193107, WO2017 / 093969, US2016 / 272999, and US2015 / 056705, or a targeting domain capable of binding to the aforementioned targeting sequences. In some embodiments, the sequence targeted by the CRISPR / Cas9 gRNA at the TRAC locus is set forth in SEQ ID NOs: 117, 163, and 165-211, e.g., In some embodiments, the sequences targeted by CRISPR / Cas9 gRNAs in the TRBC1 and / or TRBC2 loci are set forth in SEQ ID NOs: 118, 164, and 212, e.g., In some embodiments, the gRNA targeting domain sequence for targeting a target site in the TRAC locus is In some embodiments, the gRNA targeting domain sequence for targeting a target site in the TRBC1 and / or TRBC2 locus is The file is TIFF0007630280000026.tif4128.

[0249] In some embodiments, the gRNA for targeting the TRAC locus comprises the sequence The gRNA can be obtained by in vitro transcription of the target site of the TRAC locus (described in SEQ ID NO: 26; the bold and underlined portion is complementary to the target site of the TRAC locus) or can be chemically synthesized. TIFF0007630280000028.tif18161 (described in SEQ ID NO: 27; see Osborn et al., Mol Ther. 24(3):570-581 (2016)). Other exemplary gRNA sequences for causing gene disruption of endogenous genes encoding TCR domains or regions, such as TRAC, TRBC1, and / or TRBC2, are described, for example, in International PCT Patent Application Publication No. WO2015 / 161276. Exemplary methods for gene editing of endogenous TCR loci include those described, for example, in U.S. Patent Application Publication Nos. US2011 / 0158957, US2014 / 0301990, US2015 / 0098954, US2016 / 0208243; US2016 / 272999, and US2015 / 056705; International PCT Patent Application Publication Nos. WO2014 / 191128, WO2015 / 136001, WO2015 / 161276, WO2016 / 069283, WO2016 / 016341; and Osborn et al. (2016) Mol. Ther. 24(3):570-581. Any of the known methods can be used to cause genetic disruption of an endogenous gene encoding a TCR domain or region and can be used in the embodiments provided herein.

[0250] In some embodiments, targeting domains include those for introducing gene disruptions at the TRAC, TRBC1, and / or TRBC2 loci using Streptococcus pyogenes Cas9 or using N. meningitidis Cas9.

[0251] In some embodiments, targeting domains include those for using S. pyogenes Cas9 to introduce gene disruptions at the TRAC, TRBC1, and / or TRBC2 loci. Any of the targeting domains can be used with S. pyogenes Cas9 molecules that create double-strand breaks (Cas9 nuclease) or single-strand breaks (Cas9 nickase).

[0252] In some embodiments, dual targeting is used to create two nicks in opposite DNA strands by using a Streptococcus pyogenes Cas9 nickase with two targeting domains complementary to opposite DNA strands; for example, any gRNA containing a minus-strand targeting domain can pair with any gRNA containing a plus-strand targeting domain. In some embodiments, the two gRNAs are oriented on the DNA so that the PAMs face outward and the distance between the 5' ends of the gRNAs is 0-50 bp. In some embodiments, two gRNAs are used to target two Cas9 nucleases or two Cas9 nickases, for example, using a pair of Cas9 molecule / gRNA molecule complexes guided by two different gRNA molecules to cleave the target domain with two single-strand breaks on opposite strands of the target domain. In some embodiments, the two Cas9 nickases can comprise a molecule with HNH activity, e.g., a Cas9 molecule with abolished RuvC activity, e.g., a Cas9 molecule with a mutation at D10, e.g., a D10A mutation, a molecule with RuvC activity, e.g., a Cas9 molecule with abolished HNH activity, e.g., a Cas9 molecule with a mutation at H840, e.g., H840A, or a molecule with RuvC activity, e.g., a Cas9 molecule with abolished HNH activity, e.g., a Cas9 molecule with a mutation at N863, e.g., N863A. In some embodiments, each of the two gRNAs is complexed with a D10A Cas9 nickase.

[0253] In some embodiments, the target sequence (target domain) is located at or near the TRAC, TRBC1, and / or TRBC2 locus, such as any portion of the TRAC, TRBC1, and / or TRBC2 coding sequence set forth in SEQ ID NOs: 1-3 or in Tables 1-3 herein. In some embodiments, the target nucleic acid complementary to the targeting domain is located in the early coding region of a gene of interest, e.g., TRAC, TRBC1, and / or TRBC2. Targeting the early coding region can be used for gene disruption (i.e., elimination of expression) of a gene of interest. In some embodiments, the early coding region of a gene of interest includes a sequence immediately following the start codon (e.g., ATG) or within 500 bp (e.g., less than 500, 450, 400, 350, 300, 250, 200, 150, 100, 50 bp, 40 bp, 30 bp, 20 bp, or 10 bp) of the start codon. In particular examples, the target nucleic acid is within 200 bp, 150 bp, 100 bp, 50 bp, 40 bp, 30 bp, 20 bp, or 10 bp of the start codon. In some examples, the targeting domain of the gRNA is complementary, e.g., at least 80, 85, 90, 95, 98, or 99% complementary, e.g., fully complementary, to a target sequence on a target nucleic acid, e.g., a target nucleic acid in the TRAC, TRBC1, and / or TRBC2 locus.

[0254] In some aspects, the gRNA can target a site within an exon of the open reading frame of the endogenous TRAC, TRBC1, and / or TRBC2 locus. In some aspects, the gRNA can target a site within an intron of the open reading frame of the TRAC, TRBC1, and / or TRBC2 locus. In some aspects, the gRNA can target a site within a regulatory or control element, e.g., a promoter, of the TRAC, TRBC1, and / or TRBC2 locus. In some aspects, the target site of the TRAC, TRBC1, and / or TRBC2 locus targeted by the gRNA can be any target site described herein, for example, in Section IA1. In some embodiments, the gRNA can target an exon corresponding to the early coding region, e.g., a site within or very close to exon 1, 2, or 3 of the open reading frame of the endogenous TRAC, TRBC1, and / or TRBC2 locus, or a site comprising a sequence immediately following the transcription start site, within exon 1, 2, or 3, or within less than 500, 450, 400, 350, 300, 250, 200, 150, 100, or 50 bp of exon 1, 2, or 3. In some embodiments, the gRNA can target a site at or near exon 2 of the endogenous TRAC, TRBC1, and / or TRBC2 locus, or within less than 500, 450, 400, 350, 300, 250, 200, 150, 100, or 50 bp of exon 2.

[0255] C) First complementarity domain Examples of first complementarity domains include those described in WO2015 / 161276, e.g., Figures 1A-1G therein. The first complementarity domain is complementary to the second complementarity domain described herein and generally has sufficient complementarity to the second complementarity domain to form a double-stranded region under at least some physiological conditions. The first complementarity domain is typically 5-30 nucleotides in length, and may be 5-25 nucleotides in length, 7-25 nucleotides in length, 7-22 nucleotides in length, 7-18 nucleotides in length, or 7-15 nucleotides in length. In various embodiments, the first complementarity domain is 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides in length.

[0256] Typically, the first complementary domain does not have exact complementarity with the second complementary domain target. In some embodiments, the first complementary domain may have 1, 2, 3, 4, or 5 nucleotides that are not complementary to the corresponding nucleotides of the second complementary domain. For example, a 1, 2, 3, 4, 5, or 6 (e.g., 3) nucleotide segment of the first complementary domain may not be paired in the duplex and can form a non-duplex or looped-out region. In some cases, a non-paired or looped-out region, such as a 3-nucleotide loop-out, exists in the second complementary domain. This non-paired region optionally begins 1, 2, 3, 4, 5, or 6, for example, 4 nucleotides, from the 5' end of the second complementary domain.

[0257] The first complementarity domain can include three subdomains, which, from 5' to 3', are a 5' subdomain, a central subdomain, and a 3' subdomain. In some embodiments, the 5' subdomain is 4 to 9, e.g., 4, 5, 6, 7, 8, or 9 nucleotides in length. In some embodiments, the central subdomain is 1, 2, or 3, e.g., 1 nucleotide in length. In some embodiments, the 3' subdomain is 3 to 25, e.g., 4 to 22, 4 to 18, or 4 to 10, or 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides in length.

[0258] In some embodiments, the first and second complementary domains, when double stranded, can be represented by, for example, the gRNA sequence (one paired strand is underlined and one is in bold): Contains 11 paired nucleotides in TIFF0007630280000029.tif11162.

[0259] In some embodiments, the first and second complementary domains, when double stranded, can be represented by, for example, the gRNA sequence (one paired strand is underlined and one is in bold): Contains 15 paired nucleotides in TIFF0007630280000030.tif19164.

[0260] In some embodiments, the first and second complementary domains, when double stranded, can be represented by, for example, the gRNA sequence (one paired strand is underlined and one is in bold): Contains 16 paired nucleotides in TIFF0007630280000031.tif19162.

[0261] In some embodiments, the first and second complementary domains, when double stranded, can be represented by, for example, the gRNA sequence (one paired strand is underlined and one is in bold): Contains 21 paired nucleotides in TIFF0007630280000032.tif19164.

[0262] In some embodiments, for example, the gRNA sequence (the exchanged nucleotides are underlined): Nucleotides are exchanged to remove the polyU tract in TIFF0007630280000033.tif55164.

[0263] The first complementarity domain may be homologous to or derived from a naturally occurring first complementarity domain, hi some embodiments, it has at least 50% homology to a first complementarity domain disclosed herein, e.g., a first complementarity domain of Streptococcus pyogenes, Staphylococcus aureus, N. meningitidis, or S. thermophilus.

[0264] It should be noted that one or more, or even all, of the nucleotides of the first complementarity domain may have modifications along the lines described herein for the targeting domain.

[0265] D) Concatenated domain Examples of linking domains include those described in WO2015 / 161276, e.g., Figures 1A-1G therein. In a unimolecular or chimeric gRNA, the linking domain serves to link a first complementary domain to a second complementary domain of the unimolecular gRNA. The linking domain can covalently or non-covalently link the first and second complementary domains. In some embodiments, the linkage is a covalent bond. In some embodiments, the linking domain covalently joins the first and second complementary domains. See, e.g., WO2015 / 161276, e.g., Figures 1B-1E therein. In some embodiments, the linking domain is or includes a covalent bond inserted between the first complementary domain and the second complementary domain. Typically, a linking domain comprises one or more, for example, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides, although in various embodiments the linker may be 20, 30, 40, 50, or even 100 nucleotides in length.

[0266] In modular gRNA molecules, the two molecules are joined by hybridization of complementary domains and a linking domain may be absent. See, e.g., WO2015 / 161276, e.g., Figure 1A therein.

[0267] A wide variety of linking domains are suitable for use in a unimolecular gRNA molecule. Linking domains can consist of a covalent bond or can be as short as one or a few nucleotides, e.g., 1, 2, 3, 4, or 5 nucleotides in length. In some embodiments, linking domains are 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, or 25 or more nucleotides in length. In some embodiments, linking domains are 2-50, 2-40, 2-30, 2-20, 2-10, or 2-5 nucleotides in length. In some embodiments, linking domains are homologous to or derived from naturally occurring sequences, e.g., sequences of tracrRNAs that are 5' to the second complementarity domain. In some embodiments, linking domains have at least 50% homology to the linking domains disclosed herein.

[0268] As described herein for the first complementarity domain, some or all of the nucleotides of the linking domain may comprise modifications.

[0269] E) 5' extension domain In some cases, the modular gRNA can include an additional sequence 5' to the second complementarity domain, referred to herein as a 5' extension domain (WO2015 / 161276, e.g., Figure 1A therein). In some embodiments, the 5' extension domain is 2-10, 2-9, 2-8, 2-7, 2-6, 2-5, or 2-4 nucleotides in length. In some embodiments, the 5' extension domain is 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more nucleotides in length.

[0270] F) Second complementarity domain Examples of second complementarity domains include those described in WO2015 / 161276, e.g., in Figures 1A-1G therein. The second complementarity domain is complementary to the first complementarity domain and generally has sufficient complementarity to the second complementarity domain to form a double-stranded region under at least some physiological conditions. In some cases, e.g., as shown in WO2015 / 161276, e.g., in Figures 1A-1B therein, the second complementarity domain can include a sequence that lacks complementarity with the first complementarity domain, e.g., a sequence that loops out from the double-stranded region.

[0271] The second complementary domain can be 5 to 27 nucleotides in length, and in some cases can be longer than the first complementary region. For example, the second complementary domain can be 7 to 27 nucleotides in length, 7 to 25 nucleotides in length, 7 to 20 nucleotides in length, or 7 to 17 nucleotides in length. More commonly, the complementary domain can be 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 nucleotides in length.

[0272] In some embodiments, the second complementarity domain comprises three subdomains, which, in the 5' to 3' direction, are a 5' subdomain, a central subdomain, and a 3' subdomain. In some embodiments, the 5' subdomain is 3 to 25, e.g., 4 to 22, 4 to 18, or 4 to 10, or 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides in length. In some embodiments, the central subdomain is 1, 2, 3, 4, or 5, e.g., 3 nucleotides in length. In some embodiments, the 3' subdomain is 4 to 9, e.g., 4, 5, 6, 7, 8, or 9 nucleotides in length.

[0273] In some embodiments, the 5' and 3' subdomains of a first complementarity domain are complementary, eg, fully complementary, to the 3' and 5' subdomains of a second complementarity domain, respectively.

[0274] The second complementarity domain may be homologous to or derived from a naturally occurring second complementarity domain, hi some embodiments, it has at least 50% homology to a second complementarity domain disclosed herein, e.g., a first complementarity domain of Streptococcus pyogenes, Staphylococcus aureus, Neisseria meningitidis, or S. thermophilus.

[0275] Some or all of the nucleotides of the second complementarity domain may have a modification, such as a modification described herein.

[0276] G) Proximal domain Examples of proximal domains include those described in WO2015 / 161276, e.g., Figures 1A-1G therein. In some embodiments, the proximal domain is 5-20 nucleotides in length. In some embodiments, the proximal domain may be homologous to or derived from a naturally occurring proximal domain. In some embodiments, it has at least 50% homology to a proximal domain disclosed herein, e.g., a proximal domain of Streptococcus pyogenes, Staphylococcus aureus, Neisseria meningitidis, or S. thermophilus.

[0277] Some or all of the nucleotides of the proximal domain may have modifications along the lines described herein.

[0278] H) Tail domain Examples of tail domains include those described in WO2015 / 161276, e.g., Figures 1A-1G therein. As can be seen from an examination of the tail domains in WO2015 / 161276, e.g., Figures 1A and 1B-1F therein, a wide variety of tail domains are suitable for use in gRNA molecules. In various embodiments, the tail domain is 0 (none), 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides in length. In certain embodiments, the nucleotides of the tail domain are derived from or have homology to the 5'-terminal sequence of a naturally occurring tail domain. See, e.g., WO2015 / 161276, e.g., Figures 1D or 1E therein. The tail domain also optionally includes sequences that are complementary to each other and form a double-stranded region under at least some physiological conditions.

[0279] The tail domain may have homology to or may be derived from a naturally occurring proximal tail domain. As a non-limiting example, a given tail domain according to various aspects of the present disclosure may have at least 50% homology to a naturally occurring tail domain disclosed herein, e.g., a tail domain of Streptococcus pyogenes, Staphylococcus aureus, Neisseria meningitidis, or S. thermophilus.

[0280] In certain cases, the tail domain contains nucleotides at the 3' end that are relevant for in vitro or in vivo transcription methods. When a T7 promoter is used for in vitro transcription of gRNA, these nucleotides can be any nucleotides that precede the 3' end of the DNA template. When a U6 promoter is used for in vivo transcription, these nucleotides can be the sequence UUUUUU. When an alternative Pol-III promoter is used, these nucleotides can be a different number, or can be uracil bases, or can contain alternative bases.

[0281] As a non-limiting example, in various embodiments, the proximal and tail domains, taken together, comprise the following sequences: TIFF0007630280000034.tif48170.

[0282] In some embodiments, the tail domain comprises the 3' sequence UUUUUU, e.g., when a U6 promoter is used for transcription. In some embodiments, the tail domain comprises the 3' sequence UUUU, e.g., when an H1 promoter is used for transcription. In some embodiments, the tail domain comprises a variable number of 3' U's, depending, e.g., on the termination signal of the Pol-III promoter used. In some embodiments, the tail domain comprises a variable 3' sequence derived from the DNA template, e.g., when a T7 promoter is used. In some embodiments, the tail domain comprises a variable 3' sequence derived from the DNA template, e.g., when in vitro transcription is used to generate the RNA molecule. In some embodiments, the tail domain comprises a variable 3' sequence derived from the DNA template, e.g., when a Pol-II promoter is used to drive transcription.

[0283] In some embodiments, the gRNA has the following structure: 5' [targeting domain] - [first complementarity domain] - [linking domain] - [second complementarity domain] - [proximal domain] - [tail domain] - 3', where the targeting domain comprises a core domain and optionally a secondary domain and is 10-50 nucleotides in length; the first complementarity domain is 5-25 nucleotides in length and in some embodiments has at least 50, 60, 70, 80, 85, 90, 95, 98, or 99% homology with a reference first complementarity domain disclosed herein. the linking domain is 1-5 nucleotides in length; the proximal domain is 5-20 nucleotides in length and, in some embodiments, has at least 50, 60, 70, 80, 85, 90, 95, 98, or 99% homology to a reference proximal domain disclosed herein; the tail domain is absent or has a nucleotide sequence 1-50 nucleotides in length and, in some embodiments, has at least 50, 60, 70, 80, 85, 90, 95, 98, or 99% homology to a reference tail domain disclosed herein.

[0284] I) Exemplary chimeric gRNAs In some embodiments, the unimolecular or chimeric gRNA preferably comprises, from 5' to 3', e.g., 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 nucleotides: a targeting domain (which is complementary to the target nucleic acid); a first complementarity domain; a linking domain; a second complementarity domain (which is complementary to the first complementarity domain); a proximal domain; and a tail domain, wherein (a) the proximal and tail domains, taken together, are at least 15, 18, 20, 25, 30, 31, 35, or 40 nucleotides long. , 40, 45, 49, 50, or 53 nucleotides; (b) there are at least 15, 18, 20, 25, 30, 31, 35, 40, 45, 49, 50, or 53 nucleotides 3' to the last nucleotide of the second complementarity domain; or (c) there are at least 16, 19, 21, 26, 31, 32, 36, 41, 46, 50, 51, or 54 nucleotides 3' to the last nucleotide of the second complementarity domain that is complementary to the corresponding nucleotide of the first complementarity domain.

[0285] In some embodiments, the sequence from (a), (b), or (c) has at least 60, 75, 80, 85, 90, 95, or 99% homology to the corresponding sequence of a naturally occurring gRNA or to a gRNA described herein. In some embodiments, the proximal and tail domains collectively comprise at least 15, 18, 20, 25, 30, 31, 35, 40, 45, 49, 50, or 53 nucleotides. In some embodiments, at least 15, 18, 20, 25, 30, 31, 35, 40, 45, 49, 50, or 53 nucleotides are present 3' to the last nucleotide of the second complementarity domain. In some embodiments, there are at least 16, 19, 21, 26, 31, 32, 36, 41, 46, 50, 51, or 54 nucleotides 3' to the last nucleotide of the second complementarity domain that is complementary to the corresponding nucleotide of the first complementarity domain. In some embodiments, the targeting domain comprises, has, or consists of 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 nucleotides (e.g., 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 consecutive nucleotides) that have complementarity with the target domain, e.g., the targeting domain is 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 nucleotides in length.

[0286] In some embodiments, a unimolecular or chimeric gRNA molecule (comprising a targeting domain, a first complementary domain, a linking domain, a second complementary domain, a proximal domain, and optionally a tail domain) has the following sequence: TIFF0007630280000035.tif19164. In some embodiments, the mono- or chimeric gRNA molecule is a Streptococcus pyogenes gRNA molecule.

[0287] In some embodiments, a unimolecular or chimeric gRNA molecule (comprising a targeting domain, a first complementary domain, a linking domain, a second complementary domain, a proximal domain, and optionally a tail domain) has the following sequence: TIFF0007630280000036.tif19164. In some embodiments, the monomolecular or chimeric gRNA molecule is a Staphylococcus aureus gRNA molecule. The sequences and structures of exemplary chimeric gRNAs are also shown in WO2015 / 161276, e.g., Figures 10A-10B therein.

[0288] J) Exemplary modular gRNAs In some embodiments, the modular gRNA comprises a first and a second strand: the first strand preferably comprises, from 5' to 3', a targeting domain comprising, for example, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 nucleotides; The second strand preferably comprises, from 5' to 3', an optional 5' extension domain; a second complementarity domain; a proximal domain; and a tail domain, wherein (a) the proximal and tail domains collectively comprise at least 15, 18, 20, 25, 30, 31, 35, 40, 45, 49, 50, or 53 nucleotides; (b) there are at least 15, 18, 20, 25, 30, 31, 35, 40, 45, 49, 50, or 53 nucleotides 3' to the last nucleotide of the second complementarity domain; or (c) there are at least 16, 19, 21, 26, 31, 32, 36, 41, 46, 50, 51, or 54 nucleotides 3' to the last nucleotide of the second complementarity domain that is complementary to the corresponding nucleotide of the first complementarity domain.

[0289] In some embodiments, the sequence from (a), (b), or (c) has at least 60, 75, 80, 85, 90, 95, or 99% homology to the corresponding sequence of a naturally occurring gRNA or to a gRNA described herein. In some embodiments, the proximal and tail domains collectively comprise at least 15, 18, 20, 25, 30, 31, 35, 40, 45, 49, 50, or 53 nucleotides. In some embodiments, at least 15, 18, 20, 25, 30, 31, 35, 40, 45, 49, 50, or 53 nucleotides are present 3' to the last nucleotide of the second complementarity domain.

[0290] In some embodiments, there are at least 16, 19, 21, 26, 31, 32, 36, 41, 46, 50, 51, or 54 nucleotides 3' to the last nucleotide of the second complementarity domain that is complementary to the corresponding nucleotide of the first complementarity domain.

[0291] In some embodiments, the targeting domain has or consists of 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 nucleotides (e.g., 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 consecutive nucleotides) that are complementary to the target domain, e.g., the targeting domain is 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 nucleotides in length.

[0292] K) Methods for designing gRNAs The method for designing gRNA is described herein, including the method for selecting, designing and verifying targeting domain.Exemplary targeting domain is also provided herein.The targeting domain discussed herein can be incorporated into the gRNA described herein.

[0293] In some embodiments, a guide RNA (gRNA) specific to a target gene (e.g., human TRAC, TRBC1, and / or TRBC2) is used with an RNA-guided nuclease, e.g., Cas, to induce DNA cleavage at a target site or location. Methods and exemplary targeting domains for designing gRNAs include those described, for example, in International PCT Patent Application Publication No. WO2015 / 161276. The targeting domain can be incorporated into the gRNA used to target the Cas9 nuclease to the target site or location.

[0294] Methods for target sequence selection and validation and off-target analysis are described, for example, in Mali et al., 2013 Science 339(6121): 823-826; Hsu et al. Nat Biotechnol, 31(9): 827-32; Fu et al., 2014 Nat Biotechnol, doi: 10.1038 / nbt.2808. PubMed PMID: 24463574; Heigwer et al., 2014 Nat Methods 11(2):122-3. doi: 10.1038 / nmeth.2812. PubMed PMID: 24481216; Bae et al., 2014 Bioinformatics PubMed PMID: 24463181; Xiao A et al., 2014 Bioinformatics PubMed Listed in PMID: 24389662.

[0295] In some embodiments, software tools can be used to optimize the selection of gRNAs within a user's target sequence, for example, to minimize total off-target activity across the genome. Off-target activity can be other than cleavage. For example, for each possible gRNA selection using Streptococcus pyogenes Cas9, the software tool can identify all potential off-target sequences (preceding either NAG or NGG PAM) across the genome that contain up to a certain number of mismatched base pairs (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10). The cleavage efficiency at each off-target sequence can be predicted, for example, using an experimentally derived weighting scheme. Each possible gRNA can then be ranked according to its total predicted off-target cleavage; the top-ranked gRNAs represent those likely to have the greatest on-target and least off-target cleavage. Other functions may also be included in the tool, such as automated reagent design for gRNA vector construction, primer design for on-target Surveyor assays, and primer design for high-throughput detection and quantification of off-target cleavage via next-generation sequencing. Candidate gRNA molecules can be evaluated by methods known in the art or as described herein.

[0296] In some embodiments, gRNAs for use with Streptococcus pyogenes, Staphylococcus aureus, and Neisseria meningitidis Cas9 are identified using a DNA sequence search algorithm, e.g., using custom gRNA design software based on the public tool cas-offinder (Bae et al. Bioinformatics. 2014;30(10):1473-1475). The custom gRNA design software calculates the genome-wide off-target propensity of the guide and then scores the guide. Typically, matches ranging from a perfect match to seven mismatches are considered for guides ranging in length from 17 to 24. In some aspects, once off-target sites are computationally determined, a total score is calculated for each guide and compiled in a tabular output using a web interface. In addition to identifying potential gRNA sites adjacent to the PAM sequence, the software can also identify all PAM-flanking sequences that differ from the selected gRNA site by one, two, three, or more nucleotides. In some embodiments, the gGenomic DNA sequence for each gene can be obtained from the UCSC Genome browser, and the publicly available RepeatMasker program can be used to screen the sequence for repetitive elements. RepeatMasker searches the input DNA sequence for repetitive elements and low-complexity regions. The output is a detailed annotation of the repeats present in a given query sequence.

[0297] Once identified, gRNAs can be ranked into a hierarchy based on one or more of their distance to the target site, their orthogonality, and the presence of a 5'G (based on identifying exact matches in the human genome with relevant PAMs, e.g., NGG PAM for Streptococcus pyogenes, NNGRR (e.g., NNGRRT or NNGRRV) PAM for Staphylococcus aureus, and NNNNGATT or NNNNGCTT PAM for Neisseria meningitidis). Orthogonality refers to the number of sequences in the human genome that contain a minimal number of mismatches to the target sequence. "High level of orthogonality" or "good orthogonality" can refer, for example, to a 20-mer targeting domain that has no identical sequences in the human genome except for the intended target and no sequences containing one or two mismatches in the target sequence. Targeting domains with good orthogonality are selected to minimize off-target DNA cleavage. It is understood that this is a non-limiting example and that a variety of strategies can be utilized to identify gRNAs for use with Streptococcus pyogenes, Staphylococcus aureus, and Neisseria meningitidis or other Cas9 enzymes.

[0298] In some embodiments, gRNAs for use with S. pyogenes Cas9 can be identified using the publicly available web-based ZiFiT server (Fu et al., Improving CRISPR-Cas nuclease specificity using truncated guide RNAs. Nat Biotechnol. 2014 Jan 26. doi: 10.1038 / nbt.2808. PubMed PMID: 24463574. For original references, see Sander et al., 2007, NAR 35:W599-605; Sander et al., 2010, NAR 38: W462-8). In addition to identifying potential gRNA sites adjacent to the PAM sequence, the software also identifies all PAM-flanking sequences that differ from the selected gRNA site by one, two, three, or more nucleotides. In some aspects, the genomic DNA sequence for each gene can be obtained from the UCSC Genome browser, and the sequence can be screened for repetitive elements using the publicly available Repeat-Masker program. RepeatMasker searches the input DNA sequence for repetitive elements and low-complexity regions. The output is a detailed annotation of the repeats present in a given query sequence.

[0299] Once identified, gRNAs for use with S. pyogenes Cas9 can be ranked into a hierarchy, e.g., a tier of five. In some embodiments, targeting domains for first-tier gRNA molecules are selected based on their distance to the target site, their orthogonality, and the presence of a 5'G (based on ZiFiT identification of exact matches in the human genome containing an NGG PAM). In some embodiments, both 17-mer and 20-mer gRNAs are designed for the target. In some aspects, gRNAs are selected for both single gRNA nuclease cleavage and dual gRNA nickase strategies. The criteria for selecting gRNAs and the decision as to which gRNAs can be used for which strategies can be based on several considerations. In some embodiments, gRNAs are identified for both single gRNA nuclease cleavage and dual gRNA pairing "nickase" strategies. In some embodiments for selecting gRNAs, including determining which gRNAs can be used in a double gRNA pairing "nickase" strategy, the gRNA pair should be oriented on the DNA so that the PAM faces outward and cleavage by the D10A Cas9 nickase will result in a 5' overhang. In some aspects, it can be assumed that cleavage by a double nickase pair will result in the entire deletion of the intervening sequence with a reasonable frequency. However, cleavage by a double nickase pair can also frequently result in an indel mutation at only one site of the gRNA. Candidate pair members can be tested for how efficiently they remove the entire sequence compared to simply causing an indel mutation at one site of the gRNA.

[0300] In some embodiments, targeting domains for first-tier gRNA molecules can be selected based on (1) reasonable distance to the target location, e.g., within the first 500 bp of the coding sequence downstream of the start codon, (2) a high level of orthogonality, and (3) the presence of a 5'G. In some embodiments, for second-tier gRNA selection, the 5'G requirement can be eliminated, but distance restrictions are required and a high level of orthogonality is required. In some embodiments, third-tier selection uses the same distance restrictions and 5'G requirement, but eliminates the requirement for good orthogonality. In some embodiments, fourth-tier selection uses the same distance restrictions, but eliminates the requirement for good orthogonality and starting with a 5'G. In some embodiments, fifth-tier selection eliminates the requirement for good orthogonality and 5'G, and longer sequences (e.g., the remaining coding sequence, e.g., an additional 500 bp upstream or downstream of the transcription target site) are scanned. In certain cases, gRNAs are not identified based on specific tier criteria.

[0301] In some embodiments, gRNAs are specified for single gRNA nuclease cleavage and for dual gRNA pairing "nickase" strategies.

[0302] In some aspects, gRNAs for use with meningococcal and Staphylococcus aureus Cas9 can be manually identified by scanning genomic DNA sequences for the presence of PAM sequences. These gRNAs can be separated into two tiers. In some embodiments, for the first tier of gRNAs, targeting domains are selected within the first 500 bp of the coding sequence downstream of the start codon. In some embodiments, for the second tier of gRNAs, targeting domains are selected within the remaining coding sequence (downstream of the first 500 bp). In certain cases, gRNAs are not identified based on specific tier criteria.

[0303] In some embodiments, another strategy for identifying guide RNAs (gRNAs) for use with Streptococcus pyogenes, Staphylococcus aureus, and Neisseria meningitidis Cas9 can use a DNA sequence search algorithm. In some aspects, guide RNA design is performed using custom guide RNA design software based on the public tool cas-offinder (Bae et al. Bioinformatics. 2014;30(10):1473-1475). The custom guide RNA design software calculates the genome-wide off-target propensity of the guide and then scores the guide. Typically, matches ranging from a perfect match to seven mismatches are considered for guides ranging in length from 17 to 24. Once off-target sites are computationally determined, a total score is calculated for each guide and summarized in a tabular output using a web interface. In addition to identifying potential gRNA sites adjacent to the PAM sequence, the software also identifies all PAM-flanking sequences that differ from the selected gRNA site by one, two, three, or more nucleotides. In some embodiments, the genomic DNA sequence for each gene is obtained from the UCSC Genome browser, and the sequence is screened for repetitive elements using the publicly available RepeatMasker program. RepeatMasker searches the input DNA sequence for repetitive elements and low-complexity regions. The output is a detailed annotation of the repeats present in a given query sequence.

[0304] In some embodiments, once identified, gRNAs are ranked in a hierarchy based on their distance to the target site or their orthogonality (based on identifying exact matches in the human genome with relevant PAMs, e.g., NGG PAM for Streptococcus pyogenes, NNGRR (e.g., NNGRRT or NNGRRV) PAM for Staphylococcus aureus, and NNNNGATT or NNNNGCTT PAM for Neisseria meningitidis). In some aspects, targeting domains with good orthogonality are selected to minimize off-target DNA cleavage.

[0305] As an example, 17-mer or 20-mer gRNAs can be designed for targets of Streptococcus pyogenes and Neisseria meningitidis. As another example, 18-mer, 19-mer, 20-mer, 21-mer, 22-mer, 23-mer, and 24-mer gRNAs can be designed for targets of Staphylococcus aureus.

[0306] In some embodiments, gRNAs are identified for both single gRNA nuclease cleavage and dual gRNA pairing "nickase" strategies. To select gRNAs, including determining which gRNAs can be used in the dual gRNA pairing "nickase" strategy, in some embodiments, the gRNA pair should be oriented on the DNA so that the PAM faces outward and cleavage by the D10A Cas9 nickase will result in a 5' overhang. In some aspects, it can be assumed that cleavage by a dual nickase pair will result in the entire deletion of the intervening sequence with a reasonable frequency. However, cleavage by a dual nickase pair can also frequently result in indel mutations at only one site of the gRNA. Candidate pair members can be tested for how efficiently they remove the entire sequence compared to simply causing an indel mutation at one site of the gRNA.

[0307] To design a strategy for gene disruption, in some embodiments, targeting domains for tier 1 gRNA molecules against S. pyogenes are selected based on their distance to the target site and their orthogonality (PAM is NGG). In some cases, targeting domains for tier 1 gRNA molecules are selected based on (1) a reasonable distance to the target location, e.g., within the first 500 bp of the coding sequence downstream of the start codon, and (2) a high level of orthogonality. In some aspects, a high level of orthogonality is not required for the selection of tier 2 gRNAs. In some cases, tier 3 gRNAs eliminate the requirement for good orthogonality, allowing longer sequences (e.g., the remaining coding sequence) to be scanned. In certain cases, gRNAs are not identified based on the criteria of a particular tier.

[0308] To design strategies for gene disruption, in some embodiments, targeting domains for tier 1 gRNA molecules against Neisseria meningitidis were selected within the first 500 bp of the coding sequence and had a high level of orthogonality. Targeting domains for tier 2 gRNA molecules against Neisseria meningitidis were selected within the first 500 bp of the coding sequence and did not require high orthogonality. Targeting domains for tier 3 gRNA molecules against Neisseria meningitidis were selected within the remainder of the coding sequence downstream of the 500 bp. Note that the tiers are non-inclusive (each gRNA is listed only once). In certain cases, gRNAs were not identified based on the criteria of a particular tier.

[0309] To design strategies for gene disruption, in some embodiments, targeting domains for tier 1 gRNA molecules against S. aureus are selected within the first 500 bp of the coding sequence, have a high level of orthogonality, and include an NNGRRT PAM. In some embodiments, targeting domains for tier 2 gRNA molecules against S. aureus are selected within the first 500 bp of the coding sequence, do not require a high level of orthogonality, and include an NNGRRT PAM. In some embodiments, targeting domains for tier 3 gRNA molecules against S. aureus are selected within the remainder of the downstream coding sequence and include an NNGRRT PAM. In some embodiments, targeting domains for tier 4 gRNA molecules against S. aureus are selected within the first 500 bp of the coding sequence and include an NNGRRV PAM. In some embodiments, targeting domains for tier 5 gRNA molecules against S. aureus are selected within the remainder of the downstream coding sequence and include an NNGRRV PAM. In certain cases, gRNAs are not identified based on criteria for a particular tier.

[0310] 2) Cas9 In the methods and compositions described herein, the Cas9 molecules of various species can be used.Although the Cas9 molecules of Streptococcus pyogenes, Staphylococcus aureus, Neisseria meningitidis and S. thermophilus are the subject of much of the disclosure herein, the Cas9 molecules of other species of Cas9 proteins listed herein, the Cas9 molecules derived from said Cas9 proteins, or the Cas9 molecules based on said Cas9 proteins can also be used.In other words, although much of the description herein uses the Cas9 molecules of Streptococcus pyogenes, Staphylococcus aureus, Neisseria meningitidis and S. thermophilus, the Cas9 molecules from other species can be substituted therefor. Such species include: Acidovorax avenae, Actinobacillus pleuropneumoniae, Actinobacillus succinogenes, Actinobacillus suis, Actinomyces sp., Cycliphilus denitrificans, Aminomonas paucivorans, Bacillus cereus, Bacillus smithii, Bacillus thuringiensis, Bacteroides sp. sp.), Blastopirellula marina, Bradyrhizobium sp.), Brevibacillus laterosporus, Campylobacter coli, Campylobacter jejuni, Campylobacter lari, Candidatus puniceispirillum, Clostridium cellulolyticum, Clostridium perfringens, Corynebacterium accolens, Corynebacterium diphtheria, Corynebacterium matruchotii, Dinoroseobacter shibae, Eubacterium dolichum, Gammaproteobacterium, Gluconacetobacter diazotrophicus, Haemophilus parainfluenzae, Haemophilus sputorum, Helicobacter canadensis, Helicobacter cinaedi, Helicobacter mustelae, Ilyobacter polytropus, Kingella kingae, Lactobacillus crispatus, Listeria ivanovii ivanovii, Listeria monocytogenes, Listeriaceae bacterium, Methylocystis sp.), Methylosinus trichosporium, Mobiluncus mulieris, Neisseria bacilliformis, Neisseria cinerea, Neisseria flavescens, Neisseria lactamica, Neisseria meningitidis, Neisseria sp., Neisseria wadsworthii, Nitrosomonas sp., Parvibaculum lavamentivorans, Pasteurella multocida multocida, Phascolarctobacterium succinatutens, Ralstonia syzygii, Rhodopseudomonas palustris, Rhodovulum sp., Simonsiella muelleri, Sphingomonas sp., Sporolactobacillus vineae, Staphylococcus aureus, Staphylococcus lugdunensis, Streptococcus sp., Subdoligranulum sp.), Tistrella mobilis, Treponema sp.), or Verminephrobacter eiseniae. Examples of Cas9 molecules include those described in WO2015 / 161276, WO2017 / 193107, WO2017 / 093969, US2016 / 272999, and US2015 / 056705.

[0311] As used herein, the term "Cas9 molecule" or "Cas9 polypeptide" refers to a molecule or polypeptide that can interact with a gRNA molecule and coordinate with the gRNA molecule to direct or localize to a site containing a target domain and a PAM sequence. As used herein, the term "Cas9 molecule" or "Cas9 polypeptide" refers to naturally occurring Cas9 molecules and altered, changed, or modified Cas9 molecules or Cas9 polypeptides that differ from a reference sequence, such as the most similar naturally occurring Cas9 molecule, by at least one amino...

Claims

1. 1. A method of generating an engineered T cell containing a modified T cell receptor alpha constant (TRAC) locus, comprising: introducing into a T cell a polynucleotide comprising a transgene sequence encoding a T cell receptor beta (TCRβ) chain comprising a variable beta (Vβ) domain and a constant beta (Cβ) domain, and a portion of a TCR α chain that is shorter than a full-length native T cell receptor alpha (TCRα) chain comprising a variable alpha (Vα) domain and a portion of the constant alpha (Cα) domain, wherein the T cell has a gene disruption within exon 1 of the T cell's endogenous TRAC locus, and the transgene sequence is targeted for integration into exon 1 of the endogenous TRAC locus via homology directed repair (HDR), thereby generating an engineered T cell containing a modified TRAC locus, wherein the modified TRAC locus comprises a nucleic acid sequence comprising an in-frame fusion of (i) the transgene sequence and (ii) a subsequence of an open reading frame of the endogenous TRAC locus, and wherein upon targeted integration of the transgene: a portion of Cα is encoded by the transgene sequence and an additional portion of Cα is encoded by a partial sequence of an open reading frame of the endogenous TRAC locus, the additional portion of Cα being shorter than the full length of a native Cα; and The method, wherein a portion of the Cα and / or Cβ region encoded by the introduced gene sequence contains one or more modifications compared to a native Cα region and / or a native Cβ region, wherein the one or more modifications introduce one or more cysteine ​​residues capable of forming one or more non-native disulfide bridges between the TCR α chain and the TCR β chain, and / or the Cα and / or Cβ of the recombinant TCR contains one or more non-native cysteines.

2. (a) introducing into a T cell one or more agents capable of inducing a gene disruption at a target site within exon 1 of the endogenous T cell receptor alpha constant (TRAC) locus of the T cell; and (b) introducing into the T cell a template polynucleotide comprising a transgene sequence encoding a T cell receptor beta (TCRβ) chain comprising a variable beta (Vβ) domain and a constant beta (Cβ) domain, and a portion of a TCRα chain that is shorter than a full-length native T cell receptor alpha (TCRα) chain comprising a variable alpha (Vα) domain and a portion of the constant alpha (Cα) domain.

1. A method of generating a genetically engineered T cell comprising a modified TRAC locus, comprising: The introduction of the template polynucleotide is followed by the introduction of one or more agents capable of inducing gene disruption; and The transgene is targeted for integration within exon 1 of the endogenous TRAC locus via homology directed repair (HDR), thereby generating a genetically engineered cell containing a modified TRAC locus, the modified TRAC locus comprising a nucleic acid sequence that comprises an in-frame fusion of (i) the transgene sequence and (ii) a subsequence of an open reading frame of the endogenous TRAC locus, and wherein, upon targeted integration of the transgene: a portion of Cα is encoded by the transgene sequence and an additional portion of Cα is encoded by a partial sequence of an open reading frame of the endogenous TRAC locus, the additional portion of Cα being shorter than the full length of a native Cα; and the portion of the Cα and / or Cβ region encoded by the transgene sequence comprises one or more modifications compared to a native Cα region and / or a native Cβ region, the one or more modifications introducing one or more cysteine ​​residues capable of forming one or more non-native disulfide bridges between the TCR α and TCR β chains, and / or the Cα and / or Cβ of the recombinant TCR comprises one or more non-native cysteines; The method.

3. 1. A method of generating an engineered T cell comprising a modified T cell receptor alpha constant (TRAC) locus, comprising introducing into a T cell having a gene disruption within exon 1 of the T cell's endogenous TRAC locus a polynucleotide comprising a transgene sequence encoding a T cell receptor beta (TCRβ) chain comprising a variable beta (Vβ) domain and a constant beta (Cβ) domain, and a portion of a T cell receptor alpha (TCRα) chain comprising a variable alpha (Vα) domain and a portion of the constant alpha (Cα) domain, wherein the transgene is targeted for integration within exon 1 of the endogenous TRAC locus via homology directed repair (HDR), thereby generating a genetically engineered cell comprising a modified TRAC locus, wherein the modified TRAC locus comprises a nucleic acid sequence comprising an in-frame fusion of (i) the transgene sequence and (ii) a subsequence of an open reading frame of the endogenous TRAC locus, and wherein upon targeted integration of the transgene: a portion of Cα is encoded by the transgene sequence and an additional portion of Cα is encoded by a subsequence of an open reading frame of the endogenous TRAC locus, the additional portion of Cα being shorter than the full length of a native Cα; and The method, wherein a portion of the Cα and / or Cβ region encoded by the introduced gene sequence contains one or more modifications compared to a native Cα region and / or a native Cβ region, wherein the one or more modifications introduce one or more cysteine ​​residues capable of forming one or more non-native disulfide bridges between the TCR α chain and the TCR β chain, and / or the Cα and / or Cβ of the recombinant TCR contains one or more non-native cysteines.

4. (a) introducing into a T cell one or more agents capable of inducing a gene disruption at a target site within exon 1 of the endogenous T cell receptor alpha constant (TRAC) locus of the T cell; and (b) introducing into the T cell a polynucleotide comprising a transgene sequence encoding a T cell receptor beta (TCRβ) chain comprising a variable beta (Vβ) domain and a constant beta Cβ domain, and a portion of a TCR α chain that is shorter than a full-length native T cell receptor alpha (TCRα) chain comprising a variable alpha (Vα) domain and a portion of the constant alpha Cα domain.

1. A method of generating a genetically engineered T cell comprising a modified TRAC locus, comprising: The transgene is targeted for integration within exon 1 of the endogenous TRAC locus via homology directed repair (HDR), thereby generating a genetically engineered cell containing a modified TRAC locus, the modified TRAC locus comprising a nucleic acid sequence that comprises an in-frame fusion of (i) the transgene sequence and (ii) a subsequence of an open reading frame of the endogenous TRAC locus, and wherein, upon targeted integration of the transgene: a portion of Cα is encoded by the transgene sequence and an additional portion of Cα is encoded by a partial sequence of an open reading frame of the endogenous TRAC locus, the additional portion of Cα being shorter than the full length of a native Cα; and the portion of the Cα and / or the Cβ region encoded by the transgene sequence comprises one or more modifications compared to a native Cα region and / or a native Cβ region, the one or more modifications introducing one or more cysteine ​​residues capable of forming one or more non-native disulfide bridges between the alpha and beta chains, and / or the Cα and / or Cβ of the recombinant TCR comprises one or more non-native cysteines; The method.

5. The method of claim 1 or 3, wherein the gene disruption is induced by one or more agents capable of inducing gene disruption of one or more target sites within the endogenous TRAC locus.

6. the one or more agents being (i) comprising a DNA-binding protein or a DNA-binding nucleic acid capable of inducing gene disruption and specifically binding or hybridizing to a target site; (ii) comprises a zinc finger protein (ZFP), a TAL protein, or a clustered regularly interspaced short palindromic nucleic acid (CRISPR)-associated nuclease (Cas) specific for a target site; and / or (iii) a combination of CRISPR-Cas9 and a guide RNA (gRNA) having a targeting domain that is complementary to at least one target site; 5. The method according to claim 2 or 4.

7. 7. The method of claim 6, wherein the one or more agents are introduced as a ribonucleoprotein (RNP) complex comprising a gRNA and a Cas9 protein.

8. (i) the concentration of RNP is between 1 μM and 5 μM; and / or (ii) the RNP is introduced via electroporation; The method of claim 7.

9. gRNA, is complementary to a target site in the TRAC locus, and A targeting domain comprising a sequence selected from the group consisting of: The method according to any one of claims 6 to 8, comprising the steps of:

10. (i) the T cells are primary T cells from the subject; (ii) the T cell is (a) a CD8+ T cell or a subtype thereof, or (b) a CD4+ T cell or a subtype thereof, and / or (iii) the T cells comprise T cells that are (a) autologous to the subject; or (b) allogeneic to the subject. The method according to any one of claims 1 to 9.

11. The method of any one of claims 1 to 10, wherein the polynucleotide is comprised in a viral vector.

12. The method of claim 11, wherein the vector is an AAV vector.

13. 13. The method of any one of claims 1 to 12, wherein the recombinant TCR is capable of binding to an antigen associated with, specific for and / or expressed on a cell or tissue that is associated with a disease, disorder or condition.

14. The method according to any one of claims 4 to 13, wherein the introduction of the polynucleotide comprising the transgene sequence is performed after the introduction of one or more agents capable of inducing gene disruption.

15. 15. The method of claim 2 or 14, wherein the polynucleotide comprising the transgene sequence is introduced immediately after, or within 30 seconds, 1 minute, 2 minutes, 3 minutes, 4 minutes, 5 minutes, 6 minutes, 6 minutes, 8 minutes, 9 minutes, 10 minutes, 15 minutes, 20 minutes, 30 minutes, 40 minutes, 50 minutes, 60 minutes, 90 minutes, 2 hours, 3 hours, or 4 hours after the introduction of one or more agents capable of inducing gene disruption.

16. performed on multiple T cells, (i) the plurality of T cells comprises CD4+ T cells, CD8+ T cells, or CD4+ T cells and CD8+ T cells; and / or (ii) the plurality of T cells comprises CD4+ T cells and CD8+ T cells, and the ratio of CD4+ T cells to CD8+ T cells is from 1:3 to 3:1; 16. The method according to any one of claims 1 to 15.

17. 16. The method of any one of claims 2, 4-9, and 14-15, comprising incubating the cells in vitro with a stimulatory agent under conditions to stimulate or activate the one or more T cells prior to the introduction of the agent or agents.

18. 18. The method of any one of claims 2, 4-9, 14-15, and 17, further comprising incubating the cells with one or more recombinant cytokines prior to, during, or after the introduction of the one or more agents and / or the introduction of a polynucleotide comprising a transgene sequence.

19. (i) the polynucleotide comprising the transgene sequence is at least 2500, 2750, 3000, 3250, 3500, 3750, 4000, 4250, 4500, 4760, 5000, 5250, 5500, 5750, 6000, 7000, 7500, 8000, 9000, or 10000 nucleotides in length, or any value between any of the foregoing; and / or (ii) the polynucleotide comprising the transgene sequence is between 2500 nucleotides and 5000 nucleotides, between 3500 nucleotides and 4500 nucleotides, or between 3750 nucleotides and 4250 nucleotides in length; 19. The method according to any one of claims 1 to 18.

20. (i) an additional portion of Cα is encoded by a sequence of nucleotides that contains fewer than four exons, fewer than three exons, fewer than two exons, one exon, or less than one complete exon of an open reading frame at the TRAC locus; (ii) a further portion of Cα is encoded by a sequence of nucleotides that is less than 400, less than 300, less than 250, less than 200, or less than 150 base pairs in length; (iii) a further portion of Cα is encoded by a portion of exon 1 of the TRAC locus that is shorter than the full length of exon 1 of the open reading frame of the TRAC locus; (iv) upon production from a cell into which the polynucleotide has been introduced, the encoded Cα comprises a sequence selected from any one of SEQ ID NOs: 19, 24, and 243-252, or a sequence that exhibits at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to any one of SEQ ID NOs: 19, 24, and 243-252, or a subsequence thereof; (v) at least a portion of Cα is encoded by a sequence that exhibits at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the sequence of nucleotides starting at residue 3 to residue 3155 of the sequence set forth in SEQ ID NO:1, or one or more exons thereof, or a subsequence thereof; and / or (vi) a further portion of Cα contains a sequence as set forth in SEQ ID NO:142, or a sequence that exhibits at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to SEQ ID NO:142, or a subsequence thereof; The method of claim 4.

21. (i) the introduction of one or more cysteine ​​residues comprises the substitution of a non-cysteine ​​residue with a cysteine ​​residue; and / or (ii) upon production from a cell into which the polynucleotide has been introduced, the encoded Cα region contains a cysteine ​​at a position corresponding to position 48 in the numbering as set forth in any of SEQ ID NOs:24; and / or the encoded Cβ region contains a cysteine ​​at a position corresponding to position 57 in the numbering as set forth in SEQ ID NO:

20.

21. The method of claim 4 or 20.

22. (a) a nucleic acid sequence encoding a portion of a recombinant T cell receptor (TCR), the nucleic acid sequence encoding (i) a T cell receptor beta (TCRβ) chain comprising a variable beta (Vβ) domain and a constant beta (Cβ) domain, and (ii) a portion of a TCRα chain that is shorter than the full length of a native T cell receptor alpha (TCRα) chain comprising a variable alpha (Vα) domain and a portion of the constant alpha (Cα) domain; and (b) a homology arm, the homology arm including a 5' homology arm and a 3' homology arm that contain sequences homologous to a region in a partial sequence of the open reading frame of the TRAC locus; A polynucleotide comprising the structure: [5' homology arm]-[the nucleic acid sequence]-[3' homology arm], wherein the nucleic acid sequence is in frame with exon 1 of an open reading frame of the TRAC locus contained in the homology arm, or a subsequence thereof; the Cβ domain and the portion of the Cα domain encoded by the nucleic acid sequence comprise one or more modifications compared to a native Cα region and / or a native Cβ region, the one or more modifications introducing one or more cysteine ​​residues capable of forming one or more non-native disulfide bridges between the TCR α and TCR β chains, and / or the Cα and / or Cβ of the recombinant TCR comprise one or more non-native cysteines; the polynucleotide is contained in a viral vector; The polynucleotide.

23. (a) a nucleic acid sequence encoding a portion of a recombinant T cell receptor (TCR), the nucleic acid sequence encoding (i) a T cell receptor beta (TCRβ) chain comprising a variable beta (Vβ) domain and a constant beta (Cβ) domain, and (ii) a portion of a TCRα chain that is shorter than the full length of a native T cell receptor alpha (TCRα) chain comprising a variable alpha (Vα) domain and a portion of the constant alpha (Cα) domain; and (b) a homology arm, the homology arm including a 5' homology arm and a 3' homology arm that include a sequence homologous to a region in a partial sequence of an open reading frame of an endogenous TRAC locus of a T cell; A polynucleotide comprising the structure: [5' homology arm]-[the nucleic acid sequence]-[3' homology arm], wherein the nucleic acid sequence is in frame with exon 1 of an open reading frame of the TRAC locus contained in the homology arm, or a subsequence thereof; When the TCR or antigen-binding fragment thereof is expressed from a cell into which the polynucleotide has been introduced: a portion of Cα is encoded by the nucleic acid sequence and an additional portion of Cα is encoded by a subsequence of an open reading frame of the endogenous TRAC locus, the additional portion of Cα being shorter than the full length of a native Cα; and a portion of the Cα and / or Cβ region encoded by the nucleic acid sequence of (a) comprises one or more modifications compared to a native Cα region and / or a native Cβ region, the one or more modifications introducing one or more cysteine ​​residues capable of forming one or more non-native disulfide bridges between the TCR α and TCR β chains, and / or the Cα and / or Cβ of the recombinant TCR comprises one or more non-native cysteines; The polynucleotide.

24. (a) a nucleic acid sequence encoding a portion of a recombinant T cell receptor (TCR), the nucleic acid sequence encoding (i) a T cell receptor beta (TCRβ) chain comprising a variable beta (Vβ) domain and a constant beta (Cβ) domain, and (ii) a portion of a TCRα chain that is shorter than the full length of a native T cell receptor alpha (TCRα) chain comprising a variable alpha (Vα) domain and a portion of the constant alpha (Cα) domain; and (b) a homology arm, the homology arm including a 5' homology arm and a 3' homology arm that contain sequences homologous to a region in a partial sequence of the open reading frame of the TRAC locus; A polynucleotide comprising the structure: [5' homology arm]-[the nucleic acid sequence]-[3' homology arm], wherein the nucleic acid sequence is in frame with exon 1 of an open reading frame of the TRAC locus contained in the homology arm, or a subsequence thereof; the Cβ domain and the portion of the Cα domain encoded by the nucleic acid sequence comprise one or more modifications compared to a native Cα region and / or a native Cβ region, the one or more modifications introducing one or more cysteine ​​residues capable of forming one or more non-native disulfide bridges between the TCR α and TCR β chains, and / or the Cα and / or Cβ of the recombinant TCR comprise one or more non-native cysteines; the nucleic acid sequence comprises one or more heterologous or regulatory regulatory elements, including a heterologous promoter, operably linked to regulate expression of the TCR upon expression from the transfected cell in the engineered T cell; The polynucleotide.

25. the nucleic acid sequence of (a) and one of the homology arms together comprise a sequence of nucleotides encoding a Cα that is shorter than the full length of a native Cα, and at least a portion of the Cα is encoded by an open reading frame of the endogenous TRAC locus or a subsequence thereof when the TCR or antigen-binding fragment thereof is expressed from a cell into which the polynucleotide has been introduced. A polynucleotide according to any one of claims 22 to 24.

26. (i) a nucleic acid sequence encoding a TCR β chain is upstream of a nucleic acid sequence encoding a portion of a TCR α chain; and / or (ii) the nucleic acid sequence of (a) does not include a 3' untranslated region (3' UTR) or a sequence encoding an intron; A polynucleotide according to any one of claims 22 to 25.

27. 27. The polynucleotide of any one of claims 22 to 26, wherein the open reading frame or a subsequence thereof comprises at least one intron and at least one exon of the endogenous TRAC locus.

28. (i) the additional portion of Cα is encoded by a sequence of nucleotides that includes fewer than four exons, fewer than three exons, fewer than two exons, one exon, or less than one complete exon of the open reading frame of the TRAC locus; (ii) a further portion of Cα is encoded by a sequence of nucleotides that is less than 400, less than 300, less than 250, less than 200, or less than 150 base pairs in length; (iii) upon production from a cell into which the polynucleotide has been introduced, the encoded Cα comprises a sequence selected from any one of SEQ ID NOs: 19, 24, and 243-252, or a sequence that exhibits at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to any one of SEQ ID NOs: 19, 24, and 243-252, or a subsequence thereof; (iv) at least a portion of Cα is encoded by a sequence of nucleotides starting from residue 3 to residue 3155 of the sequence set forth in SEQ ID NO:1, or one or more exons thereof, or a sequence that exhibits at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the sequence of nucleotides starting from residue 3 to residue 3155 of the sequence set forth in SEQ ID NO:1, or one or more exons thereof, or a subsequence thereof; and / or (v) a further portion of Cα comprises a sequence as set forth in SEQ ID NO:142, or a sequence exhibiting at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to SEQ ID NO:142, or a subsequence thereof; 24. The polynucleotide of claim 23.

29. 29. The polynucleotide of claim 28, wherein a portion of Cα and / or Cβ region encoded by the nucleic acid sequence of (a) contains one or more modifications.

30. 24. The polynucleotide of claim 23, wherein the introduction of one or more cysteine ​​residues comprises substitution of a non-cysteine ​​residue with a cysteine ​​residue.

31. (i) upon production from a cell into which the polynucleotide has been introduced, the encoded Cα region contains a cysteine ​​at a position corresponding to position 48 in the numbering as set forth in any of SEQ ID NOs:24; and / or the encoded Cβ region contains a cysteine ​​at a position corresponding to position 57 in the numbering as set forth in SEQ ID NO:20; and / or (ii) when produced from a cell into which the polynucleotide has been introduced, the encoded Cα comprises a sequence selected from any one of SEQ ID NOs: 248-252, or a subsequence thereof; 31. A polynucleotide according to any one of claims 23, 29 and 30.

32. 32. The polynucleotide of any one of claims 22 to 31, wherein the 5' and 3' homology arms comprise nucleic acid sequences homologous to nucleic acid sequences surrounding a target site, the target site being within the TRAC locus.

33. The 5' homology arm is a) a sequence that has at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the sequence set forth in SEQ ID NO:124, or that contains at least 150, 200, 250, 300, 350, 400, 450, 500, 550 or 600 contiguous nucleotides; b) a sequence comprising 150, 200, 250, 300, 350, 400, 450, 500, 550, or 600 consecutive nucleotides of the sequence shown in SEQ ID NO:124; or c) the sequence shown in SEQ ID NO:124 The polynucleotide according to any one of claims 22 to 32, comprising:

34. The 3' homology arm is a) a sequence that has at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the sequence set forth in SEQ ID NO:125, or that contains at least 150, 200, 250, 300, 350, 400, 450, 500, 550 or 600 contiguous nucleotides; b) a sequence comprising 150, 200, 250, 300, 350, 400, 450, 500, 550, or 600 consecutive nucleotides of, or at least 150, 200, 250, 300, 350, 400, 450, 500, 550, or 600 consecutive nucleotides of, the sequence depicted in SEQ ID NO:125; or c) the sequence shown in SEQ ID NO:125 The polynucleotide according to any one of claims 22 to 33, comprising:

35. 35. The polynucleotide of any one of claims 22-34, wherein upon production from a cell into which the polynucleotide has been introduced, the encoded Cβ comprises a sequence selected from any one of SEQ ID NOs: 20, 21, 25, and 253-258, or a sequence that exhibits at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to any one of SEQ ID NOs: 20, 21, 25, and 253-258, or a subsequence thereof.

36. 36. The polynucleotide of any one of claims 22 to 35, wherein the nucleic acid sequence of (a) is a sequence that is foreign or heterologous to the open reading frame of the endogenous genomic TRAC locus of the T cell.

37. The polynucleotide of any one of claims 22 to 36, wherein the nucleic acid sequence of (a) comprises one or more multicistronic elements.

38. (i) the multicistronic element is located between a nucleic acid sequence encoding a TCR alpha or a portion thereof and a nucleic acid sequence encoding a TCR beta or a portion thereof, and / or is upstream of a nucleic acid sequence encoding a TCR or a portion of a TCR; and / or (ii) the multicistronic element is or contains a ribosomal skip sequence; 38. The polynucleotide of claim 37.

39. 39. The polynucleotide of any one of claims 22 to 38, wherein the nucleic acid sequence of (a) comprises one or more heterologous or regulatory regulatory elements operably linked to regulate expression of the TCR upon expression from a cell into which the polynucleotide has been introduced.

40. The heterologous control or regulatory elements include a heterologous promoter; (i) the heterologous promoter is selected from among a constitutive promoter, an inducible promoter, a repressible promoter, and / or a tissue-specific promoter; and / or (ii) the heterologous promoter is or comprises the human elongation factor 1 alpha (EF1α) promoter or the MND promoter or a variant thereof; 40. The polynucleotide of claim 39.

41. The polynucleotide of any one of claims 22 to 40, which is comprised in a viral vector.

42. 42. The polynucleotide of any one of claims 37 to 41, comprising the structure: (i) [5' homology arm]-[multicistronic element]-[nucleic acid sequence of (a)]-[3' homology arm]; or (ii) [5' homology arm]-[heterologous promoter]-[nucleic acid sequence of (a)]-[3' homology arm].

43. (i) the encoded recombinant TCR is capable of binding to an antigen associated with, specific for, and / or expressed on a cell or tissue that is associated with a disease, disorder, or condition; (ii) is at least 2500, 2750, 3000, 3250, 3500, 3750, 4000, 4250, 4500, 4760, 5000, 5250, 5500, 5750, 6000, 7000, 7500, 8000, 9000, or 10000 nucleotides in length, or any value between any of the foregoing; and / or (iii) is between 2500 and 5000 nucleotides, between 3500 and 4500 nucleotides, or between 3750 and 4250 nucleotides in length; A polynucleotide according to any one of claims 22 to 42.

44. 44. A method of generating a genetically engineered T cell comprising an altered TRAC locus, comprising introducing a polynucleotide of any one of claims 22-43 into a T cell comprising a gene disruption in the TRAC locus.

45. A polynucleotide according to any one of claims 22 to 43, one or more agents capable of inducing gene disruption at a target site within the TRAC locus; (c) an article of manufacture,

46. (a) a nucleic acid sequence encoding a T cell receptor beta (TCRβ) chain including a variable beta (Vβ) domain and a constant beta (Cβ) domain, and a portion of a TCRα chain that is shorter than a full-length native T cell receptor alpha (TCRα) chain including a variable alpha (Vα) domain and at least a portion of a constant alpha (Cα) domain; and (b) a homology arm including a 5' homology arm and a 3' homology arm that include a sequence homologous to a region in a partial sequence of the open reading frame of the TRAC locus encoding the TCR α chain; and a polynucleotide comprising: one or more agents capable of inducing gene disruption at a target site within exon 1 of the TRAC locus; 1. An article of manufacture comprising: the Cβ domain and the portion of the Cα domain encoded by the nucleic acid sequence comprise one or more modifications compared to a native Cα region and / or a native Cβ region, the one or more modifications introducing one or more cysteine ​​residues capable of forming one or more non-native disulfide bridges between the TCR α and TCR β chains, and / or the Cα and / or Cβ of the recombinant TCR comprise one or more non-native cysteines; An article of manufacture, wherein the polynucleotide comprises the structure: [5' homology arm]-[the nucleic acid sequence]-[3' homology arm].

47. 47. A kit comprising an article of manufacture according to claim 45 or 46 and instructions for use.

Images