Preparation of functional bacterial colonies for carbon fixation and decontamination of organically contaminated soils
The preparation of functional bacterial colonies using Sphingobium sp. RS2 and Nitrososphaera viennensis.EN76 strains addresses the challenge of carbon fixation and decontamination in soils, enhancing soil health and carbon sequestration by purifying PAHs and promoting carbon neutrality.
Patent Information
- Application Number
- JP2025027444
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2024-08-06
- Filing Date
- 2025-02-24
- Publication Date
- 2025-10-27
- Estimated Expiration
- 2045-02-24
AI Technical Summary
Existing methods are inadequate for preparing functional bacterial colonies that can simultaneously achieve carbon fixation and decontamination of organic pollutant-laden soils, particularly polycyclic aromatic hydrocarbons (PAHs), which are toxic, mutagenic, and carcinogenic, and pose a significant threat to agricultural soil health and carbon sequestration.
A method involving the preparation of functional bacterial colonies using Sphingobium sp. RS2 and Nitrososphaera viennensis.EN76 strains, quantified using specific gene-based primers, and mixed at a 1:1 ratio to form a synergistic mixture for effective carbon fixation and decontamination, including steps of culture, centrifugation, and fluorescent quantitative PCR to determine cell counts.
The method facilitates easy cultivation and operation, effectively purifies polluted agricultural soil, reduces safety threats, and enhances soil organic carbon content while achieving carbon peak and neutralization goals, supporting decontamination of wastewater and other contaminated areas.
Smart Images

Figure 0007760101000001_ABST
Abstract
Description
[Technical Field]
[0001] The present invention relates to the technical field of soil microbial remediation, specifically to carbon fixation and pollution control of organic polluted soil. This invention relates to a method for preparing functional bacterial colonies for stain removal. [Background technology]
[0002] Polycyclic aromatic hydrocarbo ns, PAHs) are a type of persistent organic pollutant containing multiple benzene rings, and are genetically They are toxic, mutagenic, and carcinogenic. The main source of PAHs in the natural environment is coking , petroleum refining, coal combustion, and burning of straw and firewood. Soil is the main concentration site of PAHs in the environment. PAHs that flow into soil are adsorbed by organic matter and are difficult to remove, so they remain in the soil. Farmland is the main source of agricultural production, and the problem of PAHs contamination in farmland soil is a major concern. Therefore, the problem of PAH contamination in agricultural soil is a serious issue. requires careful consideration. Soil is the largest carbon store on land, and 25% of potential global climate problems are due to soil carbon Therefore, soil is a very important resource for reducing carbon emissions and increasing carbon sinks. It is important and has a reliable ecological function in mitigating climate change. It is a large country with great potential for carbon sequestration and emission reduction in agricultural soils, and This has become a key link in achieving carbon neutrality. How to efficiently treat PAHs in soil remains an important issue that needs to be resolved urgently. Microbial biodegradation is the process by which harmful organic pollutants are converted into non-toxic or low-toxicity products. It is decomposable, safe, economical and easy to apply. At the same time, microorganisms in the soil It also plays an important role in the formation and persistence of organic carbon. We are screening bacterial strains that have PAHs decomposition function, and we are investigating the decomposition of phenanthrene in soil. Few techniques have been reported for preparing functional bacterial colonies that can simultaneously achieve CO2 fixation and CO2 fixation. It has not been done. Summary of the Invention
[0003] In order to solve the above problems, the present invention provides a method for carbon fixation and decontamination of organic polluted soil. A method for preparing functional bacterial colonies is provided, comprising the steps of: S1, the first strain culture: Sphingobium sp. RS2 strain was taken and activated in LB medium. The Sphingobium sp. RS2 single bacterium was obtained and prepared by incubating and culturing it. The activation culture method is as follows: inoculation of Sphingobium sp. RS2 strain. Add the seed loop to 20-30 mL of LB medium and inoculate Sphingobium sp. RS2 The strain was cultured until logarithmic growth phase, centrifuged, the supernatant was removed, and Sphingobium RS2 precipitate was obtained, and the Sphingobium sp. RS2 precipitate was added to an inorganic salt medium. The above steps of centrifugation and resuspension were repeated 2 to 3 times. After final resuspension, the Sphingobium sp. RS2 single bacterium is obtained, S2, second strain culture: Nitrososphaera viennensis.EN76 The strain was taken and cultured in a constant temperature culture box under continuous light protection, and Nitrososphaera v iennensis.EN76 single bacterium was obtained and prepared. S3, Cell count quantification: Sphingo prepared in S1 using the single-copy gene nahE Quantification of cell number in single bacterium, Bacillus sp. RS2, using the single copy gene amoA Nitrososphaera viennensis.EN76 single-fiber prepared in S2 Quantify the number of cells in the bacteria. S4, Single Bacteria Mixture: Sphingobium sp. RS2 single bacterium and Nitro sosphaera viennensis.EN76 single bacteria at a cell number ratio of 1:1 The cells were mixed and counted at 10 8 and obtain functional bacterial colonies. Furthermore, in the step S1, the Sphingobium sp. RS2 strain was grown in the logarithmic growth phase. The culture conditions were as follows: temperature 28-32°C, rotation speed 120-160 rpm. Shake and culture for 10 to 15 hours. Furthermore, the conditions for the centrifugation treatment are as follows: temperature 3 to 5°C, 7500 Centrifuge at ~8500 rpm for 4-6 minutes. Furthermore, in the step S2, the temperature of the constant temperature culture box is 40 to 43°C, and the continuous dark culture During the process, the Nitrososphaera vienne was cultured until it reached the logarithmic growth phase. nsis.EN76 monobacterium was obtained. Furthermore, in S3, the Sphingobium sp. RS2 single extract prepared in S1 was used. The method for quantifying cell number in bacteria is as follows: Primers were designed based on the gene sequence of the single-copy gene nahE, comprises a forward primer and a reverse primer, and the sequence of the forward primer is is shown in SEQ ID NO. 1, and the sequence of the reverse primer is shown in SEQ ID NO. 2, SEQ ID NO.1:TTGGCGTGCCGATGTGGTG SEQ ID NO.2:GCGGGAAATCGAATTTGAAGG The primers are amplified by PCR to obtain a gene sequence, and the gene sequence is incorporated into a plasmid. Then, a standard plasmid was constructed, and the standard plasmid was diluted 10-fold to obtain a template. The sample DNA was then subjected to fluorescent quantitative PCR to obtain a standard curve, and then a DNA extraction kit was used. DNA was extracted from 1 mL of Sphingobium sp. Rs2 using a fluorescent probe. Quantitative PCR was performed to obtain the C value, and the copy number was calculated based on the C value. Copy number represents the number of cells per microliter. Furthermore, the reaction system of the fluorescent quantitative PCR is as follows: The fluorescent quantitative PCR was carried out under the following conditions: the template DNA was heated at 95°C. Pre-denaturation heating was performed, followed by a 5-minute hold, followed by denaturation heating at 95°C for 10 seconds and annealing for 30 seconds. The annealing temperature was 56°C, and the extension time was 30 s. The extension temperature was 72°C. The solubilization curve analysis was performed in a total of 40 cycles under the following analytical conditions: 95°C for 15 min; Heat for s, cool to 60°C, heat for 1 min, then heat to 95°C and hold for 1 s. Furthermore, in S3, Nitrososphaera vien prepared in S2 The method for quantifying the number of cells in a single bacterium is as follows: Primers were designed based on the gene sequence of the single-copy gene amoA, and the primers comprises a forward primer and a reverse primer, and the sequence of the forward primer is is shown in SEQ ID NO. 3, and the sequence of the reverse primer is shown in SEQ ID NO. 4, SEQ ID NO.3:TCGGTCTCGGATACTTGAA SEQ ID NO.4:GCACGCTGTCATCATCAT The primers are amplified by PCR to obtain a gene sequence, and the gene sequence is incorporated into a plasmid. Then, a standard plasmid was constructed, and the standard plasmid was diluted 10-fold to obtain a template. The sample DNA was then subjected to fluorescent quantitative PCR to obtain a standard curve, and then a DNA extraction kit was used. 1 mL of Nitrososphaera viennensis.EN76 single bacterium was used. DNA was extracted and fluorescent quantitative PCR was performed to obtain the CT value, and the copy number was calculated based on the CT value. The copy number of a single copy gene represents the number of cells per microliter. Furthermore, the reaction system of the fluorescent quantitative PCR is as follows: The fluorescent quantitative PCR process conditions were as follows: the template DNA was heated at 95°C. Pre-denaturation heating was performed, followed by a 5-minute hold, followed by denaturation heating at 95°C for 10 seconds and annealing for 30 seconds. The annealing temperature was 60°C, extension was 30 s, and extension temperature was 72°C, for a total of 40 The solubilization curve analysis was performed by cycle heating at 95°C for 15 seconds under the following conditions: Then, cool to 60°C, heat for 1 minute, raise the temperature to 95°C and hold for 1 second. Validate the feasibility of the designed primers, preferably by agarose gel electrophoresis. The method further includes the step of: Compared with the prior art, the present invention has the following beneficial effects: (1) Preparation of functional bacterial colonies for carbon fixation and decontamination of organically contaminated soil In terms of production method, the strain is easy to cultivate, the difficulty of compounding is low, and it is easy to operate. It not only purifies polluted agricultural soil and reduces the threat to the safety of agricultural products, but also fixes CO2. This can increase the SOC content in agricultural soil. (2) Using functional bacterial colonies prepared by the method of the present invention, PAHs-contaminated agricultural soil By purifying the soil, we will achieve the carbon peak and carbon neutralization goals, and improve carbon fixation and They can provide technical and theoretical support for the decontamination of wastewater and other contaminated areas. [Brief explanation of the drawings]
[0004] [Figure 1] FIG. 1 is a standard curve diagram of the single-copy gene nahE used for quantifying the strain Sphingobium sp. RS2 in Example 1 of the present invention. [Figure 2] FIG. 1 is a standard curve diagram of the single-copy gene amoA used for quantifying the strain Nitrososphaera viennensis EN76 in Example 1 of the present invention. [Figure 3] FIG. 1 is a schematic diagram showing the ability of functional bacterial colonies to decompose phenanthrene in soil in Experimental Example 1 of the present invention. [Figure 4] 1 is a schematic diagram of the 13C / 12C atomic percentage of 13CO2 marker soil in Experimental Example 2 of the present invention. [Figure 5] 1 is a schematic diagram of the amount of CO2 assimilated by functional bacterial colonies in organic sputum in Experimental Example 2 of the present invention. [Figure 6] FIG. 1 is a schematic diagram of the carbon fixation efficiency of functional bacterial colonies in Experimental Example 2 of the present invention. [Figure 7] 1 is a flow chart of the method of the present invention. [Figure 8] FIG. 1 is an agarose gel electrophoresis diagram in Example 1 of the present invention. DETAILED DESCRIPTION OF THE INVENTION
[0005] In order to more fully explain the method adopted and the effects achieved by the present invention, the following experiments and At the same time, the technical solutions of the present invention are clearly and completely explained. Example 1: This example describes the functionality of organically contaminated soil for carbon fixation and decontamination. The bacterial colony preparation method, as shown in Figure 7, includes the following steps: S1, the first strain culture: Sphingobium sp. RS2 strain was taken and activated in LB medium. Sphingobium sp. RS2 single bacterium was obtained and prepared by activated culture. The method is as follows: 2 inoculation loops of Sphingobium sp. RS2 strain were inserted into the tube. Add it to 4 mL of LB medium and grow Sphingobium sp. RS2 strain until it reaches the logarithmic growth phase. The mixture was cultured in a centrifuge, the supernatant was removed, and Sphingobium sp. RS2 was precipitated. The Sphingobium sp. RS2 precipitate was resuspended in an inorganic salt medium. The above centrifugation and resuspension steps were repeated three times, and after the final resuspension, Sp The conditions for obtaining single bacteria of Hingobium sp. RS2 and centrifuging the bacteria were as follows: : The temperature is 4°C, and the mixture is centrifuged at 8000 rpm for 5 minutes. The conditions for culturing Sphingobium sp. RS2 strain to the logarithmic growth phase are as follows: The temperature was 30°C, and the culture was shaken at 150 rpm for 12 hours. S2, second strain culture: Nitrososphaera viennensis.EN76 The strain was taken and cultured in a constant temperature culture box under continuous light protection, and Nitrososphaera v iennensis.EN76 single bacteria were obtained and prepared, and the temperature of the incubation box was 42℃. During the continuous dark culture process, the culture was continued until the logarithmic growth phase. ennensis.EN76 single bacterium obtained, The following is Nitrososphaera viennensis. EN76 monobacterial culture The mineral salts medium used in the study is shown in Table 1.
[0006] Table 1 Mineral salts medium JPEG0007760101000004.jpg238168, where the components of mod Trace Elements are shown in Table 2:
[0007] Table 2. Ingredients of mod Trace Elements JPEG0007760101000005.jpg238168S3, Cell number quantification: S3-1, Sphingobium prepared in S1 with the single-copy gene nahE Quantify the number of cells in single bacteria of sp. RS2: Primers were designed based on the gene sequence of the single-copy gene nahE. The forward primer and reverse primer are included, and the sequence of the forward primer is S The sequence of the reverse primer is shown in SEQ ID NO. 2. is shown, SEQ ID NO.1:TTGGCGTGCCGATGTGGTG SEQ ID NO.2:GCGGGAAATCGAATTTGAAGG The primers are used for PCR amplification to obtain the gene sequence, which is then incorporated into the plasmid and used as a target. A quasi-plasmid was constructed, and the standard plasmid was diluted 10-fold to obtain template DNA. Then, fluorescent quantitative PCR was performed to obtain a standard curve, and the R2 of the standard curve was >0.99, and the increase was >110%. If the width efficiency is >90%, as shown in Figure 1, then 1 mL of Sphinx DNA can be extracted using a DNA extraction kit. DNA was extracted from the single bacterium, ngobium sp. Rs2, and fluorescent quantitative PCR was performed to determine the CT value. The CT value was then substituted into the formula on the standard curve to calculate the copy number, and the number of copies of the single-copy gene was calculated. - The number represents the number of cells per microliter, S3-2, Nitrososphatase prepared in S2 using the single-copy gene amoA Era viennensis.EN76 Cell count in single bacteria: Primers were designed based on the gene sequence of the single-copy gene amoA. The forward primer and reverse primer are included, and the sequence of the forward primer is S The sequence of the reverse primer is shown in SEQ ID NO. 4. SEQ ID NO.3:TCGGTCTCGGATACTTGAA SEQ ID NO.4:GCACGCTGTCATCATCAT The primers are used for PCR amplification to obtain the gene sequence, which is then incorporated into the plasmid and used as a target. A quasi-plasmid was constructed, and the standard plasmid was diluted 10-fold to obtain template DNA. Then, fluorescent quantitative PCR was performed to obtain a standard curve, and the R2 of the standard curve was >0.99, and the increase was >110%. If the width efficiency is >90%, as shown in Figure 2, then use a DNA extraction kit to extract 1 mL of Nitr ososphaera viennensis.EN76 Single bacterial DNA extraction and fluorescence Quantitative PCR was performed to obtain the CT value, and the CT value was substituted into the formula on the standard curve to calculate the copy number. , the copy number of a single copy gene represents the number of cells per microliter, Here, when PCR amplification is performed using primers in S3-1 and S3-2, the PCR reaction system is as follows: Shown in Table 3:
[0008] Table 3 PCR reaction system for PCR amplification of primers In JPEG0007760101000006.jpg238168S3-1, the PCR amplification process conditions are as follows: nahE gene: Pre-denatured at 95°C for 10 min, denatured at 95°C for 30 s, and then denatured at 58.26°C Anneal at 4°C for 30 seconds, then anneal at 72°C for 20 seconds (34 cycles), then extend at 72°C for 5 minutes. Three parallel tubes were prepared for each sample, and the template DNA (ddHO) was replaced with A PCR system without the addition of the nucleotides serves as a negative control. In S3-2, the PCR amplification step conditions are as follows: amoA gene: Pre-denatured at 95°C for 10 min, denatured at 95°C for 30 s, and then denatured at 53.77°C Anneal at 4°C for 30 seconds, then anneal at 72°C for 20 seconds (34 cycles), then extend at 72°C for 5 minutes. Three parallel tubes were prepared for each sample, and the template DNA (ddHO) was replaced with The PCR system without the addition of the nucleotides was used as a negative control. Verify the feasibility of the designed primers by agarose gel electrophoresis includes: (1) Heat and melt 1% agarose gel, add 20 mL to a small beaker, and add 2 μL of TS- Add GelRed and mix evenly to prepare a gel plate. After cooling and solidifying, place in the electrophoresis tank. Get in, (2) Add 5 μL of DL2000 Marker to the first gel well and collect the PCR products. Add 5 μL of the mixture to the gel well. (3) Set the voltage of the electrophoresis device to 110V, maintain it for 30 minutes, and then turn off the electrophoresis device. Close and remove the agarose gel. (4) Place the gel in a gel imager to observe the electrophoretic structure and check the clarity and mar By comparing the primers, we can determine which primers can be used in subsequent experiments. The reaction system for fluorescent quantitative PCR in S3-1 and S3-2 is shown in Table 4:
[0009] Table 4. Fluorescent quantitative PCR reaction system In JPEG0007760101000007.jpg238168S3-1, the process conditions for fluorescent quantitative PCR were as follows: template DNA The mixture was pre-denatured at 95°C, held for 5 minutes, and then subsequently denatured at 95°C for 10 seconds. Annealing for 30 s, annealing temperature 56 °C, extension for 30 s, extension temperature 72 °C The solubilization curve analysis was performed at 9 °C for a total of 40 cycles. The analysis conditions were as follows: Heat at 5°C for 15 seconds, cool to 60°C and heat for 1 minute, then heat to 95°C and hold for 1 second death, In S3-2, the process conditions for fluorescent quantitative PCR were as follows: template DNA The mixture was pre-denatured at 95°C, held for 5 minutes, and then subsequently denatured at 95°C for 10 seconds. Annealing for 30 s, annealing temperature 60°C, extension for 30 s, extension temperature 72°C The solubilization curve analysis was performed at 9 °C for a total of 40 cycles. The analysis conditions were as follows: Heat at 5°C for 15 seconds, cool to 60°C and heat for 1 minute, then heat to 95°C and hold for 1 second death, Description: Fluorescent quantitative PCR allows for the generation of a standard curve and the CT values obtained in subsequent experiments. Calculate the copy number by substituting the formula on the standard curve. The copy number of a single-copy gene is 1 microgram. It can be expressed as the number of cells per liter, S4, Monobacteria mixed: Sphingobium sp. RS2 monobacteria and Nitrososp Haera viennensis EN76 single bacteria were mixed at a cell number ratio of 1:1 and The number of cells is 10 8 and obtain functional bacterial colonies. Example 2: This example differs from Example 1 in the following respects: In S1, an inoculation loop of Sphingobium sp. RS2 strain was inserted into 30 mL of L B medium and cultivate Sphingobium sp. RS2 strain until logarithmic growth phase. After centrifugation, the supernatant was removed to obtain Sphingobium sp. RS2 precipitate. The Hingobium sp. RS2 precipitate was resuspended in an inorganic salt medium and centrifuged as described above. The isolation and resuspension steps were repeated twice, and after the final resuspension, Sphingobi The conditions for centrifugation were as follows: temperature 3°C; The mixture was centrifuged at 7500 rpm for 6 minutes, and Sphingobium sp. The RS2 strain was cultured to the logarithmic growth phase under the following conditions: temperature 28°C; , and cultured at 120 rpm for 15 hours with shaking. In S2, the temperature of the incubation box is 40°C. Example 3: This example differs from Example 1 in the following respects: In S1, an inoculation loop of Sphingobium sp. RS2 strain was inserted into 20 mL of L B medium and cultivate Sphingobium sp. RS2 strain until logarithmic growth phase. After centrifugation, the supernatant was removed to obtain Sphingobium sp. RS2 precipitate. The Hingobium sp. RS2 precipitate was resuspended in an inorganic salt medium and centrifuged as described above. The isolation and resuspension steps were repeated three times, and after the final resuspension, Sphingo was added. The conditions for centrifugation were as follows: temperature 5°C; Centrifuge at 8500 rpm for 4 min at ℃, and extract Sphingobium s The conditions for culturing the p.RS2 strain to the logarithmic growth phase were as follows: temperature 32°C; The mixture was shaken at 160 rpm for 10 hours. At S2, the temperature of the incubation box is 43°C. Experimental Example 1: Using the functional bacterial colonies prepared by the method of Example 1 of the present invention, Treat the soil and verify the ability of functional bacterial colonies to decompose phenanthrene in the soil. . The experimental equipment used was a 100 mL serum bottle, and sterilized water was added to the soil to a moisture content of 60%. Each experimental treatment is set according to Table 5, and three parallel sets are set for each treatment. Phenanthrene was added to the test soil to a final concentration of 10 mg / kg. g soil, 13 CO2 content is 5%. 90% 13 After the CO2 is consumed, First, the top of the serum bottle was flushed with pressurized synthetic air (20% O2, 80% N2) for 1 min. Under elementary conditions, 13 Add CO2. Place the microcosms culture system at 28°C. The gas in the serum bottle was renewed every 5 days, and all were renewed on the 5th, 10th, and 20th days. Soil samples were collected and freeze-dried, and the dried samples were stored at -20 Stored at ℃.
[0010] Table 5. Experimental design for the degradation ability of phenanthrene in soil by functional bacterial colonies. JPEG0007760101000008.jpg238168 After freeze-drying and thoroughly grinding the soil sample, 2g of the soil sample was added to 10mL of n- Add to a solution of hexane and dichloromethane (volume ratio 1:1), mix well by vortexing, and The mixture was extracted by sonication for 30 minutes, centrifuged at 2000 rpm for 10 minutes, and the supernatant was collected. Repeat this process three times, and purify the extract by passing it through a 2g anhydrous sodium sulfate and 2g silica gel column. Finally, 10 mL of a mixture of n-hexane and dichloromethane was eluted. The solution was dried on a rotary evaporator, and then the volume was adjusted to 2 mL with methanol. The phenanthrene concentration was detected by the following formula: Calculated as: Phenanthrene degradation rate (%) = (1 - phenanthrene content in other treatment group / phenanthrene content in sterilized group) Nanthrene content) x 100% As can be seen from Figure 3, on the 20th day, the degradation rate of phenanthrene by functional bacterial colonies reached 87.51%, which indicates that the functional bacterial colony had good phenanthrene degradation ability. After 5 days, the degradation rate of phenanthrene by functional bacterial colonies was Sphingobium sp. RS2 monobacterium and Nitrososphaera vi ennensis. EN76 bacterium, which is significantly higher than the phenanthrene degradation process. During this time, Sphingobium sp. RS2 and Nitrososphaera vi ennensis. EN76 have a certain synergistic effect, and the establishment of functional bacterial colonies is It is shown to be beneficial for the removal of phenanthrene. Experimental Example 2: The following functional bacterial colonies prepared by the method of Example 1 of the present invention were used to The soil was treated and the ability of functional bacterial colonies to fix CO2 was examined. The experimental equipment used was a 100 mL serum bottle, and sterilized water was added to the soil so that the moisture content was 60%. Each experimental treatment was set up according to Table 6, with three parallel runs for each treatment. Phenanthrene was added to the test soil to a final concentration of 10 mg / kg. Contains 0g soil, 13 The CO2 content is 5%, and after 90% of the CO2 is consumed, First, the top of the serum bottle was flushed with pressurized synthetic air (20% O2, 80% N2) for 1 minute to allow for aerobic conditions. Maintain the matter, 13 CO2 was added. The microcosms culture system was placed at 28°C and cultured. The gas in the serum bottle was renewed every 5 days, and all the samples were collected on the 5th, 10th, and 20th days, respectively. The soil samples were freeze-dried and the dried samples were stored at -20°C for later analysis. Ta.
[0011] Table 6 Experimental design for CO2 fixation capacity by functional bacterial colonies JPEG0007760101000009.jpg238168 The freeze-dried samples were analyzed for markers and marker-free markers using an isotope ratio mass spectrometer and an elemental analyzer. The δ of soil that cannot be 13 C value and SOC were measured, and 13 C / 12 C atomic percent, SO The amount of CO2 assimilated and carbon fixation efficiency in C were analyzed. As can be seen from Figures 4 to 6, on 20d, Nitrososphaera vienne nsis. EN76 single bacterium 13 C / 12 The atomic percentage of C reaches 1.76, and SO CO2 assimilation in C was 77.27 mg·Kg -1 and the carbon fixation rate was 3.86 mg· Kg -1 ·d -1 However, after the soil was contaminated with phenanthrene, Nitros osphaera viennensis. EN76 monobacterial 13 C / 12 C atom number The CO2 assimilation rate and carbon fixation rate in SOC significantly decreased. It was suggested that nanthrene inhibited the carbon fixation ability. ra viennensis. EN76 and the phenanthrene-degrading fungus Sphingobiu m sp. RS2 to obtain microbial functional bacterial colonies, 13 C / 12 Number of C atoms The percentage reached 1.73, and the amount of CO2 assimilated in SOC was 76.02 mg·Kg -1 Yes The carbon fixation rate was 3.80 mg kg -1 ·d -1 and under phenanthrene stress Nitrososphaera viennensis. EN76 monobacterial carbon fixation significantly higher than the fixed capacity. Wherein: Sphingobium sp. RS2 strain is from the following literature: J.Liu., ZMZhang., YHSheng., YZGao., Z. H. Zhao., Phenanthrene-degrading bacteria on root surfaces: a natural defense that protects plants from phenanthrene conta Plant Soil, 2018, 425:335-350. Nitrososphaera viennensis. EN76 strain was obtained from the following literature. These are: M. Tournaa., M. Stieglmeiera., A. Spanga., M.K. onnekeb., A. Schintlmeisterc., T. Uricha., M. Engeld., M. Schloterd., M. Wagnerc., A. Richte. rc., C.Schleper., Nitrososphaera viennensi s, an ammonia oxidizing archaeon from soi l.Proceedings of the national academy of sciences of the united states of america a, 2011, 108:8420-8425. As can be seen from the above experiments, the functional bacterial colonies prepared by the preparation method of the present invention , Nitrososphaera viennensis. Phenan against EN76 It can reduce stress on the tren and achieve better carbon fixation effect.
[0012] [Sequence table] <st26sequencelisting dtdversion="V1_3" filename="有機汚染土壌の炭素固定および汚 染除去のための機能性細菌コロニーの調製方法.xml" softwarename="WIPO Sequence" sof twareversion="2.2.0" productiondate="2025-02-21"> <applicationidentification> <ipofficecode> JP< / ipofficecode> <applicationnumbertext / > <filingdate / > < / applicationidentification> <applicantfilereference> Nanjing Agricultural University< / applicantfilereference> <earliestpriorityapplicationidentification> <ipofficecode> CN< / ipofficecode> <applicationnumbertext> 202411069404.6< / applicationnumbertext> <filingdate> 2024-08-06< / filingdate> < / earliestpriorityapplicationidentification> <applicantname languagecode="ja"> Nanjing Agricultural University< / applicantname> <applicantnamelatin> Nanjing Agricultural University< / applicantnamelatin> <inventiontitle languagecode="ja">Mechanisms for carbon fixation and decontamination of organically contaminated soils Preparation of potent bacterial colonies< / inventiontitle> <sequencetotalquantity> 4< / sequencetotalquantity> <sequencedata sequenceidnumber="1"> <insdseq> <INSDSeq_length>19< / INSDSeq_length> <INSDSeq_moltype>RNA< / INSDSeq_moltype> <INSDSeq_division>PAT< / INSDSeq_division> <INSDSeq_feature-table> <insdfeature> <INSDFeature_key>source< / INSDFeature_key> <INSDFeature_location>1..19< / INSDFeature_location> <INSDFeature_quals> <insdqualifier> <INSDQualifier_name>mol_type< / INSDQualifier_name> <INSDQualifier_value>other RNA< / INSDQualifier_value> < / insdqualifier> <insdqualifier id="q2"> <INSDQualifier_name>organism< / INSDQualifier_name> <INSDQualifier_value>synthetic construct< / INSDQualifier_value> < / insdqualifier> < / INSDFeature_quals> < / insdfeature> < / INSDSeq_feature-table> <INSDSeq_sequence>ttggcgtgccgatgtggtg< / INSDSeq_sequence> < / insdseq> < / sequencedata> <sequencedata sequenceidnumber="2"> <insdseq> <INSDSeq_length> 21< / INSDSeq_length> <INSDSeq_moltype> RNA< / INSDSeq_moltype> <INSDSeq_division> PAT< / INSDSeq_division> <INSDSeq_feature-table> <insdfeature> <INSDFeature_key>source< / INSDFeature_key> <INSDFeature_location>1..21< / INSDFeature_location> <INSDFeature_quals> <insdqualifier> <INSDQualifier_name>mol_type< / INSDQualifier_name> <INSDQualifier_value>other RNA< / INSDQualifier_value> < / insdqualifier> <insdqualifier id="q4"> <INSDQualifier_name>organism< / INSDQualifier_name> <INSDQualifier_value>synthetic construct< / INSDQualifier_value> < / insdqualifier> < / INSDFeature_quals> < / insdfeature> < / INSDSeq_feature-table> <INSDSeq_sequence> gcgggaaatcgaatttgaagg< / INSDSeq_sequence> < / insdseq> < / sequencedata> <sequencedata sequenceidnumber="3"> <insdseq> <INSDSeq_length> 19< / INSDSeq_length> <INSDSeq_moltype> RNA< / INSDSeq_moltype> <INSDSeq_division> PAT< / INSDSeq_division> <INSDSeq_feature-table> <insdfeature> <INSDFeature_key>source< / INSDFeature_key> <INSDFeature_location>1..19< / INSDFeature_location> <INSDFeature_quals> <insdqualifier> <INSDQualifier_name>mol_type< / INSDQualifier_name> <INSDQualifier_value>other RNA< / INSDQualifier_value> < / insdqualifier> <insdqualifier id="q6"> <INSDQualifier_name>organism< / INSDQualifier_name> <INSDQualifier_value>synthetic construct< / INSDQualifier_value> < / insdqualifier> < / INSDFeature_quals> < / insdfeature> < / INSDSeq_feature-table> <INSDSeq_sequence> tcggtctcggataacttgaa< / INSDSeq_sequence> < / insdseq> < / sequencedata> <sequencedata sequenceidnumber="4"> <insdseq> <INSDSeq_length>18< / INSDSeq_length> <INSDSeq_moltype>RNA< / INSDSeq_moltype> <INSDSeq_division>PAT< / INSDSeq_division> <INSDSeq_feature-table> <insdfeature> <INSDFeature_key>source< / INSDFeature_key> <INSDFeature_location>1..18< / INSDFeature_location> <INSDFeature_quals> <insdqualifier> <INSDQualifier_name>mol_type< / INSDQualifier_name> <INSDQualifier_value>other RNA< / INSDQualifier_value> < / insdqualifier> <insdqualifier id="q8"> <INSDQualifier_name>organism< / INSDQualifier_name> <INSDQualifier_value>synthetic construct< / INSDQualifier_value> < / insdqualifier> < / INSDFeature_quals> < / insdfeature> < / INSDSeq_feature-table> <INSDSeq_sequence>gcacgctgtcatcatcat< / INSDSeq_sequence> < / insdseq> < / sequencedata> < / st26sequencelisting>
[0013]
Claims
1. S1, the first strain culture: Sphingobium sp. RS2 strain was taken and activated in LB medium. The Sphingobium sp. RS2 single bacterium was obtained and prepared by incubating the culture. The activation culture method is as follows: Sphingobium sp. RS2 strain is cultured for 2 days. Add it to 0-30 mL of LB medium and grow Sphingobium sp. RS2 strain in logarithmic growth. The culture was cultured until the growth period and centrifuged. The conditions for the centrifugation were as follows: temperature 3 Centrifuge at 7500-8500 rpm for 4-6 minutes at 5°C or less, and remove the supernatant. A Sphingobium sp. RS2 precipitate was obtained, and the Sphingobium sp. The RS2 precipitate was resuspended by adding an inorganic salt medium, and the above-mentioned centrifugation and resuspension steps were repeated. Repeat the resuspension two or three times, and after the final resuspension, obtaining a single bacterium; S2, second strain culture: Nitrosphaera viennensis. EN76 The strain was taken and cultured in a constant temperature culture box under continuous light protection. obtaining and providing S. ienensis EN76 bacteria; S3, Cell count quantification: Sphingo prepared in S1 using the single-copy gene nahE The number of cells in a single bacterium of B. sp. RS2 was quantified using the single copy gene amoA. Nitrososphaera viennensis. EN76 single-celled tissue prepared in S2 Quantifying the number of cells in the bacteria; S4, single bacteria mixture: the Sphingobium sp. RS2 single bacteria and the Nitro sosphaera viennensis. EN76 single bacteria were mixed at a cell number ratio of 1:
1. The cells were mixed and counted at 10 8 and obtaining functional bacterial colonies; A functional bacterial colony for carbon fixation and decontamination of organic polluted soil, comprising: Knee preparation method.
2. The culture conditions for culturing the Sphingobium sp. RS2 strain until the logarithmic growth phase are as follows: The temperature is 28-32°C, the rotation speed is 120-160 rpm, and the vibration time is 10-15 hours.
2. The method for carbon fixation and decontamination of organic polluted soil according to claim 1, wherein the method is cultured in the presence of the microbial organisms. Method for preparing functional bacterial colonies for:
3. In the step S2, the temperature of the incubation box is 40 to 43°C, and during the continuous dark incubation process, Each time, the Nitrososphaera viennensis was cultured until it reached the logarithmic growth phase. EN76 single bacterium is obtained, and the carbon fixation and and methods for preparing functional bacterial colonies for decontamination.
Citation Information
Patent Citations
Method for simultaneously removing USEPA PAHs in plant bodies by utilizing compound PAHs degrading bacteria
CN107306532A
Preparation method of carbon sequestration and decontamination functional flora for organic contaminated soil
CN118599738A
PAHs-heavy metal complex decomposition / adsorption bacteria and their application in environmental remediation
JP6782036B1
JPP6782036B