Methods for constructing and using antigen-specific binding polypeptide gene display vectors
The antigen-specific binding polypeptide gene display vector addresses the limitations of current antibody discovery methods by ensuring directional ligation and high-diversity libraries, enhancing screening efficiency and clone success rates.
Patent Information
- Application Number
- JP2022558484
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2020-03-27
- Filing Date
- 2021-03-26
- Publication Date
- 2025-11-18
- Estimated Expiration
- 2041-03-26
AI Technical Summary
Current antibody discovery methods suffer from poor antibody library quality, low diversity, low effective clone rate, and inefficient screening processes, leading to long development times and low screening throughput.
A method for constructing an antigen-specific binding polypeptide gene display vector using a combination of restriction endonucleases to ensure directional ligation and controlled fragment ratios, eliminating incorrect ligation and reducing PCR-induced mutations, enabling high-diversity libraries with efficient screening and biological activity analysis.
This approach enhances the quality, quantity, and diversity of antibody libraries, significantly improving the screening efficiency and success rate, reducing the time from vector construction to identifying positive clones by up to 50% or more.
Smart Images

Figure 0007772379000008 
Figure 0007772379000009 
Figure 0007772379000010
Abstract
Description
[Technical Field]
[0001] The present application relates to the field of biomedicine, and in particular to a method for constructing an antigen-specific binding polypeptide gene display vector that can be used to screen for antigen-specific binding polypeptides. [Background technology]
[0002] Currently, antibody discovery methods commonly used in the prior art fall into two major categories: hybridoma technology and antibody display technology. Hybridoma technology further includes two types of mouse hybridomas and transgenic mouse hybridomas. Antibody display technologies are primarily divided into three types: phage display, yeast display, and mammalian cell display. Each antibody discovery technology has distinct advantages but also significant drawbacks and limitations. For example, a lack of quality control during the construction of antibody drug seed banks results in poor antibody library quality, small library capacity, low diversity, and a low effective clone rate, making it difficult to screen for high-quality lead antibodies. Furthermore, antibody library screening technologies lack quantitative screening, resulting in low screening throughput, poor screening effectiveness, and long screening times.
[0003] Therefore, innovative antibody discovery technologies are needed to improve the quality, quantity, and diversity of lead antibody molecules for screening innovative antibody drugs, accelerate the development of antibody drugs, and improve the success rate of development. Summary of the Invention
[0004] The present application provides a method for constructing an antigen-specific binding polypeptide gene display vector. The antigen-specific binding polypeptide gene display vector is composed of four fragments, and the 5' and 3' ends of the four fragments are provided with sticky ends of specific sequences by constructing a component library and a display vector so that they are directionally circularized to form the antigen-specific binding polypeptide gene display vector. The present application's method for constructing an antigen-specific binding polypeptide gene display vector and the present application's method for screening antigen-specific binding polypeptides using the antigen-specific binding polypeptide gene display vector have at least one of the following characteristics: 1) a special recognition site for a restriction endonuclease can be used in the construction of the present application's antigen-specific binding polypeptide gene display vector, which not only ensures directional ligation but also prevents incorrect ligation and allows the molecular number of each component fragment to be controlled at 1:1 during ligation, thereby improving ligation and transformation efficiency. On the other hand, a strategy for constructing a VH component library and an LC component library is adopted to improve the efficiency of ligation and transformation of each fragment; 2) the combinatorial PCR strategy used in conventional antibody library construction methods in the art is not used, which effectively reduces the probability of introducing mutations caused by PCR; 3) quality control is easier, which can meet the needs of industrial mass production; 4) after the display vector is introduced into cells, it can be directly screened by biological activity analysis experiments, which effectively shortens the time from constructing an antigen-specific binding polypeptide gene display vector to screening for antigen-specific polypeptides with unique sequences.For example, the time from constructing the display vector to screening for positive clones of unique sequences can be at least about 1 week (at least about 10 days, at least about 2 weeks, at least about 3 weeks, at least about 4 weeks, at least about 5 weeks, at least about 6 weeks, at least about 7 weeks, at least about 8 weeks); 5) the diversity of clones in the display vector bacterial library is high, and screening efficiency is high. In some cases, in libraries containing antigen-specific binding polypeptide gene display vectors, the percentage of effective clones can be up to about 50% or more (e.g., more than about 55%, more than about 60%, more than about 65%, more than about 70%, more than about 75%, more than about 80%, more than about 85%, more than about 90%, more than about 95%, or more), resulting in high transformation efficiency and a high success rate of library construction.
[0005] In one aspect, the present application provides a method for constructing an antigen-specific binding polypeptide genetic display vector, the method comprising: a) providing a first display vector polynucleotide comprising, in a 5' to 3' direction, a B2-displaying VH-B3; b) providing a second display vector polynucleotide comprising, in a 5' to 3' direction, a S5-displaying LC-S6; c) providing a third display vector polynucleotide comprising, in a 5' to 3' direction, a B3-display vector fragment I-S5; d) providing a fourth display vector polynucleotide comprising, in a 5' to 3' direction, a S6-display vector fragment II-B2; and e) cleaving the first display vector polynucleotide, the second display vector polynucleotide, and the S6-display vector polynucleotide to obtain a cleaved first display vector polynucleotide, a cleaved second display vector polynucleotide, a cleaved third display vector polynucleotide, and a cleaved fourth display vector polynucleotide. specifically cleaving the third display vector polynucleotide and the fourth display vector polynucleotide with a restriction endonuclease, wherein the restriction endonuclease specifically recognizes B2, B3, S5, and S6, respectively; and f) mixing the cleaved first display vector polynucleotide, the cleaved second display vector polynucleotide, the cleaved third display vector polynucleotide, and the cleaved fourth display vector polynucleotide such that they can be directionally ligated and circularized to form an antigen-specific binding polypeptide gene display vector, wherein display VH encodes a heavy chain variable region of the antigen-specific binding polypeptide, display LC encodes a light chain of the antigen-specific binding polypeptide, and B2, B3, S5, and S6 are each independently a recognition site for the restriction endonuclease.
[0006] In some embodiments, the ends generated from specific cleavage of B2 by a restriction endonuclease that specifically recognizes B2 do not recognize or ligate to the ends generated from specific cleavage of any one of B3, S5, and S6 by the corresponding restriction endonuclease.
[0007] In some embodiments, the ends generated from specific cleavage of B3 by a restriction endonuclease that specifically recognizes B3 do not recognize or ligate to the ends generated from specific cleavage of any one of B2, S5, and S6 by the corresponding restriction endonuclease.
[0008] In some embodiments, the ends generated from specific cleavage of S5 by a restriction endonuclease that specifically recognizes S5 do not recognize or ligate to the ends generated from specific cleavage of any one of B2, B3, and S6 by the corresponding restriction endonuclease.
[0009] In some embodiments, the ends generated from specific cleavage of S6 by a restriction endonuclease that specifically recognizes S6 do not recognize or ligate to the ends generated from specific cleavage of any one of B2, B3, and S5 by the corresponding restriction endonuclease.
[0010] In some embodiments, the restriction endonuclease is selected from SfiI, Esp3I, and BsmBI.
[0011] In some embodiments, B2 and B3 can be specifically recognized and cleaved by an enzyme selected from the group consisting of BsmBI and Esp3I.
[0012] In some embodiments, S5 and S6 can be specifically recognized and cleaved by Sfil.
[0013] In some embodiments, B2 comprises the nucleic acid sequence set forth in SEQ ID NO:8.
[0014] In some embodiments, B3 comprises the nucleic acid sequence set forth in SEQ ID NO:9.
[0015] In some embodiments, S5 comprises the nucleic acid sequence set forth in SEQ ID NO:10.
[0016] In some embodiments, S6 comprises the nucleic acid sequence set forth in SEQ ID NO:11.
[0017] In some embodiments, the method further comprises introducing the first display vector polynucleotide into a first display bacterium to obtain a display VH component bacterial library.
[0018] In some embodiments, the method includes inserting a first display vector polynucleotide into a display component vector to form a display VH storage ligation product, and introducing the display VH storage ligation product into a first display bacterium to obtain a display VH component bacterial library.
[0019] In some embodiments, the method further comprises introducing a second display vector polynucleotide into a second display bacterium to obtain a display LC component bacterial library.
[0020] In some embodiments, the method includes inserting a second display vector polynucleotide into a display component vector to form a display LC storage ligation product, and introducing the display LC storage ligation product into a second display bacterium to obtain a display LC component bacterial library.
[0021] In some embodiments, the method further comprises introducing a third display vector polynucleotide into a third display bacterium to obtain a display vector component I bacterial library.
[0022] In some embodiments, the method includes inserting a third display vector polynucleotide into a display component vector to form a display vector fragment I storage ligation product, and introducing the storage ligation product into a third display bacterium to obtain a display vector component I bacterial library.
[0023] In some embodiments, the method further comprises introducing a fourth display vector polynucleotide into a fourth display bacterium to obtain a display vector component II bacterial library.
[0024] In some embodiments, the method includes inserting a fourth display vector polynucleotide into a display component vector to form a display vector fragment II storage ligation product, and introducing the storage ligation product into a fourth display bacterium to obtain a display vector component II bacterial library.
[0025] In some embodiments, the display vector component vector is derived from a pUC vector.
[0026] In some embodiments, the pUC vector is or is derived from a pUC19 vector.
[0027] In some embodiments, the method further includes obtaining a display VH component plasmid comprising a first display vector polynucleotide from the display VH component bacterial library, and obtaining a truncated first display vector polynucleotide from the display VH component plasmid.
[0028] In some embodiments, the method comprises digesting the display VH component plasmid with a restriction endonuclease that specifically recognizes B2 and B3, thereby obtaining a truncated first display vector polynucleotide.
[0029] In some embodiments, the method further includes obtaining a display LC component plasmid comprising a second display vector polynucleotide from the display LC component bacterial library, and obtaining a cleaved second display vector polynucleotide from the display LC component plasmid.
[0030] In some embodiments, the method comprises digesting the display LC component plasmid with a restriction endonuclease that specifically recognizes S5 and S6, thereby obtaining a truncated second display vector polynucleotide.
[0031] In some embodiments, the method further includes obtaining a display fragment component plasmid I from the expression vector component I bacterial library, the display fragment component plasmid I comprising a third display vector polynucleotide, and obtaining a cleaved third display vector polynucleotide from the display fragment component plasmid I.
[0032] In some embodiments, the method includes digesting display fragment component plasmid I with restriction endonucleases that specifically recognize B3 and S5, thereby obtaining a truncated third display vector polynucleotide.
[0033] In some embodiments, the method further includes obtaining a display fragment component plasmid II from the expression vector component II bacterial library, the display fragment component plasmid II comprising a fourth display vector polynucleotide, and obtaining a cleaved fourth display vector polynucleotide from the display fragment component plasmid II.
[0034] In some embodiments, the method includes digesting display fragment component plasmid II with restriction endonucleases that specifically recognize S6 and B2, thereby obtaining a truncated fourth display vector polynucleotide.
[0035] In some embodiments, the method comprises: a) providing a fifth polynucleotide comprising, in a 5' to 3' direction, a B antigen-specific VH-B; b) providing a VH component vector, the VH component vector comprising, in a 5' to 3' direction, a sixth polynucleotide comprising B3-VH component vector ligation fragment-B2; c) cleaving the fifth polynucleotide and the VH component vector with a restriction endonuclease to obtain a cleaved fifth polynucleotide and a released sixth polynucleotide; d) mixing the cleaved fifth polynucleotides and the released sixth polynucleotides such that they can be directionally ligated and circularized to form an antigen-specific VH component library; Including, B is a recognition site for a restriction endonuclease capable of specifically recognizing B2 and / or B3, and the antigen-specific VH encodes the heavy chain variable region of an antigen-specific binding polypeptide.
[0036] In some embodiments, the method comprises: a) providing a seventh polynucleotide comprising, in a 5' to 3' direction, an S antigen-specific LC-S; b) providing a LC component vector, the LC component vector comprising an eighth polynucleotide comprising, in a 5' to 3' direction, the S6-LC component vector ligation fragment S5; c) cleaving the seventh polynucleotide and the LC component vector with a restriction endonuclease to obtain a cleaved seventh polynucleotide and a released eighth polynucleotide; d) mixing the cleaved seventh polynucleotide and the released eighth polynucleotide so that they can be directionally ligated and circularized to form an antigen-specific LC component library; Including, S is a recognition site for a restriction endonuclease capable of specifically recognizing S5 and / or S5, and the antigen-specific LC encodes the light chain of an antigen-specific binding polypeptide.
[0037] In some embodiments, the method comprises: a) providing a ninth polynucleotide comprising in a 5' to 3' direction a B2-VH component vector tool fragment B3; b) inserting the ninth polynucleotide into an expression component vector to obtain a VH component vector; Includes:
[0038] In some embodiments, the method comprises: a) providing a tenth polynucleotide comprising in a 5' to 3' direction an S5-LC component vector tool fragment S6; b) inserting the tenth polynucleotide into an expression component vector to obtain an LC component vector; Includes:
[0039] In some embodiments, the expression component vector is derived from the pMD vector.
[0040] In some embodiments, the pMD vector is or is derived from the pMD19 vector.
[0041] In some embodiments, the method comprises: a) introducing the VH component vector into a ninth bacterium to obtain a VH component vector-stored bacterial library; b) obtaining a VH component vector storage plasmid from a VH component vector storage bacterial library; c) obtaining the released sixth polynucleotide from the VH component vector storage plasmid; Includes:
[0042] In some embodiments, the method comprises digesting the VH component vector storage plasmid with a restriction endonuclease that specifically recognizes B2 and B3, thereby obtaining a released sixth polynucleotide.
[0043] In some embodiments, the method comprises: a) introducing the LC component vector into a tenth bacterium to obtain an LC component vector-preserved bacterial library; b) obtaining the LC component vector-conserved plasmid from the LC component vector-conserved bacterial library; c) obtaining the released eighth polynucleotide from the LC component vector storage plasmid; Includes:
[0044] In some embodiments, the method comprises digesting the LC component vector storage plasmid with a restriction endonuclease that specifically recognizes S5 and S6, thereby obtaining a released eighth polynucleotide.
[0045] In some embodiments, the method comprises: a) providing an antigen-specific VH component library, the antigen-specific VH component library comprising a first polynucleotide comprising, in a 5' to 3' direction, a B2 antigen-specific VH-B3; b) providing an antigen-specific LC component library, the antigen-specific LC component library comprising a second polynucleotide comprising, in a 5' to 3' direction, an S5-antigen-specific LC-S6; c) providing a display vector, the display vector comprising a third polynucleotide comprising, in a 5' to 3' direction, a B3-display vector fragment I-S5, and a fourth polynucleotide comprising, in a 5' to 3' direction, an S6-display vector fragment II-B2; d) specifically cleaving the antigen-specific VH component library, the antigen-specific LC component library and the display vector with restriction endonucleases to obtain a released first polynucleotide, a released second polynucleotide, a released third polynucleotide and a released fourth polynucleotide, wherein the restriction endonucleases specifically recognize B2, B3, S5 and S6, respectively; e) mixing the released first polynucleotide, the released second polynucleotide, the released third polynucleotide, and the released fourth polynucleotide so that they can be directionally ligated and circularized to form an antigen-specific binding polypeptide gene display vector; Including, The antigen-specific LC encodes the light chain of the antigen-specific binding polypeptide, and the antigen-specific VH encodes the heavy chain variable region of the antigen-specific binding polypeptide; B2, B3, S5 and S6 are each independently a recognition site for a restriction endonuclease.
[0046] In some embodiments, the method comprises digesting the antigen-specific VH component library with a restriction endonuclease that specifically recognizes B2 and B3, thereby obtaining released first polynucleotides.
[0047] In some embodiments, the method comprises digesting the antigen-specific LC component library with a restriction endonuclease that specifically recognizes S5 and S6, thereby obtaining a released second polynucleotide.
[0048] In some embodiments, the method includes digesting the display vector with a restriction endonuclease that specifically recognizes B3 and a restriction endonuclease that specifically recognizes S5, thereby obtaining a released third polynucleotide.
[0049] In some embodiments, the method includes digesting the display vector with a restriction endonuclease that specifically recognizes S6 and a restriction endonuclease that specifically recognizes B2, thereby obtaining a released fourth polynucleotide.
[0050] In some embodiments, the fifth polynucleotide, the seventh polynucleotide, the ninth polynucleotide, the tenth polynucleotide, the first display vector polynucleotide, the second display vector polynucleotide, the third display vector polynucleotide, and / or the fourth display vector polynucleotide are obtained from a sample material.
[0051] In some embodiments, the sample material comprises antibodies or antigen-binding fragments thereof and / or IgGs that target specific antigens.
[0052] In some embodiments, the antibody or antigen-binding fragment thereof targets ROR1, PD-1 and / or PD-L1.
[0053] In some embodiments, the IgG is human IgG.
[0054] In some embodiments, the human IgG is human IgG1 or human IgG2.
[0055] In some embodiments, directional ligation involves the use of a ligase.
[0056] In some embodiments, the ligase comprises T4 DNA ligase.
[0057] In some embodiments, the method comprises introducing an antigen-specific binding polypeptide gene display vector into a cell and obtaining the antigen-specific binding polypeptide from the cell.
[0058] In some embodiments, the method comprises: a) introducing an antigen-specific binding polypeptide gene display vector into a first bacterium to obtain an antigen-specific binding polypeptide gene display bacterial library; b) obtaining an antigen-specific binding polypeptide display gene library from the antigen-specific binding polypeptide gene display bacterial library; c) obtaining an antigen-specific binding polypeptide expression vector DNA from the antigen-specific binding polypeptide display gene library; and d) introducing the antigen-specific binding polypeptide expression vector DNA into cells; e) obtaining antigen-specific binding polypeptides from the cells; Includes:
[0059] In some embodiments, the method comprises cryopreserving the antigen-specific binding polypeptide genetic display bacterial library, the VH component vector-stored bacterial library, the LC component vector-stored bacterial library, the display VH component bacterial library, the display LC component bacterial library, the display vector component I bacterial library, and the display vector component II bacterial library.
[0060] In some embodiments, the VH component vector-stored bacterial library comprises at least 10 different clones.
[0061] In some embodiments, the LC component vector-stored bacterial library comprises at least 10 different clones.
[0062] In some embodiments, the display VH component bacterial library comprises at least 10 different clones.
[0063] In some embodiments, the display LC component bacterial library comprises at least 10 different clones.
[0064] In some embodiments, the display vector component I bacterial library comprises at least 10 identical clones.
[0065] In some embodiments, the display vector component II bacterial library comprises at least 10 identical clones.
[0066] In some embodiments, the percentage of successful clones in the antigen-specific binding polypeptide gene display bacterial library is at least about 10%.
[0067] In some embodiments, the cell is a mammalian cell.
[0068] In another aspect, the present application provides a method for screening for an antigen-specific binding polypeptide or a fragment thereof, comprising using an antigen-specific binding polypeptide gene display vector.
[0069] In another aspect, the application provides an antigen-specific binding polypeptide gene display vector produced by the method.
[0070] In another aspect, the present application provides an antigen-specific binding polypeptide genetic display bacterial library produced by the present method.
[0071] Other aspects and advantages of the present application can be readily recognized by those skilled in the art from the following detailed description. In the following detailed description, only exemplary embodiments of the present application are shown and described. As will be recognized by those skilled in the art, the contents of the present application will enable those skilled in the art to make modifications to the specific embodiments disclosed without departing from the spirit and scope of the invention contained herein. Correspondingly, the drawings and descriptions in the specification of the present application are merely illustrative, rather than limiting.
[0072] Particular features of the invention contained in this application are set forth in the appended claims. The features and advantages of the invention contained in this application can be better understood by reference to the exemplary embodiments described in detail below and the accompanying drawings, a brief description of which follows. [Brief explanation of the drawings]
[0073] [Figure 1] FIG. 1 shows the structure of the display vector of the present application. [Figure 2] FIG. 1 shows an example of a display vector of the present application. [Figure 3] FIG. 1 shows the structure of the VH component vector of the present application. [Figure 4] FIG. 1 shows the structure of the LC component vector of the present application. [Figure 5A] FIG. 1 shows the amino acid sequence of the antigen-specific LC of the present application. [Figure 5B] FIG. 1 shows the amino acid sequences of antigen-specific VHs of the present application. [Figure 6] FIG. 1 shows the expression of ROR1 antigen-specific binding polypeptides on the surface of CHO cells analyzed by FACS. [Figure 7] FIG. 1 shows SDS-PAGE denaturing and reducing gel electrophoresis analysis of eight exemplary antibodies. [Figure 8] FIG. 1 shows the results of FACS analysis of positive antibodies screened by the method of the present application. [Figure 9]FIG. 1 is a schematic diagram of the light chain conservation vector during the construction of the phage library. [Figure 10] FIG. 1 is a schematic diagram of the heavy chain conservation vector during the construction of the phage library. [Figure 11] FIG. 1 is a schematic diagram of a linker-conserving vector during the construction of a phage library. [Figure 12] FIG. 1 is a schematic diagram of the pCom3x vector during the construction of a phage library. [Figure 13] FIG. 1 is a schematic diagram of a phage display vector during the construction of a phage library. [Figure 14] FIG. 1 is a schematic diagram of the ligation product plasmid for display in the process of constructing a phage library. DETAILED DESCRIPTION OF THE INVENTION
[0074] Embodiments of the present application are described below by way of specific examples, and other advantages and benefits of the present application will be readily apparent to those skilled in the art from the disclosure herein.
[0075] Definition of Terms In this application, the term "antigen-binding polypeptide" generally refers to a polypeptide molecule capable of specifically recognizing and / or neutralizing a particular antigen. This term can include an antibody or an antigen-binding portion thereof, or the antigen-binding region and / or antibody variable region of an intact antibody. A basic four-chain antibody unit is a heterotetrameric glycoprotein composed of two identical light chains and two identical heavy chains. In the case of IgG, each L chain is linked to an H chain via a covalent disulfide bond, and the two H chains are linked to each other via one or more disulfide bonds, the number of which depends on the H chain isotype. Each H and L chain also has regularly spaced intrachain disulfide bonds. Each H chain has a variable domain (VH) at its N-terminus, followed by three (for α and γ chains, respectively) or four (for μ and ε isotypes) constant domains (CH). Antigen-binding polypeptides can be obtained by chemical and / or genetic engineering methods. For example, antibodies can be digested using proteases, including pepsin and papain, to generate antigen-binding fragments. In the present application, the antibody fragment can be Fab.
[0076] In this application, the term "Fab" generally refers to two identical antigen-binding fragments produced by papain digestion of an antibody with an intact structure (e.g., with the Fc region and hinge region removed). Fab may consist of an intact light chain, a heavy chain variable region (VH), and the first constant domain (CH1) of the heavy chain. Each Fab may have a single antigen-binding site.
[0077] In this application, the term "first polynucleotide" generally refers to a polynucleotide comprising an antigen-specific VH, which may have an endonuclease (e.g., a restriction endonuclease) recognition site at the 5'-end and / or 3'-end. For example, the first polynucleotide may comprise B2 antigen-specific VH-B3 in the 5'-to-3' direction, where B2 and B3 may be restriction endonuclease recognition sites. For example, after digestion with an endonuclease that recognizes the endonuclease recognition site in the first polynucleotide (e.g., a restriction endonuclease that recognizes B2 and B3, such as BsmBI), the released first polynucleotide may comprise an antigen-specific VH, and the two ends of the antigen-specific VH may also have sticky ends with specific sequences after cleavage.
[0078] In this application, the term "second polynucleotide" generally refers to a polynucleotide comprising an antigen-specific LC, which may have a recognition site for an endonuclease (e.g., a restriction endonuclease) at the 5'-end and / or 3'-end. 2 The polynucleotide may comprise, in the 5' to 3' direction, an S5-antigen specific LC-S6, where S5 and S6 may be recognition sites for a restriction endonuclease. 2 After digestion with an endonuclease that recognizes the endonuclease recognition site in the polynucleotide (e.g., a restriction endonuclease that recognizes S5 and S6, such as SfiI), the released 2 The polynucleotide of can comprise an antigen-specific LC, and the antigen-specific LC can also have sticky ends of specific sequences at its two ends after cleavage.
[0079] In this application, the term "antigen-specific VH" generally refers to nucleotides encoding the heavy chain variable region of an antibody capable of specifically binding to an antigen, and the term "antigen-specific LC" generally refers to nucleotides encoding the light chain of an antibody capable of specifically binding to an antigen. The sequences of the antigen-specific VH and antigen-specific LC can be obtained by any method known in the art, including, but not limited to, phage display technology, yeast surface display technology, ribosome display technology, mRNA display technology, and / or hybridoma technology. For example, they can be obtained by phage library display.
[0080] In this application, the term "third polynucleotide" generally refers to a polynucleotide comprising display vector fragment I, which may have an endonuclease (e.g., a restriction endonuclease) recognition site at the 5' and / or 3' end. For example, the third polynucleotide may comprise B3-display vector fragment I-S5 in the 5' to 3' direction, where B3 and S5 may be restriction endonuclease recognition sites. The third polynucleotide may be contained in a display vector. After digestion with an endonuclease that recognizes the endonuclease recognition site in the third polynucleotide (e.g., a restriction endonuclease that recognizes B3 and S5, such as SfiI, BsmBI, and / or Esp3I), the third polynucleotide may be released. The released third polynucleotide may comprise display vector fragment I, which may also have sticky ends of specific sequences at its two ends after cleavage.
[0081] In the present application, the term "released third polynucleotide" generally refers to a fragment of the third polynucleotide released after processing with the display vector. In the present application, the processing can be digestion with a restriction endonuclease. For example, an appropriate restriction endonuclease (e.g., SfiI, BsmBI, and / or Esp3I) can be selected for the recognition site for the restriction endonuclease on the display vector so that the released third polynucleotide can be released from the display vector and isolated.
[0082] In this application, the term "fourth polynucleotide" generally refers to a polynucleotide comprising display vector fragment II, which may have an endonuclease (e.g., a restriction endonuclease) recognition site at the 5' and / or 3' end. For example, the fourth polynucleotide may comprise S6-display vector fragment II-B2 from 5' to 3', where S6 and B2 may be restriction endonuclease recognition sites. The fourth polynucleotide may be contained in a display vector. After digestion with an endonuclease that recognizes the endonuclease recognition site in the fourth polynucleotide (e.g., a restriction endonuclease that recognizes S6 and B2, such as SfiI, BsmBI, and / or Esp3I), the fourth polynucleotide may be released. The released fourth polynucleotide may comprise display vector fragment II, which may also have sticky ends of specific sequences at its two ends after cleavage.
[0083] In the present application, the term "released fourth polynucleotide" generally refers to a fragment of the fourth polynucleotide released after processing with the display vector. In the present application, the processing can be digestion with a restriction endonuclease. For example, an appropriate restriction endonuclease (e.g., SfiI, BsmBI, and / or Esp3I) can be selected for the recognition site for the restriction endonuclease on the display vector so that the released fourth polynucleotide can be released from the display vector and isolated.
[0084] In the present application, the term "fifth polynucleotide" generally refers to a polynucleotide comprising an antigen-specific VH, which may have an endonuclease (e.g., a restriction endonuclease) recognition site at the 5' end and / or 3' end. For example, the fifth polynucleotide may comprise a B antigen-specific VH-B in the 5' to 3' direction, where B may be a restriction endonuclease recognition site, and the restriction endonuclease may be a restriction endonuclease capable of recognizing B2 and / or B3. The cleaved fifth polynucleotide may comprise an antigen-specific VH after being digested with an endonuclease that recognizes the endonuclease recognition site in the fifth polynucleotide (e.g., a restriction endonuclease that recognizes B, such as BsmBI and / or Esp3I).
[0085] In this application, the term "seventh polynucleotide" generally refers to a polynucleotide comprising an antigen-specific LC, which may have a recognition site for an endonuclease (e.g., a restriction endonuclease) at the 5' end and / or 3' end. 7The seventh polynucleotide can comprise, in the 5' to 3' direction, an S antigen-specific LC-S, where S can be a recognition site for a restriction endonuclease, and the restriction endonuclease can be a restriction endonuclease capable of recognizing S5 and / or S6. The cleaved seventh polynucleotide can comprise the antigen-specific LC after digestion with an endonuclease that recognizes the endonuclease recognition site in the seventh polynucleotide (e.g., a restriction endonuclease that recognizes S, such as SfiI).
[0086] In this application, the term "VH component vector" generally refers to a circular polynucleotide comprising a sixth polynucleotide and / or a VH component vector tool fragment.
[0087] In this application, LC The term "component vector" generally refers to a circular polynucleotide that comprises an eighth polynucleotide and / or an LC component vector tool fragment.
[0088] In this application, the term "display vector" generally refers to a circular polynucleotide comprising a display vector fragment I and a display vector fragment II, which may further comprise a display VH and a display LC. After processing, the display vector comprises 1 The display vector polynucleotide of 2 The first display vector polynucleotide, the third display vector polynucleotide, and / or the fourth display vector polynucleotide can be released.
[0089] In this application, the term "first display vector polynucleotide" generally refers to a polynucleotide comprising a display VH that may have an endonuclease (e.g., a restriction endonuclease) recognition site at the 5' end and / or 3' end. For example, a first display vector polynucleotide may comprise B2-display VH-B3 in the 5' to 3' direction, where B2 and B3 may be restriction endonuclease recognition sites. For example, after digestion with an endonuclease that recognizes the endonuclease recognition site in the first display vector polynucleotide (e.g., a restriction endonuclease that recognizes B2 and B3, such as BsmBI), the cleaved first display vector polynucleotide may comprise a display VH, and the display VH may have sticky ends of specific sequences at its two ends after cleavage.
[0090] In this application, the term "second display vector polynucleotide" generally refers to a polynucleotide comprising a display LC that may have a recognition site for an endonuclease (e.g., a restriction endonuclease) at the 5' end and / or 3' end. 2 The display vector polynucleotide of the second display vector can comprise, from 5' to 3', an S5-display LC-S6, where S5 and S6 can be restriction endonuclease recognition sites. For example, after digestion with an endonuclease that recognizes the endonuclease recognition site in the second display vector polynucleotide (e.g., a restriction endonuclease that recognizes S5 and S6, such as SfiI), the cleaved second display vector polynucleotide can comprise a display LC, and the display LC can have sticky ends of specific sequences at its two ends after cleavage.
[0091] In the present application, the term "display VH" generally refers to nucleotides encoding the heavy chain variable region of an antigen-binding polypeptide, and the term "display LC" generally refers to nucleotides encoding the light chain of an antigen-binding polypeptide. The "display VH" and "antigen-specific VH" in the present application may be nucleotides encoding the heavy chain variable region derived from a binding polypeptide for the same antigen, or may be nucleotides encoding heavy chain variable regions derived from binding polypeptides for different antigens. The "display LC" and "antigen-specific LC" in the present application may be nucleotides encoding the light chain derived from a binding polypeptide for the same antigen, or may be nucleotides encoding light chains derived from binding polypeptides for different antigens.
[0092] In this application, the term "display vector fragment" generally refers to a fragment obtained by cleavage of a display vector with a restriction endonuclease (e.g., BsmBI and / or SfiI), such as display vector fragment I and display vector fragment II. The 5' and 3' ends of the display vector fragment can contain recognition sites for the restriction endonuclease.
[0093] In this application, the term "third display vector polynucleotide" generally refers to a polynucleotide comprising display vector fragment I, which may have a recognition site for an endonuclease (e.g., a restriction endonuclease) at the 5' end and / or 3' end. 3 The display vector polynucleotide can include, in the 5' to 3' direction, a B3-display vector fragment I-S5, where B3 and S5 can be recognition sites for restriction endonucleases. 3After digestion with an endonuclease that recognizes the endonuclease recognition site in the display vector polynucleotide (e.g., a restriction endonuclease that recognizes S5, such as SfiI, or a restriction endonuclease that recognizes B3, such as BsmBI and / or Esp3I), the cleaved third display vector polynucleotide can include display vector fragment I, which can also have sticky ends of specific sequences at its two ends after cleavage.
[0094] In this application, the term "fourth display vector polynucleotide" generally refers to a polynucleotide comprising display vector fragment II, which may have a recognition site for an endonuclease (e.g., a restriction endonuclease) at the 5' end and / or 3' end. 4 The display vector polynucleotide can include, in the 5' to 3' direction, an S6-display vector fragment II-B2, where S6, B2 can be a recognition site for a restriction endonuclease. 4 After digestion with an endonuclease that recognizes the endonuclease recognition site in the display vector polynucleotide (e.g., a restriction endonuclease that recognizes S6, such as SfiI, or a restriction endonuclease that recognizes B2, such as BsmBI and / or Esp3I), the cleaved fourth display vector polynucleotide can include display vector fragment II, which can also have sticky ends of specific sequences at its two ends after cleavage.
[0095] In this application, the term "VH component vector" generally refers to the circular polynucleotide formed by inserting the ninth polynucleotide into an expression component vector.
[0096] In this application, the term "LC component vector" generally refers to a circular polynucleotide formed by inserting a tenth polynucleotide into an expression component vector.
[0097] In this application, the term "expression component vector" generally refers to a vector into which a polynucleotide (e.g., a ninth polynucleotide and / or a tenth polynucleotide) can be inserted. The expression component vector is derived from a pMD vector. For example, the expression component vector can be a pMD19 vector or can be derived from a pMD19 vector.
[0098] In this application, the term "ninth polynucleotide" generally refers to a polynucleotide comprising a VH component vector tool fragment that may have a recognition site for an endonuclease (e.g., a restriction endonuclease) at the 5'-end and / or 3'-end. For example, the ninth polynucleotide may comprise a B2-VH component vector tool fragment B3 in the 5'-3' direction, where B2 and B3 may be recognition sites for a restriction endonuclease.
[0099] In this application, the term "tenth polynucleotide" generally refers to a polynucleotide comprising an LC component vector tool fragment that can have a recognition site for an endonuclease (e.g., a restriction endonuclease) at the 5'-end and / or 3'-end. For example, the tenth polynucleotide can comprise an S5-LC component vector tool fragment S6 in the 5'-to-3' direction, where S5 and S6 can be recognition sites for a restriction endonuclease.
[0100] In this application, the term "component vector tool fragment" generally refers to any polynucleotide that may have an endonuclease (e.g., restriction endonuclease) recognition site at the 5' end and / or 3' end, but does not have an endonuclease (e.g., restriction endonuclease) recognition site therein. The length of the component vector tool fragment is usually different from the length of the antigen-specific VH and the antigen-specific LC. In some cases, the length of the component vector tool fragment may be approximately 1 kb. In some cases, the component vector tool fragment may be derived from the Fc region of IgG. For example, the component vector tool fragment may be derived from an Fc region selected from the group consisting of human IgG1 and human IgG2. For example, the endonuclease (e.g., restriction endonuclease) recognition site may be B2 and B3. In another example, the endonuclease (e.g., restriction endonuclease) recognition site may be S5 and S6.
[0101] In this application, the term "component vector" generally refers to a circular polynucleotide formed by inserting a ninth polynucleotide and / or a tenth polynucleotide into an expression component vector.
[0102] In the present application, the term "ninth bacterium" generally refers to a bacterium into which a ninth nucleotide has been introduced or which contains a ninth nucleotide. The ninth bacterium can contain a VH component vector. In the present application, the ninth bacterium can express, replicate, and / or store (e.g., cryopreservate) the ninth nucleotide and / or the VH component vector. In the present application, a VH component vector storage plasmid containing the VH component vector can be obtained from the ninth bacterium.
[0103] In this application, the term "tenth bacterium" generally refers to a bacterium that has introduced or includes a tenth nucleotide. 10The tenth bacterium can comprise the LC component vector. In the present application, the tenth bacterium can express, replicate, and / or store (e.g., cryopreservate) the tenth nucleotide and / or LC component vector. In the present application, an LC component vector storage plasmid comprising the LC component vector can be obtained from the tenth bacterium.
[0104] In the present application, the term "sixth polynucleotide" generally refers to a polynucleotide comprising a VH component vector ligation fragment that may have a recognition site for an endonuclease (e.g., a restriction endonuclease) at the 5' end and / or 3' end. 6 The sixth polynucleotide can comprise a B3-VH component vector ligation fragment B2 in the 5' to 3' direction, where B3 and B2 can be restriction endonuclease recognition sites. The sixth polynucleotide can be included in the VH component vector. After digestion with an endonuclease that recognizes the endonuclease recognition site in the sixth polynucleotide (e.g., a restriction endonuclease that recognizes B3 and B2, such as BsmBI and / or Esp3I), the sixth polynucleotide can be released. The released sixth polynucleotide can be 6 The polynucleotide of can comprise an antigen-specific VH, which can also have sticky ends of specific sequences at its two ends after cleavage.
[0105] In the present application, the term "released sixth polynucleotide" generally refers to a fragment of the sixth polynucleotide released after processing with the VH component vector. In the present application, the processing can be digestion with a restriction endonuclease. For example, a suitable restriction endonuclease (e.g., BsmBI and / or Esp3I) can be used to digest the released sixth polynucleotide from the VH component vector so that it can be released and isolated. VH component vector The recognition site for the above restriction endonuclease can be selected.
[0106] In this application, the term "eighth polynucleotide" generally refers to a polynucleotide comprising an LC component vector ligation fragment that may have a recognition site for an endonuclease (e.g., a restriction endonuclease) at the 5' end and / or 3' end. 8 The eighth polynucleotide can comprise the S6-LC component vector ligation fragment S5 in the 5' to 3' direction, where S6 and S5 can be restriction endonuclease recognition sites. The eighth polynucleotide can be contained in the LC component vector. After digestion with an endonuclease that recognizes the endonuclease recognition site in the eighth polynucleotide (e.g., a restriction endonuclease that recognizes S6 and S5, such as SfiI), the eighth polynucleotide can be released. The released eighth polynucleotide can comprise an antigen-specific LC, which can also have sticky ends of specific sequences at its two ends after cleavage.
[0107] In the present application, the term "released eighth polynucleotide" generally refers to a fragment of the eighth polynucleotide released after treatment with the LC component vector. In the present application, the treatment can be digestion with a restriction endonuclease. For example, an appropriate restriction endonuclease (e.g., SfiI) can be added to the LC component vector so that the released eighth polynucleotide can be released from the LC component vector and isolated. LC component vector The recognition site for the above restriction endonuclease can be selected.
[0108] In this application, the term "restriction endonuclease" generally refers to an enzyme that cleaves double-stranded DNA. Restriction endonucleases can generate sticky ends with protruding single-stranded DNA that can be bound by DNA ligase. In this application, restriction endonucleases can have the effect of recognition and restriction cleavage. For example, the cleavage site of a restriction endonuclease is at a certain distance from its recognition site. For example, the restriction endonuclease can be selected from SfiI, BsmBI, and Esp3I.
[0109] In this application, the term "first bacterium" generally refers to a bacterium into which an antigen-specific binding polypeptide gene display vector has been introduced or which contains the vector. The first bacterium may contain an antigen-specific VH, an antigen-specific LC, a display vector fragment I, and a display vector fragment II. In this application, the first bacterium is capable of expressing, replicating, and / or storing (e.g., cryopreserving) the antigen-specific VH, the antigen-specific LC, the display vector fragment I, and the display vector fragment II, or the antigen-specific binding polypeptide expression vector DNA.
[0110] In the present application, the term "antigen-specific binding polypeptide genetic display bacterial library" generally refers to a bacterial library obtained by introducing an antigen-specific binding polypeptide genetic display vector into a first bacterium. In the present application, the antigen-specific binding polypeptide genetic display bacterial library can be a bacterial library containing nucleic acid sequences encoding the light chain variable region of an antigen-specific binding polypeptide or the heavy chain variable region of an antigen-specific binding polypeptide. In the present application, the antigen-specific binding polypeptide genetic display bacterial library is a bacterial library containing nucleic acid sequences encoding antigen-specific binding polypeptides in a volume of about 10 5 ~about 10 9 can contain (e.g., about 10 5 ~about 10 8 , about 10 5 ~about 10 7 , about 10 6 ~about 10 7 In the present application, the antigen-specific binding polypeptide gene display bacterial library comprises a first bacterium, the first bacterium being about 10 7 ~about 10 12 can contain (e.g., about 10 7 ~about 10 11 , about 10 7 ~about 10 10 , about 10 7 ~about 10 9 , about 10 7 ~about 10 8 may contain).
[0111] In the present application, the term "first display bacterium" generally refers to a bacterium into which a first display vector polynucleotide has been introduced or which contains the first display vector polynucleotide. The first bacterium can contain a display VH. In the present application, the first display bacterium can express, replicate, and / or store (e.g., cryopreservate) the display VH and / or the first display vector polynucleotide.
[0112] In the present application, the term "display VH component bacterial library" generally refers to a bacterial library obtained by introducing a first display vector polynucleotide into a first display bacterium. In the present application, the display VH component bacterial library can be a bacterial library containing nucleic acid sequences encoding heavy chain variable regions of antigen-specific polypeptides. In the present application, the display VH component bacterial library can be a bacterial library containing about 10 nucleic acid sequences encoding display VHs. 5 ~about 10 9 can contain (e.g., about 10 5 ~about 10 8 , about 10 5 ~about 10 7 , about 10 6 ~about 10 7 In the present application, the display VH component bacterial library comprises a first display bacterium containing about 10 7 ~about 10 12 can contain (e.g., about 10 7 ~about 10 11 , about 10 7 ~about 10 10 , about 10 7 ~about 10 9 , about 10 7 ~about 10 8 may contain).
[0113] In this application, the term "second display bacterium" generally refers to a bacterium into which a second display vector polynucleotide has been introduced or which contains the second display vector polynucleotide. The second bacterium can contain a display LC. In this application, the second display bacterium can express, replicate, and / or store (e.g., cryopreservate) the display LC and / or the second display vector polynucleotide.
[0114] In the present application, the term "display LC component bacterial library" generally refers to a bacterial library obtained by introducing a second display vector polynucleotide into a second display bacterium. In the present application, the display LC component bacterial library can be a bacterial library containing nucleic acid sequences encoding the light chain of an antigen-specific polypeptide. In the present application, the display LC component bacterial library is a bacterial library containing about 10 nucleic acid sequences encoding the display LC. 5 ~about 10 9 can contain (e.g., about 10 5 ~about 10 8 , about 10 5 ~about 10 7 , about 10 6 ~about 10 7 In the present application, the display LC component bacterial library may contain about 10 second display bacteria. 7 ~about 10 12 can contain (e.g., about 10 7 ~about 10 11 , about 10 7 ~about 10 10 , about 10 7 ~about 10 9 , about 10 7 ~about 10 8 may contain).
[0115] In the present application, the term "third display bacterium" generally refers to a bacterium into which a third display vector polynucleotide has been introduced or which contains a third display vector polynucleotide. The third bacterium can contain display vector fragment I. In the present application, the third display bacterium can express, replicate, and / or store (e.g., cryopreservate) display vector fragment I and / or the third display vector polynucleotide.
[0116] In the present application, the term "display vector component I bacterial library" generally refers to a bacterial library obtained by introducing a third display vector polynucleotide into a third display bacterium. In the present application, the display vector component I bacterial library can be a bacterial library containing a nucleic acid sequence encoding a display vector component I. In the present application, the display vector component I bacterial library is a bacterial library containing about 10 nucleic acid sequences encoding a display LC. 5 ~about 10 9 can contain (e.g., about 10 5 ~about 10 8 , about 10 5 ~about 10 7 , about 10 6 ~about 10 7 In the present application, the display vector component I bacterial library comprises about 10 7 ~about 10 12 can contain (e.g., about 10 7 ~about 10 11 , about 10 7 ~about 10 10 , about 10 7 ~about 10 9 , about 10 7 ~about 10 8 may contain).
[0117] In the present application, the term "fourth display bacterium" generally refers to a bacterium into which a fourth display vector polynucleotide has been introduced or which contains a fourth display vector polynucleotide. The fourth bacterium can contain display vector fragment II. In the present application, the fourth display bacterium can express, replicate, and / or store (e.g., cryopreservate) display vector fragment II and / or the fourth display vector polynucleotide.
[0118] In this application, the term "display vector component II bacterial library" generally refers to 4 The term "display vector component II bacterial library" refers to a bacterial library obtained by introducing a display vector polynucleotide of the first component II into a fourth display bacterium. In the present application, the display vector component II bacterial library can be a bacterial library containing a nucleic acid sequence encoding the display vector component II. In the present application, the display vector component II bacterial library refers to a bacterial library containing a nucleic acid sequence encoding the display LC of about 10 5 ~about 10 9 can contain (e.g., about 10 5 ~about 10 8 , about 10 5 ~about 10 7 , about 10 6 ~about 10 7 In the present application, the display vector component II bacterial library comprises about 10 7 ~about 10 12 can contain (e.g., about 10 7 ~about 10 11 , about 10 7 ~about 10 10 , about 10 7 ~about 10 9 , about 10 7 ~about 10 8 may contain).
[0119] In this application, the term "introduction" generally refers to the process of transferring or introducing an exogenous polynucleotide into a cell. The cell may be a host cell. Introduced cells include the primary cell of interest and their progeny. The cell may be a prokaryotic cell, such as a bacterial cell.
[0120] In this application, the term "ligation" generally refers to the ligation of two or more polynucleotide molecules together. For example, ligation can be achieved by a ligase (e.g., a DNA ligase). For example, the 3' end of one polynucleotide is ligated to the 5' end of another polynucleotide to form an intact polynucleotide molecule.
[0121] In this application, the term "clones" generally refers to the number of colonies. For example, clones can be the number of colonies in a bacterial library (e.g., a light chain component bacterial library, a heavy chain component bacterial library, a display bacterial library, and / or a phage library). In some cases, clones can be the number of different colonies in a bacterial library. In some cases, clones can be the number of progeny populations produced by a single clone.
[0122] In this application, the terms "polynucleotide," "nucleotide," "nucleotide sequence," "nucleic acid," and "oligonucleotide" can be used interchangeably and generally refer to a polymeric form of nucleotides of any length, such as deoxyribonucleotides or ribonucleotides or analogs thereof, including, for example, 200, 300, 500, 1000, 2000, 3000, 5000, 7000, 10,000, 100,000, etc. Polynucleotides may contain phosphodiester bonds.
[0123] In this application, the term "and / or" should be understood to mean either or both of the alternatives.
[0124] In this application, the term "comprise" generally refers to the inclusion of the features expressly specified but not the exclusion of other elements.
[0125] In this application, the term "about" generally refers to a variation within 0.5% to 10% above or below the specified value, for example, a variation within 0.5%, 1%, 1.5%, 2%, 2.5%, 3%, 3.5%, 4%, 4.5%, 5%, 5.5%, 6%, 6.5%, 7%, 7.5%, 8%, 8.5%, 9%, 9.5%, or 10% above or below the specified value.
[0126] Detailed Description In one aspect, the present application provides methods for constructing antigen-specific binding polypeptide gene display vectors.
[0127] The antigen-specific binding polypeptide gene display vector of the present application can be composed of four fragments linked by directional circularization, and can include an antigen-specific VH, an antigen-specific LC, a display vector fragment I, and a display vector fragment II, respectively.
[0128] Ingredient Vector The method of the present application can include constructing a component vector, which can include providing polynucleotides, such as a ninth polynucleotide and a tenth polynucleotide. The ninth polynucleotide can include, in a 5' to 3' direction, a B2-VH component vector tool fragment B3, and the tenth polynucleotide can include, in a 5' to 3' direction, an S5-LC component vector tool fragment S6. The vector tool fragments can be derived from the Fc fragment of IgG. For example, the Fc fragment of human IgG1 can be included. Another example is the Fc fragment of human IgG2. In some cases, the ninth polynucleotide can be obtained by amplification using DDB214 and DDB215 as primers and the Fc fragment of human IgG1 as a template, where DDB214 can include the amino acid sequence set forth in SEQ ID NO:1 and DDB215 can include the amino acid sequence set forth in SEQ ID NO:2. In some cases, the tenth nucleotide can be obtained by amplification using DDB216 and DDB217 as primers and the Fc fragment of human IgG1 as a template, where DDB216 can comprise the amino acid sequence set forth in SEQ ID NO: 3 and DDB217 can comprise the amino acid sequence set forth in SEQ ID NO: 4. The ninth nucleotide can comprise restriction endonuclease recognition sites B2 and B3 at its two ends, and the tenth nucleotide can comprise restriction endonuclease recognition sites S5 and S6 at its two ends.
[0129] The method can include inserting the polynucleotides (eg, the ninth and tenth polynucleotides) into an expression component vector to obtain component vectors (eg, a VH component vector and a LC component vector).
[0130] The expression component vector can be derived from any vector, for example, any vector that can be amplified and / or easily stored. In some cases, the vector used as the expression component vector can have characteristics such as high copy number, low molecular weight, etc. In some cases, the expression component vector can be derived from a pMD vector. For example, the expression component vector can be a pMD19 vector or can be derived from a pMD19 vector.
[0131] In the present application, for the purpose of constructing an expression component vector, a pMD vector or a vector derived from pMD can be manipulated / modified. For example, one or more recognition sites for an endonuclease in the vector can be removed by site-directed mutagenesis (e.g., one or more recognition sites for BsmBI and / or SfiI can be removed therein). In some cases, one or more recognition sites for an endonuclease can also be added to the vector by site-directed mutagenesis (e.g., one or more recognition sites for BsmBI and / or SfiI can be added at selected positions).
[0132] For example, one or more recognition sites for BsmBI originally contained in a vector can be removed by site-directed mutagenesis, and then one or more additional recognition sites for BsmBI can be added at different locations within the vector to obtain a modified vector (e.g., a modified pMD vector).
[0133] In the present application, an expression component vector (e.g., an expression component vector of a VH component vector) may contain a recognition site for BsmBI. In some cases, an expression component vector may contain two recognition sites for BsmBI.
[0134] In another example, one or more recognition sites for SfiI originally contained in a vector can be removed by site-directed mutagenesis, and then one or more additional recognition sites for SfiI can be added at different locations within the vector to obtain a modified vector (e.g., a modified pMD vector).
[0135] In the present application, an expression component vector (e.g., an expression component vector of an LC component vector) may contain a recognition site for SfiI. In some cases, an expression component vector may contain two recognition sites for SfiI.
[0136] In some cases, the method may further include inserting the polynucleotides (e.g., the ninth and tenth polynucleotides) into expression component vectors to obtain component vector storage plasmids (e.g., a VH component vector storage plasmid and an LC component vector storage plasmid), and then introducing the component vector storage plasmids into bacteria (e.g., the ninth and tenth bacteria) to obtain component vector storage bacterial libraries (e.g., a VH component vector storage bacterial library and an LC component vector storage bacterial library).
[0137] For example, the VH component vector of the present application is shown in Figure 3, which can be obtained by ligating a ninth polynucleotide into an expression component vector. The VH component vector comprises a sixth polynucleotide that can comprise, in a 5' to 3' direction, B3-VH component vector ligation fragment-B2, where B2 and B3 can be specifically recognized and cleaved by BsmBI and / or Esp3I, respectively. For example, B2 can comprise the nucleic acid sequence set forth in SEQ ID NO:8, and B3 can comprise the nucleic acid sequence set forth in SEQ ID NO:9.
[0138] After being processed (e.g., digested), the VH component vector can generate a released sixth polynucleotide that can have sticky ends of specific sequences generated after cleavage at its 5' and 3' ends.
[0139] For example, the LC component vector of the present application is shown in Figure 4, which can be obtained by ligating a tenth polynucleotide into an expression component vector. The LC component vector includes an eighth polynucleotide that can include, in a 5' to 3' direction, an S6-LC component vector ligation fragment S5, where S6 and S5 can each be specifically recognized and cleaved by SfiI. For example, S6 can include the nucleic acid sequence set forth in SEQ ID NO:11, and S5 can include the nucleic acid sequence set forth in SEQ ID NO:10.
[0140] After being processed (e.g., digested), LC component vector can generate a released eighth polynucleotide that can have sticky ends of a specific sequence generated after cleavage at its 5' and 3' ends.
[0141] Antigen-specific VH and antigen-specific LC The method of the present application includes providing a fifth polynucleotide comprising, in the 5' to 3' direction, a B antigen-specific VH-B, where B is a recognition site for a restriction endonuclease that can specifically recognize B2 and / or B3. For example, an antigen-specific VH can be amplified using an antigen-specific VH fragment as a template such that the 5' and 3' ends of the antigen-specific VH bind to the recognition sites for the restriction endonuclease (e.g., BsmBI and / or Esp3I).
[0142] The method of the present application includes providing a seventh polynucleotide comprising, in the 5' to 3' direction, an S antigen-specific LC-S, where S is a recognition site for a restriction endonuclease that can specifically recognize S5 and / or S6. For example, the antigen-specific LC can be amplified using an antigen-specific LC fragment as a template such that the 5' and 3' ends of the antigen-specific LC bind to the recognition sites of the restriction endonuclease (e.g., SfiI).
[0143] In some cases, the antigen-specific VH fragment and the antigen-specific LC fragment can be obtained by prior art methods, for example, they can be obtained from animals immunized with the antigen, or they can be obtained from antibody libraries, including combinatorial antibody libraries, phage display libraries, yeast surface display libraries, ribosome display libraries, and mRNA display libraries.
[0144] Ingredient Library The method of the present application may include cleaving the fifth polynucleotide and the VH component vector with a restriction endonuclease to obtain cleaved fifth polynucleotides and released sixth polynucleotides, and then mixing the cleaved fifth polynucleotides and released sixth polynucleotides so that they can be directionally ligated and circularized to form the antigen-specific VH component library.
[0145] The antigen-specific VH component library can contain antigen-specific VHs. After cleaving the antigen-specific VH component library with a restriction endonuclease (e.g., a restriction endonuclease that recognizes B2 and B3), released antigen-specific VHs can be obtained, whose 5' and 3' ends can have sticky ends of specific sequences.
[0146] The method of the present application may include cleaving the seventh polynucleotide and the LC component vector with a restriction endonuclease to obtain a cleaved seventh polynucleotide and a released eighth polynucleotide, and then mixing the cleaved seventh polynucleotide and the released eighth polynucleotide such that they can be directionally ligated and circularized to form the antigen-specific LC component library.
[0147] The antigen-specific LC component library can contain antigen-specific LCs. After cleaving the antigen-specific LC component library with a restriction endonuclease (e.g., a restriction endonuclease that recognizes S5 and S6), released antigen-specific LCs can be obtained, whose 5' and 3' ends can have sticky ends of specific sequences.
[0148] Display Vector The methods of the present application may also include constructing a display vector that may be composed of four display vector polynucleotides (e.g., a first display vector polynucleotide, a second display vector polynucleotide, a third display vector polynucleotide, and a fourth display vector polynucleotide).
[0149] The display vector polynucleotides of the present application (first display vector polynucleotide, second display vector polynucleotide, third display vector polynucleotide, and fourth display vector polynucleotide) can comprise an antigen-binding polypeptide or a fragment thereof, such as a display LC and / or a display VH. In the present application, the display LC can encode the light chain of the antigen-binding polypeptide, and the display VH can encode the heavy chain variable region of the antigen-binding polypeptide, where the light chain can bind to the heavy chain variable region to form an Fab that recognizes a target. In some cases, the target can be an antigen. For example, the target is PD-1.
[0150] The display vector polynucleotides of the present application (e.g., the first display vector polynucleotide, the second display vector polynucleotide, the third display vector polynucleotide, and the fourth display vector polynucleotide) can comprise display vector fragments such as display vector fragment I and display vector fragment II. The desired length or type of display vector fragment I and display vector fragment II can be selected depending on the length or nature of the antigen-binding polypeptide or fragment thereof to be expressed, and the length or nature of the restriction site, respectively.
[0151] In some cases, the display vector fragment I and the display vector fragment II can be derived from any one vector fragment capable of expressing a target gene. For example, the expression vector fragment I and the expression vector fragment II can be derived from a fragment of the display vector pDGB4 (for pDGB4, see Ivan Zhou et al., "Four-way ligation for construction of a mammalian cell-based full-length antibody display library," Acta Biochim Biophys Sin 2011, 43:232-238).
[0152] The display vector fragments of the present application (e.g., display vector fragment I and display vector fragment II) can contain nucleotide sequences having specific functions, including, but not limited to, promoters, enhancers, signal peptides, screening markers (e.g., they may include enzyme recognition sites, resistance genes, reporter genes, and screening genes), which can be adjusted in the display vector fragments by those skilled in the art according to the desired functions (insertion / substitution and / or deletion of the above nucleotide sequences having specific functions). In some cases, the display vector fragments can be adjusted in different cases to obtain different nucleotide sequences.
[0153] In the present application, the first display vector polynucleotide can comprise, from 5' to 3', B2-display VH-B3, where B2 and B3 can each independently be a recognition site for a restriction endonuclease, and the display VH can encode a heavy chain variable region of an antigen-binding polypeptide. In some cases, B2 and B3 can be specifically recognized and cleaved by BsmBI, respectively. For example, B2 can comprise the nucleic acid sequence set forth in SEQ ID NO:8, and B3 can comprise the nucleic acid sequence set forth in SEQ ID NO:9.
[0154] The second display vector polynucleotide can comprise, in a 5' to 3' direction, an S5-display LC-S6, where S5 and S6 can each independently be a recognition site for a restriction endonuclease, and the display LC can encode the light chain of an antigen-binding polypeptide. In some cases, S5 and S6 can each be specifically recognized and cleaved by Sfil. For example, S5 can be a sequence similar to SEQ ID NO: 10 and S6 may comprise the nucleic acid sequence set forth in SEQ ID NO:11.
[0155] The third display vector polynucleotide can comprise, from 5' to 3', the B3-display vector fragment I-S5, where B3 and S5 can each independently be a recognition site for a restriction endonuclease. In some cases, S5 can be specifically recognized and cleaved by Sfil, and B3 can be specifically recognized and cleaved by BsmBI and / or Esp3I. For example, B3 can comprise the nucleic acid sequence set forth in SEQ ID NO:9, and S5 can comprise the nucleic acid sequence set forth in SEQ ID NO:10.
[0156] The fourth display vector polynucleotide can include, from 5' to 3', the S6-display vector fragment II-B2, where S6 and B2 can each independently be a recognition site for a restriction endonuclease. In some cases, S6 can be specifically recognized and cleaved by Sfil, and B2 can be specifically recognized and cleaved by BsmBI and / or Esp3I. For example, B2 can include the nucleic acid sequence set forth in SEQ ID NO:8, and S6 can include the nucleic acid sequence set forth in SEQ ID NO:11.
[0157] The first display vector polynucleotide, second display vector polynucleotide, third display vector polynucleotide, and / or fourth display vector polynucleotide of the present application can be obtained from a sample material. In some cases, the sample material can contain an antigen-targeting antibody or antigen-binding fragment thereof. The antigen can be any immunogenic fragment or determinant, including, but not limited to, PD-1, PD-L1, LAG-3, CD47, and CD3. For example, the antibody or antigen-binding fragment thereof targets PD-1.
[0158] To screen for positive bacteria into which the display vector polynucleotides have been introduced, the display vector polynucleotides (e.g., the first, second, third, and fourth display vector polynucleotides) can also include a nucleic acid sequence encoding a signal peptide, such as a signal peptide expressing a native resistance gene. In one example, the 3' end of the nucleic acid sequence encoding the signal peptide can be linked to a restriction site at the 5' end of the polynucleotide. In some cases, the base sequence of the nucleic acid sequence encoding the signal peptide can be altered by unintentional mutation to introduce a suitable restriction site at the 3' end, while the amino acid sequence of the signal peptide remains unchanged. For example, the nucleic acid sequence encoding the signal peptide can include the nucleic acid sequence set forth in any one of SEQ ID NOs: 12 and 14. Alternatively, the signal peptide can include the amino acid sequence set forth in any one of SEQ ID NOs: 13 and 15.
[0159] Polynucleotides can be obtained by conventional methods in the art, including, but not limited to, standard PCR, long PCR, hot-start PCR, qPCR, RT-PCR, and isothermal amplification. In some cases, primers can be designed according to the sequences of the target fragments (e.g., display LC, display VH, display vector fragment I, and display vector fragment II), respectively, and then used as templates for amplification to obtain polynucleotides. For example, primers for amplifying display LC can include the nucleotide sequences set forth in SEQ ID NO:20 and SEQ ID NO:21. For example, primers for amplifying display VH can include the nucleotide sequences set forth in SEQ ID NO:22 and SEQ ID NO:23. For example, primers for amplifying display vector fragment I can include the nucleotide sequences set forth in SEQ ID NO:18 and SEQ ID NO:19. For example, primers for amplifying display vector fragment II can include the nucleotide sequences set forth in SEQ ID NO:16 and SEQ ID NO:17.
[0160] After obtaining the display vector polynucleotides, they can be introduced into bacteria separately to obtain a bacterial library. Thus, the method of the present application may further include introducing a first display vector polynucleotide into a first display bacterium to obtain a display VH component bacterial library, introducing a second display vector polynucleotide into a second display bacterium to obtain a display LC component bacterial library, introducing a third display vector polynucleotide into a third display bacterium to obtain a display vector component I bacterial library, and introducing a fourth display vector polynucleotide into a fourth display bacterium to obtain a display vector component II bacterial library.
[0161] In the present application, the first display vector polynucleotide, the second display vector polynucleotide, the third display vector polynucleotide, and the fourth display vector polynucleotide can all be linear nucleic acid molecules.
[0162] Optionally, the display vector polynucleotide can be inserted into a display component vector to form a storage ligation product. Optionally, the polynucleotide can be inserted into the component vector by using PCR cloning. Component vectors can include plasmid vectors (e.g., pBR322, pUC vectors), phage vectors (e.g., M13 vectors, lambda vectors), phage-derived plasmids (e.g., phagemids, cosmids), and bacterial artificial chromosomes (BACs). In some embodiments, the component vector can be derived from a pUC vector. For example, the component vector can be a pUC19 vector or can be derived from a pUC19 vector.
[0163] The stored ligation products can then be introduced into bacteria to generate a display bacterial library.
[0164] In the present application, the display bacterial library (e.g., the display VH component bacterial library and the display LC component bacterial library) can comprise at least about 10 (e.g., at least about 100, at least 200, at least 300, at least 400, at least 500, at least 600, at least 800, at least about 1000, at least about 10,000 or more) different clones.
[0165] In the present application, a display bacterial library (e.g., a display vector component I bacterial library and a display vector component II bacterial library) can contain at least about 10 identical clones (e.g., at least about 100, at least 200, at least 300, at least 400, at least 500, at least 600, at least 800, at least about 1000, at least about 10,000 or more).
[0166] In the present application, the percentage of effective clones in a display bacterial library (e.g., a display VH component bacterial library, a display LC component bacterial library, a display vector component I bacterial library, and a display vector component II bacterial library) can be at least about 50% (e.g., at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 99%).
[0167] In the present application, bacteria in a display bacterial library (e.g., a display VH component bacterial library, a display LC component bacterial library, a display vector component I bacterial library, and a display vector component II bacterial library) can be cultured in liquid. The time for liquid culture can be about 8 hours or less, for example, about 4 hours or less, about 5 hours or less, about 6 hours or less, or about 7 hours or less. In the present application, the liquid culture operation is simple. In some cases, bacteria in a display bacterial library can be spread on plates and cultured in a small amount of bacterial broth, and then colonies are selected. The time for plate culture can be about 12 to 18 hours, for example, about 12, 13, 14, 15, 16, 17, or 18 hours. In the present application, plate culture allows for colony selection (e.g., selection of monoclones) prior to sequencing analysis.
[0168] Antigen-specific binding polypeptide gene display vector The methods of the present application may further include specifically cleaving the VH component library, the LC component library, and the display vector with a restriction endonuclease (e.g., a restriction endonuclease that specifically recognizes S5, S6, B2, and B3) to obtain the released first polynucleotide, the released second polynucleotide, the released third polynucleotide, and the released fourth polynucleotide.
[0169] The 5' end of the released first polynucleotide can have a sticky end after cleavage with a restriction endonuclease (e.g., a restriction endonuclease that specifically recognizes B2, e.g., BsmBI and / or Esp3I), and the 3' end can have a sticky end after cleavage with a restriction endonuclease (e.g., a restriction endonuclease that specifically recognizes B3, e.g., BsmBI and / or Esp3I).
[0170] The 5' end of the released second polynucleotide has a sticky end after cleavage with a restriction endonuclease (e.g., a restriction endonuclease that specifically recognizes S5, such as SfiI), and the 3' end has a sticky end after cleavage with a restriction endonuclease (e.g., a restriction endonuclease that specifically recognizes S6, such as SfiI).
[0171] The 5' end of the released third polynucleotide has a sticky end after cleavage with a restriction endonuclease (e.g., a restriction endonuclease that specifically recognizes B3, e.g., BsmBI and / or Esp3I), and the 3' end has a sticky end after cleavage with a restriction endonuclease (e.g., a restriction endonuclease that specifically recognizes S5, e.g., SfiI).
[0172] The 5' end of the released fourth polynucleotide has a sticky end after cleavage with a restriction endonuclease (e.g., a restriction endonuclease that specifically recognizes S6, such as SfiI), and the 3' end has a sticky end after cleavage with a restriction endonuclease (e.g., a restriction endonuclease that specifically recognizes B2, such as BsmBI and / or Esp3I).
[0173] In the present application, the first polynucleotide, second polynucleotide, third polynucleotide and fourth polynucleotide can all be linear nucleic acid molecules.
[0174] The method of the present application may further include mixing the released first polynucleotide, the released second polynucleotide, the released third polynucleotide, and the released fourth polynucleotide so that they can be directionally ligated and circularized to form an antigen-specific binding polypeptide gene display vector. In some cases, the directional ligation may include the use of a ligase, such as T4 DNA ligase.
[0175] In some cases, an antigen-specific binding polypeptide gene display vector Thin By introducing the vector into bacteria, a bacterial library of antigen-specific binding polypeptide genes can be obtained.
[0176] In the present application, the antigen-specific binding polypeptide gene display bacterial library may contain at least about 10 clones (e.g., at least about 100, at least about 200, at least about 300, at least about 400, at least about 500, at least about 1000, at least about 10,000 or more).
[0177] In the present application, the percentage of effective clones in an antigen-specific binding polypeptide gene display bacterial library can be at least about 50% (e.g., at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 99%).
[0178] The time required from construction of a display vector to screening for antigen-specific binding polypeptides of unique sequences using the method of the present application can be at least about one week (e.g., at least about 10 days, at least about two weeks, at least about three weeks, or at least about four weeks).
[0179] In the present application, bacteria in an antigen-specific binding polypeptide gene display bacterial library can be cultured in liquid. The time for liquid culture can be about 24 hours or less, for example, about 5 hours or less, about 10 hours or less, about 15 hours or less, about 20 hours or less, about 22 hours or less, or about 22 hours or less. In the present application, the liquid culture procedure is simple. In some cases, bacteria in the bacterial library can be spread on plates and cultured in a small amount of bacterial broth, followed by colony selection. The time for plate culture can be about 12 to 18 hours, for example, about 12, 13, 14, 15, 16, 17, or 18 hours. In the present application, plate culture allows for colony selection (e.g., selection of monoclones) prior to sequencing analysis.
[0180] The method may further include introducing the antigen-specific binding polypeptide gene display vector into a cell and obtaining the antigen-specific binding polypeptide from the cell. For example, the cell may be a mammalian cell. The antigen-specific binding polypeptide is then cell can be obtained from
[0181] Restriction sites In the present application, the polynucleotide encoding the antigen-binding polypeptide or a fragment thereof is designed so that the restriction endonuclease recognition site sequence is not included. The restriction endonuclease of the present application can specifically recognize B2, B3, S5, and S6, respectively. B2, B3, S5, and S6 can each independently be a recognition site for the restriction endonuclease.
[0182] The restriction endonuclease recognition sites in this application can be specifically recognized by one, two, three, four or more restriction endonucleases, respectively. In some cases, the restriction endonucleases can be selected from SfiI, BsmBI and / or Esp3I. In other cases, other viable restriction endonucleases can also be selected.
[0183] In the present application, the restriction endonuclease may be selected from SfiI, BsmBI, and Esp3I. In the present application, BsmBI and Esp3I may be isozymes capable of recognizing the same recognition site of the restriction endonuclease.
[0184] In the present application, for example, S5 and S6 can be recognized and cleaved by SfiI. In the present application, for example, B2 and B3 can be recognized and cleaved by BsmBI and / or Esp3I.
[0185] For example, SfiI can recognize a 13-base (5' to 3') sequence consisting of GGCCNNNN / NGGCC, which can form an overhang sequence (e.g., a single-stranded sequence containing 3 bases) at the 3' end after enzymatic cleavage, where N can represent any of the four bases GATC. Thus, there are 4-5 different sequences that can be recognized by SfiI.
[0186] For example, BsmBI and Esp3I can recognize a 12-base (5' to 3') sequence consisting of CGTCTCN / NNNNN, which can form an overhang sequence (e.g., a single-stranded sequence containing four bases) at the 5' end after enzymatic cleavage, where N can represent any one of the four bases GATC. Therefore, there are 4 to 6 different sequences that can be recognized by BsmBI and Esp3I.
[0187] In some cases, the restriction endonuclease recognition site may be a site specifically recognized and cleaved by SfiI. For example, the sites may be designated S5 and S6, respectively. For example, S5 may comprise the nucleic acid sequence set forth in SEQ ID NO: 10. In another example, S6 may comprise the nucleic acid sequence set forth in SEQ ID NO: 11.
[0188] The restriction endonuclease recognition sites can be sites specifically recognized and cleaved by BsmBI and / or Esp3I. For example, the sites can be designated B2 and B3, respectively. For example, B2 can include the nucleic acid sequence set forth in SEQ ID NO:8. Further, for example, B3 can include the nucleic acid sequence set forth in SEQ ID NO:9.
[0189] It should be noted that recognition sites for restriction endonucleases in this application include, but are not limited to, the recognition sites enumerated herein, and can also include recognition sites for other restriction endonucleases not enumerated, as well as other recognition sites for restriction endonucleases, so long as they do not result in undesired recognition or cleavage of the target sequence (e.g., a polynucleotide encoding an antigen-binding polypeptide or fragment thereof).
[0190] In another aspect, the present application further provides an antigen-specific binding polypeptide genetic display bacterial library.
[0191] In another aspect, the application further provides a display vector produced by the method.
[0192] Without intending to be limited by any theory, the following examples are merely illustrative of the fusion proteins, their preparation methods and uses of the present application, and are not to be used to limit the scope of the invention of the present application.
[0193] example Example 1. Construction of a phage surface antibody (Fab) display library on human PBMCs 1.1 Obtaining total RNA / mRNA from immune samples Total RNA was extracted from human peripheral blood lymphocytes, and mRNA was further isolated from the total RNA (Takara catalog number Z652N / 636592, please refer to the product manual for specific test procedures).
[0194] 1.2 Primer design and synthesis Primers for the human heavy chain variable region VH, light chain KLC (full-length kappa light chain), and light chain LLC (full-length lambda light chain) were designed with reference to phage display (A Laboratory Manual, ISBN 0-87969-546-3). The 5' end of the light chain forward primer contained the nucleotide sequence GGCCCAGGCGGCC (SEQ ID NO: 78) of R1, the 5' end of the reverse primer contained the nucleotide sequence GGCCACATAGGCC (SEQ ID NO: 79) of R2, the 5' end of the heavy chain variable region forward primer contained the nucleotide sequence GGCCCAACCGGCC (SEQ ID NO: 80) of R5, and the 5' end of the reverse primer contained the nucleotide sequence GGCCCTCAGCGGCC (SEQ ID NO: 81) of R6. Primers were synthesized by GENEWIZ.
[0195] Forward and reverse primers for amplifying the linker were designed using the pComb3x vector as a template: the 5' end of the forward primer contained the nucleotide sequence GGCCACATAGGCC (SEQ ID NO: 79) of R3, and the 5' end of the reverse primer contained the nucleotide sequence GGCCCAACCGGCC (SEQ ID NO: 80) of R4.
[0196] For specific primer sequences, see Table 1-1 below. [Table 1]
[0197] 1.3 Obtaining the first polynucleotide and the third polynucleotide The component antibody gene library was amplified by a two-step approach.
[0198] Step 1. Using the mRNA obtained in Example 1.1 as a template, cDNA was synthesized by reverse transcription using MMLV from Promega (according to the product instructions from Promega Co., the primer was Thermo Cat#N8080127 and the reverse transcriptase was Promega Cat#M1701).
[0199] Step 2. Using the cDNA obtained in Step 1 as a template and the primers obtained in Example 1.2, the KLC, LLC, and VH gene libraries of the component antibodies were amplified by PCR (Takara catalog number RR900A, according to the company's product instructions). After purification and recovery by gel electrophoresis (using the Axygen Gel Extraction Kit, operating according to the instructions in "Molecular Cloning: A Laboratory Manual"), the PCR products, i.e., the KLC fragment, LLC fragment, and VH fragment, respectively, were obtained.
[0200] 1.4 Construction of storage vectors 1.4.1 Primer design The primers were designed with reference to the contents of Example 1.2.
[0201] Primers for obtaining the storage vector were designed and synthesized. For specific primer sequences, see Tables 1-2 below. [Table 2]
[0202] 1.4.2 PCR amplification PCR was performed using the R1-1kb-R2 forward primer and the R1-1kb-R2 reverse primer prepared in Example 1.4.1, with a 1 kb long human IgG1 Fc (SEQ ID NO: 164) as a template. After purification and recovery by gel electrophoresis (using the Axygen Gel Extraction Kit), the PCR product R1-1kb-R2 (SEQ ID NO: 165) was obtained.
[0203] Using the pComb3x vector as a template, PCR was performed using the forward primer of R3 linker R4 (SEQ ID NO: 160) and the reverse primer of R3 linker R4 (SEQ ID NO: 161). After purification and recovery by gel electrophoresis (using the Axygen Gel Extraction Kit), the PCR product R3 linker R4 (SEQ ID NO: 167) was obtained. The linker may have a length of 72 bp, and its nucleotide sequence is as shown in SEQ ID NO: 166.
[0204] PCR was performed using the R5-1kb-R6 forward primer and the R5-1kb-R6 reverse primer prepared in Example 1.4.1, with a 1 kb human IgG1 Fc (SEQ ID NO: 164) as a template. After purification and recovery by gel electrophoresis, the PCR product R5-1kb-R6 (SEQ ID NO: 168) was obtained.
[0205] 1.4.3 Construction of light chain and heavy chain conservation vectors Using the TA cloning method (TA cloning kit purchased from Takara Co.), the R1-1kb-R2 fragment prepared in 1.4.2 was inserted into the pMD19-T vector to obtain the light chain conservation vector DDB-R1-1kb-R2 for insertion into the full-length light chain gene library, the vector map of which is shown in Figure 9.
[0206] The R5-1kb-R6 fragment prepared in 1.4.2 was inserted into the pMD19-T vector using the TA cloning method (TA cloning kit purchased from Takara Co.) to obtain a vector containing the R5-1kb-R6 fragment. Using this as a template, the original BsmBI restriction site in this vector was removed by primer mutation to obtain the heavy chain conservation vector DDB-R5-1kb-R6 for insertion into the VH gene library, the vector map of which is shown in Figure 10.
[0207] For specific primer sequences, see Tables 1-3 below. [Table 3]
[0208] 1.4.4 Construction of linker-conserved vectors and acquisition of linker component bacteria Using the TA cloning method (TA cloning kit purchased from Takara Co.), the R3 linker R4 prepared in Example 1.4.2 was inserted into the pMD19-T vector to obtain the linker storage vector DDB-R3 linker R4, the vector map of which is shown in Figure 11. TG1 competent bacteria (Lucigen Co.) were transformed with the linker storage vector and cultured on plates at 37°C overnight. After the colonies were sent for sequencing, the colonies were collected to obtain linker component bacteria, which can be frozen and stored for later use.
[0209] 1.5 Obtaining component bacterial libraries 1.5.1 Obtaining a light chain component bacterial library The polynucleotides containing KLC and LLC prepared in Example 1.3 were digested with restriction endonucleases R1 and R2 to obtain a target light chain fragment (approximately 0.65 kb).
[0210] The light chain storage vector DDB-R1-1 kb-R2 prepared in Example 1.4 was digested with restriction endonucleases R1 and R2 to obtain a light chain storage vector fragment (approximately 2.7 kb).
[0211] The resulting target light chain fragment was mixed with the light chain conservation vector fragment and then ligated using T4 DNA ligase (NEB, purchased from Thermo Scientific) to obtain the light chain conservation ligation product. TG1 competent bacteria (Lucigen, catalog number 60502-2, operated according to the manufacturer's instructions) were transformed with the light chain conservation ligation product, spread onto ampicillin-resistant plates (Thermo, catalog number 240845), and grown overnight at 37°C. After sending the colonies for sequencing, all colonies were collected to obtain a light chain component bacterial library, whose quality could be verified and / or frozen for later use.
[0212] 1.5.2 Obtaining a heavy chain component bacterial library The polynucleotide prepared in Example 1.3 was digested with restriction endonucleases R5 and R6 to obtain a target heavy chain variable region fragment (approximately 0.35 kb).
[0213] The heavy chain storage vector DDB-R5-1 kb-R6 prepared in Example 1.4 was digested with restriction endonucleases R5 and R6 to obtain a heavy chain storage vector fragment (approximately 2.7 kb).
[0214] The resulting target heavy chain variable region fragment was mixed with the heavy chain conservation vector fragment and then ligated using T4 DNA ligase (NEB, purchased from Thermo Scientific) to obtain the heavy chain conservation ligation product. TG1 competent bacteria (Lucigen, catalog number 60502-2, operated according to the manufacturer's instructions) were transformed with the heavy chain conservation ligation product, spread onto ampicillin-resistant plates (Thermo, catalog number 240845), and grown overnight at 37°C. After sending the colonies for sequencing, all colonies were collected to obtain a heavy chain component bacterial library, which can be used to detect its quality and / or frozen for later use.
[0215] 1.6 Obtaining light chain component plasmids, heavy chain component plasmids, and linker fragments Using a plasmid extraction kit (purchased from Axygen), the plasmids of the light chain component bacterial library prepared in Example 1.5.1 and the heavy chain component bacterial library prepared in Example 1.5.2 were extracted separately to obtain light chain component plasmids and heavy chain component plasmids, respectively.
[0216] The light chain component plasmid prepared in Example 1.5.1 was digested with restriction endonucleases R1 and R2, and then purified and recovered by gel electrophoresis to obtain the light chain insert fragment LC.
[0217] The heavy chain component plasmid prepared in Example 1.5.2 was digested with restriction endonucleases R5 and R6, and then purified and recovered by gel electrophoresis to obtain the heavy chain insert fragment HC.
[0218] Using a plasmid extraction kit (purchased from Axygen), the plasmid in the linker component bacteria prepared in Example 1.4.4 was extracted to obtain a linker component plasmid. Using the linker component plasmid or linker storage vector of Example 1.4.4 as a template, a 0.8 kb fragment containing the linker was amplified with a linker forward primer (SEQ ID NO: 156) and a linker reverse primer (SEQ ID NO: 157). The 0.8 kb PCR product was then digested with restriction endonucleases R3 and R4, purified and recovered by gel electrophoresis (using a small fragment gel extraction kit purchased from Lifefeng Biotech (catalog number DK402)), and a 72 kb linker fragment was obtained.
[0219] 1.7 Getting the display vector The pComb3x vector was purchased, and its vector map is shown in FIG. 12. The map of the modified pComb3x-fab vector used for antibody Fab display is shown in FIG.
[0220] The SfiI restriction site at the 3' end of the Fab gene in the pComb3x-fab vector was removed by nonsense mutation.
[0221] Subsequently, a restriction endonuclease R2 site was added downstream of the light chain stop codon in the vector after nonsense mutation, and a restriction endonuclease R5 site was introduced via nonsense mutation at the end of the signal peptide of the heavy chain variable region to obtain the modified phage display vector DDB-R1R2R5R6, the map of which is shown in Figure 14.
[0222] 1.8 Preparation of display bacterial library The display vector DDB-R1R2R5R6 produced in Example 1.7 was digested with restriction endonucleases R7 and R8 to obtain a 3.6 kb display vector fragment.
[0223] The light chain insert fragment LC (0.65 kb), heavy chain insert fragment HC (0.35 kb), linker fragment (72 bp), and phage display vector fragment (3.6 kb) obtained in Example 1.6 were mixed in a molecular ratio of 1:1:1:1 and ligated with T4 DNA ligase at 20°C for more than 20 hours to obtain a ligation product for display.
[0224] The ligation products were purified by PCR cleanup, transferred to TG1 competent bacteria (Lucigen, catalog no. 60502-2, operated according to the manufacturer's instructions), and cultured in antibiotic-free 2YT medium at 37°C with shaking at 250 rpm for 60 minutes, then spread onto ampicillin-resistant plates (Thermo, catalog no. 240845) and grown overnight at 37°C. Colonies were selected for sequencing, and all colonies grown on the plates, i.e., the phage-displayed bacterial library, were collected and can be stored for later use.
[0225] 1.9 Preparation of display antibody phage library An appropriate amount of bacterial solution was collected from the display bacterial library prepared in Example 1.8 and cultured in 2YT medium (containing 100 μg / ml ampicillin and 2% glucose) at 37°C until the OD600 reached 0.5. Next, M13KO7 helper phage (purchased from NEB, catalog number N0315S, MOI approximately 10-20) was added to the bacterial solution and mixed uniformly. After mixing, the mixture was left to stand at 37°C for 30 minutes and then shaken at 37°C and 250 rpm for 30 minutes. After centrifugation, the supernatant containing the M13KO7 helper phage was discarded. The bacteria were resuspended in culture medium (containing ampicillin and kanamycin) four times the original volume of the bacterial solution and shaken overnight at 30°C and 250 rpm. The next day, the phage were recovered by PEG precipitation. The phage concentration was titrated, and the phage were stored in aliquots to obtain the display antibody phage library.
[0226] Example 2: Construction of a display vector 2.1 Obtaining sample materials The PD-1-targeting antibody pembrolizumab and the pDGB4 vector were selected as an example to construct a display vector as shown in Figure 1. The nucleotide sequence of the light chain of pembrolizumab is SEQ ID NO:5, the nucleotide sequence of the heavy chain variable region of pembrolizumab is SEQ ID NO:6, and the nucleotide sequence of the pDGB4 vector is SEQ ID NO:7.
[0227] 2.2 Design of restriction sites The restriction endonucleases BsmBI and SfiI were selected to design the sequences of two BsmBI recognition sites (B2 and B3) and two SfiI recognition sites (S5 and S6), the nucleotide sequence of B2 being as shown in SEQ ID NO:8, the nucleotide sequence of B3 being as shown in SEQ ID NO:9, the nucleotide sequence of S5 being as shown in SEQ ID NO:10, and the nucleotide sequence of S6 being as shown in SEQ ID NO:11.
[0228] 2.3 Selection of signal peptide Two signal peptides, SP1 and SP2, were selected to express native antibody genes. The nucleotide sequences of the two signal peptides were altered by unintentional mutation to introduce suitable restriction sites at the 3'-end of the signal peptides, but the amino acid sequences of the signal peptides remained unchanged. SP1 expressed a display VH, the nucleotide sequence of which was set forth in SEQ ID NO: 12, and the amino acid sequence of which was set forth in SEQ ID NO: 13. SP2 expressed a display LC, the nucleotide sequence of which was set forth in SEQ ID NO: 14, and the amino acid sequence of which was set forth in SEQ ID NO: 15.
[0229] 2.4 Obtaining display vector polynucleotides Primers for the display VH, display LC, and display vector fragment I and display vector fragment II were designed, and their expression was all driven by the CMV promoter. The synthetic primers were amplified by PCR using the sequence of 2.1 as a template. The sequences are listed in Table 2. [Table 4]
[0230] The four display vector polynucleotides were amplified by PCR (LA Taq, Takara Co., performed according to the product instructions). The template and primer sequences used are listed in Table 2. The PCR products were purified and recovered by gel electrophoresis (following the instructions in "Molecular Cloning: A Laboratory Manual"). The PCR products were inserted into the pUC19 plasmid vector using the TA cloning method (TA cloning kit purchased from Takara Co.) to obtain the ligation product. DH5a competent bacteria (Takara Co.) were transformed with the ligation product and grown overnight at 37°C on plates. After colonies were sent for sequencing, bacteria containing the desired display vector polynucleotides were obtained: the first display vector polynucleotide containing the display VH, the second display vector polynucleotide containing the display LC, the third display vector polynucleotide containing display vector fragment I, and the fourth display vector polynucleotide containing expression vector fragment II. The bacteria can be frozen and stored as a bacterial library for later use.
[0231] 2.5 Digestion Using a plasmid extraction kit (purchased from Axygen), each bacterial plasmid in the bacterial library of Example 2.4 was extracted. The plasmid vector was then digested with restriction endonucleases BsmBI and SfiI, isolated and purified by electrophoresis, and four truncated display vector polynucleotides were obtained.
[0232] 2.6 Obtaining a display vector by ligation The four cleaved display vector polynucleotides obtained in Example 2.5 were mixed in equal molecular proportions, and ligase was added to directionally ligate and circularize them to form an expression vector. The expression vector was transformed into DH5a competent bacteria (Takara, operated according to the manufacturer's instructions) and cultured in antibiotic-free 2YT medium at 37°C with shaking at 250 rpm for 60 minutes. It was then spread onto ampicillin-resistant plates (Thermo, catalog number 240845) and grown overnight at 37°C. Colonies were selected for sequencing, and a display vector containing the correct sequence was obtained. The specific structure of the display vector is shown in Figure 2.
[0233] Example 3 Construction of VH component vector and LC component vector 3.1 VH component vector PCR was performed using a 1-kb-long human IgG1 Fc fragment as a template and primers DDB214 and DDB215. After purification and recovery by gel electrophoresis, PCR product B2-KB-B3 was obtained. The nucleotide sequence of DDB214 was shown in SEQ ID NO:1, and the nucleotide sequence of DDB215 was shown in SEQ ID NO:2. B2-KB-B3 was inserted into the pMD19 expression component vector to obtain the VH component vector storage plasmid. TG1 competent bacteria (Lucigen Co.) were transformed with the VH component vector storage plasmid and grown overnight at 37°C on plates. Colonies were selected for sequencing to determine which VH component vector contained the correct sequence. The structure of the VH component vector is shown in Figure 3.
[0234] 3.2 LC component vectors PCR was performed using a 1 kb long human IgG1 Fc as a template with primers DDB216 and DDB217. After purification and recovery by gel electrophoresis, PCR product S5-KB-S6 was obtained, and the nucleotide sequence of DDB216 was as shown in SEQ ID NO:3, and the nucleotide sequence of DDB217 was as shown in SEQ ID NO:4. S5-KB-S6 was inserted into the expression component vector pMD19 vector to obtain the LC component vector storage plasmid. TG1 competent bacteria (Lucigen Co.) were transformed with the LC component vector storage plasmid and cultured on a plate at 37°C overnight. Colonies were selected for sequencing to confirm that they contained the correct sequence. LC The component vectors were determined, and the structures of the LC component vectors are shown in Figure 4.
[0235] Example 4: Obtaining antigen-specific VH and antigen-specific LC 4.1 First screening 500 μl of the phage library constructed in Example 1 was collected (Fab library, original library volume was 4 × 10 10 The effective clones were over 80%, and the prepared phage library contained 2 × 10 13 Biotin-labeled ROR1 antigen (Acro Biosystems, catalog number RO1-H82E6) was mixed with the phage library (antigen concentration 10 μg / ml) and shaken at room temperature for 2 hours to allow phages displaying antigen-specific Fab to bind to the biotin-labeled antigen. Next, 80 μl of magnetic beads (purchased from Invitrogen) were mixed with the phage library antigen and shaken at room temperature for 20 minutes to capture the antigen-specific phages via the binding of avidin and biotin on the magnetic bead surface, forming a magnetic bead-avidin-biotin-antigen-Fab antibody fragment crosslinker. The formed crosslinker carrying the ROR1 antigen-specific Fab was then collected using a magnetic stand. The phages displaying ROR1 antigen-specific Fab were eluted with a glycine solution at pH 2.2 and neutralized to pH 7.0 with Tris buffer at pH 8.0, yielding a final phage solution of 550 μl.
[0236] 4.2 Second screening 250 μl of the phage solution obtained from the first screening round was mixed with an equal volume of 4% milk-PBS to a final volume of 0.5 ml. Next, 4 μg of biotin-labeled antigen was mixed with the phage solution to a final antigen concentration of 8 μg / ml and shaken at room temperature for 3 hours to allow phages displaying antigen-specific Fab to bind to the biotin-labeled antigen. Next, 40 μl of magnetic beads were mixed with the phage solution and antigen and shaken at room temperature for 20 minutes to capture the antigen-specific phage via the binding of avidin and biotin on the magnetic bead surface, forming a magnetic bead-avidin-biotin-antigen-Fab antibody fragment crosslinker. The formed crosslinker carrying the ROR1 antigen-specific Fab was collected using a magnetic stand. The mixture was then washed four times with 1x PBST, followed by four washes with 1x PBS. Finally, phages displaying ROR1 antigen-specific Fab were eluted with 50 μl of pH 2.2 glycine solution and neutralized to pH 7.0 with 20 μl of pH 8.0 Tris buffer to finally obtain 75 μl of phage solution.
[0237] 4.3 TG1 bacterial infection 75 μl of the phage solution obtained in the second screening in Example 4.2 was mixed with 500 μl of logarithmic-phase TG1 bacteria and incubated for 30 minutes at 37° C. The infected TG1 bacterial solution was then spread onto an Amp-resistant plate and incubated overnight at 37° C.
[0238] 4.4 Screening for positive clones by ELISA Colonies grown on the plates were counted and inoculated into two 96-well deep-well plates containing 400 μl of culture medium (2YT + Amp + 0.2% glucose) in each well and incubated at 37°C for 6 hours with shaking. 400 μl of culture medium (2YT + Amp + 2 mM IPTG) containing a final concentration of 1 mM IPTG was added to each well, and the plates were incubated overnight at 30°C with shaking at 250 rpm. Two 96-well ELISA plates were coated with 100 ng / 100 μl / well of non-biotinylated ROR1 antigen overnight at 4°C.
[0239] After washing and blocking the 96-well ELISA plate coated overnight with antigen, 100 μl of the overnight cultured bacterial solution was added to each well, incubated at 37°C for 1 hour, and washed again. Next, a secondary antibody (HRP-labeled anti-human IgG-Fab antibody) was added and incubated at 37°C for 40 minutes. After washing, a developing solution was added and the plate was stored in the dark for 30 minutes. The OD600 values were read using a microplate reader, and the results are shown in Tables 3-1 and 3-2 below. [Table 5] [Table 6]
[0240] A total of 35 clones with a read value greater than 0.25 were sent for sequencing. Sequence analysis revealed the presence of 34 unique VH and 28 unique LC. The comparison of the light chain amino acid sequences is shown in Figure 5A, and the comparison of the heavy chain variable region amino acid sequences is shown in Figure 5B.
[0241] Example 5 Construction of VH and LC component libraries 5.1 Amplification of antigen-specific VH and antigen-specific LC Primers containing restriction endonuclease (Esp3I and SfiI) recognition sites were designed. 29 primers were used to amplify antigen-specific VHs, including 24 forward primers and 5 reverse primers; 19 primers were used to amplify antigen-specific KLCs (kappa light chains), including 18 forward primers and 1 reverse primer; and 26 primers were used to amplify antigen-specific LLCs (lambda light chains), including 25 forward primers and 1 reverse primer. Each primer in each set of forward primers was mixed in equal proportions, and the VH reverse primers were also mixed in equal proportions. The forward and reverse primers were then mixed in equal proportions to form three sets of primers, which were used to amplify VHs, KLCs, and LLCs, respectively. As an example, in this embodiment, KLC is taken as an example, and the forward primers for VH are as shown in SEQ ID NOs: 30 to 53, the reverse primers for VH are as shown in SEQ ID NOs: 54 to 58, the forward primers for KLC are as shown in SEQ ID NOs: 59 to 76, and the reverse primer for KLC is as shown in SEQ ID NO: 77.
[0242] Equal amounts of miniDNA from the 35 positive clones obtained by screening in Example 4 were mixed and amplified using the three sets of primers described above. Purified antigen-specific VH and antigen-specific LC (KLC is used as an example) containing the recognition site obtained by PCR were analyzed by electrophoresis.
[0243] 5.2 Digestion and ligation The antigen-specific VH obtained in Example 5.1 was digested with Esp3I, and the purified antigen-specific VH after digestion was analyzed by electrophoresis. The VH component vector obtained in Example 3.1 was digested with Esp3I, and the purified 2.8 kb component vector fragment after digestion was analyzed by electrophoresis. The purified antigen-specific VH and the 2.8 kb component vector fragment were ligated to obtain a ROR1-specific VH component library.
[0244] The antigen-specific LC obtained in Example 5.1 was digested with SfiI, and the purified antigen-specific LC after digestion was analyzed by electrophoresis. The LC component vector obtained in Example 3.2 was digested with SfiI, and the purified 2.8 kb component vector fragment after digestion was analyzed by electrophoresis. The purified antigen-specific LC and the 2.8 kb component vector fragment were ligated to obtain a ROR1-specific LC component library.
[0245] Example 6 Construction of an antigen-specific binding polypeptide display library The VH component library was digested with Esp3I, and 0.35 kb of purified antigen-specific VH (i.e., the first polynucleotide released) with sticky ends after digestion was analyzed by electrophoresis. The KLC component library was digested with SfiI, and 0.65 kb of purified antigen-specific LC (i.e., the second polynucleotide released) with sticky ends after digestion was analyzed by electrophoresis. The display vector obtained in Example 1 was double-digested with Esp3I and SfiI and purified to obtain a 3 kb display vector fragment I (i.e., the third polynucleotide released) with sticky ends and a 5 kb display vector fragment II (i.e., the fourth polynucleotide released) with sticky ends. Equal amounts of the four digested fragments were mixed and ligated in a 10 μl ligation system containing a total of 25 ng of fragments at 20°C for 4 hours to obtain an antigen-specific binding polypeptide gene display vector.
[0246] The ligation product was purified using a PCR cleanup kit and recovered by elution with 10 μl of ddH2O. 4 μl of the purified ligation product was taken for electroporation (Takara DH5a, electroporated competent bacteria), spread onto a plate, and cultured overnight at 37°C. The number of colonies was counted, and the library volume was determined to be 2.3 × 10 5 When the number of colonies reached 100, an antigen-specific binding polypeptide gene display bacterial library was obtained. All colonies were collected, and vector DNA was extracted from them to obtain an antigen-specific binding polypeptide display library.
[0247] Example 7: Monoclonal antibody screening ROR1-specific binding polypeptide expression vector DNA was obtained from the antigen-specific binding polypeptide display library obtained in Example 6, and 40 μg of DNA was transformed into FCHO cells. Sixty hours after transformation, the expression of full-length antibodies on the cell surface and the ROR1 antigen specificity of the antibodies were analyzed by FACS. The results in Figure 6 indicated that full-length ROR1 antibodies were expressed on the cell surface and could specifically bind to FITC-labeled ROR1 (labeled with a FITC labeling kit). The unbiotinylated ROR1 antigen was from Acro Biosystems (catalog number RO1-H5250-1mg). Figure 6 shows the fluorescent signal of cells double-stained with PE-labeled mouse anti-human κ light chain antibody and FITC-labeled ROR1 antigen, as well as the cell surface analyzed by FACS. A shows the negative control. B shows the cell library expressing ROR1-specific antibodies.
[0248] The stably transformed FCHO cell library was screened under pressure with hygromycin (500 μg / ml hygromycin concentration). After 10 days of culture with hygromycin under pressure, a stably transformed cell library was obtained. The cell library was double-stained with PE-labeled mouse anti-human kappa light chain antibody (BD) and FITC-labeled ROR1 antigen, and PE- and FITC-double-positive cells were sorted by FACS. Single cell clones were added to a 96-well plate at one cell per well and cultured with hygromycin under pressure.
[0249] After 14 days of culture with hygromycin under pressure, 92 stably transformed single-cell clones were obtained. The cells were digested with 0.5 mM EDTA-PBS buffer. The 92 single-cell clones were double-stained with PE-labeled mouse anti-human kappa light chain antibody and FITC-labeled ROR1 antigen (antigen concentration: 0.15 ng / 50 μl).
[0250] FACS analysis yielded 71 PE and FITC fluorescent double-positive cell clones, with a positive rate of 77% (71 / 92=77%).
[0251] Example 8: Obtaining positive clone sequences A total of 30 cell clones (representing different affinities) located at different positions on the FACS analysis chart were selected for PCR amplification of antibody genes. Cells from each positive clone were collected by centrifugation, the supernatant discarded, and 20 μl of cellular genomic extraction solution (Quick Extraction Buffer, Lucigen) was used to extract cellular genomic DNA according to the reagent instructions. Two μl of cellular genomic DNA extract was taken from each clone, and the VH and LC of each clone were amplified by PCR. The forward primer for amplifying the VH fragment was TGGGCTCTGCTCCTCCTGACC (SEQ ID NO: 24), the reverse primer for amplifying the VH fragment was AGTTCCACGACACCGTCACCGGTTC (SEQ ID NO: 25), the forward primer for amplifying the LC fragment was GGACCTGGAGGATCCTCTTCTTGG (SEQ ID NO: 26), and the reverse primer for amplifying the LC fragment was GGACCTGGAGGATCCTCTTCTTGG (SEQ ID NO: 27). Reverse The primer was TAAATTCCTCGGCCGTGCAGGCCTTATCAACACTCTCCCCTGTTGAAGCTCT (SEQ ID NO: 27).
[0252] The VH and LC fragments amplified by PCR were isolated and purified by electrophoresis. The purified VH and LC fragments were analyzed by sequencing, and 14 unique VHs and 13 unique LCs were determined. By combining these, 17 positive clones with unique sequences could be obtained (six CDRs of the light chain and heavy chain differed by at least one amino acid). As an example, a pair of unique VH and LC sequences is listed here, where the VH amino acid sequence of the unique sequence is shown in SEQ ID NO: 28, and the kappa LC amino acid sequence of the unique sequence is shown in SEQ ID NO: 29.
[0253] Example 9: Antibody affinity analysis The positive VH fragment with a unique sequence obtained in Example 8 was digested with Esp3I, and the positive LC fragment with a unique sequence obtained in Example 8 was digested with SfiI. The digested VH and LC fragments were purified by PCR cleanup. The VH and LC fragments were separately inserted into a soluble heavy chain expression vector, and colonies were sequenced. DNA from the VH and LC expression vectors determined by sequencing was extracted.
[0254] 293EXP cells were amplified by suspension culture to form a total of 17 pairs of antibody light and heavy chain expression vectors according to the light and heavy chain pairings determined in Example 8. Each pair was mixed in a ratio of 18 μg of light chain expression vector to 12 μg of heavy chain expression vector and used to transform 30 ml of suspension 293EXP cells (1.2 × 10 6 / ml). Culture supernatants were collected on day 6 after transfection, and antibodies were purified with GenScript magnetic beads (catalog no. L00695) according to the manufacturer's instructions, equilibrated by dialysis into PBS-antibody solution, and stored at -80°C. Antibody purity was greater than 90% as analyzed using SDS-PAGE denaturing gel electrophoresis (Figure 7). The binding affinity of the purified antibodies to the antigen was analyzed by ELISA, and the EC50 of eight exemplary antibodies is listed here for illustrative purposes; the results are shown in Table 4 below. [Table 7]
[0255] Example 10 Rapid screening for antigen-specific polypeptides According to the ELISA data of positive clones obtained by screening the phage library in Example 4, 15 clones with ELISA readings greater than 0.8 were selected from Tables 3-1 and 3-2. After mixing with an equal volume of bacterial solution, vector DNA was mini-extracted. Following the procedure in Example 5, the antigen-specific VH and antigen-specific LC of the 15 clones were amplified by PCR and purified by digestion. Following the procedure in Example 6, an antigen-specific binding polypeptide display library was constructed. Next, 48 colonies were randomly selected and sent for sequencing. After analyzing the sequencing results, 36 clones with the correct VH and LC were selected, from which vector DNA was mini-extracted and transiently transfected into CHO cells. After 60 hours, the cells were digested with 0.5 mM EDTA-PBS buffer. The 36 cell populations were double-stained with PE-labeled mouse anti-human kappa light chain antibody and FITC-labeled ROR1 antigen (antigen concentration: 0.15 ng / 50 μl). The FACS analysis results are shown in Figure 8. Six PE- and FITC-double-positive cell clones were obtained, with a positive rate of 17% (6 / 36). Figure 8 shows cells double-stained with PE-labeled mouse anti-human kappa light chain antibody and FITC-labeled ROR1 antigen, as well as the cell surface fluorescent signals analyzed by FACS. A shows a negative control. B shows a cell clone expressing a non-ROR1-specific antibody. C–H show six exemplary positive cell clones expressing a ROR1-specific antibody. [Sequence List Free Text]
[0256] Sequence Listing 1 <223> DDB214 Sequence Listing 2 <223> DDB215 Sequence Listing 3 <223> DDB216 Sequence Listing 4 <223> DDB217 Sequence Listing 5 <223> PD1-LC Sequence Listing 6 <223> PD1-VH Sequence Listing 7 <223> pDGB4 Sequence Listing 8 <223> B2 Sequence Listing 9 <223> B3 Sequence Listing 10 <223> S5 Sequence Listing 11 <223> S6 Sequence Tables 12-13 <223> SP1 Sequence Tables 14-15 <223> SP2 Sequence Listing 16 <223> P1 Sequence Listing 17 <223> P2 Sequence Listing 18 <223> P3 Sequence Listing 19 <223> P4 Sequence Listing 20 <223> P5 Sequence Listing 21 <223> P6 Sequence Listing 22 <223> P7 Sequence Listing 23 <223> P8 Sequence Listing 24 <223> VH fragment forward primer Sequence Listing 25 <223> VH fragment reverse primer Sequence Listing 26 <223> LC fragment forward primer Sequence Listing 27 <223> LC fragment reverse primer Sequence Listing 28 <223> Antigen-binding peptide VH Sequence Listing 29 <223> Antigen-binding peptide KLC Sequence Listing 30 <223> First VH forward primer Sequence Listing 31 <223> Second VH forward primer Sequence Listing 32 <223> Third VH forward primer Sequence Listing 33 <223> Fourth VH forward primer Sequence Listing 34 <223> 5th VH forward primer Sequence Listing 35 <223> 6th VH forward primer Sequence Listing 36 <223> Seventh VH forward primer Sequence Listing 37 <223> 8th VH forward primer Sequence Listing 38 <223> 9th VH forward primer Sequence Listing 39 <223> 10th VH forward primer Sequence Listing 40 <223> 11th VH forward primer Sequence Listing 41 <223> 12th VH forward primer Sequence Listing 42 <223> 13th VH forward primer Sequence Listing 43 <223> 14th VH forward primer Sequence Listing 44 <223> 15th VH forward primer Sequence Listing 45 <223> 16th VH forward primer Sequence Listing 46 <223> 17th VH forward primer Sequence Listing 47 <223> 18th VH forward primer Sequence Listing 48 <223> 19th VH forward primer Sequence Listing 49 <223> 20th VH forward primer Sequence Listing 50 <223> 21st VH forward primer Sequence Listing 51 <223> VH forward primer no. 22 Sequence Listing 52 <223> 23rd VH forward primer Sequence Listing 53 <223> 24th VH forward primer Sequence Listing 54 <223> First VH reverse primer Sequence Listing 55 <223> Second VH reverse primer Sequence Listing 56 <223> Third VH reverse primer Sequence Listing 57 <223> Fourth VH reverse primer Sequence Listing 58 <223> 5th VH reverse primer Sequence Listing 59 <223> First LC forward primer Sequence Listing 60 <223> Second LC forward primer Sequence Listing 61 <223> Third LC forward primer Sequence Listing 62 <223> 4th LC forward primer Sequence Listing 63 <223> 5th LC forward primer Sequence Listing 64 <223> 6th LC forward primer Sequence Listing 65 <223> 7th LC forward primer Sequence Listing 66 <223> 8th LC forward primer Sequence Listing 67 <223> 9th LC forward primer Sequence Listing 68 <223> 10th LC forward primer Sequence Listing 69 <223> 11th LC forward primer Sequence Listing 70 <223> 12th LC forward primer Sequence Listing 71 <223> 13th LC forward primer Sequence Listing 72 <223> 14th LC forward primer Sequence Listing 73 <223> 15th LC forward primer Sequence Listing 74 <223> 16th LC forward primer Sequence Listing 75 <223> 17th LC forward primer Sequence Listing 76 <223> 18th LC forward primer Sequence Listing 77 <223> LC reverse primer Sequence Listing 78 <223> R1 or R8 Sequence Listing 79 <223> R2 or R3 Sequence Listing 80 <223> R4 or R5 Sequence Listing 81 <223> R6 or R7 Sequence list 82-99 <223> Light chain KLC forward primer Sequence Listing 100 <223> Light chain KLC reverse primer Sequence list 101-125 <223> Light chain LLC forward primer Sequence Listing 126 <223> Reverse primer for light chain LLC Sequence list 127-150 <223> VH forward primer Sequence List 151-155 <223> Reverse primer for VH Sequence Listing 156 <223> Linker forward primer Sequence Listing 157 <223> Linker reverse primer Sequence Listing 158 <223> Forward primer for R1-1kb-R2 Sequence Listing 159 <223> Reverse primer for R1-1kb-R2 Sequence Listing 160 <223> R3-linker-R4 forward primer Sequence Listing 161 <223> R3-linker-R4 reverse primer Sequence Listing 162 <223> Forward primer for R5-1kb-R6 Sequence Listing 163 <223> Reverse primer for R5-1kb-R6 Sequence Listing 165 <223> R1-1kb-R2 Sequence Listing 166 <223> 72bp-long linker Sequence Listing 167 <223> R3-linker (72 bp)-R4 Sequence Listing 168 <223> R5-1kb-R6 Sequence Listing 169 <223> Forward primer for mutation of pUC19 vector Sequence Listing 170 <223> Reverse primer for mutation of pUC19 vector Sequence Listing 171 <223> 90bp long linker Sequence Listing 172 <223> R3-linker (90 bp)-R4 Sequence Table 173-174 <223> Forward primer with 90bp linker Sequence Listing 175 <223> Reverse primer with 90bp linker
Claims
1. 1. A method for screening for an antigen-specific binding polypeptide or fragment thereof, comprising: a) obtaining antigen-specific binding VH sequences and antigen-specific binding LC sequences from a phage display library; b) constructing an antigen-specific binding polypeptide gene display vector; c) introducing the antigen-specific binding polypeptide gene display vector into a first bacterium to obtain an antigen-specific binding polypeptide gene display bacterial library; d) obtaining an antigen-specific binding polypeptide gene library from the antigen-specific binding polypeptide gene display bacterial library; e) obtaining antigen-specific binding polypeptide gene display vector DNA from the antigen-specific binding polypeptide gene library; f) introducing the antigen-specific binding polypeptide gene display vector DNA into a cell, optionally wherein the cell is a mammalian cell; and g) obtaining the gene encoding the antigen-specific binding polypeptide from the cell; The step of constructing the antigen-specific binding polypeptide gene display vector comprises: i) providing a first display vector polynucleotide comprising B2-display VH-B3 in a 5' to 3' direction, inserting the first display vector polynucleotide into a display component vector to form a display VH storage ligation product, introducing the display VH storage ligation product into a first display bacterium to obtain a display VH component bacterial library, obtaining a display VH component plasmid comprising the first display vector polynucleotide from the display VH component bacterial library, and digesting the display VH component plasmid with a restriction endonuclease that specifically recognizes B2 and B3, thereby obtaining a cleaved first display vector polynucleotide; ii) providing a second display vector polynucleotide comprising S5-display LC-S6 in the 5' to 3' direction, inserting the second display vector polynucleotide into a display component vector to form a display LC storage ligation product, introducing the display LC storage ligation product into a second display bacterium to obtain a display LC component bacterial library, obtaining a display LC component plasmid comprising the second display vector polynucleotide from the display LC component bacterial library, and digesting the display LC component plasmid with a restriction endonuclease that specifically recognizes S5 and S6, thereby obtaining a cleaved second display vector polynucleotide; iii) providing a third display vector polynucleotide comprising, in a 5' to 3' direction, the B3-display vector fragment I-S5, and cleaving the third display vector polynucleotide with a restriction endonuclease that specifically recognizes B3 or S5 to obtain a cleaved third display vector polynucleotide; iv) providing a fourth display vector polynucleotide comprising, in a 5' to 3' direction, an S6-display vector fragment II-B2, and cleaving the fourth display vector polynucleotide with a restriction endonuclease that specifically recognizes S6 or B2 to obtain a cleaved fourth display vector polynucleotide; v) mixing the cleaved first display vector polynucleotides, the cleaved second display vector polynucleotides, the cleaved third display vector polynucleotides, and the cleaved fourth display vector polynucleotides and directionally ligating and circularizing them to form an antigen-specific binding polypeptide gene display vector; Including, wherein said display VH encodes a heavy chain variable region of an antigen-specific binding polypeptide, and said display LC encodes a light chain of an antigen-specific binding polypeptide; said B2 and B3 can be specifically recognized and cleaved by an enzyme selected from the group consisting of BsmBI and Esp3I, and said S5 and S6 can be specifically recognized and cleaved by Sfil; A method wherein B2 comprises the nucleic acid sequence shown in SEQ ID NO: 8, B3 comprises the nucleic acid sequence shown in SEQ ID NO: 9, S5 comprises the nucleic acid sequence shown in SEQ ID NO: 10, and / or S6 comprises the nucleic acid sequence shown in SEQ ID NO:
11.
2. 2. The method of claim 1, further comprising introducing the third display vector polynucleotide into a third display bacterium to obtain a display vector component I bacterial library, and / or introducing the fourth display vector polynucleotide into a fourth display bacterium to obtain a display vector component II bacterial library.
3. inserting the third display vector polynucleotide into a display component vector to form a display vector fragment I storage ligation product, and / or introducing the storage ligation product into the third display bacterium to obtain the display vector component I bacterial library; inserting the fourth display vector polynucleotide into a display component vector to form a display vector fragment II conserved ligation product, and / or introducing the conserved ligation product into the fourth display bacterium to obtain the display vector component II bacterial library; The method of claim 2 , comprising:
4. The method of claim 1 , wherein the directional ligation comprises the use of a ligase.
Citation Information
Patent Citations
High complexity mammalian display library and methods of screening
US20120101000A1