Plants with improved nematode resistance
The introduction of SmD1 alleles with missense mutations in plants provides enhanced resistance to nematodes, addressing the limitations of current control methods by improving nematode tolerance and yield in crops.
Patent Information
- Application Number
- JP2022560157
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2020-04-03
- Filing Date
- 2021-03-29
- Publication Date
- 2026-01-30
- Estimated Expiration
- 2041-03-29
AI Technical Summary
Current methods for controlling nematodes in agricultural crops, such as root-knot nematodes and cyst nematodes, are inadequate, as many species can overcome existing resistance genes, and nematicides pose health and environmental risks, necessitating alternative strategies for improved nematode resistance in plants.
Introduction of SmD1 alleles encoding modified SmD1 proteins with missense mutations, particularly a threonine-isoleucine substitution at position 14, which confer enhanced resistance to nematodes in plants like tomato, tobacco, and other crops.
The modified SmD1 proteins prevent nematode recognition while maintaining functionality, significantly reducing nematode damage and improving nutrient uptake efficiency, thus enhancing plant yield and resistance to nematodes like Meloidogyne species.
Smart Images

Figure 0007808811000003 
Figure 0007808811000004 
Figure 0007808811000005
Abstract
Description
[Technical Field]
[0001] The present invention relates to novel plants that exhibit improved resistance to nematodes. The present invention also relates to seeds and parts of said plants. The present invention further relates to methods for making and using such seeds and plants. The present invention also relates to novel SmD1 alleles that result in modified SmD1 proteins associated with such improved resistance to nematodes. [Background technology]
[0002] Epiphytic endoparasitic nematodes, such as root-knot nematodes (RKN; Meloidogyne spp.) and cyst nematodes (CN; Heterodera spp. and Globodera spp.), cause significant damage to many agricultural crops. The nematodes spend most of their life cycle within plant roots, inducing the formation of multinucleate hypertrophied feeding cells called giant cells and syncytia, respectively. These giant cells are surrounded by smaller dividing cells and form new organs within the roots known as nodules or root clubs, which act as metabolic sinks for the nematodes throughout their lifespan. This leads to severe abnormalities in the function of the plant root system, significantly reducing the plant's nutrient uptake efficiency and ultimately affecting yield (Singh et al., 2013; Mejias et al., 2019).
[0003] Controlling nematodes to prevent yield losses typically relies on crop management and rotation, the use of nematicides, and plant genetics. However, many nematicide solutions have been withdrawn from the market. Furthermore, their use has been significantly reduced to address concerns about human health, food safety (e.g., regarding residues in crop harvests), and environmental sustainability (e.g., protecting soil organisms). Furthermore, some nematode species are able to overcome the very few existing solutions that are based on plant genetics. For example, many Meloidogyne species (e.g., M. enterolobii, M. incognita, M. arenaria, and M. javanica) can overcome resistance in tomato and pepper genotypes that harbor the Mi-1.2 and N resistance genes, which are widely used for nematode management (Kiewnick et al., 2009).
[0004] As a result, there is a need for alternative strategies to further improve nematode control in plants, particularly tomato plants. Summary of the Invention [Means for solving the problem]
[0005] The present invention solves the need to provide new plants that exhibit high resistance to nematodes, especially nematodes of the genus Meloidogyne.
[0006] In a first embodiment, the present invention provides a plant comprising an SmD1 allele encoding an SmD1 protein having at least 90% amino acid sequence identity to SEQ ID NO: 1, wherein the SmD1 protein comprises a missense mutation resulting in a modified SmD1 protein that confers improved nematode resistance.
[0007] In a further embodiment, the modified SmD1 protein comprises a missense mutation at a position corresponding to any one of amino acid positions 1-108 of SEQ ID NO:1.
[0008] In a further embodiment, the modified SmD1 protein comprises a missense mutation at a position corresponding to amino acid position 14 of SEQ ID NO:1.
[0009] In a further embodiment, the modified SmD1 protein comprises a threonine-isoleucine substitution at a position corresponding to amino acid position 14 of SEQ ID NO:1.
[0010] In a further embodiment, the present invention provides a plant according to any of the preceding embodiments, wherein said plant is selected from the list comprising tomato, tobacco, pepper, pumpkin, watermelon, melon, cucumber and soybean.
[0011] In a further embodiment, the present invention provides a plant according to any of the preceding embodiments, wherein said plant is a selfed, dihaploid or hybrid plant.
[0012] In a further embodiment, the present invention provides a plant according to any of the preceding embodiments, wherein said plant is a rootstock.
[0013] In a further embodiment, the present invention provides a plant according to any of the preceding embodiments, wherein said plant comprises two copies of said SmD1 allele.
[0014] In a further embodiment, the modified SmD1 protein confers improved resistance to nematodes of the genus Meloidogyne, preferably Meloidogyne incognita, Meloidogyne arenaria, Meloidogyne hapla, Meloidogyne enterolobii and Meloidogyne javanica.
[0015] In a further embodiment, the present invention provides a plant according to any of the preceding embodiments, wherein said plant is Solanum lycopersicum.
[0016] In a further embodiment, the modified SmD1 protein has the amino acid sequence of SEQ ID NO:2.
[0017] In a further embodiment, the SmD1 allele is available from Solanum lycopersicum accession 19TEP250122, deposited with NCIMB on November 29, 2019 under NCIMB accession number 43529.
[0018] In a further embodiment, the present invention provides a plant part according to any of the preceding embodiments, wherein said plant part comprises said SmD1 allele.
[0019] In a further embodiment, the present invention provides a seed bearing the plant or plant part of any of the preceding embodiments.
[0020] In a further embodiment, the present invention provides a method for producing a pharmaceutical composition comprising: a) obtaining a population of mutant plants; b) selecting mutant plants containing a modified SmD1 allele encoding an SmD1 protein with a missense mutation in its amino acid sequence; The present invention provides a method for improving nematode resistance in plants, comprising:
[0021] It has been shown that the use of SmD1 alleles that produce modified SmD1 proteins leads to increased tolerance to nematodes.It has been demonstrated that missense mutations prevent the recognition of the SmD1 protein by nematode effectors, while maintaining the necessary activity of the modified SmD1 protein in plants, thereby improving the plant's ability to cope with pests.The present invention can therefore be used in future breeding programs to improve plant resistance to nematode pests. [Brief explanation of the drawings]
[0022] [Figure 1]FIG. 1: Sequence alignment and percent identity matrix of the SmD1 amino acid sequences of the present invention encoded by Arabidopsis thaliana (AT4G02840.1 (SEQ ID NO: 4) and AT3G07590.1 (SEQ ID NO: 5)), Nicotiana benthamiana (NbS00005390g0012.1 (SEQ ID NO: 6), NbS00006569g0006.1 (SEQ ID NO: 7) and NbS00054309g0007.1 (SEQ ID NO: 8)), and Solanum lycopersicum (Solyc09g064660.2.1 (SEQ ID NO: 1) and Solyc06g084310.2.1 (SEQ ID NO: 3)), as well as Glycine max (Glycine max). max) (Glyma.02G096000.1 (SEQ ID NO: 9)), pepper (Capsicum annuum) (CA06g26820 (SEQ ID NO: 10) and Capana06g000068 (SEQ ID NO: 11)), Japanese pumpkin (Cucurbita moschata) (CmoCh02G018520.T 1 (SEQ ID NO: 12)), melon (Cucumis melo) (MELO3C018220.2.1 (SEQ ID NO: 13)), cucumber (Cucumis sativus) (Cs.gyl 4.3.1.022189.T1 (SEQ ID NO: 14)), watermelon (Citrillus lanatus) (Cla023415_T (SEQ ID NO: 15)), Solanum habrochaites (Sh.LYI Orthologous sequences from the SmD1 alleles of 01.2.1.003421 J1 (SEQ ID NO: 16) and Solatium pennellii (Sopen09g026350.1 (SEQ ID NO: 17)). Sequence alignments and percent identity matrices were calculated using the software Clustal Omega (Sievers et al., 2011). [Figure 2]Figure 2: Assessment of the level of susceptibility to nematodes in Arabidopsis (A), Nicotiana benthamiana (B), and tomato (C) plants with impaired SmD1 gene expression versus their respective control plants. (D) Assessment of the plant root system in SmD1-silenced tomato plants. (A) 40 plants were used for each genotype, and statistical analysis of the results was performed using Student's t-test (P<0.05). (B) 12 plants were used for each treatment, and statistical analysis of the results was performed using the Mann-Whitney test (a=5%). (C) 18-20 plants were used for each genotype, and statistical analysis of the results was performed using the Mann-Whitney test (a=5%). [Figure 3] Figure 3: Assessment of the plant root system (A) and the susceptibility level to nematodes of tomato plants carrying a missense mutation in the SmD1b gene (B). Statistical analysis of the results was performed using the Mann-Whitney test (a = 1%). DETAILED DESCRIPTION OF THE INVENTION
[0023] A brief description of arrays SEQ ID NO: 1: Amino acid sequence encoded by the SmD1b gene Solyc09g064660.2.1 SEQ ID NO: 2: Modified amino acid sequence containing a T14I missense mutation at position 14 of SEQ ID NO: 1 SEQ ID NO: 3: Amino acid sequence encoded by the SmD1a gene Solyc06g084310.2.1 SEQ ID NO: 4: Amino acid sequence encoded by the SmD1b gene AT4G02840.1 SEQ ID NO: 5: Amino acid sequence encoded by the SmD1a gene AT3G07590.1 SEQ ID NO: 6: Amino acid sequence encoded by the SmD1 gene NbS00005390g0012.1 SEQ ID NO: 7: Amino acid sequence encoded by the SmD1 gene NbS00006569g0006.1 SEQ ID NO: 8: Amino acid sequence encoded by SmD1 gene NbS00054309g0007.1 SEQ ID NO: 9: Amino acid sequence encoded by the SmD1 gene Glyma.02G096000.1 SEQ ID NO: 10: Amino acid sequence encoded by SmD1 gene CA06g26820 SEQ ID NO: 11: Amino acid sequence encoded by the SmD1 gene Capana06g000068 SEQ ID NO: 12: Amino acid sequence encoded by the SmD1 gene CmoCh02G018520.T1 SEQ ID NO: 13: Amino acid sequence encoded by SmD1 gene MELO3C018220.2.1 SEQ ID NO: 14: Amino acid sequence encoded by the SmD1 gene Cs.gy14.3.1.022189.T1 SEQ ID NO: 15: Amino acid sequence encoded by SmD1 gene Cla023415_T SEQ ID NO: 16: Amino acid sequence encoded by the SmD1 gene Sh.LY101.2.1.003421.T1 SEQ ID NO: 17: Amino acid sequence encoded by the SmD1 gene Sopen09g026350.1 SEQ ID NO: 18: Nucleic acid sequence encoding SEQ ID NO: 1 SEQ ID NO: 19: Nucleic acid sequence encoding SEQ ID NO: 2 SEQ ID NO: 20: Genomic sequence of the Solyc09g064660.2.1 SmD1b gene SEQ ID NO: 21: Genomic sequence of modified Solyc09g064660.2.1 SmD1b gene SEQ ID NO: 22 / 23: Primer pair amplifying the Solyc09g064660.2.1 gene region SEQ ID NO: 24: Genomic sequence encoding SEQ ID NO: 3 SEQ ID NO: 25: Genomic sequence encoding SEQ ID NO: 4 SEQ ID NO: 26: Genomic sequence encoding SEQ ID NO: 5 SEQ ID NO: 27: Genomic sequence encoding SEQ ID NO: 9 SEQ ID NO: 28: Genomic sequence encoding SEQ ID NO: 10 SEQ ID NO: 29: Genomic sequence encoding SEQ ID NO: 11 SEQ ID NO: 30: Genomic sequence encoding SEQ ID NO: 12 SEQ ID NO: 31: Genomic sequence encoding SEQ ID NO: 13 SEQ ID NO: 32: Genomic sequence encoding SEQ ID NO: 14 SEQ ID NO: 33: Genomic sequence encoding SEQ ID NO: 15 SEQ ID NO: 34: Genomic sequence encoding SEQ ID NO: 16 SEQ ID NO: 35: Genomic sequence encoding SEQ ID NO: 17
[0024] definition The technical terms and expressions used within the scope of this application should generally be given the meanings commonly applied to them in the relevant art of plant breeding and cultivation, unless otherwise indicated herein below.
[0025] As used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to a "plant" includes one or more plants, and reference to a "cell" includes mixtures of cells, tissues, and the like.
[0026] As used herein, the term "about," when referring to a value or amount of mass, weight, time, volume, concentration, or percentage, is meant to include variations from the specified amount of, in some embodiments, ±20%, in some embodiments ±10%, in some embodiments ±5%, in some embodiments ±1%, in some embodiments ±0.5%, and in some embodiments ±0.1%, as such variations are appropriate for the practice of the methods of the present disclosure.
[0027] A "cultivated" plant, within the scope of the present invention, is understood to refer to a plant that is no longer in its natural state but has been developed and domesticated by human care for agricultural use and / or human consumption, excluding wild accessions. By way of example, in an embodiment, a "cultivated plant" is a hybrid plant. Alternatively, or in addition, a "cultivated tomato" plant according to the present invention is capable of growing yellow, orange, or red fruit. Alternatively, or in addition, the cultivated tomato plant is a Solanum lycopersicum plant.
[0028] Within the scope of the present invention, "allele" is understood to refer to alternative or variant forms of various genetic units related to the same or different forms of genes, which are located at the same locus on homologous chromosomes and therefore are alternative in genetic traits. Such alternative or variant forms may be the result of single nucleotide polymorphisms, insertions, inversions, translocations, or deletions, or may be the result of gene regulation caused, for example, by chemical or structural modifications, transcriptional regulation, or post-translational modification / regulation. In diploid cells or organisms, the two alleles of a given gene or genetic element typically occupy corresponding loci on a pair of homologous chromosomes. In the context of the present invention, alternative or variant alleles of the SmD1 gene encode modified SmD1 proteins containing missense mutations associated with improved nematode resistance phenotypes. Alternative or variant alleles of the SmD1 gene are defined relative to the wild-type SmD1 gene. For example, the wild-type SmD1b gene SEQ ID NO: 20 encodes the wild-type SmD1b protein of SEQ ID NO: 1. Correspondingly, the mutant SmD1b allele of SEQ ID NO:21 encodes the modified SmD1b protein of SEQ ID NO:2.
[0029] Relatively, the term "enhanced nematode resistance" is understood herein to mean that a plant according to the present invention, comprising an SmD1 allele encoding an SmD1 protein having at least 90% amino acid sequence identity to SEQ ID NO: 1, for example, wherein said SmD1 protein comprises a missense mutation, exhibits increased nematode resistance compared to a plant not having said allele. Within the scope of the present invention, a plant with "enhanced nematode resistance" is understood to mean a plant that has statistically significantly higher nematode resistance (e.g., shows a significantly reduced number of egg masses, as described in the Examples) compared to a control plant using a Mann-Whitney test (α=1, 2.5, or 5%) or a Student's test (P<0.05).
[0030] In the context of nematode resistance, the term "moderately resistant" refers to a plant that contains an allele according to the present invention and that exhibits a statistically significant difference in the number of nodules and / or the number of egg masses when compared to a susceptible control plant (Tomato Reference Genome-HEINZ) that has the wild-type corresponding allele.
[0031] A "control plant" within the scope of the present invention can be a plant with the same genetic background as a plant of a cultivar containing the present invention, where the control plant does not carry the allele of the present invention associated with improved nematode resistance. The control plant can be a plant belonging to the same plant variety and not containing the allele of the present invention. The control plant is grown for the same period and under the same conditions as the plant of the cultivar of the present invention. In this specification, plant variety is understood according to the definition of UPOV. Thus, the control plant can be a near-isogenic line, an inbred line or a hybrid, where the control plant has the same genetic background as the plant of the present invention, but the control plant does not carry any of the alleles of the present invention associated with improved nematode resistance. In a preferred embodiment, the "control plant" is a "control tomato plant".
[0032] The term "trait" refers to a characteristic or phenotype. In the context of the present invention, a nematode resistance trait is an improved nematode resistance trait. A trait can be inherited in a dominant or recessive manner, or in a partially dominant or partially dominant manner. A trait can be monogenic or polygenic, or can result from the interaction of one or more genes with the environment. A plant can be homozygous or heterozygous for a trait.
[0033] The terms "hybrid," "hybrid plant," and "hybrid progeny" refer to individuals produced from genetically different parents (e.g., genetically heterozygous or near-heterozygous individuals).
[0034] The term "inbred" refers to a genetically homozygous or near-homozygous population. Inbred strains are obtained, for example, through several cycles of brother / sister breeding or selfing, or in dihaploid production.
[0035] The term "diploid line" refers to a stable inbred line derived from a separate culture. Some pollen grains (haploids) grown in a particular medium and environment can develop embryos containing n chromosomes. These embryos are then "doubled" to contain 2n chromosomes. The progeny of these embryos are called "diploids" and essentially no longer segregate (are stable).
[0036] The terms "cultivar" or "variety" refer to a horticulturally derived variety that is distinct from the natural variety. In some embodiments of the invention, the cultivar or variety is commercially available.
[0037] The term "rootstock" refers to a plant used as a recipient for a cutting. Typically, the rootstock plant and the cutting are of different genotypes. In an embodiment, a plant of the present invention is used as a rootstock plant.
[0038] The term "genetically fixed" refers to a genetic element that has been stably integrated into the genome of a plant that does not normally contain the genetic element. If genetically fixed, the genetic element can be easily and predictably transmitted to other plants by sexual crossing.
[0039] The term "plant" or "plant part" hereinafter refers to a plant part, organ or tissue obtainable from a (e.g. tomato) plant according to the invention, including but not limited to leaves, stems, roots, flowers or inflorescences, fruits, shoots, gametophytes, sporophytes, pollen, anthers, microspores, egg cells, zygotes, embryos, meristematic tissue sections, callus tissue, seeds, cuttings, cell or tissue cultures, or any other part or product of the plant which, when grown into a plant that produces fruit, still exhibits the nematode resistance trait according to the invention.
[0040] A "plant" is any plant at any stage of development.
[0041] A "plant seed" is a seed that develops into a plant as described in any of the embodiments.
[0042] A "plant cell" is the structural and physiological unit of a plant, comprising a protoplast and a cell wall. Plant cells can be in the form of isolated single cells or cultured cells, or can be part of a more highly organized unit, such as a plant tissue, a plant organ, or a whole plant.
[0043] "Plant cell culture" refers to cultures of plant units such as, for example, protoplasts, cell culture cells, cells in plant tissue, pollen, pollen tubes, embryo stocks, embryo sacs, zygotes, and embryos at various stages of development.
[0044] A "plant organ" is a distinct, visually structured differentiated part of a plant, such as a root, stem, leaf, flower bud or embryo.
[0045] As used herein, "plant tissue" means a group of plant cells organized into a structural and functional unit. Any plant tissue in a plant or in culture is included. The term includes, but is not limited to, whole plants, plant organs, plant seeds, tissue cultures, and any group of plant cells organized into a structural and / or functional unit. Use of this term in conjunction with or without any specific type of plant tissue listed above or encompassed by this definition is not intended to exclude any other type of plant tissue.
[0046] As used herein, the term "breeding" and its grammatical variations refer to any process of producing offspring individuals. Breeding can be sexual or asexual, or any combination thereof. Exemplary, non-limiting types of breeding include crossing, selfing, derivative production of doubled haploids, and combinations thereof.
[0047] As used herein, the phrase "established breeding population" refers to a collection of potential breeding partners generated by and / or used as parents in a breeding program, e.g., a commercial breeding program. Members of an established breeding population are typically well characterized genetically and / or phenotypically. For example, some phenotypic traits of interest may be evaluated, for example, under different environmental conditions, in multiple locations, and / or at different times. Alternatively or additionally, one or more genetic loci associated with the expression of the phenotypic trait may be identified, and one or more members of the breeding population may be genotyped for the one or more genetic loci and for one or more genetic markers associated with the one or more genetic loci.
[0048] As used herein, the phrase "diploid individual" refers to an individual having two sets of chromosomes, typically one from each of its two parents. However, it is understood that in some embodiments, a diploid individual may inherit its "maternal" and "paternal" sets of chromosomes from the same single organism, for example, when a plant self-pollinates to produce subsequent generations of the plant.
[0049] Within the scope of the present invention, "homozygous" is understood to refer to the same allele at one or more corresponding loci in homologous chromosomes. In the context of the present invention, a plant containing two identical copies of a particular allele at a particular locus, for example, an SmD1 allele encoding an SmD1 protein having at least 90% amino acid sequence identity to SEQ ID NO: 1, wherein the SmD1 protein contains a missense mutation resulting in a modified SmD1 protein that confers improved nematode resistance, is homozygous at the corresponding locus.
[0050] Within the scope of the present invention, "heterozygous" is understood to refer to different alleles at one or more corresponding loci in homologous chromosomes. In the context of the present invention, a tomato plant containing one copy of a specific allele at a specific locus, for example, an SmD1 allele encoding an SmD1 protein having at least 90% amino acid sequence identity to SEQ ID NO: 1, wherein the SmD1 protein contains a missense mutation resulting in a modified SmD1 protein that confers improved nematode resistance, is heterozygous at the corresponding locus.
[0051] A "dominant" allele is understood within the scope of the present invention to refer to an allele which determines the phenotype when present in the heterozygous or homozygous state.
[0052] A "recessive" allele refers to an allele that determines a phenotype only when present in the homozygous state.
[0053] A "missense mutation" is understood to refer to a point mutation in which the change of a single nucleotide results in a codon encoding a different amino acid.
[0054] "Backcrossing" is understood within the scope of the present invention to refer to a process in which hybrid offspring are repeatedly crossed with one of the original parents. Different recurrent parents may be used in subsequent backcrosses.
[0055] A "locus" is understood within the scope of the present invention to refer to a region on a chromosome that contains a gene or any other genetic element or factor that contributes to a trait.
[0056] As used herein, a "marker locus" refers to a region on a chromosome that is present in an individual's genome and contains a nucleotide or polynucleotide sequence associated with one or more loci of interest, which may include genes or any other genetic determinants or factors that contribute to a trait. A "marker locus" also refers to a region on a chromosome that contains a polynucleotide sequence that is complementary to a genomic sequence, such as the sequence of a nucleic acid used as a probe.
[0057] As used herein, the phrases "sexual mating" and "sexual reproduction" in relation to the subject matter of the present disclosure refer to the production of offspring by the fusion of gametes (e.g., by fertilization, such as the production of seeds by pollination in a plant). "Sexual mating" or "cross-fertilization," in some embodiments, is the fertilization of one individual by another (e.g., cross-pollination in a plant). The term "selfing," in some embodiments, refers to the production of seeds by self-fertilization or self-pollination, i.e., the pollen and ovules are from the same plant.
[0058] As used herein, the phrase "genetic marker" refers to a feature of an individual's genome (e.g., a nucleotide or polynucleotide sequence present in an individual's genome) associated with one or more loci of interest. In certain embodiments, a genetic marker is a locus that is polymorphic or occupied by a polymorphism in a population of interest, depending on the context. Genetic markers include, for example, single nucleotide polymorphisms (SNPs), indels (i.e., insertions / deletions), simple sequence repeats (SSRs), restriction fragment length polymorphisms (RFLPs), random amplified polymorphic DNA (RAPDs), cleaved amplified polymorphic sequence (CAPS) markers, diversity array technology (DArT) markers, and amplified fragment length polymorphisms (AFLPs), among many other examples. Genetic markers can be used, for example, to identify the location of loci containing alleles on chromosomes that contribute to variability in phenotypic traits. The phrase "genetic marker" can also refer to a polynucleotide sequence complementary to a genomic sequence, such as the sequence of a nucleic acid used as a probe.
[0059] A "genetic marker" can be physically located at a chromosomal location within or outside the locus to which it is associated (i.e., intragenic or extragenic, respectively). In other words, genetic markers are typically used when the location on the chromosome of a gene or functional mutation corresponding to the locus of interest, e.g., within a regulatory element external to the gene, has not been identified and there is a non-zero recombination rate between the genetic marker and the locus of interest; however, the presently disclosed subject matter can also use genetic markers that are physically within the boundaries of the locus (e.g., within the genomic sequence corresponding to the gene, such as, but not limited to, a polymorphism within an intron or exon of the gene). In certain embodiments of the presently disclosed subject matter, the one or more genetic markers include 1 to 10 markers; in certain embodiments, the one or more genetic markers include more than 10 genetic markers.
[0060] As used herein, the term "genotype" refers to the genetic makeup of a cell or organism. An individual's "genotype for a set of genetic markers" includes the particular alleles for one or more genetic marker loci present in the individual's haplotype. As is known in the art, a genotype can be associated with a single locus or multiple loci, regardless of whether the loci are related or unrelated and / or linked or unlinked. In certain embodiments, an individual's genotype is associated with one or more genes that are related in that one or more of the genes are involved in the expression of a phenotype of interest (e.g., a quantitative trait as defined herein). Thus, in certain embodiments, the genotype includes a profile of one or more alleles present in the individual at one or more loci of a quantitative trait. In certain embodiments, the genotype is expressed in terms of a haplotype (defined herein below).
[0061] As used herein, the term "germline" refers to the totality of the genotypes of a population or other population (e.g., a species). The term "germline" can also refer to plant material, e.g., a group of plants that serve as a repository of various alleles. The phrase "adapted germplasm" refers, for example, to plant material with proven genetic superiority for a given environmental or geographic region, while the phrases "non-adapted germplasm," "original germplasm," and "foreign germplasm" refer, for example, to plant material with unknown or unproven genetic value for a given environmental or geographic region; thus, the phrase "non-adapted germplasm," in some embodiments, refers to plant material that is not part of an established breeding population and has no known relationship to members of an established breeding population.
[0062] As used herein, the phrase "nucleic acid" refers to any physical chain of monomeric units that can correspond to a chain of nucleotides, including polymers of nucleotides (e.g., typical DNA, cDNA, or RNA polymers), modified oligonucleotides (e.g., oligonucleotides containing bases that are not typical of biological RNA or DNA, such as 2'-O-methylated oligonucleotides), etc. In certain embodiments, a nucleic acid can be single-stranded, double-stranded, multi-stranded, or a combination thereof. Unless otherwise indicated, specific nucleic acid sequences of the presently disclosed subject matter optionally include or encode complementary sequences in addition to any sequences explicitly indicated.
[0063] As used herein, the term "plurality" refers to two or more. Thus, a "plurality of individuals" refers to at least two individuals. In some embodiments, the term "plurality" refers to more than half of the total. For example, in some embodiments, a "plurality of a population" refers to more than half of the members of the population.
[0064] As used herein, the term "progeny" refers to the offspring of a particular cross. Typically, progeny result from the breeding of two individuals, although some species (particularly some plants and hermaphrodite animals) can self-pollinate (i.e., the same plant serves as both male and female gamete donor). Progeny can be, for example, F1, F2, or any subsequent generation.
[0065] The term "recipient plant" is used herein to refer to a plant that will receive DNA from a donor plant that contains a mutant allele for improved nematode resistance.
[0066] "Donor plant" is understood within the scope of the present invention to mean a plant that provides an alternative or mutant allele associated with improved nematode resistance.
[0067] As used herein, the phrase "qualitative trait" refers to a phenotypic trait controlled by one or several genes that exhibit a major phenotypic effect. Thus, qualitative traits are typically simply inherited. Examples in plants include, but are not limited to, flower color and some known disease resistances, such as resistance to fungal spot or tomato mosaic virus.
[0068] "Marker-assisted selection" is understood within the scope of the present invention to refer to the use of genetic markers to detect, for example, one or more nucleic acids from a plant, which nucleic acids are associated with a desired trait to identify plants that carry the gene for the desired (or undesirable) trait so that those plants can be used (or avoided) in selective breeding programs.
[0069] Single nucleotide polymorphisms (SNPs), which are mutations at a single site in DNA, are the most common type of genomic variation. A single nucleotide polymorphism (SNP) is a variation in DNA sequence that occurs when a single base (A, T, C, or G) in a genome (or other shared sequence) differs between members of a biological species or between paired chromosomes of an individual. For example, two sequenced DNA fragments, AAGCCTA and AAGCTTA, from different individuals contain a single base difference. In this case, there are two alleles: C and T. The basic principles of SNP arrays are the same as those of DNA microarrays. These are the combination of DNA hybridization, fluorescence microscopy, and DNA capture. The three components of an SNP array are an array containing nucleic acid sequences (i.e., amplified sequences or targets), one or more labeled allele-specific oligonucleotide probes, and a detection system that records and interprets the hybridization signal.
[0070] The presence or absence of the desired allele can be determined by real-time PCR using double-stranded DNA dye or fluorescent reporter probe methods.
[0071] "PCR (Polymerase Chain Reaction)" is understood within the scope of the present invention to refer to a method for producing relatively large amounts of specific regions or subsets of genomic DNA, thereby allowing various analyses based on those regions.
[0072] "PCR primer" is understood within the scope of the present invention to refer to a relatively short piece of single-stranded DNA used in the PCR amplification of a specific region of DNA.
[0073] "Phenotype" is understood within the scope of the present invention to refer to the distinguishing characteristics of genetically controlled traits.
[0074] As used herein, the phrase "phenotypic trait" refers to the appearance or other detectable characteristics of an individual that result from the interaction of its genome, proteome and / or metabolome with the environment.
[0075] "Polymorphism" is understood within the scope of the present invention to refer to the occurrence of two or more different forms of a gene, genetic marker or inherited trait or a population of gene products that can be obtained, for example, by alternative splicing, DNA methylation, etc.
[0076] "Selective breeding" is understood within the scope of the present invention to refer to a breeding program that uses plants that have or exhibit desirable traits as parents.
[0077] A "test" plant is understood within the scope of the present invention to refer to a plant that is used to genetically characterize a trait in a test plant. Typically, the test plant is crossed with a "test" plant and the segregation ratio of the trait in the progeny of the cross is scored.
[0078] As used herein, "probe" refers to a group of atoms or molecules that can recognize and bind to a specific target molecule or cellular structure, thus allowing for the detection of the target molecule or structure. In particular, "probe" refers to a labeled DNA or RNA sequence that can be used to detect the presence and quantify a complementary sequence by molecular hybridization.
[0079] As used herein, the term "hybridizing" refers to conventional hybridization conditions, preferably those in which 5xSSPE, 1% SDS, and 1x Denhardt's solution are used as the solution, and / or the hybridization temperature is 35°C to 70°C, preferably 65°C. After hybridization, washing is preferably carried out first using 2xSSC, 1% SDS, followed by 0.2xSSC, at a temperature of 35°C to 75°C, particularly 45°C to 65°C, but particularly 59°C (for the definitions of SSPE, SSC, and Denhardt's solution, see the references in Sambrook et al.). High stringency hybridization conditions, such as those described in Sambrook et al. (supra), are particularly preferred. Particularly preferred stringent hybridization conditions exist, for example, when hybridization and washing are carried out at 65°C as indicated above. For example, non-stringent hybridization conditions are less preferred with hybridization and washing performed at 45°C, and even less preferred at 35°C.
[0080] According to the present invention, the term "position corresponding to said position X" (X is any number found in the respective context in this application) not only includes the respective positions in the SEQ ID NOs described below, but also any sequence corresponding to an SmD1 allele or encoding an SmD1 protein, where, after alignment with a reference SEQ ID NO, the respective positions may have different but corresponding numbers to those indicated for the reference SEQ ID NO. Alignment of SmD1 allele or SmD1 protein sequences can be performed in a practical manner by applying various alignment tools, for example by applying the tools described below.
[0081] "Sequence identity." The terms "identical" or "identity," with respect to two or more nucleic acid or protein sequences, refer to two or more sequences or subsequences that are the same or have a specified percentage of the same amino acid residues or nucleotides when compared and aligned for maximum correspondence, as measured using one of the sequence comparison algorithms described below or by visual inspection. When the two sequences being compared to each other are of different lengths, sequence identity preferably relates to the percentage of nucleotide residues in the shorter sequence that are identical to the nucleotide residues in the longer sequence. As used herein, the percent identity / homology between two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps and the length of each gap that need to be introduced for optimal alignment of the two sequences (i.e., % identity = number of identical positions / total number of positions × 100). Comparison of sequences and determination of percent identity between two sequences can be performed using a mathematical algorithm, as described herein below. For example, sequence identity can be conventionally determined using a computer program such as the Bestfit program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, 575 Science Drive, Madison, WI 53711). Bestfit utilizes the locus homology algorithm of Smith and Waterman, Advances in Applied Mathematics 2 (1981), 482-489, to find the segment with the highest sequence identity between two sequences. When using Bestfit or another sequence alignment program to determine whether a particular sequence has, for example, 95% identity with the reference sequence of the present invention, parameters are preferably adjusted so that the percentage of identity is calculated over the entire length of the reference sequence and so that homology gaps of up to 5% of the total number of nucleotides in the reference sequence are allowed. When using Bestfit, so-called optional parameters are preferably left at their preset ("default") values.Deviations observed in the comparison between a given sequence and the above sequences of the present invention may be caused, for example, by additions, deletions, substitutions, insertions or recombinations. Such sequence comparisons may also be preferably carried out using the program "fasta20u66" (Version 2.0u66 by William R. Pearson and the University of Virginia, September 1998; W.R. Pearson (1990), Methods in Enzymology 183, 63-98, see also the appended examples and http: / / workbench.sdsc.edu / ). For this purpose, the "default" parameter settings may be used.
[0082] Another indication that two nucleic acid sequences are substantially identical is that the two molecules hybridize to each other under stringent conditions. The phrase "specifically hybridize" refers to the fact that when a particular nucleotide sequence is present in a complex mixture (e.g., whole cell) of DNA or RNA, the molecule binds, duplexes, or hybridizes to only that sequence under stringent conditions. "Substantially bind" refers to complementary hybridization between the probe nucleic acid and the target nucleic acid, and includes minor mismatches that can be accommodated by reducing the stringency of the hybridization medium to achieve the desired detection of the target nucleic acid sequence.
[0083] "Stringent hybridization conditions" and "stringent hybridization wash conditions" for nucleic acid hybridization experiments such as Southern and Northern hybridizations are sequence-dependent and vary under different environmental parameters. Longer sequences hybridize specifically at higher temperatures. An extensive guide to nucleic acid hybridization can be found in Tijssen (1993) Laboratory Techniques in Biochemistry and Molecular Biology—Hybridization with Nucleic Acid Probes, part I, chapter 2, "Overview of principles of hybridization and the strategy of nucleic acid probe assays," Elsevier, New York. Generally, highly stringent hybridization and wash conditions are selected to be approximately 5° C. lower than the thermal melting point for the specific sequence at a defined ionic strength and pH. Typically, under "stringent conditions," a probe will hybridize to its target subsequence but to no other sequences.
[0084] The "thermal melting point" is the temperature (under defined ionic strength and pH) at which 50% of the target sequence hybridizes to a perfectly matched probe. Very stringent conditions are those higher than the melting temperature (T m) is selected to be equal to 1. An example of stringent hybridization conditions for hybridization of complementary nucleic acids having more than 100 complementary residues on a filter in a Southern or Northern blot is 50% formamide containing 1 mg heparin at 42°C, with hybridization occurring overnight. An example of highly stringent wash conditions is 0.15 M NaCl at 72°C for approximately 15 minutes. An example of stringent wash conditions is a 0.2x SSC wash at 65°C for 15 minutes (see Sambrook, infra, for a description of SSC buffers). A high stringency wash is often preceded by a low stringency wash to remove background probe signal. For example, an example of a moderate stringency wash for a duplex of more than 100 nucleotides is 1x SSC at 45°C for 15 minutes. For example, an example of a low stringency wash for a duplex of more than 100 nucleotides is 4-6× SSC at 40°C for 15 minutes. For short probes (e.g., about 10-50 nucleotides), stringent conditions typically include a salt concentration of less than about 1.0 M Na ion at pH 7.0-8.3, typically about 0.01-1.0 M Na ion (or other salt), and a temperature typically of at least about 30°C. Stringent conditions can also be achieved by the addition of destabilizing agents such as formamide. Generally, a signal-to-noise ratio of 2x (or greater) that observed for an unrelated probe in a particular hybridization assay indicates detection of a specific hybridization. Nucleic acids that do not hybridize to each other under stringent conditions are still substantially identical if the proteins they encode are substantially identical. This occurs, for example, when copies of nucleic acids are formed using the maximum codon degeneracy permitted by the genetic code.
[0085] Plants, seeds, fruits. In a first embodiment, the present invention provides a plant comprising an SmD1 allele encoding an SmD1 protein having at least 90% or 91%, preferably 92%, 93% or 94%, more preferably 95%, 96% or 97%, and even more preferably 98% or 99% amino acid sequence identity to SEQ ID NO: 1, wherein the SmD1 protein comprises a missense mutation resulting in a modified SmD1 protein that confers improved nematode resistance.
[0086] In a further embodiment, the modified SmD1 protein comprises a missense mutation at a position corresponding to any one of amino acid positions 1-108 of SEQ ID NO:1.
[0087] In a further embodiment, the modified SmD1 protein comprises a missense mutation at a position corresponding to amino acid position 14 of SEQ ID NO:1.
[0088] In a further embodiment, the modified SmD1 protein comprises a threonine-isoleucine substitution at a position corresponding to amino acid position 14 of SEQ ID NO:1.
[0089] In a further embodiment, the present invention provides a plant according to any of the preceding embodiments, wherein the SmD1 allele is an SmD1b allele.
[0090] In a further embodiment, the present invention provides a plant according to the preceding embodiment, wherein the SmD1 allele encoding the modified SmD1 protein is artificially generated. In a further embodiment, the present invention provides a plant according to the preceding embodiment, wherein the plant is not obtained essentially exclusively by biological processes.
[0091] In a further embodiment, the present invention provides a plant according to any of the preceding embodiments, wherein the SmD1 allele has at least 60%, 65%, 70%, 75%, 80%, 85%, 90% or 95% nucleic acid sequence identity to SEQ ID NO: 20.
[0092] In a further embodiment, the present invention provides a plant according to any of the preceding embodiments, wherein said plant is selected from the list comprising tomato, tobacco, pepper, pumpkin, watermelon, melon, cucumber and soybean.
[0093] In a further embodiment, the present invention provides a plant according to any of the preceding embodiments, wherein said plant is a selfed, dihaploid or hybrid plant.
[0094] In another embodiment, the plant of the present invention is male sterile. In another embodiment, the plant of the present invention is cytoplasmic male sterile.
[0095] In a further embodiment, the present invention provides a plant according to any of the preceding embodiments, wherein said plant is a rootstock.
[0096] In a further embodiment, the present invention provides a plant according to any of the preceding embodiments, wherein said plant comprises two copies of said SmD1 allele.
[0097] In a further embodiment, the modified SmD1 protein confers moderate resistance to nematodes of the genus Meloidogyne, Heterodera and Globodera, preferably Meloidogyne, more preferably Meloidogyne incognita, Meloidogyne arenaria, Meloidogyne hapla, Meloidogyne enterolobii and Meloidogyne javanica.
[0098] In a further embodiment, the present invention provides a plant according to any of the preceding embodiments, wherein said plant is Solanum lycopersicum.
[0099] In a further embodiment, the present invention provides a plant according to any of the preceding embodiments, wherein the modified SmD1 protein has the amino acid sequence of SEQ ID NO:2.
[0100] In a further embodiment, the invention provides a plant according to any of the preceding embodiments, wherein the SmD1b allele comprises the nucleic acid sequence of SEQ ID NO: 19 or SEQ ID NO: 21. In a further embodiment, the invention provides a plant according to any of the preceding embodiments, wherein the SmD1b allele consists of the nucleic acid sequence of SEQ ID NO: 19 or SEQ ID NO: 21.
[0101] In a further embodiment, the invention provides a plant according to any of the preceding embodiments, wherein the SmD1b allele is available from Solanum lycopersicum accession 19TEP250122, deposited with NCIMB on November 29, 2019 under NCIMB accession number 43529.
[0102] In a further embodiment, the present invention provides a plant according to any of the preceding embodiments, wherein, when infested by nematodes, the number of females with egg masses is reduced by 25%, preferably by 50%, compared to a plant of the same cultivar that does not have the SmD1 allele.
[0103] In a further embodiment, there is provided a plant part, organ or tissue obtainable from a cultivated plant according to any of the preceding embodiments, preferably from a cultivated tomato plant, more preferably from a cultivated Solanum lycopersicum plant, including, but not limited to, a leaf, stem, root, flower or inflorescence, fruit, shoot, gametophyte, sporophyte, pollen, anther, microspore, egg cell, zygote, embryo, meristematic tissue part, callus tissue, seed, cutting, cell or tissue culture, or any other part or product of a plant which still exhibits the improved nematode resistance trait according to the present invention, particularly when grown into a fruit-bearing plant.
[0104] In a further embodiment, the present invention provides a fruit produced by a plant according to any of the preceding embodiments. In a further embodiment, the present invention provides a tomato fruit produced by a tomato plant according to any of the preceding embodiments.
[0105] In a further embodiment, the present invention provides a seed that will result in a plant of any of the preceding embodiments. In a further embodiment, the present invention provides a tomato seed that will result in a tomato plant according to any of the preceding embodiments.
[0106] Alleles, markers. The present invention further relates to mutant SmD1 alleles, preferably mutant SmD1b alleles, associated with a nematode resistance trait in plants. In a further embodiment, the present invention relates to a mutant SmD1 allele, the wild-type of which is SEQ ID NO: 20 and encodes the SmD1 protein of SEQ ID NO: 1, or the wild-type SmD1 allele encodes an SmD1 protein having at least 90% amino acid sequence identity to SEQ ID NO: 1, wherein the mutant SmD1 allele encodes a modified SmD1 protein having a missense mutation that confers an improved nematode resistance phenotype. In a further embodiment, SEQ ID NO: 21 is a mutant SmD1 allele encoding the modified SmD1 protein of SEQ ID NO: 2. In a further embodiment, the tomato SmD1 allele of the present invention is located on chromosome 9. In a further embodiment of the invention, a tomato SmD1b allele of the invention is available, obtained, or derived from Solanum lycopersicum accession 19TEP250122, deposited with NCIMB on November 29, 2019 under NCIMB accession number 43529, or a donor plant that is a descendant or ancestor thereof, comprising said SmD1b allele of the invention.
[0107] In a further embodiment, the present invention relates to an isolated nucleic acid sequence encoding SEQ ID NO: 1 or 2. In a further embodiment, the isolated nucleic acid sequence is SEQ ID NO: 18, 19, 20 or 21.
[0108] The present invention discloses a kit for detecting nematode resistance trait alleles in cultivated tomato plants, in particular cultivated Solanum lycopersicum plants, wherein said kit comprises one PCR oligonucleotide primer pair represented by the forward primer of SEQ ID NO: 22 and the reverse primer of SEQ ID NO: 23. This kit allows for the detection of the SmD1b allele of the present invention, wherein the resulting amplicons are sequenced and the T14I(A) allele of the present invention is detected. C T-->AT T codon) mutations are detected. In this context, the T14I mutation can be used as a SNP marker.
[0109] The present invention also discloses the use of the SNP markers according to the present invention for the diagnostic selection and / or genotyping of nematode resistance alleles in cultivated plants, particularly cultivated tomato plants, especially cultivated Solanum lycopersicum plants.
[0110] The present invention further discloses the use of the SNP markers according to the present invention for identifying the presence of nematode resistance alleles in plants, in particular cultivated tomato plants, in particular Solanum lycopersicum plants according to the present invention, and / or for monitoring the introgression of nematode resistance alleles in cultivated plants, in particular cultivated tomato plants, in particular Solanum lycopersicum plants according to the present invention, as described herein.
[0111] The present invention further discloses a polynucleotide (amplified product) obtainable in a PCR reaction with one oligonucleotide primer or a pair of PCR oligonucleotide primers of SEQ ID NO: 22 and SEQ ID NO: 23 that is statistically correlated and therefore co-segregates with the nematode resistance trait or with one of the disclosed markers, which corresponds to an amplified product obtainable in a PCR reaction with an equivalent primer or primer pair from Solanum lycopersicum accession 19TEP250122 deposited with NCIMB on November 29, 2019 under NCIMB accession number 43529, which contains the SmD1b allele of the present invention, or a descendant or ancestor thereof, provided that the respective allele is still present in the plant and / or can be considered an allele thereof.
[0112] Also contemplated herein are polynucleotides having at least 60%, particularly at least 65%, particularly at least 70%, particularly at least 75%, particularly at least 80%, particularly at least 85%, particularly at least 90%, particularly at least 95% sequence identity to the sequence of said amplification product and / or polynucleotide exhibiting a nucleotide sequence that hybridizes to the nucleotide sequence of said amplification product obtainable in the above PCR reaction.
[0113] The amplification products according to the present invention and as described herein above can then be used to generate or develop novel primers and / or probes that can be used to identify nematode resistance trait alleles.
[0114] The present invention therefore in one embodiment further relates to derivative markers, in particular derivative primers or probes, according to the present invention and developed by methods known in the art from the amplification products described herein above, which derivative markers are genetically linked to improved nematode resistance trait loci.
[0115] The present invention also relates to a method for identifying cultivated tomato plants, preferably cultivated Solanum lycopersicum plants, that exhibit improved nematode tolerance and that have at least one copy of an SmD1 allele encoding an SmD1 protein having at least 90% amino acid sequence identity to SEQ ID NO: 1, wherein said SmD1 protein comprises a missense mutation that results in a modified SmD1 protein, the method comprising: a) obtaining a population of mutant plants; b) screening said population for the presence of said SmD1 allele Includes.
[0116] Breeding methods. In another embodiment, the present invention relates to a method of providing a cultivated plant, preferably a cultivated tomato plant, more preferably the cultivated plant Solanum lycopersicum, plant part or seed, said method comprising: a) crossing a first plant according to any of the preceding embodiments with a second plant lacking an SmD1 allele of the present invention; b) obtaining progeny plants; and c) optionally selecting said progeny plants characterized as exhibiting improved nematode resistance. Includes.
[0117] In a further embodiment, the present invention provides a method for producing a cultivated plant, preferably a cultivated tomato plant, more preferably a cultivated Solanum lycopersicum plant, exhibiting improved nematode resistance, comprising the steps of: a) crossing a first plant according to any of the preceding embodiments, comprising at least one copy of an SmD1 allele of the present invention, with a plant of a second cultivar lacking said SmD1 allele; b) selecting progeny plants that exhibit improved nematode resistance; wherein the selection in step b) is carried out by detecting the presence of an SmD1 allele of the invention with the primer pair of SEQ ID NOs: 22 and 23, followed by sequencing the resulting amplicon.
[0118] In a further embodiment, the invention relates to the method of any of the preceding embodiments, wherein the first plant in step a) is Solanum lycopersicum accession 19TEP250122, deposited with NCIMB on November 29, 2019 under NCIMB accession number 43529.
[0119] In another embodiment, the present invention provides a method of providing a cultivated plant, preferably a cultivated tomato plant, more preferably a cultivated Solanum lycopersicum plant, exhibiting improved nematode resistance, comprising the steps of: a) crossing a first plant according to any of the preceding embodiments with a second plant lacking an SmD1 allele of the present invention; b) obtaining progeny cultivar plants; and c) optionally selecting said progeny plants, characterized in that in the case of nematode infestation, the number of females with egg masses is 25%, preferably 50% less than in plants of the same cultivar lacking said SmD1 allele. The present invention relates to a method comprising:
[0120] In a further embodiment, contemplated is the method of any of the preceding embodiments, wherein the first tomato plant in step a) is Solanum lycopersicum accession 19TEP250122, deposited with NCIMB on November 29, 2019 under NCIMB accession number 43529, or a descendant or ancestor thereof.
[0121] In another embodiment, there is provided a method for producing a cultivated plant, preferably a cultivated tomato plant, more preferably a cultivated Solanum lycopersicum plant, exhibiting improved nematode resistance, comprising the steps of: a) providing seeds of a plant according to any of the previous embodiments; b) germinating said seeds and growing mature, fertile plants therefrom; c) inducing self-pollination of the plants in a), allowing them to develop fruit, and harvesting fertile seeds therefrom; and d) growing plants from the seeds harvested in c) and selecting improved nematode-resistant plants. Methods including the following are considered:
[0122] A further embodiment of the present invention provides a method for providing a plant with improved nematode resistance by introducing into the plant a nucleotide sequence encoding an SmD1 protein having at least 90% amino acid sequence identity to SEQ ID NO: 1, wherein the SmD1 protein comprises a missense mutation resulting in a modified SmD1 protein that confers improved nematode resistance. A further embodiment of the present invention provides a method for providing a tomato plant with improved nematode resistance by introducing into the tomato plant a nucleotide sequence encoding the SmD1 protein of SEQ ID NO: 2. A further embodiment of the present invention provides a method for providing a tomato plant with improved nematode resistance by introducing into the tomato plant a nucleotide sequence of SEQ ID NO: 19 or 21.
[0123] In a further embodiment, the present invention provides a method for improving nematode resistance in a plant, comprising the steps of: a) obtaining a population of mutant plants; b) selecting mutant plants containing a modified SmD1b allele encoding an SmD1 protein with a missense mutation in its amino acid sequence; The present invention provides a method comprising:
[0124] Modified SmD1 alleles can also be introduced by mutagenesis, for example chemical mutagenesis (e.g., EMS mutagenesis). Alternatively, or subsequently, modified SmD1 alleles can be identified and / or introduced using the tiling technique.
[0125] Modified SmD1 alleles can also be introduced by targeted mutagenesis, such as homologous recombination, zinc finger nucleases, oligonucleotide-based mutagenesis, transcription activator-like effector nucleases (TALENs), the clustered regularly interspaced short palindromic repeat (CRISPR) system, or any alternative technique for editing the genome.
[0126] Alternatively, the modified SmD1b allele can also be introduced by transgenic or cis-genic methods via a nucleotide construct which may be contained in a vector.
[0127] use In another embodiment, the present invention relates to the use of a cultivated plant, preferably a cultivated tomato plant, more preferably a cultivated Solanum lycopersicum plant, plant part or seed according to any of the preceding embodiments, for growing the plant and producing and harvesting a crop and / or fruit.
[0128] In another embodiment, the present invention relates to the use of a cultivated plant, preferably a cultivated tomato plant, more preferably a cultivated Solanum lycopersicum plant, according to any of the preceding embodiments, for producing fruit for the fresh market or food processing.
[0129] In another embodiment, the present invention relates to the use of a cultivated tomato plant, preferably a cultivated Solanum lycopersicum plant, plant part, or seed, according to any of the preceding embodiments, wherein the cultivated tomato plant, preferably a cultivated Solanum lycopersicum plant, plant part, or seed is Solanum lycopersicum accession 19TEP250122 deposited with NCIMB on November 29, 2019 under NCIMB accession number 43529, or a descendant or ancestor thereof.
[0130] In a further embodiment, the present invention relates to the use of a cultivated plant, preferably a cultivated tomato plant, more preferably a cultivated Solanum lycopersicum plant, plant part or seed according to any of the preceding embodiments for sowing in a field, greenhouse or plastic greenhouse. In a further embodiment, the present invention relates to the use of a cultivated plant, preferably a cultivated tomato plant, more preferably a cultivated Solanum lycopersicum plant, plant part or seed according to any of the preceding embodiments as a rootstock plant.
[0131] The present invention also relates to the use of nematode-resistant propagation material obtainable from a plant according to any of the preceding embodiments for growing a plant, wherein said nematode resistance may be assessed in standard assays, in particular the assay described in Example 4 below.
[0132] In a further embodiment, the present invention relates to the use of an SmD1 allele of the present invention to confer an improved nematode resistance trait to a plant lacking said allele.
[0133] The present invention further relates to the use of a plant according to any of the preceding embodiments for introgressing a nematode resistance trait into a plant lacking said trait.
[0134] Based on the description herein, a person skilled in the art who possesses Solanum lycopersicum accession 19TEP250122, deposited with NCIMB on November 29, 2019, under NCIMB accession number 43529, or a descendant or ancestor thereof, which contains one copy of the SmD1 allele of the present invention as described herein, can easily introduce the allele of the present invention into various types of other tomato plants using breeding techniques well known in the art. Alternatively, based on the description herein, including the disclosure of an SmD1 allele having a missense mutation that results in a modified SmD1 protein associated with a nematode tolerance phenotype, a person skilled in the art can easily reproduce the present invention using techniques well known in the art.
[0135] Seed deposit details Applicant deposited 2,500 seeds of Solanum lycopersicum accession 19TEP250122 with NCIMB on November 29, 2019, under NCIMB accession number 43529. The deposited seeds were obtained from a population segregating for the SmD1 allele of the present invention. Thus, 50% of the deposited seeds are homozygous for the mutant allele, 25% of the deposited seeds are heterozygous for the mutant allele, and 25% of the seeds are homozygous for the wild-type SmD1 allele.
[0136] The applicant requests that the deposited material shall be made available only to experts in accordance with Rule 32(1) EPC or corresponding national legislation or treaties (expert witness clause) until notice of grant of the patent has been published, or, if the application is refused, withdrawn or deemed withdrawn, for a period of 20 years from the filing date. [Example]
[0137] Example 1: Identification of the plant protein SmD1 as a target of nematode effectors In yeast two-hybrid experiments using the M. incognita effector MiEFF18 (Minc18636; Nguyen et al. 2018) as bait, we observed that the tomato plant protein SmD1 was a potential target of the nematode effector. This interaction was first demonstrated in tomato, where the SmD1 proteins are 100% identical to the two tomato SmD1 genes Sl06g084310.2.1 and Sl09g064660.2.1 (SEQ ID NOs: 1 and 3). The interaction was then verified in Arabidopsis thaliana with the SmD1b protein (SEQ ID NO: 4) from the Arabidopsis thaliana gene AT4G02840. The complemented SmD1 proteins and their corresponding genes are listed in Table 1.
[0138] [Table 1]
[0139] Yeast two-hybrid experiments showed that the portion of the SmD1 protein that interacts with the nematode effector is the first 108 amino acids. Figure 1 discloses an alignment of the SmD1 amino acid sequence, highlighting its high conservation among plant species.
[0140] Example 2A: Effect of the Arabidopsis smd1 mutation on nematode susceptibility To verify the role of the SmD1 gene in susceptibility to nematodes, Arabidopsis smd1a (AT3G07590) and smd1b (AT4G02840) mutant plants (Columbia background) were recovered ( Elvira-Matelot et al., 2016 ) and evaluated for their susceptibility level when subjected to the sweet potato root-knot nematode ( M. incognita ).
[0141] Arabidopsis smd1b mutants were found to be significantly less susceptible to M. incognita infection than wild-type Columbia plants or smd1a mutants (Fig. 2A), suggesting that AtSmD1b is primarily involved in the nematode susceptibility mechanism.
[0142] Example 2B: Effect of Nicotiana benthamiana SmD1 silencing on nematode susceptibility To confirm the important role of the SmD1 gene in susceptibility to nematodes, we generated SmD1-silenced Nicotiana benthamiana plants and assessed their susceptibility levels when subjected to M. incognita.
[0143] We again found that SmD1-silenced Nicotiana benthamiana plants were significantly less susceptible to M. incognita infection than control tobacco plants (Fig. 2B), suggesting that NbSmD1 is similarly involved in the nematode susceptibility mechanism.
[0144] Example 2C: Effect of tomato SmD1 silencing on nematode susceptibility Finally, the important role of SmD1 in nematode susceptibility was also confirmed in tomato. SmD1-silenced tomato plants were generated in the Saint-Pierre background and evaluated for their level of susceptibility when subjected to M. incognita. SmD1-silenced tomato plants were again found to be significantly less susceptible to M. incognita infection than control tomato plants (Figure 2C), suggesting that SmD1 is similarly involved in the nematode susceptibility mechanism.
[0145] However, tomato plants in which the SlSmD1 gene was silenced also exhibited commercially unfavorable phenotypes, including a significantly reduced root system (Figure 2D), overall dwarfism, and ultimately reduced fruit yield. Consequently, plants modified with nonsense or KO-type mutations in the SmD1 gene are likely to exhibit undesirable traits due to the lack of functional SmD1 protein in the plant, even though they are more resistant to nematodes.
[0146] Example 3: Identification of commercially relevant tomato SmD1b mutations To obtain tomato plants that exhibit high resistance to nematodes while maintaining the economic value of the crop, we generated mutants using EMS in the M82 background and screened them using the tilling approach to identify tomato plants with modified SmD1 genes resulting in missense mutations in the SmD1 protein. A tilling tomato line (line #123, 18TEP250123, homozygous for the mutation and the ancestral plant of the deposited line 19TEP250122, carrying the missense mutation at position 14 of SEQ ID NO: 1) was inoculated with M. incognita and egg-forming females. Six weeks after infection, root weights were measured and compared with those of the control M82 line #117 (18TEP250117, + / +, wild-type).
[0147] Analysis of root morphology and weight revealed a net increase in the root system of the #123 mutant line (Figure 3(A)). At the same time, the #123 mutant line showed a significant 50% reduction in the number of females forming egg masses (Mann-Whitney test, α = 2.5%) (Figure 3(B)).
[0148] To verify homozygosity of the mutation in SmD1b (Solyc09g064660), six plants from each line were genotyped using primers SlSmD1b-M82-F (ATTTTGAACAACCCCTGGCG (SEQ ID NO: 22)) and SlSmD1b-M82-R (ACTCTACGACCTCACCACTT (SEQ ID NO: 23)). Sequencing of the 420-bp amplicon revealed that all #117 plants had the wild-type SmD1b allele, while all #123 plants had a homozygous SmD1b mutant allele (ACT->ATT codon) resulting in a missense mutation (T14I).
[0149] [Table 2]
[0150] In conclusion, we found that a missense mutation in SmD1b (T14I) confers enhanced resistance to the root-knot nematode Meloidogyne incognita while preserving the function of the SmD1 protein in planta. Given the high degree of structural conservation of the SmD1 protein across plant species, we anticipate that a similar missense mutation in the orthologous SmD1b gene will result in an effect similar to that observed in the #123 mutant tomato line.
[0151] Example 4: Protocol for assessing nematode tolerance in tomato plants Meloidogyne incognita (Calissane strain) was propagated on tomato plants (Solanum lycopersicum cv St Pierre) in a greenhouse. Newly hatched second instar larvae (J2s) were collected as previously described ( Caillaud and Favery, 2016 ). Sterile tomato seeds (cv M82) were sown in soil mixed with sand (1:1); after 48 h at 4°C, samples were transferred to a growth chamber at 24°C with a 16-h photoperiod. Seven-day-old plantlets were individually transferred to small pots in soil / sand. One-month-old tomato seedlings were inoculated with 150 M. incognita J2s per plant. 6 weeks after infection, roots were harvested and stained with 0.5% eosin. The weights of egg-bearing females and roots were measured 6 weeks after infection. Another aspect of the present invention may be as follows. [1] A plant comprising an SmD1 allele encoding an SmD1 protein having at least 90% amino acid sequence identity to SEQ ID NO: 1, wherein the SmD1 protein contains a missense mutation that results in a modified SmD1 protein that confers improved nematode resistance. [2] The plant according to [1], wherein the modified SmD1 protein contains a missense mutation at a position corresponding to any one of amino acid positions 1 to 108 of SEQ ID NO: 1. [3] The plant described in [1] or [2], wherein the modified SmD1 protein contains a missense mutation at a position corresponding to amino acid position 14 of SEQ ID NO: 1. [4] The plant according to any one of [1] to [3], wherein the modified SmD1 protein contains a threonine-isoleucine substitution at a position corresponding to amino acid position 14 of SEQ ID NO: 1. [5] The plant according to any one of [1] to [4] above, wherein the SmD1 allele is obtained by mutagenesis. [6] The plant according to any one of [1] to [5], wherein the plant is selected from the list including tomato, tobacco, pepper, pumpkin, watermelon, melon, cucumber, and soybean. [7] The plant according to [6], wherein the plant is a self-pollinating, dihaploid or hybrid plant. [8] The plant described in [6] or [7] above, wherein the plant is a rootstock. [9] The plant according to any one of [1] to [8], wherein the plant contains two copies of the SmD1 allele.
[10] The plant according to any one of [1] to [9], wherein the modified SmD1 protein confers improved resistance to nematodes of Meloidogyne species, preferably Meloidogyne incognita, Meloidogyne arenaria, Meloidogyne hapla, Meloidogyne enterolobii, and Meloidogyne javanica.
[11] The plant according to any one of [1] to
[10] above, wherein the plant is Solanum lycopersicum.
[12] The plant described in
[11] , wherein the modified SmD1 protein has the amino acid sequence of SEQ ID NO: 2.
[13] The Solanum lycopersicum plant according to
[12] , wherein the SmD1 allele is obtained from Solanum lycopersicum accession 19TEP250122, deposited with NCIMB on November 29, 2019 under NCIMB accession number 43529.
[14] A plant part of the plant according to any one of [1] to
[13] above, which contains the SmD1 allele.
[15] A seed produced from the plant according to any one of [1] to
[14] above.
[16] A method for improving nematode resistance in a plant, comprising: a) obtaining a population of mutant plants; b) selecting mutant plants containing a modified SmD1 allele encoding an SmD1 protein with a missense mutation in its amino acid sequence; A method comprising:
[17] A method for identifying a cultivated tomato plant, preferably a cultivated Solanum lycopersicum plant, that exhibits improved nematode tolerance and has at least one copy of an SmD1 allele encoding an SmD1 protein having at least 90% amino acid sequence identity to SEQ ID NO: 1, wherein the SmD1 protein contains a missense mutation resulting in a modified SmD1 protein: a) obtaining a population of mutant plants; b) screening said population for the presence of said SmD1 allele A method comprising:
[18] A kit for detecting the nematode resistance trait SmD1 allele in cultivated tomato plants, particularly cultivated Solanum lycopersicum plants, comprising one PCR oligonucleotide primer pair represented by a forward primer of SEQ ID NO: 22 and a reverse primer of SEQ ID NO: 23.
[0152] References ·Caillaud and Favery, 2016, In vivo imaging of microtubule organization in dividing giant cell. In Plant Cell Division: Methods and Protocols, Methods in Molecular Biology, Marie-Cecile Caillaud (ed.), Springer Science+Business Media New York, vol. 1370, DOI 10.1007 / 978-1-4939-3142-2_11. ·Elvira-Matelot et al., 2016, The nuclear ribonucleoprotein SmD1 interplays with splicing, RNA quality control, and posttranscriptional gene silencing in Arabidopsis, The Plant Cell 28(2), DOI: 10.1105 / tpc.15.01045. ·Kiewnick et al., 2009, Effects of the Mi-1 and the N root-knot nematode-resistance gene on infection and reproduction of Meloidogyne enterolobii on tomato and pepper cultivars, J. Nematol. 41(2), pages 134 - 139. ·Mejias et al.,2019,Plant proteins and processes targeted by parasitic nematode effectors,Front.Plant Sci.July 2019 10:970,doi:10.3389 / fpls.2019.00970,eCollection 2019. ·Nguyen et al.,2018,A root-knot nematode small glycine and cysteine-rich secreted effector,MiSGCR1,is involved in plant parasitism.New Phytol.,217:687-699.Doi:10.1111 / nph.14837. ·Sievers et al.,2011,Fast,scalable generation of high-quality protein multiple sequence alignments using Clustal Omega,Mol.Syst.Biol.2011;7:539.https: / / www.ebi.ac.uk / Tools / msa / clustalo / ·Singh et al.,2013,Plant-parasitic nematodes of potential phytosanitary importance,their main hosts and reported yield losses,EPPO Bulletin 43(2),pages 334-374.
Claims
1. 1. A plant comprising a homozygous SmD1b allele encoding an SmD1 protein having at least 90% amino acid sequence identity to SEQ ID NO: 1, wherein the SmD1 protein comprises a missense mutation that results in a modified SmD1 protein that confers improved resistance to Meloidogyne species nematodes, and the missense mutation is a T14I mutation.
2. The plant of claim 1 , wherein the SmD1b allele is obtained by mutagenesis.
3. The plant according to any one of claims 1 to 2, wherein the plant is selected from the list comprising tomato, tobacco, pepper, pumpkin, watermelon, melon, cucumber and soybean.
4. The plant of claim 3 , wherein the plant is a selfed, dihaploid, or hybrid plant.
5. The plant according to claim 3 or 4, wherein the plant is a rootstock.
6. 6. The plant according to claim 1, wherein the modified SmD1 protein confers improved resistance to a nematode selected from any one of the following species: Meloidogyne incognita, Meloidogyne arenaria, Meloidogyne hapla, Meloidogyne enterolobidii, and Meloidogyne javanica.
7. The plant according to any one of claims 1 to 6, wherein the plant is Solanum lycopersicum.
8. The plant of claim 7, wherein the modified SmD1 protein consists of the amino acid sequence of SEQ ID NO:
2.
9. 9. The Solanum lycopersicum plant of claim 8, wherein the SmD1b allele is obtained from Solanum lycopersicum accession 19TEP250122, deposited with NCIMB on November 29, 2019 under NCIMB accession number 43529.
10. A plant part of the plant according to any one of claims 1 to 9, comprising the SmD1b allele.
11. A seed produced from the plant according to any one of claims 1 to 9.
12. 1. A method for improving resistance to Meloidogyne nematodes in plants, comprising: a) obtaining a population of mutant plants; b) selecting mutant plants containing a modified homozygous SmD1b allele encoding an SmD1 protein with a missense mutation in its amino acid sequence; wherein the missense mutation is a T14I mutation.
13. 1. A method for identifying a cultivated tomato plant that exhibits improved resistance to Meloidogyne nematodes and that has a homozygous SmD1b allele encoding an SmD1 protein having at least 90% amino acid sequence identity to SEQ ID NO: 1, wherein the SmD1 protein comprises a missense mutation resulting in a modified SmD1 protein: a) obtaining a population of mutant plants; b) screening said population for the presence of said SmD1b allele wherein the missense mutation is a T14I mutation.
14. 14. The method of claim 13, wherein the cultivated tomato plant is a cultivated Solanum lycopersicum plant.
Citation Information
Patent Citations
Meloidogyne-controlling agent and method for controlling the same
JP2008120749A
Nematode resistance
JP2019523643A
Isolated polynucleotides and polypeptides, and methods of using same for increasing plant yield and / or agricultural characteristics
WO2013179211A1