Infectious bronchitis chimeric virus comprising foreign QX-like virus spike protein and vaccine composition comprising same

Abstract

The present specification relates to an infectious bronchitis chimeric virus comprising a foreign QX-like virus spike protein, and a vaccine composition comprising same, wherein the chimeric virus has excellent vaccine efficacy against a QX-like type infectious bronchitis virus.

Description

Infectious bronchitis chimeric virus comprising foreign QX-like virus spike protein and vaccine composition comprising the same

[0001] The present disclosure relates to an infectious bronchitis chimeric virus comprising an exogenous QX-like viral spike protein and a vaccine composition against a bronchitis virus comprising the same.

[0002] Coronaviruses, belonging to the Nidovirales family, are large, positive-sense, single-stranded RNA viruses with an envelope, measuring approximately 26–32 kb (Cavanagh 2007). First discovered in birds in 1930, coronaviruses are susceptible to a wide range of species and are classified into four genera (groups 1–4) (Cavanagh and Naqi 2003). Coronaviruses infect humans, livestock, and companion animals, causing widespread damage by causing respiratory syndrome, pneumonia, diarrhea, oviposition pathogenesis, and death. In addition to humans, they also infect and cause disease in various animal species, including birds, particularly chickens, pigs, cats, and mice.

[0003] Avian coronaviruses, which infect chickens, are infectious bronchitis viruses that infect the respiratory tract and inhibit the ciliary movement of tracheal epithelial cells, leading to secondary infections with pathogens such as Escherichia coli. They also cause lesions in the egg-laying organs and kidneys, resulting in economic losses to the poultry industry (Hong et al. 2012). Coronaviruses infect a wide range of animal species, causing mild to severe illness. When a new coronavirus species emerges and causes an epidemic, rapid and complete defense is currently impossible.

[0004] Domestic avian infectious bronchitis viruses are classified by the genotype of the spike I protein, with GI-19 (KM91-like, QX-like, K40 / 09-like), GI-15, and GI-1 being the most prevalent types, and the QX-like virus of GI-19 being the most prevalent type. Four subgroups (QX-I to IV) of QX-like have been created to date, and QX-like III and QX-like IV are currently the predominant types.

[0005] In addition to point mutations, deletions, and insertions in the base sequence, coronaviruses frequently exhibit antigenic variants resulting from genetic recombination. However, the partial protective efficacy of heterozygous vaccine strains has been proven, and a limited number of vaccine strains are being used to combat various viral outbreaks. Failure to provide complete protection against circulating strains presents an opportunity for recombination between vaccine strains and field strains, leading to the emergence of new variants. Therefore, there is a need to develop vaccines utilizing recently circulating viruses.

[0006] Most of the avian infectious bronchitis viruses commonly used as avian coronavirus vaccines are developed through serial passage in SPF embryo eggs, but they may cause disease due to insufficient attenuation, have a long latent infection period, and there is a risk of mutant strains occurring through recombination with outdoor strains, and may acquire pathogenicity through reverse mutation.

[0007] Herein, the inventors of the present invention established a cold-adapted strain (caKII, Republic of Korea Patent Publication No. 10-2019-0023959) through passage at low temperature in chicken embryos, identified related genetic mutations, and confirmed that when infected with an SPF test system, it did not cause clinical symptoms, did not show tissue lesions, and was quickly eliminated from the body, but induced a sufficient immune response compared to the existing chicken embryo-adapted vaccine strain. Since the pathogenicity of infectious bronchitis virus is important for the internal genes, not the spike protein, the genome of the cold-adapted strain can be usefully used in reverse genetics technology for producing a chimeric recombinant vaccine strain that is non-pathogenic and has the same antigenicity as the field strain.

[0008] Over the past several decades, reverse genetics research on coronaviruses has steadily advanced. While coronavirus reverse genetics technology has evolved from targeted recombination to the production of infectious cDNA clones, the extremely large size of the virus genome presents several limitations, and the development of stable and reproducible techniques remains a challenge. Two key challenges in generating infectious clones are reverse transcriptase and the presence of eukaryotic virus-derived toxicity sequences in bacteria. These two issues are essential for the creation of stable viruses.

[0009] Many studies have proposed alternatives to overcome these problems. The first method is to stabilize the cell by maintaining a low copy number using Bacterial Artificial Choromosomes (BACs). The second method is to assemble full-length cDNA in vitro and clone it into a pox-virus vector. Alternatively, the second method is to directly transfect infectious RNA obtained through in vitro transcription using the same method. While both of these methods are excellent technologies, they require very delicate techniques and the hassle of removing various interfering factors during the process of producing the final infectious cDNA clone.

[0010] Specifically, high concentrations of gene fragments are required during in vitro ligation and cloning into vaccinia virus vectors. Furthermore, self-concatemer formation and random linkage of similar sequences during full-length cDNA assembly can make it difficult to secure a consensus sequence. Furthermore, the transcription of infectious clones requires the stable generation of RNA of approximately 30 kb.

[0011] Therefore, more concise and useful technological improvements are required. Recently, for the production of COVID-19 recombinant viruses, circular polymerase extension reaction (CPER) technology (Torii, Shiho, et al. "Establishment of a reverse genetics system for SARS-CoV-2 using circular polymerase extension reaction." Cell reports 35.3 (2021): 109014.) was developed, which is showing a high success rate. The technology divides the viral genome and transcription module into overlapping genetic fragments so that the base sequences at both ends can complementarily bind, amplifies the products by polymerase chain reaction, mixes them, performs polymerase chain reaction again, and then transfects cells.

[0012]

[0013] Under the above background, the inventors of the present invention used the BP-caKII genome as a basic framework, and after specifying and detoxifying the E. coli toxic gene region, selected a cell line that is easy to produce the virus and conditions for increasing the gene transfer infection rate, and applied CPER technology to produce a chimeric recombinant virus containing the spike gene of a QX-like virus that has recently become prevalent in Korea, thereby developing a vaccine, thereby completing the present invention.

[0014] The present disclosure provides an infectious bronchitis chimeric virus comprising an exogenous QX-like viral spike protein, specifically an infectious bronchitis chimeric virus comprising an amino acid sequence comprising SEQ ID NO: 3 and / or a gene encoding said amino acid.

[0015] Another example provides a vaccine composition against infectious bronchitis virus, comprising the infectious bronchitis chimeric virus.

[0016] Another example provides a method for producing an infectious bronchitis chimeric virus, comprising the step of introducing a foreign QX-like viral spike protein encoding gene into an infectious bronchitis virus.

[0017] Another example provides a method for immunizing against infectious bronchitis virus and / or a method for preventing, ameliorating and / or treating infectious bronchitis, comprising administering to a subject in need thereof an infectious bronchitis chimeric virus and / or vaccine composition, the method comprising administering the infectious bronchitis chimeric virus and / or vaccine composition.

[0018] Another example provides a composition for diagnosing infectious bronchitis virus comprising an antiserum to the infectious bronchitis chimeric virus as an active ingredient.

[0019] Another example provides a composition for preventing, ameliorating and / or treating infectious bronchitis comprising an antiserum to the infectious bronchitis chimeric virus as an active ingredient.

[0020] Other examples provide for the use of the infectious bronchitis chimeric virus for the prevention, amelioration and / or treatment of infectious bronchitis or for the manufacture of a composition (e.g., a pharmaceutical composition and / or a vaccine composition) of the infectious bronchitis chimeric virus for the prevention, amelioration and / or treatment of infectious bronchitis.

[0021] The present disclosure provides an infectious bronchitis chimeric virus comprising a foreign spike protein (e.g., a foreign QX-like viral spike protein) and / or a gene encoding said spike protein.

[0022] The above foreign spike protein may comprise the amino acid sequence of sequence number 3.

[0023] The above foreign spike protein and / or the gene encoding the spike protein can be inserted into the spike protein region of the infectious bronchitis virus.

[0024] Another example provides a vaccine composition against infectious bronchitis virus, comprising the infectious bronchitis chimeric virus.

[0025] Another example provides a method for immunizing against infectious bronchitis virus and / or a method for preventing, ameliorating and / or treating infectious bronchitis, comprising administering the infectious bronchitis chimeric virus and / or vaccine composition to a subject in need of immunization against infectious bronchitis virus and / or prevention, amelioration and / or treatment of infectious bronchitis.

[0026] Other examples provide for the use of the infectious bronchitis chimeric virus for the prevention, amelioration and / or treatment of infectious bronchitis or for the manufacture of a composition (e.g., a pharmaceutical composition and / or a vaccine composition) of the infectious bronchitis chimeric virus for the prevention, amelioration and / or treatment of infectious bronchitis.

[0027]

[0028] Hereinafter, the present invention will be described in more detail.

[0029]

[0030] The present disclosure provides an infectious bronchitis chimeric virus comprising a foreign spike protein (e.g., a foreign QX-like viral spike protein) and / or a gene encoding said spike protein.

[0031] Specifically, the foreign spike protein may include, but is not limited to, the amino acid sequence of SEQ ID NO: 3 or an amino acid sequence having at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or at least 99.5% sequence homology with the amino acid sequence of SEQ ID NO: 3. The gene encoding the spike protein may include, but is not limited to, the nucleic acid sequence of SEQ ID NO: 17 or a nucleic acid sequence having at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or at least 99.5% sequence homology with the nucleic acid sequence of SEQ ID NO: 17.

[0032] The above foreign spike protein may be a spike protein derived from the SNU19018 (GenBank accession number: OP765956) virus.

[0033] In this specification, "spike protein" refers to a protrusion-shaped protein that protrudes outward from the viral envelope (viral capsid or viral envelope), and is utilized when the virus binds to a receptor on a host cell. The spike protein can be broadly divided into spike 1 and II regions, and the spike I region contains an antigenic determinant that can play a major role when the virus binds to a receptor. The spike I region can be divided into the NH2-terminal domain (NTD) region and the carboxy-terminal domain (CTD) region, and the NTD region contains a hypervariable region and a receptor binding domain, which is an antigenic determinant region. However, the CTD region also contains a potential receptor binding site, which plays a role in receptor binding.

[0034] The SNU19018 virus was confirmed to belong to the QX-like III type of infectious bronchitis virus, and the spike protein of the SNU19018 virus was confirmed to have high homology in all gene regions of spike I-NTD, I, II, and the full length to the QX-like type compared to the K40 / 09-like type of GI-19 and / or the KM91-like type, which is another subgroup of GI-19 that mainly occurred in Korea, and may be more effective in protecting against the QX-like type of infectious bronchitis virus.

[0035] In this specification, "Infectious bronchitis virus (IBV)" is a type of gammacorona virus and is the causative virus of infectious bronchitis (IB). Specifically, the IBV is known to inhibit the ciliary movement of tracheal epithelial cells, secondarily causing colibacillosis, etc., and, when infected in laying hens, to cause abortive laying, reduced egg production, and deformed eggs. Since 1990, IBV mutants causing kidney lesions have been reported in Korea (Kim Jae-hong et al., 1994), and until recently, the IBV mutants have been known to cause damage by killing chickens and embryonated eggs.

[0036] Infectious bronchitis of chickens is classified into 35 lineages based on genotype, and GI-19 is the most prevalent worldwide. In Korea, GI-1, GI-15, and GI-19 have been prevalent together, and GI-19 is classified into three subgroups (QX-like, KM91-like, and K40 / 09-like).

[0037] Among the above subgroups, QX-like has been the most problematic virus for a long time and is classified into I-IV within QX-like, and recently, QX-like III and IV have been prevalent together. A new clade has been formed from I-IV over time, and SNU8065, SNU11045 (QX-like II), SNU19018, and SNU19012 (QX-like III) in Table 4 of Example 1-4 below correspond to I-IV, and QX-like I is currently not isolated.

[0038] KM91-like of GI-19 is mainly isolated as a vaccine strain, and the KM91-like vaccine, which was most widely used in poultry farms for the past decade, provides some protection against QX-like viruses, but its efficiency is very low and it is now rarely used. In addition, K40 / 09 of GI-19 is a new cluster that emerged in the late 2000s. Approximately 0-861 bp of the spike gene corresponding to the N-terminal domain (NTD) region where the hypervariable region in the spike I part and the receptor binding domain, which is an epitope, are genes of a QX-like virus, and the remaining genes of the spike were derived from a recombinant virus with a KM91-like virus.

[0039] Therefore, the spike NTD portion may show high homology with QX-like, but the homology with QX-like II, which occurred after QX-like type I, is lower than that of the above-mentioned SNU19018, and there is a significant difference in IV. In the entire portion of spike I (S1), SNU19018 shows higher homology with QX-like viruses than K40 / 09, showing superior specificity compared to existing vaccine strains in selecting vaccine strains to protect against the currently most prevalent and problematic QX-like virus.

[0040] The above-mentioned foreign spike protein and / or the gene encoding the spike protein may be inserted into the spike protein region of the infectious bronchitis virus. Specifically, the gene encoding the infectious bronchitis virus spike protein may be inserted by replacing it with a gene encoding the foreign spike protein.

[0041] The above infectious bronchitis virus may have the accession number KCTC13221BP, but is not limited thereto.

[0042] The infectious bronchitis virus (BP-caKII) having the above-mentioned accession number KCTC13221BP is an infectious bronchitis virus of the Republic of Korea Patent Publication No. 10-2019-0023959 (incorporated herein by reference), belonging to the KM91-like subtype, and was deposited at the Biological Resource Center of the Korea Research Institute of Bioscience and Biotechnology on May 21, 2017 and assigned the accession number KTCT13221BP.

[0043] The above infectious bronchitis chimeric virus

[0044] An infectious bronchitis chimeric virus, wherein the 12,336th nucleic acid sequence from the 5' end of the full-length gene of the infectious bronchitis chimeric virus is C.

[0045] In the virus reverse genetics technology, when producing an infectious clone, a specific base sequence of the full-length genome shows an unstable aspect in bacteria, which presents a limitation in securing a plasmid. However, it was confirmed that a plasmid was successfully obtained when producing an infectious clone using the virus reverse genetics technology for producing the infectious bronchitis chimeric virus, including a sequence in which the 12,336th nucleotide sequence from the 5' end is C in the full-length gene of the infectious bronchitis chimeric virus.

[0046] Another example provides infectious bronchitis virus, which has a nucleotide sequence C at position 12,336 from the 5' end of the full-length gene.

[0047] Another example is an infectious bronchitis chimeric virus, in which a foreign spike protein comprising the amino acid sequence of sequence number 3 or a gene encoding the spike protein is inserted into the infectious bronchitis virus.

[0048] The above foreign spike protein or the gene encoding the spike protein may be inserted into the spike protein region of an infectious bronchitis virus.

[0049] The above infectious bronchitis virus may have the accession number KCTC13221BP.

[0050] The genome of infectious bronchitis virus is approximately 27 kb long and contains RNA polymerase / transcriptase (1ab), spike (S), envelope (E), membrane (M), nonstructural proteins (nsp) 3a, 3b, 4b, 4c, 5a, 5b, nucleocapsid (N), and 6b genes from the 5'- to 3'-end (Cavanagh, 2007; Reddy et al., 2015).

[0051] The above 1ab protein is a nonstructural protein (nsp) that is created by a -1 frameshift of the ribosome in the frameshifting / slippery base sequence between the 1a and 1b genes, and is cleaved into 14-15 nsps by its own protease action, and is known to be responsible for functions related to viral replication such as RNA-dependent RNA polymerase, helicase, proteases, and RNA processing, and is known to be related to pathogenicity (Armesto et al., 2009; Fang et al., 2008). The spike protein is activated by being cleaved into S1 and S2 by the host protease, and most of the viral protective antigens are known to be distributed in S1 (Kant et al., 1992; Kusters et al., 1989).

[0052] The above infectious bronchitis chimeric virus may additionally include, but is not limited to, one or more genes selected from the group consisting of a gene encoding a 1a protein, a gene encoding a 1ab protein, a gene encoding a 3a protein, a gene encoding a 3b protein, a gene encoding an E protein, a gene encoding an M protein, a gene encoding a 4b protein, a gene encoding a 4c protein, a gene encoding a 5a protein, a gene encoding a 5b protein, a gene encoding an N protein, and a gene encoding a 6b protein.

[0053] The above 1a protein may include, but is not limited to, the amino acid sequence of SEQ ID NO: 1 or an amino acid sequence having 70% or more, 80% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 99.5% or more sequence homology with the amino acid sequence of SEQ ID NO: 1. The gene encoding the above 1a protein may include, but is not limited to, the nucleic acid sequence of SEQ ID NO: 15 or a nucleic acid sequence having 70% or more, 80% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 99.5% or more sequence homology with the nucleic acid sequence of SEQ ID NO: 15.

[0054] The above 1ab protein may include, but is not limited to, the amino acid sequence of SEQ ID NO: 2 or an amino acid sequence having at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or at least 99.5% sequence homology with the amino acid sequence of SEQ ID NO: 2. The gene encoding the above 1ab protein may include, but is not limited to, the nucleic acid sequence of SEQ ID NO: 16 or a nucleic acid sequence having at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or at least 99.5% sequence homology with the nucleic acid sequence of SEQ ID NO: 16.

[0055] The above 3a protein may include, but is not limited to, the amino acid sequence of SEQ ID NO: 4 or an amino acid sequence having at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or at least 99.5% sequence homology with the amino acid sequence of SEQ ID NO: 4. The gene encoding the above 3a protein may include, but is not limited to, the nucleic acid sequence of SEQ ID NO: 18 or a nucleic acid sequence having at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or at least 99.5% sequence homology with the nucleic acid sequence of SEQ ID NO: 18.

[0056] The above 3b protein may include, but is not limited to, the amino acid sequence of SEQ ID NO: 5 or an amino acid sequence having at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or at least 99.5% sequence homology with the amino acid sequence of SEQ ID NO: 5. The gene encoding the above 3b protein may include, but is not limited to, the nucleic acid sequence of SEQ ID NO: 19 or a nucleic acid sequence having at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or at least 99.5% sequence homology with the nucleic acid sequence of SEQ ID NO: 19.

[0057] The E protein may include, but is not limited to, the amino acid sequence of SEQ ID NO: 6 or an amino acid sequence having at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or at least 99.5% sequence homology with the amino acid sequence of SEQ ID NO: 6. The gene encoding the E protein may include, but is not limited to, the nucleic acid sequence of SEQ ID NO: 20 or a nucleic acid sequence having at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or at least 99.5% sequence homology with the nucleic acid sequence of SEQ ID NO: 20.

[0058] The above M protein may include, but is not limited to, the amino acid sequence of SEQ ID NO: 7 or an amino acid sequence having 70% or more, 80% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 99.5% or more sequence homology with the amino acid sequence of SEQ ID NO: 7. The gene encoding the above M protein may include, but is not limited to, the nucleic acid sequence of SEQ ID NO: 21 or a nucleic acid sequence having 70% or more, 80% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 99.5% or more sequence homology with the nucleic acid sequence of SEQ ID NO: 21.

[0059] The above 4b protein may include, but is not limited to, the amino acid sequence of SEQ ID NO: 8 or an amino acid sequence having at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or at least 99.5% sequence homology with the amino acid sequence of SEQ ID NO: 8. The gene encoding the above 4b protein may include, but is not limited to, the nucleic acid sequence of SEQ ID NO: 22 or a nucleic acid sequence having at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or at least 99.5% sequence homology with the nucleic acid sequence of SEQ ID NO: 22.

[0060] The above 4c protein may include, but is not limited to, the amino acid sequence of SEQ ID NO: 9 or an amino acid sequence having at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or at least 99.5% sequence homology with the amino acid sequence of SEQ ID NO: 9. The gene encoding the above 4c protein may include, but is not limited to, the nucleic acid sequence of SEQ ID NO: 23 or a nucleic acid sequence having at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or at least 99.5% sequence homology with the nucleic acid sequence of SEQ ID NO: 23.

[0061] The above 5a protein may include, but is not limited to, the amino acid sequence of SEQ ID NO: 10 or an amino acid sequence having at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or at least 99.5% sequence homology with the amino acid sequence of SEQ ID NO: 10. The gene encoding the above 5a protein may include, but is not limited to, the nucleic acid sequence of SEQ ID NO: 24 or a nucleic acid sequence having at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or at least 99.5% sequence homology with the nucleic acid sequence of SEQ ID NO: 24.

[0062] The above 5b protein may include, but is not limited to, the amino acid sequence of SEQ ID NO: 11 or an amino acid sequence having at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or at least 99.5% sequence homology with the amino acid sequence of SEQ ID NO: 11. The gene encoding the above 5b protein may include, but is not limited to, the nucleic acid sequence of SEQ ID NO: 25 or a nucleic acid sequence having at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or at least 99.5% sequence homology with the nucleic acid sequence of SEQ ID NO: 25.

[0063] The above N protein may include, but is not limited to, the amino acid sequence of SEQ ID NO: 12 or an amino acid sequence having at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or at least 99.5% sequence homology with the amino acid sequence of SEQ ID NO: 12. The gene encoding the above N protein may include, but is not limited to, the nucleic acid sequence of SEQ ID NO: 26 or a nucleic acid sequence having at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or at least 99.5% sequence homology with the nucleic acid sequence of SEQ ID NO: 26.

[0064] The above 6b protein may include, but is not limited to, the amino acid sequence of SEQ ID NO: 13 or an amino acid sequence having at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or at least 99.5% sequence homology with the amino acid sequence of SEQ ID NO: 13. The gene encoding the above 6b protein may include, but is not limited to, the nucleic acid sequence of SEQ ID NO: 27 or a nucleic acid sequence having at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or at least 99.5% sequence homology with the nucleic acid sequence of SEQ ID NO: 27.

[0065] The above infectious bronchitis chimeric virus may include, but is not limited to, the nucleic acid sequence of SEQ ID NO: 14 or a nucleic acid sequence having at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or at least 99.5% sequence homology to the nucleic acid sequence of SEQ ID NO: 14.

[0066] The above infectious bronchitis chimeric virus may have the accession number KCTC15444BP.

[0067] Another example provides a vaccine composition against infectious bronchitis virus, comprising the infectious bronchitis chimeric virus.

[0068] Another example provides a method for producing a plasmid for producing an infectious clone of an infectious bronchitis virus, comprising the step of inducing a mutation at base 12,345 and / or base 12,336 from the 5' end of the infectious bronchitis virus full-length gene.

[0069] The above “infectious clone” is a clone produced for transfecting any cell with nucleic acid or plasmid, and may be in the form of cDNA.

[0070] The mutation of the above base may be a substitution of C, and specifically, T may be a substitution of C, but is not limited thereto.

[0071] The mutation of the above base may be induced by using a fragment including bases 9550 to 12920 from the 5' end of the full-length gene, but is not limited thereto.

[0072] The above infectious bronchitis virus may have the accession number KCTC13221BP, but is not limited thereto.

[0073] A plasmid in which the above base mutation is induced can produce colonies normally when transfected into cells (e.g., RBC competent cells), unlike a plasmid in which the mutation is not induced.

[0074] Another example provides a method for producing an infectious bronchitis chimeric virus, comprising introducing a gene encoding a foreign spike protein (e.g., a foreign QX-like viral spike protein) into an infectious bronchitis virus.

[0075] The method for producing the above infectious bronchitis chimeric virus is

[0076] (1) a step of inserting a foreign spike protein including a gene encoding an amino acid sequence of sequence number 3 into the spike protein region of an infectious bronchitis virus; and

[0077] (2) It may include a step of inducing a mutation of the 12,336th T of the above infectious bronchitis virus to C.

[0078] The above step (1) may be, but is not limited to, inserting a gene encoding a foreign spike protein including a gene encoding an amino acid sequence of SEQ ID NO: 3 by replacing the gene encoding the spike protein of the infectious bronchitis virus.

[0079] The above infectious bronchitis virus may have the accession number KCTC13221BP, but is not limited thereto.

[0080] Another example provides a vaccine composition against infectious bronchitis virus comprising the infectious bronchitis chimeric virus for preventing, ameliorating or treating infectious bronchitis.

[0081] In this specification, “vaccine” means a biological preparation containing an antigen that induces immunity in a living organism, and refers to an immunogen or antigenic substance that induces immunity in a living organism by administering it to a human or animal to prevent infection.

[0082] The above vaccine composition may be, but is not limited to, a live vaccine, an inactivated vaccine, a subunit vaccine, a vector vaccine, a chimeric vaccine, a DNA vaccine, and / or a cell vaccine.

[0083] The above vaccine composition may additionally include, but is not limited to, one or more selected from the group consisting of an antigen adjuvant, an efficacy enhancer, a preservative, a buffer, a surfactant, a carrier, an osmotic agent, an antioxidant, and a stabilizer.

[0084] As used herein, “adjuvant” means a substance used to quantitatively or qualitatively change the immune response to an administered antigen.

[0085] As used herein, "adjuvant (or potentiator or immunopotentiator)" refers to a substance used to increase the immunogenicity of the immunogenic composition of the present invention. Such adjuvants are often provided to enhance immune responses, and this is well known to those skilled in the art.

[0086] In the present invention, "preservative (or preservative)" means a substance having an anti-viral and / or antibacterial action that inhibits the growth of microorganisms in the vaccine composition, and may be, for example, one or more (one, two, or three) selected from the group consisting of thimerosal, phenoxyethanol (2-phenoxyethanol), formaldehyde, etc., but is not limited thereto, and all conventional preservatives used in the art may be used.

[0087] Additionally, the vaccine composition may include one or more physiologically acceptable buffers. For example, when the vaccine composition is an infusion or injection, the buffer may have a buffering capacity at a pH of 4.0 to 10.0, specifically, at a pH of 5.0 to 9.0, and more specifically, at a pH of 6.0 to 8.0. The buffer may be at least one selected from the group consisting of TRIS, acetate, glutamate, lactate, maleate, tartrate, phosphate, citrate, carbonate, glycinate, histidine, glycine, succinate, and triethanolamine buffers.

[0088] In particular, when the vaccine composition of the present invention is intended for parenteral administration, the buffer may be selected from buffers suitable for the USP. For example, the buffer may be at least one selected from the group consisting of monobasic acids such as acetic acid, benzoic acid, gluconic acid, glyceric acid, and lactic acid; dibasic acids such as aconitic acid, adipic acid, ascorbic acid, carbonic acid, glutamic acid, malic acid, succinic acid, and tartaric acid; polybasic acids such as citric acid and phosphoric acid; and bases such as ammonia, diethanolamine, glycine, triethanolamine, and TRIS.

[0089] In addition, the vaccine composition provided herein may further comprise a non-ionic surfactant. Examples of non-ionic surfactants that may be further comprised include polyoxyethylene sorbitan ester compounds (Polysorbate 20 and Polysorbate 80), copolymers of ethylene oxide (EO), propylene oxide (PO), and butylene oxide (BO) (e.g., DOWFAX™); oxtoxynols having different numbers of repeating ethoxy (oxy-1,2-ethanediyl) groups, particularly ostoxynol-9 (Triton-100); ethylphenoxypolyethoxyethanol (IGEPAL CA-630 / NP-40); phospholipids such as lecithin; nonylphenol ethoxylates such as the NP series; polyoxyethylene fatty acid ethers derived from lauryl, cetyl, stearyl, and oleyl alcohols (Brij surfactants), particularly triethylene glycol monolauryl ether (Brij 30); Sorbitan ethers known as SPANs, particularly one or more selected from the group consisting of sorbitan trioleate (Span 85) and sorbitan monolaurate, but are not limited thereto. Specifically, polyoxyethylene sorbitan ester compounds (polysorbate 20 and polysorbate 80) may be present in an amount of from 0.001 % (w / v) to 20 % (w / v), for example from 0.001 % (w / v) to 10 % (w / v), especially from 0.001 % (w / v) to 1 % (w / v) or about 0.5 % (w / v), but are not limited thereto.

[0090] Physiologically acceptable carriers used in liquid formulations include aqueous or non-aqueous solvents, suspensions, emulsions, and oils. Examples of non-aqueous solvents include propylene glycol, polyethylene glycol, and ethyl oleate. Aqueous carriers include water, alcohol / aqueous solvents, emulsions or suspensions, saline, and buffered solutions. Examples of oils include vegetable or animal oils, peanut oil, soybean oil, olive oil, sunflower oil, cod liver oil, synthetic oils such as marine oil, and lipids derived from milk or eggs. The vaccine composition of the present invention may be isotonic, hypertonic, or hypotonic. For pharmaceutical compositions administered by infusion or injection, isotonicity is generally preferred, but is not limited thereto. Meanwhile, isotonicity or hypertonicity may be advantageous for the storage of the composition. If the vaccine composition is hypertonic, it may be diluted to make it isotonic before administration. The isotonic agent for dilution may be an ionic isotonic agent, such as a salt, or a non-ionic isotonic agent, such as a carbohydrate. Ionic tonicity agents include, but are not limited to, sodium chloride, calcium chloride, potassium chloride, and magnesium chloride. Nonionic tonicity agents include, but are not limited to, sorbitol and glycerol.

[0091] The vaccine compositions provided herein may include antioxidants. Exemplary reducing agents include mercaptopropionyl glycine, N-acetylcysteine, β-mercaptoethylamine, glutathione, ascorbic acid and its salts, sulfites, or sodium metabisulfite, or similar compounds. Additionally, antioxidants may include, but are not limited to, natural antioxidants such as vitamins E and C, lecithin, xanthine, and beta-carotene, as well as substances such as zinc and selenium.

[0092] The vaccine compositions provided herein may include stabilizers, wetting agents, emulsifiers, dispersants, and additional substances such as monosaccharides and polysaccharides. They may also include immunostimulatory molecules to enhance vaccine efficacy. These molecules may enhance the immune response, induce inflammation, or be specific lymphocytes or cytokines. Cytokines may include, but are not limited to, interleukin (IL)-1, IL-2, IL-3, IL4, IL-12, IL-13, granulocyte-macrophage colony-stimulating factor (GMCSF), and macrophage inflammatory factor.

[0093] The above vaccine composition may be administered by one or more routes selected from the group consisting of, but not limited to, in ovo, intranasal, intratracheal, oral, intradermal, intramuscular, intraperitoneal, intravenous, conjunctival, and subcutaneous.

[0094] The vaccine composition according to the present disclosure may be administered in a pharmaceutically effective amount to a subject in need of prevention of infection with infectious bronchitis virus and / or occurrence of disease and / or symptoms due to infectious bronchitis virus infection (e.g., at risk of infection with infectious bronchitis virus and / or occurrence of disease / symptoms due to infectious bronchitis virus infection) for the purpose of preventing disease and / or symptoms due to infectious bronchitis virus infection.

[0095] As used herein, the term "prevention" may refer to any action that inhibits or delays infection by the infectious bronchitis virus and / or the occurrence of diseases / symptoms caused by infectious bronchitis virus infection by administration of the vaccine composition of the present invention. The term "pharmaceutically effective amount" may refer to the dosage required to induce antibodies to a degree that can significantly reduce the probability of infection with the infectious bronchitis virus or the severity of the infection. The term "administration" refers to introducing a predetermined substance into an individual by any appropriate method. The vaccine composition may be administered by injection, for example, subcutaneous injection, intravenous injection, intramuscular injection, etc.

[0096] For example, a single dose of the vaccine composition may be, based on the weight of the antigen (e.g., infectious bronchitis virus), 0.1 to 1000 μg, 0.1 to 900 μg, 0.1 to 800 μg, 0.1 to 700 μg, 0.1 to 600 μg, 0.1 to 500 μg, 0.1 to 400 μg, 0.1 to 350 μg, 0.1 to 300 μg, 0.1 to 250 μg, 0.1 to 200 μg, 0.1 to 150 μg, 0.1 to 100 μg, 0.1 to 80 μg, 0.1 to 60 μg, 0.1 to 40 μg, 0.1 to 20 μg, , 0.5 to 1000 μg, 0.5 to 900 μg, 0.5 to 800 μg, 0.5 to 700 μg, 0.5 to 600 μg, 0.5 to 500 μg, 0.5 to 400 μg, 0.5 to 350 μg, 0.5 to 300 μg, 0.5 to 250 μg, 0.5 to 200 μg, 0.5 to 150 μg, 0.5 to 100 μg, 0.5 to 80 μg, 0.5 to 60 μg, 0.5 to 40 μg, 0.5 to 20 μg, 1 to 1000 μg, 1 to 900 μg, 1 to 800 μg, 1 to 700 μg, 1 to 600 μg, 1 to 500 μg, 1 to 400 μg, 1 to 350 μg, 1 to 300 μg, 1 to 250 μg, 1 to 200 μg, 1 to 150 μg, 1 to 100 μg, 1 to 80 μg, 1 to 60 μg, 1 to 40 μg, 1 to 20 μg, 5 to 1000 μg, 5 to 900 μg, 5 to 800 μg, 5 to 700 μg, 5 to 600 μg, 5 to 500 μg, 5 to 400 μg, 5 to 350 μg, 5 to 300 μg, 5 to 250 μg, 5 to 200 μg, 5 to 150 μg, 5 to 100 μg, 5 to 80 μg, 5 to 60 μg, 5 to 40 μg, 5 to 20 μg, 10 to 1000 μg, 10 to 900 μg, 10 to 800 μg, 10 to 700 μg, 10 to 600 μg, 10 to 500 μg, 10 to 400 μg, 10 to 350 μg, 10 to 300 μg, 10 to 250 μg, 10 to 200 μg, 10 to 150 μg, 10 to 100 The dose may be, but is not limited to, 10 to 80 μg, 10 to 60 μg, 10 to 40 μg, or 10 to 20 μg, and may be appropriately adjusted in consideration of the condition of the recipient, desired effect, etc.

[0097] Another example provides a method of immunization comprising administering the vaccine composition to a subject in need of immunization against infectious bronchitis virus.

[0098] Another example provides a method for preventing, ameliorating and / or treating infectious bronchitis, comprising administering the vaccine composition to a subject in need of preventing, ameliorating and / or treating infectious bronchitis.

[0099] The "subject" to which the vaccine composition of the present specification is administered may mean a living organism that can be infected with a pathogen, or a cell, tissue, or culture thereof isolated therefrom, and the subject and / or organism may be an animal including a bird, a bovine (e.g., a cow), a swine (e.g., a pig), a canine (e.g., a dog, a wolf, a fox, a coyote, a jackal, etc.), a feline (e.g., a lion, a tiger, a domestic cat, a wild cat, other big cats, a cheetah, a lynx, etc.), an equine (e.g., a horse, etc.), an ovine (e.g., a sheep, a goat, a lamb, a bison, etc.), a primate (e.g., a human, a prosimian, a tarsier, a monkey, a gibbon, a monkey), and the like, and specifically, may be a bird including, but not limited to, a chicken, a duck, a goose, a turkey, a quail, a pheasant, a parrot, a finch, a hawk, a crow, an ostrich, an emu, and a cassowary. The term "animal" above may include, but is not limited to, individual animals at any stage of development, including embryonic and fetal stages. Furthermore, the term "animal" may exclude humans.

[0100] The present invention relates to an infectious bronchitis chimeric virus comprising a foreign QX-like virus spike protein and a vaccine composition comprising the same, which has a superior vaccine effect against QX-like infectious bronchitis virus compared to existing vaccines using infectious bronchitis viruses.

[0101] Figure 1 is a diagram showing the results of phylogenetic analysis of SNU19018, which belongs to the QX-like subgroup of the field-isolated GI-19 strain, which contains a foreign gene used to replace the spike gene of BP-caKII.

[0102] Figure 2 is a vector map of the pfluRG vector used to produce HDV-CMV.

[0103] Figure 3 is a photograph of 10 PCR products electrophoresed by gradually reducing the plasmid to 1 kb intervals to identify the location of the toxic gene of the FR (4) fragment in BP-caKII.

[0104] Figure 4 is a photograph of colony PCR performed to confirm growth upon insertion into cells after cloning of a PCR product prepared to identify the location of the toxic gene of the FR (4) fragment in BP-caKII, and confirmed by electrophoresis.

[0105] Figure 5 is a photograph of an electrophoresis result obtained by performing colony PCR to determine whether growth occurred when inserting a plasmid into a cell after setting an additional range to specify the final location of the toxic gene in the FR (4) fragment within BP-caKII and producing a plasmid for the relevant region.

[0106] Figure 6 shows the results of analysis using the Prediction of bacterial promoters tool to predict potential transcription start sites among the FR (4) fragment regions where toxic genes have been identified.

[0107] Figure 7 is a photograph of the results of colony PCR performed to confirm growth when a point mutation was induced in the FR (4) fragment of BP-caKII and the manufactured plasmid was inserted into a cell, which was confirmed by electrophoresis.

[0108] Figure 8 is a schematic diagram of a fragment in which only the spike protein portion is deleted from the FR (6) fragment of BP-caKII to insert the SNU19018 spike protein into the BP-caKII fragment, and the result of aligning the corresponding gene of the chimeric virus.

[0109] Figure 9 shows the results proving that a normal gene substitution occurred by comparing the base sequences surrounding the spikes of rQX-Chi and BP-caKII with the expected base sequence in which the spike of SNU19018 was substituted into BP-caKII.

[0110] Figure 10 is a photograph showing the results of confirming whether or not the RNA of the inoculated egg was infected with IBV after inoculating the produced recombinant virus into the SPF embryonated egg.

[0111] Figure 11 is a photograph showing the results of observing the cytopathic effect of rQX-A130P in embryonic kidney cells at the third time of inoculation (passage).

[0112] Figure 12 is a graph showing a virus proliferation curve created according to the type of virus inoculated into the embryonated egg.

[0113] Figures 13 and 14 are photographs showing the results of histopathology of tracheal and kidney tissues inoculated with infectious bronchitis virus with spike protein inserted and point mutations.

[0114] Figure 15 is a graph showing the final neutralizing antibody titer results obtained by observing the cytopathic effect after inoculating 1:1 ratio of serum obtained through weekly blood collection after inoculation with a commercial vaccine and the infectious bronchitis chimeric virus of the present invention with an infectious bronchitis virus with a spike protein inserted and point mutations that infects chicken embryonic kidney cells, and then inoculating the cells into chicken embryonic kidney cells.

[0115] Figure 16 shows the results of measuring the neutralization index by measuring the neutralized virus titer by inoculating 10-day-old eggs with serum obtained through weekly blood collection after inoculation with a commercial vaccine and the infectious bronchitis chimeric virus of the present invention and reacting SNU19018 in a 1:1 ratio.

[0116] Hereinafter, the present invention will be described in more detail with reference to the following examples. However, these examples are only intended to illustrate the present invention, and the scope of the present invention is not limited by these examples.

[0117]

[0118] Example 1. Preparation of donor virus and recipient virus for production of infectious bronchitis recombinant virus.

[0119] Example 1-1. Obtaining infectious bronchitis virus (SNU19018) for securing spike donor virus.

[0120] To obtain infectious bronchitis virus (IBV) for spike donor virus acquisition, the following experiments were performed.

[0121] The trachea and cecal tonsils were collected from 39-day-old Hy-line brown, which was requested for disease diagnosis by the laying hen farm agricultural company Daal, and added to sterile phosphate buffer solution (pH 7.2). A 10% (v / v) emulsion was obtained, and centrifuged at 3,000 rpm (2,500 g) for 10 minutes to precipitate cells and tissues, and the supernatant was obtained.

[0122] RNA was extracted from 100 μl of the above supernatant using a viral Gene-Spin kit (iNtRON Biotechnology, Korea), and one-step RT-PCR (Qiagen, USA) was performed using the primers listed in Table 1 below according to the manufacturer's protocol under the following conditions: 50°C-30 m, 95°C-15 m, 95°C-30 s, 50°C-30 s, 72°C-30 s, 25 cycles, and final extension 72°C-3 m to confirm the presence of infectious bronchitis virus.

[0123] Primer name sequence (5' -> 3') sequence number Non_structural_protein 3_FGTCGCCTTACATTACAGCAATG37 Non_structural_protein 3_RCCTCTAACTTTAAGTGTCAGTG38

[0124] The supernatant in which the presence of IBV was confirmed was inoculated into three 10-day-old SPF (Specific Pathogen Free) embryonated eggs (Valo Biomedia, USA) at 200 μL each via the allantoic cavity route and cultured for 48 hours.

[0125] The embryonated eggs cultured above were stored in a refrigerator at 4°C, and allantoic fluid was obtained from the refrigerated embryonated eggs. The obtained allantoic fluid was centrifuged at 3,000 rpm (2,500 g) for 10 minutes, and the supernatant was collected. RT-PCR was performed on the supernatant using the same method as above to confirm the presence of IBV. The supernatant in which the presence of IBV was confirmed was passaged twice into 10-day-old embryonated eggs and then stored at -70°C. The infectious bronchitis virus produced through the above process was named SNU19018 (GenBank accession number: OP765956), and the corresponding strain was secured as a donor virus.

[0126]

[0127] Example 1-2. Securing a recipient virus for establishing a recombinant virus.

[0128] In order to secure a spike recipient virus for establishing a recombinant cold-adapted attenuated infectious bronchitis virus, the infectious bronchitis virus live vaccine strain BP-caKII, which was deposited with the Biological Resource Center of the Korea Research Institute of Bioscience and Biotechnology on May 21, 2017 and assigned the deposit number KCTC 13221BP, was diluted 1,000-fold and inoculated into three SPF embryonated chicken eggs via the allantoic route, cultured at 32°C for 48 hours, refrigerated at 4°C, and then the allantoic fluid was harvested and centrifuged in substantially the same manner as in Example 1-1 to separate the supernatant.

[0129] The presence of the virus was confirmed by performing PCR on 150 μL of the supernatant separated from each of the above membrane fluids in substantially the same manner as in Example 1-1, and the BP-caKII was secured as the recipient virus.

[0130]

[0131] Example 1-3. Phylogenetic analysis of field-isolated infectious bronchitis virus (SNU19018)

[0132] BP-caKII of the above Example 1-2 was identified as KM91-like of the GI-19 lineage in Korean Patent Publication No. 10-2019-0023959, and the 1-1611 base sequence (M41 numbering) encoding the S1 (spike I) fragment of the spike protein of 25 domestic and foreign IBV strains for SNU19018 of the above Example 1-1 was subjected to phylogenetic analysis (neighbor-joining, Tamura-Nei distance, bootstrapping 500 repeats) using the MEGA (ver. 11) program, and the results are shown in Fig. 1. Information on the 25 IBV strains used for phylogenetic analysis is shown in Table 2 below.

[0133] 명명리니지서븐그리China_58HeN_93II_93 / GI-19GI-19QX-likeKorea / QIA / 03342 / 03 / GI-19GI-19QX-likeKorea / K1583 / 04 / GI- 19GI-19QX-likeKorea / QIA / KR / D79 / 05 / GI-19GI-19QX-likeKorea / SNU8065 / 08 / GI-19GI-19QX-likeKorea / SNU10114 / 10 / GI-19GI-19QX-likeKorea / SNU11045 / 11 / GI-19GI-19QX-likeKorea / SNU19012 / 19 / GI-19GI-19QX-likeKorea / SNU19018 / 19 / GI-19GI-19QX-likeKorea / SNU21001 / 21 / GI-19GI-19QX-likeKorea / SNU19048 / 19 / GI-19GI-19QX-likeKorea / SNU20020 / 20 / GI-19GI-19QX-likeKorea / SNU21003 / 21 / GI-19GI-19QX-likeKorea / K2 / 01 / GI-19GI-19KM91-likeKorea / CakII / 08 / GI-19GI-19KM91-likeKorea / Km91 / 91 / GI-19GI-19KM91-likeKorea / SNU9106P / 09 / GI-19GI-19K40 / 09Kor ea / SNU10043 / 10 / GI-19GI-19K40 / 09Korea / SNU20047 / 20 / GI-19GI-19K40 / 09Korea / SNU21013 / 21 / GI-19GI-19K40 / 09K orea / SNU21005 / 21 / GI-19GI-19K40 / 09Korea / SNU20018 / 20 / GI-19GI-19K40 / 09Korea / SNU20007 / 20 / GI-15GI-15Korea IKorea / SNU21004 / 21 / GI-15GI-15Korea IKorea / SNU8067 / 08 / GI-15GI-15Korea IKorea / SNU20007 / 20 / GI-15GI-15Korea IKorea / SNU20027 / 20 / GI-15GI-15Korea IKorea / SNU21004 / 21 / GI-15GI-15KoreaIUSA_M41_41 / GI-1GI-1MassUSA / Beaudette / 37 / GI-1Gi-1Mass

[0134] As a result of phylogenetic analysis, the above SNU19018 was classified as having the same genotype as the QX-like 53HeN93 strain of the GI-19 lineage and was confirmed to belong to the QX-like-III subgroup.

[0135]

[0136] Example 1-4. Whole-Genome and 1ab Homology Analysis of Field-Isolated Infectious Bronchitis Virus (SNU19018)

[0137] The entire genome sequence of SNU19018 of Example 1-1 was compared with the full-length genome and 1ab homology of some viruses belonging to QX-like I, II, and III (SNU8065, SNU11045, and SNU19012) using Bioedit and Mega ver. 7 programs, and the results are shown in Tables 3 and 4 below, respectively.

[0138] Whole genome homology (identity)SNU8065SNU11045SNU19018SNU19012SNU8065-0.9970.970.971SNU110450.997-0.970.971SNU190180.970.97-0.993SNU190120.9710.9710.993-

[0139] 1ab homology (identity)SNU8065SNU11045SNU19018SNU19012SNU8065-0.9960.9780.979SNU1 10450.996-0.9770.978SNU190180.9780.977-0.992SNU190120.9790.9780.992-

[0140] Comparison of the above full-length genome and 1ab homology revealed that SNU19018 showed a high homology of over 97% with QX-like viruses, and that QX-like I, II, and III all shared a single ancestor, confirming that it was a complete QX-like virus rather than a recombinant one.

[0141]

[0142] Example 1-5. Analysis of Spike I homology between QX-like III group and QX-like group including SNU19018

[0143] In order to compare the homology between the QX-like III group including SNU19018 of the above Example 1-1 and the remaining QX-like subgroups (QX-like I, II and IV), the Bioedit and Mega ver. 7 programs of the above Example 1-4 were used to confirm the homology of the spike I having the antigenic determinant between each of the QX-like and K40 / 09-like groups of GI-19 and the subgroups of QX-like (QX-like I-IV), K40 / 09-like group and KM91-like group by dividing it into the entire region (S1) of the spike I of each group and the N-terminal domain (NTD) region (S1-NTD) in which the hypervariable region of the spike I and the receptor binding domain, which is the antigenic determinant, are present, and the results are shown in Table 5 below.

[0144] SubgroupGI-19GI-1 & GI-15QX-like IQX-like IIQX-like IIIQX-like IVKM91-likeK40 / 09-likeS1QX-like III84.5 ~ 95.683.7 ~ 98-87.3 ~ 98.876.5 ~ 86.578.8 ~ 90.276.2 ~ 87.2(81 ~ 94.9)(82.8 ~ 97.9)(85.8 ~ 99.2)(76.1 ~ 87.2)(78 ~ 90.2)(73.1 ~ 85.3)K40 / 09-like88.6 ~ 93.486.3 ~ 91.978.8 ~ 90.287.4 ~ 89.889.4 ~ 94.2-77.7 ~ 82.6(85.7 ~ 92.8)(85.3 ~ 90.4)(78 ~ 90.2)(87 ~ 90.2)(87.9 ~ 93.2)(75.7 ~ 80.8)S1-NTDQX-like III72.3 ~ 94.472.9 ~ 97.9-75 ~ 98.572.7 ~ 92.273.5 ~ 94.471.7 ~ 88.7(70.9 ~ 94.5)(71.7 ~ 98.4)(72.9 ~ 99.6)(70.2 ~ 92.2)(71.7 ~ 94.5)(68.3 ~ 86.3)K40 / 09-like94.8 ~ 99.490.5 ~ 95.273.5 ~ 94.491.8 ~ 9489.4 ~ 92.8-71.7 ~ 76(89.1 ~ 98.8)(89.4 ~ 95.3)(71.7 ~ 94.5)(91.4 ~ 94.9)(87.5 ~ 92.2)(68.7 ~ 73.6)

[0145] As a result of measuring the above Spike I homology, it was confirmed that the QX-like III group had a relatively high homology value to the QX-like group for the entire S1 corresponding to the entire Spike I region as well as the S1-NTD region containing the antigen binding site compared to the K40 / 09-like group.

[0146] Although S1 has an NTD and a carboxy-terminal domain (CTD), and a hypervariable region and a receptor binding domain, which is an antigenic determining region, are present in S1-NTD, it is known that S1-CTD also has a potential receptor binding site and plays a role in receptor binding. Based on the above results, it was confirmed that QX-like III has a higher homology with the QX-like group than the K40 / 09-like group for the entire S1 region excluding S1-NTD, and is therefore more effective in protecting against QX-like viruses.

[0147]

[0148] Example 1-6. Analysis of spike gene homology with the QX-like group of SNU19018.

[0149] Using the Bioedit and Mega ver. 7 programs of the above Example 1-4, a comparative analysis was performed with the entire genome base sequences of viruses included in the live vaccine strains K40 / 09 and GI-19 of Komipharm Co., Ltd. (Company C) and Daesung Microbiological Research Institute Co., Ltd. (Company D) sold domestically, to confirm the genetic homology to S1 and the homology to the full-length spike gene, and the results are shown in Tables 6 and 7, respectively.

[0150] D사C사SNU-19018 / QX-III (rQX-1)QIA-03342 / QX-IQIA-KR / D79 / 05 / QX-like ISNU-8065 / QX-like IISNU-11045 / QX-like IISNU-10043 / K40 / 09-likeSNU-9106 / K40 / 09-likeSNU-19012_QX-like IIISNU-21001_QX-like IIISNU-20017_QX-like IVSNU-21003_QX-like IVD사ID0.9040.8920.9170.9040.8940.8890.9690.9640.8920.8940.8850.889C사0.904ID0.9430.9540.9450.9430.9390.9090.8940.9430.9450.9340.937SNU-19018 / QX-III (rQX-1)0.8920.943ID0.9430.9360.9730.9690.8960.8890.9920.9980.9750.979QIA-03342 / QX-I0.9170.9540.943ID0.9640.9490.9430.9220.9090.9430.9450.9390.943QIA-KR / D79 / 05 / QX-like I0.9040.9450.9360.964ID0.9340.930.9110.9020.9360.9370.9260.934SNU-8065 / QX-like II0.8940.9430.9730.9490.934ID0.9860.8960.890.9750.9750.9680.973SNU-11045 / QX-like II0.8890.9390.9690.9430.930.986ID0.890.8850.9710.9710.9620.968SNU-10043 / K40 / 09-like0.9690.9090.8960.9220.9110.8960.89ID0.9560.8960.8980.8890.892SNU-9106 / K40 / 09-like0.9640.8940.8890.9090.9020.890.8850.956ID0.8890.890.8810.885SNU-19012_QX-like III0.8920.9430.9920.9430.9360.9750.9710.8960.889ID0.9940.9730.981SNU-21001_QX-like III0.8940.9450.9980.9450.9370.9750.9710.8980.890.994ID0.9750.979SNU-20017_QX-like IV0.8850.9340.9750.9390.9260.9680.9620.8890.8810.9730.975ID0.977SNU-21003_QX-like IV0.8890.9370.9790.9430.9340.9730.9680.8920.8850.9810.9790.977ID.

[0151]

[0152] Company D Company C SNU-19018 / QX-IIIQIA-03342 / QX-IQIA-KR / D79 / 05 / QX-ISNU-8065 / QX-IISNU-11045 / QX-IISNU-10043 / K40 / 09SNU-9106 / K40 / 09SNU-19012_QX-like IIISNU-21001_QX-like IIISNU-20017_QX-like IVSNU-21003_QX-like IVD ID0.9270.9210.9210.920.9240.9210.9510.9670.9210.9270.9160.917C ID0.927 ID0.9690.9570.9560.9710.9680.9210.9180.9670.9660.9630.964SNU-19018 / QX-III0.9210.969 ID0.9530.9520 .9830.980.9160.9160.990.9930.9840.985QIA-03342 / QX-I0.9210.9570.953ID0.9720.9560.9510 .930.920.9510.9550.950.951QIA-KR / D79 / 05 / QX-I0.920.9560.9520.972ID0.9510.9480.9340.924 0.9510.9560.9460.949SNU-8065 / QX-II0.9240.9710.9830.9560.951ID0.9920.9150.9170.9840.9 810.980.981SNU-11045 / QX-II0.9210.9680.980.9510.9480.992ID0.910.9130.9810.9770.9750.9 77SNU-10043 / K40 / 090.9510.9210.9160.930.9340.9150.91ID0.9450.9150.920.9090.91SNU-9106 / K40 / 090.9670.9180.9160.920.9240.9170.9130.945ID0.9150.9210.9110.912SNU-19012_QX-like III0.9210.9670.990.9510.9510.9840.9810.9150.915ID0.9870.9790.981SNU-21001_QX-like III0.9270.9660.9930.9550.9560.9810.9770.920.9210.987ID0.9790.98SNU-20017_QX-like IV0.9160.9630.9840.950.9460.980.9750.9090.9110.9790.979ID0.988SNU-21003_QX-like IV0.9170.9640.9850.9510.9490.9810.9770.910.9120.9810.980.988ID.

[0153] As a result of confirming the genetic homology for S1, it was confirmed that the commercial vaccines for QX-like (Company C and Company D) had significantly lower S1 genetic homology with QX-like III and IV subgroups than SNU-19018 / QX-III (rQX-1). This is because only some genes of S1 in the used vaccine, K40 / 09-like, are similar to QX-like, showing relatively lower homology.

[0154] As a result of confirming the entire spike gene homology, it was confirmed that the commercial vaccine showed lower genetic homology with QX-like viruses than rQX-1.

[0155] Through the results of the above homology confirmation, it was confirmed that SNU19018 has very high homology with both the Spike I and Spike full-length genes of recently prevalent QX-like III and IV compared to other commercial vaccines.

[0156] In the case of Company D, the homology of spike I with the QX-like isolate was confirmed to be less than 90%, and the homology of full-length spike was also confirmed to be low at 92%. In C, the homology with the recent QX-like isolate was higher than that of Company D, but it was lower than that of SNU19018, and the homology of spike I was confirmed to be lower than that of full-length spike.

[0157] Although the homology in spike I, where the epitope is present, is lower, there is a slight increase in full-length spike homology when the relatively conserved region of spike II is included, but both spike I and full-length genes were confirmed to be at lower levels than SNU19018, so it is expected that the spike of SNU19018 will show much higher efficiency in protecting against the recently popular QX-like.

[0158]

[0159] Example 2. Establishment of Recombinant Infectious Bronchitis Virus Reverse Genetics Technology

[0160] Example 2-1. Preparation of a template for constructing a recombinant infectious bronchitis virus.

[0161] To produce a template for constructing a recombinant infectious bronchitis virus, the full-length genome of BP-caKII of Example 1-2 (NCBI Accession Number: MF924724) was divided into eight gene fragments FR (1), FR (2), FR (3), FR (4), FR (5-1), FR (5-2), FR (6), and FR (7). Sequence information for each fragment is shown in Table 8 below, and specific information for each fragment is shown in Table 9 below. In addition, a primer set for each fragment was prepared, and the primer information is shown in Table 10 below.

[0162]

[0163]

[0164]

[0165]

[0166]

[0167]

[0168]

[0169]

[0170]

[0171]

[0172]

[0173]

[0174]

[0175]

[0176]

[0177]

[0178] (In Table 8 above, the bold and underlined parts indicate the beginning and end of the spike portion of the inserted SNU19018)

[0179] Gene fragment length size (bp) 0.1pmol concentration (ng / ul) FR (1) 1-39 25 39 25 260 FR (2) 3879-77 34 3856 260 FR (3) 7688-111 88 350 1230 FR (4) 111 58-1433 43177 / 3737 210 / 220 FR (5-1) 141 14-172 18310 5200 FR (5-2) 171 75-200 46287 2190 FR (6) 19902-2433 94429290 FR (7) 24133-2766 535 33230 HDV-CMV 102267

[0180] (In Table 9 above, the 0.1 pmol concentration means the minimum concentration of each fragment required to match 0.1 pmol, which is the concentration of fragment required when performing CPER PCR for reverse genetics)

[0181] Primer name sequence (5' -> 3') Nucleotide position (bp) Sequence number FR-(1)-CPER-FCTATATAAGCAGAGCTCGTTTAGTGAACCGTACTGAAAATAGATATTAATATATATCTATTAC1-3239 FR-(1)-CPER-RGAACTGGCACAACATAGTTAAACACGCCATCTACAAGAACATTCCTG 3879-392540 FR-(2)-CPER-FCAGGAATGTTCTTGTAGATGGCGTGTTTAACTATGTTGTGCCAGTTC 3879-392541 FR -(2)-CPR-RGTACCAAGGTTTTCGGTCTGTCTGTGTCATATGTATAAACATAGCAC7688-773442FR-(3)-CPER-FGTCCAATTGTTACAGCTGTTATAGATGGCGATGGGGC AG7688-773443FR-(3)-CPER-RGTCCATGCACTCTCCAACATCATAAGATGCAAGGATTTTG10,776-10,81544FR-(4)-CPER-FCAAAATCCTTGCATCTTATGATGTT GGAGAGTGCATGGAC10,776-10,81545FR-(4)-CPER-RCAAATACACATGCACCCAAAATACGTGAGGGATCCGGATATGGCAAG14,820-14,86646FR-(5-1)-CPER -FCTTGCCATATCCGGATCCCTCACGTATTTTGGGTGCATGTGTATTTG14,820-14,86647FR-(5-1)-CPER-RCAAGCATGTGTAGCCTCTACATCAAAACCTACCCAACCT CTAAC17,176-17,21948FR-(5-2)-CPER-FGTTAGAGGTTGGGTAGGTTTTGATGTAGAGGCTACACATGCTTG17,176-17,21949FR-(5)-CPER-RCATTATTGGCT ATCACGCCTTCATGCTTTCCTCTTTGAGTCATTATC19,903-19,94850FR-(6)-CPER-FGATAATGACTCAAAGAGGAAGCATGAAGGCGTGATAGCCAATAATG19,903-19,94851FR-(6)-CPER-RGCTCCTGGAACTACTACCCATGTGTACCAAAATAAACAACAAGCATC24,294-24,34052FR-(7)-New-FGATGCTTGTTGTTTATTTTGGTACACATGGGT AGTAGTTCCAGGAGC24,294-24,34053FR-(7)-HDVr-CaKII-3'-end-RGAGGTGGAGATGCCATGCCGACCCTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGCTCTAACTC27,617-54,

[0182] RNA was extracted from the above BP-caKII using the viral Gene-Spin kit (iNtRON Biotechnology, Korea) of Example 1-1, and then cDNA was synthesized using Oligo(dt) primers and an engenomic TOPscript TM cDNA of each fragment was synthesized using a cDNA Synthesis Kit, and PCR amplification was performed using the primers in Table 10 and PrimeSTAR® GXL DNA Polymerase (TAKARA). The sequence information of the Oligo(dt) primers is shown in Table 11 below.

[0183] Primer name sequence (5' -> 3') sequence number Oligo_dt_primerTTTTTTTTTTTTTTTTTT55

[0184] The above PCR amplification product was purified using the GeneAll® Expin™ Combo GP (Geneall) kit, and 4 μl was reacted with the TA cloning kit TOPcloner™ Blunt core kit (engenomics) V2 vector to produce a plasmid with each fragment inserted.

[0185] The base sequence of the plasmid into which each fragment was inserted was requested to ABI3711 automatic sequencer (Macrogen Co., Seoul, Korea; Macrogen sequencing company), and the sequence file was received and analyzed with Bioedit and chromas to confirm that there was no genetic mutation and that it matched. The plasmid was mixed with a bacterial culture solution containing Duchefa's LB Broth high salt (Tryptone 10 g / L, Sodium chloride 10 g / L, Yeast extract 5 g / L) in 70% glycerol and stored at -70℃.

[0186] In addition, a linker sequence (including 25 nucleotides of 5' and 3' of BP-caKII) for connecting the cDNA fragments of each of the eight fragments was amplified and connected by SOE-PCR together with rHDV, BHG terminator, CMV promoter, and CMV enhancer to produce one fragment HDV-CMV.

[0187] Specifically, the rHDV was amplified from the HDV region of the pfluRG vector using the linker-3'-end-HDVr-F (SEQ ID NO: 56) and BGH-(A)-HDVr-R (SEQ ID NO: 58) primers of Table 12 below, the BGH terminator was amplified from the BGH region of the pcDNA3.1 vector (ThermoFisher, cat# V79020) using the HDVr-BGH-(A)-F (SEQ ID NO: 59) and P2-pcDNA3.1-BGH-space-CMV(E)-R (SEQ ID NO: 60) primers of Table 12 below, and the CMV promoter and enhancer were amplified from the CMVpromoter region of the pSmartBac vector (Lucigen, Cat#-42030-1) using the P2-pSmart-BGH-CMV enhance-F (SEQ ID NO: 61) and PCR (rHDV: 141 bp, BGH: 294 bp, CMV-enhencer: 620 bp) was performed using the CMV-pro-UTR-R (SEQ ID NO: 62) primer and 10 ng of each template using PrimeSTAR® GXL DNA Polymerase (TAKARA) under the conditions of 98-1m, 98-15s, 55-15s, 68-30s, 24 cycles, final extension 68-30s, and purified. The vector map of the pfluRG vector used above is shown in Fig. 2.

[0188] The purified PCR products were mixed in 1 μl each and amplified by PCR using PrimeSTAR® GXL DNA Polymerase (TAKARA) under the following conditions: 98°C-1m, 98°C-15s, 55°C-15s, 68°C-1m, 24 cycles, and final extension 68°C-1m using the linker-3'-end-HDVr-F (SEQ ID NO: 56) and Linker-5'-end-Gap-CMV-R (SEQ ID NO: 57) primers in Table 12 below, to produce an HDV-CMV fragment (HDV-BGH-CMV-enhancer). The sequence of the HDV-CMV fragment is shown in Table 8 above.

[0189] Primer name sequence (5' -> 3') sequence number linker-3'-end-HDVr-FGAGTTAGAGCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGGGTCGGCATGGCATCTCCACCTC56 Linker-5'-end-Gap-CMV-RGTAATAGATATATATTAATATCTATTTTCAGTACGGTTCACTAAACGAGCTCTGCTTATATAG57 BGH-(A)-HDVr-RCTGGCAACTAGAAGGCACAGGCTCTCCCTTAGCCATCCGAGTGGACGAC58 HDVr-BGH-(A)-FCTCGGATGGCTAAGGGAGAGCCTGTGCCTTCTAGTTGCCAGCCATCTG59 P2-pcDNA3.1-BGH-space-CMV(E)-RGTCGGGGATACCCCCTAGAGCCCCAGCTGGTTC60 P2-pSmart-BGH-CMV enhence-FCTGGGGCTCTAGGGGGTATCCCCGACATTGATTATTGACTAGTTATTAATAG61CMV-pro-UTR-RACGGTTCACTAAACGAGCTCTGCTTATATAGACCTCCCACCGTAC62

[0190] Using the HDV-CMV fragment (fragment 9), a plasmid into which each of the eight fragments was inserted was constructed using a method substantially identical to that used to construct a plasmid.

[0191]

[0192] Example 2-2. Identification of virulence genes in infectious bronchitis virus

[0193] In the reverse genetics technology of coronaviruses, when producing infectious clones, certain base sequences of the full-length genome show an unstable pattern in bacteria, which presents limitations in securing plasmids. Specifically, the base sequences of various coronavirus-specific locations in Table 13 below inhibit bacterial growth during plasmid cloning, preventing plasmid collection. It was also confirmed that the avian infectious bronchitis virus contains a toxic gene that inhibits bacterial growth in the region of approximately 9,550-12,000.

[0194] Nucleotide positions in the coronavirus gene: TGEV9758-9949SARS-coV-111370-11905PEDV12810-15657IBV9550-12000

[0195] In Table 8 above, bacteria containing a clone of the FR (4) fragment including the 9,550-12,920 region did not grow in liquid and solid culture media, and no plasmid was obtained.

[0196] Accordingly, it was expected that toxic genes and proteins that function in bacteria would be present in the FR (4) fragment, so the FR (4) fragment was divided into short fragments of about 1 kb to 5 kb in 1 kb units, and the primers in Table 14 were combined with each primer set in Table 15 to perform PCR amplification, and each PCR product was subjected to TA cloning.

[0197] Specifically, the above PCR product was purified and reacted according to the manufacturer's manual of RBC TA cloning kit (RBC) and Topblunt cloning kit (engenomics), and after O / N ligation at 4℃, it was transformed into RBC competent cells (ICE-20m, 42℃-1m, ICE-5m), and after spreading on an LB Agar (amp+) plate, it was cultured in a 37℃ incubator for more than 18 h to check whether colonies were formed.

[0198] Primer name sequence (5' -> 3') Sequence number 9550-FCTGCCTAAGTGGTTGGAGAGTACTACTGTCAG6310095-FGTAGTCTTTGATACTATGGTAC6410464-FGTTGCCTATTGCTACGGTTCAATC6510095-FGTAGTCTTTGATACTATGGTAC6611157-FGACGAGCAAAATTAGTCTCGTC6711648-FGTGGCAATTCAGTTGTAGCTG6812813-FGAA TAAGGATTGGTACGAC6912920-RGTTTCCGAACTCAATAGCATTC7013317-RCAAAGGAAGTCTGAGGTATCAGTG7113772-RCTTAGAAGTCACTTCTAG AC7214241-RCCAAAGATGCTGCTATACGTAAC7314607-RGATCATCAAGGAGAAATTCTTACATAAG7414890-RGTTCTGTTCTTATCCACGTCATCTAC75

[0199] (The name of each primer in Table 14 above indicates the nucleotide position within the FR (4) fragment)

[0200] Set Number Primer Name Size (kb) 19550-F5.314890-R29550-F514607-R310095-F414241-R410464-F313772-R511157-F213317-R611648-F1.212920-R79550-F3.312920-R810095-F2.812920-R910464-F2.212920-R1011157-F1.712920-R

[0201] After the above TA cloning, the generated colonies were confirmed to be cloned by colony PCR using Maxime™ PCR PreMix (i-StarTaq, Intron) and the M13 primer in Table 16 below, and the PCR results of the 10 size-specific PCR amplification products are shown in Figure 3, and the results of confirming the PCR amplification of the colonies generated after cloning by electrophoresis are shown in Figure 4.

[0202] Primer name sequence (5' -> 3') sequence number M13-FGTAAAACGACGGCCAGTG76 M13-RCACAGGAAACAGCTATGAC77

[0203] Amplification by electrophoresis confirmed that the gene within the colonies was stably amplified at positions 4, 5, 6, 9, and 10. Positions 1 and 2 occupy almost the entire area, and although colonies were formed and colony PCR was possible, subsequent bacterial growth was inhibited, making plasmid acquisition impossible.

[0204] Since the gene in the colonies was not amplified smoothly at positions 7 and 8 of the sets, but was smoothly amplified at positions 9 and 10 of the sets, it was expected that the toxic gene was included at positions 5' to approximately 9550-12920 of the entire region of the FR (4) fragment. Specifically, the amplification that occurred at positions 2, 7, and 8 of the sets formed colonies, but in the bacterial culture for plasmid purification, positions 2 and 7 did not grow at all, so the plasmid could not be purified.

[0205] In order to specify the section containing the toxic gene, PCR products were prepared using each of the primer sets in Table 17 for the above FR (4) fragment, and electrophoresis was performed by performing PCR in substantially the same manner as the above TA cloning and colony PCR, and the results are shown in Fig. 5.

[0206] Set number Primer type Size (kb) 19550-F, 12289-R2770bp 212127-F, 12920-R794bp 312813-F, 14890-R2078bp 49550-F, 10830-R1308bp

[0207] As a result of confirming electrophoresis, it was confirmed that the predicted toxic site was located at position 5'9550-12920 of the FR (4) fragment, and specifically, the 3' sequence of the frameshifting site did not affect cloning, and the region containing the toxic gene was narrowed to the 5' adjacent section centered around site 12,348-12,356.

[0208] In addition, the section penetrating the frameshifting site also generated a stable plasmid, and the 5'9550-10830 section was also successfully cloned, confirming that the remaining 10464-12348 section contains the toxic gene.

[0209]

[0210] Example 2-3. Development of a Technology for Regulating Transcription of Infectious Bronchitis Virus Virulence Genes in Bacteria

[0211] In order to confirm the presence of a bacterial promoter within the toxic gene nucleotide range 10464-12920 identified in the above Example 2-2 and to control the bacterial growth inhibition function by a corresponding genetic mutation, a potential transcription start position among the base sequences of the toxic gene region was predicted by analysis using the Prediction of bacterial promoters tool, and the results are shown in Fig. 6.

[0212] Specifically, the transcription start point was found in the region (section 10464-12348) confirmed to contain the toxic gene in the analysis results, and the transcription factor sigma factor and RNA polymerase complex bound to base sequences located at -10, -35, etc. 5' from the transcription start point and proceeded with transcription.

[0213] In the promoter-related literature (Bingham, Alistair HA, et al. "Mutations that reduce expression from the P2 promoter of the Escherichia coli galactose operon." Gene 41.1 (1986): 67-74.), when comparing the difference in expression rate due to sequence mutations around -10 and -35, the mutation at -14 suppressed the expression of one promoter, and -12 and -19 suppressed the other promoter. Therefore, in the case of overlapping promoters, the switch of two promoters on and off can be performed with just one sequence, and thus the mutation positions were selected.

[0214] Accordingly, the sixth T of the base sequence 12,345 AAGAATTAT at position -10 of the transcription start discovered in the above suspected toxicity region was replaced with C by inducing point mutations, and the T of the base sequence 12,336 ATTTTGATA at position -14 was replaced with C by inducing point mutations.

[0215] Specifically, the gene replacement was performed by performing the first PCR according to the kit manufacturer's protocol using the Muta-Direct™ Site Directed Mutagenesis Kit (Intron) and the TS-10_ada_fis_AAT-AAC and TS-14-silent_mt primers of Table 18 below for 1 μl of the FR (4) fragment plasmid of Example 2-1 to generate mutations at positions -10 and -14, respectively, and the amplified PCR product was reacted with RBC competent cells, and after ICE-20m, heatshock-1m, and ICE-5m, it was spread on an LB agar plate (Tryptone 10 g / L, Sodium chloride 10 g / L, Yeast extract 5 g / L, Microbiological tested agar 10 g / L) and cultured in a 37°C incubator for 18 h or more.

[0216] Primer name sequence (5' -> 3') sequence number TS-10_ada_fis_AAT-AAC-FGATAAGAACTATTTAAACGGGTACGGGGTAG78 TS-10_ada_fis_AAT-AAC-RCTACCCCGTACCCGTTTAAATAGTTCTTATC79 TS-14-silent_mt-FGCTGTTGGTGTAGCTGATTTCGATAAG80 TS-14-silent_mt-RCTTATCGAAATCAGCTACACCAACAGC81

[0217] The FR (4) mutant fragment plasmids (TS-10 and TS-14, respectively) in which the -10 and -14 positions were mutated each normally produced colonies, and when the colonies were inoculated into LB broth medium, they were also successfully cultured in liquid medium. The produced colonies were subjected to colony PCR using Maxime™ PCR PreMix (i-StarTaq, Intron) and the M13 primer in substantially the same manner as in Example 2-2, and the results confirmed by electrophoresis are shown in Fig. 7.

[0218] Electrophoresis confirmed that transcription of the toxic gene was suppressed. The plasmid was purified and submitted to Macrogen for base sequence analysis, confirming a point mutation at the relevant site without any other genetic mutations. Furthermore, normal bacterial culture in liquid and solid media and successful plasmid acquisition led to the production of fragment 4.

[0219]

[0220] Example 2-4. Insertion of SNU19018 spike into the BP-caKII fragment

[0221] In order to recombine the genomic genes of BP-caKII and QX-like SNU19018 of the above Example 1-2, a PCR amplification product was generated using a primer for the ligation fragment of the FR (6) fragment clone of BP-caKII of the above Example 2-1 and the SNU19018 spike, and the information on the primers used is shown in Table 19 below.

[0222] QX primer name sequence (5' -> 3') Sequence number 1 CaKII-QX-spike junction-FCTAAGGAACGGCAAGTTATTG82 2 CaKII-QX-spike-junction-RCAATAACTTGCCGTTCCTTAG83 3 CaKII-QX-SP2-junction-FCAGACCTAAAAAGTCTGTTTAATGGTTC84 4 CaKII-QX-SP2-junction-RGAACCATTAAACAGACTTTTTAGGTCTG85

[0223] Specifically, in order to replace only the spike portion of the 4438 bp size including the spike portion of the FR (6) fragment and the 3' part and the 5' part of 3a of NSP16 with the spike portion of QX-SNU19018, two fragment templates of FR (6) in Table 20 below, in which only the spike portion of the FR (6) fragment was deleted, and a spike portion template of SNU19018 were prepared, and the templates were PCR amplified using the primers of Table 19 and the FR-(6)-CPER primers of Table 10 and PrimeSTAR® GXL DNA Polymerase (TAKARA) under the following conditions: 98°C-2m, 98°C-15s, 60°C-15s, 68°C-3m, 24 cycles, and final extension 68°C-3m.

[0224] The primer information used for each of the above templates is shown in Table 21 below, and the FR (6) fragment schematic diagram is shown in Fig. 8.

[0225]

[0226] QX template primer size (bp)AFR (6)FR (6)-CPER-F459CaKII-QX-spike-junction-RBSNU19018CaKII-QX-spike junction-F3532CaKII-QX-SP2-junction-RCFR (6)CaKII-QX-SP2-junction-F496FR (6)-CPER-R

[0227] The above amplified PCR products were mixed at a concentration of 0.1 pmol each (A: 30 ng, B: 218 ng, C: 30 ng), and then SOE-PCR was performed using the PrimeSTAR® GXL DNA Polymerase (TAKARA) kit and the FR-(6)-CPER primer in Table 10 under the conditions of 98-1m, 98-15s, 55-15s, 68-30s, 24 cycles, and final extension 68-30s, and then linked (FR (6) - QX).

[0228] The above SOE-PCR product, recombinant FR (6) - QX, was reacted according to the manufacturer's manual of the Topblunt cloning kit (engenomics), ligated O / N at 4°C, transformed into RBC competent cells (ICE-20m, 42°C-1m, ICE-5m), spread on an LB Agar (amp+) plate, and cultured in a 37°C incubator for more than 18 h.

[0229] Colonies generated through the above culture were subjected to colony PCR using Maxime™ PCR PreMix (i-StarTaq, Intron) and M13 primers in substantially the same manner as in Example 2-2, and after confirming the plasmid into which FR (6) - QX was inserted by electrophoresis, the plasmid was purified and the base sequence was analyzed. As a result, it was confirmed that the FR (6) into which SNU19018 was recombined matched the expected sequence without mutation, and the base sequence analysis results are shown in Fig. 9.

[0230] As a result of the above analysis, the spike was successfully replaced with a heterotype spike gene, and no missense mutations were found in the base sequence analysis, all were consistent, and silent mutations did not cause amino acid changes, so the process was carried out as is.

[0231]

[0232] Example 2-5. Establishment of reverse genetics for recombinant virus production

[0233] Using the SOE-PCR product of Example 2-4, the genomic genes of BP-caKII and QX-like SNU19018 of Example 1-2 were recombined, and a reverse genetics system of the circular polymerase extension reaction (CPER) method was used.

[0234] Specifically, the plasmids into which the FR (1), FR (2), FR (3), FR (5-1), FR (5-2), FR (7) and HDV-CMV fragments obtained in Example 2-1 were inserted, the mutant plasmid in which a mutation was made at the -14 site in the FR (4) fragment plasmid of Example 2-3, and the SOE-PCR product of Example 2-4 were prepared in substantially the same manner as in Example 2-1 using the FR-(6)-CPER primer of Table 10, and the FR (6) fragment plasmid into which the SNU19018 spike was introduced, a total of 9 fragments, were used as templates, and PCR for each fragment was performed using the PrimeSTAR® GXL DNA Polymerase (TAKARA) kit and the primers of Table 10, with the following sequences: 98-1m, 98-15s, 55-15s, 68-30s, 24 cycles, final extension. It was performed under 68-30s conditions.

[0235] The above amplification products were purified, and the purified PCR amplification products were placed in a tube at the same concentration of 0.1 pmol, and the first SOE-PCR was performed using PrimeSTAR® GXL DNA Polymerase (TAKARA) without primers under the conditions of 98-2m, 98-15s, 60-30s, 68-28m, 20 cycles, and final extension 68-28m.

[0236] Afterwards, the final PCR was performed using 5 μl of the above SOE-PCR amplification product as a template without purification using PrimeSTAR® GXL DNA Polymerase (TAKARA) under the conditions of 98-2m, 98-15s, 60-30s, 68-28m, 20 cycles, and final extension 68-28m using the FR-(1)-CPER-F primer of Table 10 and the Linker-5'-end-Gap-CMV-R primer of Table 12, and transfection was performed.

[0237] The above transfection was performed by mixing 70 μl of opti-MEM (Opti-MEM™ I Reduced Serum Medium, GlutaMAX™ Supplement) and 5 μl of Plus reagent according to the manufacturer's manual with Lipofectamine™ 2000 Transfection Reagent, 25 μl of the final PCR amplification product, and reacting at room temperature for 15 minutes. Afterwards, 5 μl of Lipofectamine and 95 μl of opti-MEM were mixed, mixed again with the previously reacted PCR amplification product, and reacting at room temperature for 15 minutes.

[0238] After the above reaction, Chicken fibroblast cells (DF-1, ATCC CRL-12203, UMNSAH / DF-1(Gallus gallus)) were seeded at 2x10 6A 6-well cell culture plate formed into a monolayer was washed twice with opti-MEM, and the reaction solution mixed with the PCR amplification product was dispensed and cultured in a CO2 incubator at 37°C for 1 day.

[0239] Using a cell scraper, cells and supernatant were obtained together, and 200-300 μl were inoculated into three 10-day-old SPF embryonated eggs. Allantoic fluid was collected from the inoculated eggs after 72 hours of culture, RNA was extracted from 100 μl, and 1 μl of each RNA sample was subjected to RT-PCR in substantially the same manner as in Example 1-1 to detect the virus, and the results are shown in Fig. 10. To confirm whether the virus was detected, PCR was also performed on the marker DNA (M), IBV RNA (pos), and RNA (neg) of inoculated eggs that were not inoculated with the cells to confirm the DNA size. As a result of virus detection, IBV was detected in all samples.

[0240] The recombinant virus produced through the above process was named rQX_Chi, and the sequence information of the genes encoding the 1a protein, 1ab protein, spike protein, 3a protein, 3b protein, E protein, M protein, 4b protein, 4c protein, 5a protein, 5b protein, N protein, and 6b protein contained in rQX_Chi and the full-length gene sequence information of the recombinant virus are shown in Table 22 below.

[0241] Protein type Sequence type Sequence number 1a Protein amino acid sequence 1 Gene sequence encoding protein 15 1ab Protein amino acid sequence 2 Gene sequence encoding protein 16 Spike protein amino acid sequence 3 Gene sequence encoding protein 17 3a Protein amino acid sequence 4 Gene sequence encoding protein 18 3b Protein amino acid sequence 5 Gene sequence encoding protein 19 E Protein amino acid sequence 6 Gene sequence encoding protein 20 M Protein amino acid sequence 7 Gene sequence encoding protein 21 4b Protein amino acid sequence 8 Gene sequence encoding protein 22 4c Protein amino acid sequence 9 Gene sequence encoding protein 23 5a Protein amino acid sequence 10 Gene sequence encoding protein 24 5b Protein amino acid sequence 11 Gene sequence encoding protein 25 N Protein amino acid sequence 12 Gene sequence encoding protein 26 6b Protein amino acid sequence 13 Gene sequence encoding protein 27 Full-length gene of the constructed recombinant virus 14

[0242] The above-mentioned recombinant virus was deposited at the National Institute of Biological Resources on May 15, 2023, and received the accession number KCTC 15444BP.

[0243]

[0244] Example 2-6. Inducing additional mutations for viral cell infection

[0245] Certain viruses require additional adaptation processes, such as repeated passage, to infect cells, and additional mutations were induced for cell infection when performing a neutralization test with the immune serum of the recombinant virus produced in Example 2-5.

[0246] In a research paper on the spike tissue tropism of IBV (Bouwman, Kim M., et al. "Three amino acid changes in avian coronavirus spike protein allow binding to kidney tissue." Journal of Virology 94.2 (2020): e01363-19.), it was suggested that three consecutive amino acids 117-119 of the spike amino acid gene and three consecutive amino acids 125-127 are related to kidney infection. Based on this, the A130P point mutation of the FR (6) fragment plasmid into which SNU19018 of Example 2-4 was recombined was induced for infection of chick embryonic kidney cells by the recombinant virus constructed in Example 2-5.

[0247] Specifically, point mutations were induced at the 388th position from the 5' end of the FR (6) fragment sequence containing the spike by performing PCR using the Muta-Direct™ Site Directed Mutagenesis Kit (Intron) and the primers in Table 23 below, and the amplified PCR product was reacted with RBC competent cells, and after ICE-20m, heatshock-1m, and ICE-5m, it was spread on an LB agar plate (Tryptone 10 g / L, Sodium chloride 10 g / L, Yeast extract 5 g / L, Microbiological tested agar 10 g / L) and cultured in a 37°C incubator for 18 hours.

[0248] Primer sequence (5' -> 3') Sequence number QX-LIA / LIP-muta-FGTCCTATAACAGGCCTGATTCCACGTGATCATATTC89 QX-LIA / LIP-muta-RGAATATGATCACGTGGAATCAGGCCTGTTATAGGAC90

[0249] As a result of analyzing the base sequence of the above-mentioned cultured purified plasmid, it was confirmed that the base sequence at the 388th nucleotide position of the target was mutated from G to C. The FR (6) fragment plasmid in which the mutation was induced was used instead of the FR (6) fragment plasmid in which the mutation was not induced in Example 2-5, and a recombinant virus was produced (rQX_Chi:A130P) in substantially the same manner as in Example 2-5.

[0250] In addition, to confirm whether the above-mentioned recombinant virus was adapted for cell infection by mutation, an adaptation test of the rQX-Chi:A130P virus to chicken embryo kidney cells (CEK cells) was performed.

[0251] Specifically, kidney tissues extracted from 19-20 day old SPF embryonated eggs were washed in PBS, and then finely cut into pieces with scissors. PBS was added to the cut tissues to suspend them, and then they were allowed to settle, and red blood cells were removed along with the supernatant. PBS containing 0.25 (v / v)% trypsin was added and digested at 37°C for 20 minutes.

[0252] After digestion, the digested kidney tissue was placed in a 50 ml tube containing 5 ml of fetal bovine serum (FBS, Gibco) to neutralize the internal trypsin, and 35 ml of Dulbecco's Modified Eagle Medium (DMEM, Gibco) containing a complex antibiotic-antimycotic (Gibco) was added, followed by centrifugation at 1000 rpm for 8 minutes.

[0253] After centrifugation, the supernatant was discarded, and the cell pellet of the embryonic kidney cells was dissolved. The kidney cell suspension was added to 5 ml of DMEM medium containing 2% FBS and seeded to form a monolayer in a 25T cell flask.

[0254] The culture medium of cells on which a monolayer was formed was removed and washed once with PBS. Then, 300 μl of rQX_Chi:A130P was diluted by adding 3 ml of DMEM medium containing the above-mentioned complex antibiotics. The culture medium of the cells was removed and washed once with PBS. The mixture was inoculated into a 25T flask containing kidney cells, and the reaction was carried out for 1 hour. The inoculation medium was removed and washed twice with PBS. After adding 5 ml of DMEM containing 2% FBS and complex antibiotics, the mixture was cultured in a 37°C Co2 incubator.

[0255] The above 25T flask was inoculated with the virus, and after 72 hours, freezing and thawing were repeated three times at 30-minute intervals to obtain a culture (1st passage culture), and after centrifugation at 3000 rpm for 5 minutes, the supernatant was collected, and the culture was re-inoculated in DMEM medium in substantially the same manner as above, and the passage process was performed.

[0256] RNA was extracted from 100 μl of the culture solution that had gone through the passage process above, and RT-PCR was performed in substantially the same manner as in Example 2-5 to detect the virus. Blind passage of the virus was repeated until cytopathic effect (CPE) was observed, and the results are shown in Fig. 11. As a negative control, CEK was prepared without inoculating the virus. As a result of confirming the CPE observation result, CPE was observed after passage of rQX_Chi:A130P three times (rQX-Chi:A130P-C3).

[0257]

[0258] Example 3. Confirmation of the actual proliferation capacity and content of the produced recombinant virus.

[0259] Example 3-1. Preparation and interpretation of viral growth curves of engineered recombinant viruses.

[0260] In order to create a virus proliferation curve to confirm the actual proliferation ability of the recombinant virus produced in the above Example 2-5, rQX_Chi (rQX-1) produced in the above Example 2-5, BP-caKII of the above Example 1-2, K40 / 09 infectious bronchitis virus isolated from K40 / 09 live vaccine strain of Daesung Microbiological Research Institute (Company D), and SNU19018 of the above Example 1-1 were each diluted 1 / 1000 and inoculated into 21 10-day-old SPF embryonated chicken eggs, and chilled three at a time point of 0, 12, 24, 48, 72, 96, or 120 hours, and then the allantoic fluid was collected and centrifuged at 3000 rpm.

[0261] RNA was extracted from the supernatant of the centrifuged allantoic fluid, and qRT-PCR was performed using the primers in Table 1 and EzAmp™ qPCR Master Mix (SYBR Green) under the conditions of 50°C-10 m, 98°C-5 m, 98°C-20 s, and 68°C-30 s to create a virus proliferation curve, and the created curve is shown in Fig. 12.

[0262] During the rescue process of the virus generated through reverse genetics, the proliferation curve was measured to determine whether the virus replicated. As a result, it was confirmed that normal virus replication occurred with a proliferation rate similar to that of the parent virus, BP-caKII, after 48 hours.

[0263]

[0264] Example 3-2. Measurement of the titer of the produced recombinant virus 1

[0265] To measure the titer of the recombinant virus produced in Example 2, 10-day-old SPF chick embryos were injected with 10 doses of rQX_Chi of Example 2-5 and rQX_Chi:A130P of Example 2-6. -1 ~10 -7After diluting, 100 μl was inoculated into 4 embryonated chicken eggs according to the dilution ratio, cultured for 48 h, chilled, and the allantoic fluid was collected and centrifuged at 3000 rpm. As a comparative example, SNU19018 of Example 1-1 and BP-CaKII of Example 1-2 were inoculated in the same manner and then centrifuged.

[0266] RNA was extracted from the supernatant of each centrifuged membrane fluid, and RT-PCR was performed in substantially the same manner as in Example 1-1. Then, the virus titer was determined by detecting a DNA band by electrophoresis, and the degree of dilution (10 -5 10 inland -7 ) was measured according to the Karber calculation method, and the results are shown in Table 24 below.

[0267] 10 -5 10 -6 10 -7 Titer (EID 50 / ml)rQX_Chi4 / 43 / 31 / 47.75rQX_Chi:A130P4 / 44 / 41 / 47.75BP-CaKII4 / 44 / 41 / 47.75SNU190184 / 44 / 40 / 47.5

[0268] As a result of measuring the titer of the virus, it was confirmed that it showed a titer similar to that of the parent virus, BP-caKII, confirming that reverse genetics technology for cold-adapted IBV caKII had been established.

[0269]

[0270] Example 3-3. Titer measurement of the produced recombinant virus 2

[0271] In order to measure the virus titer of rQX-Chi:A130P-C3 of Example 2-6, the chick embryonic kidney cells (CEK cells) of Example 2-6 were seeded to form a monolayer in a 96-well cell culture plate, and 180 μl of DMEM medium containing the complex antibiotics of Example 2-6 was dispensed into each 96-well U-plate, and 20 μl of the rQX-Chi:A130P-C3 was added to the first well and diluted decimal.

[0272] The CEK cells were washed once with 120 μl of PBS, and then 100 μl of the diluted virus was dispensed onto the washed CEK cells. After culturing at 37°C for 5 days, the wells showing cytopathic effects were counted and the titer was measured according to the Karber calculation method.

[0273] As a result of measuring the potency, 5.25 TCID 50 The titer of / ml was measured and it was confirmed that it was lower than the titer confirmed in Example 3-2 above, and it was confirmed that it showed a lower titer than that in the fetus, which corresponds to a sufficient virus content as a kidney cell-adapted virus for immune serum verification.

[0274]

[0275] Example 4. Evaluation of vaccine efficacy of recombinant infectious bronchitis virus.

[0276] Example 4-1. Evaluation of the safety and latent infection rate in tissues of recombinant infectious bronchitis virus.

[0277] The rQX_Chi produced in Example 2-5 and the commercial vaccines of Comipharm Co., Ltd. (Company C) and Daesung Microbiological Research Institute Co., Ltd. (Company D) against two commercially available infectious bronchitis virus K40 / 09 types from other companies were each administered to 25 1-week-old SPF test cells at a dose of 1.0x10 5 / 100μl was inoculated intraocularly and the mortality rate of each group was checked every week. In addition, 5 animals were sacrificed every week, and the trachea (T), lungs (L), cecal tonsils (CT), and kidneys (K) were removed and milked to prepare a 10% suspension. RNA was extracted from 100μl of the supernatant by centrifugation at 1,000xg for 3 minutes, and RT-PCR was performed in substantially the same manner as in Example 1-1 to detect IBV, and the results are shown in Table 25 below. A group inoculated with PBS at the same concentration was prepared as a negative control group. The experiment was conducted for a total of 4 weeks.

[0278] GroupTLCTK1234123412341234PBS0 / 50 / 50 / 50 / 50 / 50 / 50 / 50 / 50 / 50 / 50 / 50 / 50 / 50 / 50 / 50 / 50 / 50 / 50 / 50 / 50 / 50 / 50 / 50 / 50 / 50 / 50 / 5D사5 / 55 / 50 / 40 / 45 / 52 / 51 / 40 / 45 / 53 / 53 / 44 / 45 / 52 / 50 / 40 / 4C사3 / 54 / 53 / 53 / 51 / 53 / 53 / 50 / 50 / 51 / 54 / 55 / 51 / 51 / 42 / 50 / 5rQX_Chi (Red)4 / 51 / 50 / 50 / 51 / 51 / 50 ...

[0279] When the latent infection rate in the tissues was evaluated by performing RT-PCR, the virus was detected in all vaccinated groups in the organs at week 1, and the virus was still detected in the commercial vaccine group except for rQX_Chi at weeks 2-3. The virus was detected in the cecal tonsils until week 4 in all except rQX_Chi, and the virus was not detected at all in the kidneys in the commercial vaccine group until weeks 2-3.

[0280] In addition, as a result of checking the mortality rate of each group after the above vaccination, the mortality rate was 12% (Company C) and 25% (Company D) when the commercial vaccine was administered up to the 2nd week, but the mortality rate was 0% when the rQX_Chi vaccine was administered, confirming 100% survival and asymptomatic status, confirming the safety of vaccination, and confirming that the pathogenicity was very low, confirming that both the tissue tropism and latent infection rate of rQX_Chi have excellent effects as a vaccine strain.

[0281]

[0282] Example 4-2. rQX_Chi pathogenicity evaluation

[0283] In order to evaluate the latent infection rate in Example 4-1, the trachea (Tra) and kidney tissues (Kid) collected 1 and 2 weeks after vaccination with the rQX_Chi vaccine were fixed with 10% formalin and tissue slides were prepared to examine the histopathology. As a control group, the trachea and kidney tissues of cadavers collected 1 week after vaccination with the K40 / 09 live-attenuated vaccine strain of Example 4-1 were examined for histopathology, and the results of the examination for the organs are shown in Fig. 13, and the results of the examination for the kidneys are shown in Fig. 14.

[0284] As a result of examining the above tissue pathology, normal ciliated cells no different from normal mucosal cells were observed in the tracheal tissues 1 and 2 weeks after rQX_Chi inoculation, but degeneration, shedding, desquamation, and necrosis of ciliated epithelial cells of the trachea were observed in the corpses inoculated with K40 / 09, and infiltration of inflammatory cells was confirmed.

[0285] In addition, no specific histopathological differences were observed in the kidney tissues 1 and 2 weeks after rQX_Chi vaccination, but lymphoplasmacytic interstitial nephritis was confirmed in the K40 / 09 vaccination carcasses.

[0286]

[0287] Example 4-3. Evaluation of vaccine efficacy of rQX_Chi 1

[0288] For the serum neutralization test to confirm the vaccine efficacy, CEK cells were seeded to form a monolayer in a 96-well cell culture plate using substantially the same method as in Example 3-3 above, and cultured for 3 days.

[0289] In substantially the same manner as in Example 4-1, 25 SPF test cells were inoculated with rQX_Chi and a commercial vaccine against infectious bronchitis virus K40 / 09 produced in Example 2-5, and blood was collected from 5 cells every week until the 4th week and from 10 cells in the 3rd week, and serum was separated and inactivated at 56°C for 30 minutes.

[0290] In a 96-well U-plate, 180 μl of the DMEM medium of Example 2-6 was added to the first well, and 100 μl to each of the remaining wells, excluding the first well. Then, 20 μl of the separated serum was added to each of the first wells to perform a 1 / 10 dilution. Then, 100 μl was extracted from the 1 / 10 diluted well and transferred to the well immediately adjacent to it containing only 100 μl of DMEM medium to perform a binary dilution.

[0291] The above binary dilution was performed a total of 7 times, and each of the 1,280-fold diluted immune serum and 200 TCID of the rQX-Chi:A130P-C3 virus of Example 2-6 were finally diluted. 50 / 0.1ml was mixed 1:1 with 100 μl each and neutralized at 37°C for 1 hour.

[0292] After the neutralization, the cultured CEK cells were washed twice with sterile PBS, and then 100 μl of the virus reacted with the immune serum was inoculated onto the washed CEK. The cytopathic effect was observed 5 days after the inoculation, and the final neutralizing antibody titer that did not show the cytopathic effect was calculated, and the results are shown in Fig. 15 and Table 26 below. As a control group, PBS was added instead of the serum and the titer was measured. Specifically, the experiment was performed in triplicate for each serum, and the titer was calculated as the average value of three wells.

[0293] 1w2w3w4wPBS10101010C101049.5189.7D101034.859.5rQX_Chi1010197.1274.5

[0294] As a result of calculating the final neutralization index, the neutralizing antibody titer of rQX-Chi showed a higher neutralizing ability than that of the commercial vaccine.

[0295]

[0296] Example 4-4. Evaluation of the vaccine efficacy of rQX_Chi 2

[0297] Additionally, in order to perform a neutralization test using SPF embryonated eggs, each of the immune sera prepared by inoculating each vaccine of Example 4-1 in Example 4-3 and the SNU19018 virus for neutralization test diluted 10-fold were mixed in equal amounts and neutralized at 37°C for 1 hour.

[0298] Specifically, 300 μl of SNU19018 was added to 2700 μl of PBS in the above 15 ml tube to perform a decimal dilution, and 2 ml of the diluted SNU19018 virus was added to each new tube, and 2 ml of the prepared immune serum was mixed in equal amounts and neutralized at 37°C for 1 hour. In addition, the immune serum (PBS; Neg) of the group that was not vaccinated was neutralized in the same manner.

[0299] According to the above-mentioned neutralization virus content test method, 200 μl each of the neutralized serum and virus mixtures for each type of serum and 100 μl of SNU19018 diluted virus were inoculated into 4 embryonated chicken embryo eggs of 10-day-old SPF chicken embryos, cultured for 48 h, chilled, and then the allantoic fluid was collected and centrifuged at 3000 rpm. RNA was extracted from the allantoic fluid and RT-PCR was performed in substantially the same manner as in Example 1-1, and the titer was measured by the Karber calculation method based on the detection of DNA bands by electrophoresis, and the results are shown in Fig. 16 and Table 27 below.

[0300] Group name Dilution level Log (EID50 / ml)-NI (Neutralization index) 10 -1 10 -2 10 -3 10 -4 10 -5 10 -6 10 -7 10 -8 SNU19018----4 / 42 / 41 / 40 / 47.25Neg---4 / 44 / 43 / 40 / 4-6.25C4 / 44 / 44 / 43 / 4----5.25D4 / 44 / 44 / 44 / 4----5.5rQX_Chi4 / 44 / 42 / 4-----4.0

[0301] To prove that the animals used are not contaminated with the virus, the neutralization index (Neg) of the non-vaccinated control serum must be 1.0 or less for the virus titer (SNU19018), and the neutralization index of the serum of the test group (rQX_Chi) must be 2.0 or more for the non-vaccinated control serum (Neg) to confirm the vaccine's efficacy.

[0302] As a result of measuring the neutralization index, it was confirmed that the neutralization index of the control serum satisfied the above criteria for the virus titer, and the rQX_Chi vaccinated group showed a high neutralization index of 2.5 or more for the Neg serum, confirming that rQX_Chi, the cold-adapted attenuated infectious bronchitis virus established in Example 2, has a remarkable virus neutralization ability and excellent vaccine efficacy.

[0303]

[0304] [Accession number]

[0305] Name of depositor: National Institute of Biological Resources

[0306] Accession number: KCTC15444BP

[0307] Date of acceptance: 20230515

[0308]

[0309]

[0310]

Claims

1. An infectious bronchitis chimeric virus comprising a foreign spike protein comprising the amino acid sequence of sequence number 3 or a gene encoding the spike protein.

2. Infectious bronchitis chimeric virus, wherein the foreign spike protein or the gene encoding the spike protein is inserted into the spike protein region of the infectious bronchitis virus.

3. In the second paragraph, the infectious bronchitis chimeric virus has the deposit number KCTC13221BP.

4. Infectious bronchitis chimeric virus according to claim 1, wherein the 12,336th nucleic acid sequence from the 5' end of the full-length gene of the infectious bronchitis chimeric virus is C.

5. An infectious bronchitis chimeric virus according to claim 1, further comprising at least one gene selected from the group consisting of a gene encoding a 1a protein, a gene encoding a 1ab protein, a gene encoding a 3a protein, a gene encoding a 3b protein, a gene encoding an E protein, a gene encoding an M protein, a gene encoding a 4b protein, a gene encoding a 4c protein, a gene encoding a 5a protein, a gene encoding a 5b protein, a gene encoding an N protein, and a gene encoding a 6b protein.

6. In paragraph 5, The above 1a protein comprises an amino acid sequence of sequence number 1; The above 1ab protein comprises an amino acid sequence of sequence number 2; The above 3a protein comprises an amino acid sequence of sequence number 4; The above 3b protein comprises an amino acid sequence of sequence number 5; The above E protein comprises an amino acid sequence of SEQ ID NO: 6; The above M protein comprises an amino acid sequence of SEQ ID NO: 7; The above 4b protein comprises an amino acid sequence of SEQ ID NO: 8; The above 4c protein comprises an amino acid sequence of sequence number 9; The above 5a protein comprises an amino acid sequence of SEQ ID NO: 10; The above 5b protein comprises an amino acid sequence of SEQ ID NO: 11; The above N protein comprises an amino acid sequence of SEQ ID NO: 12; and The above 6b protein is an infectious bronchitis chimeric virus comprising the amino acid sequence of sequence number 13.

7. In paragraph 5 The gene encoding the above 1a protein comprises a nucleic acid sequence of SEQ ID NO: 15; The gene encoding the above 1ab protein comprises a nucleic acid sequence of SEQ ID NO: 16; The gene encoding the above 3a protein comprises a nucleic acid sequence of SEQ ID NO: 18; The gene encoding the above 3b protein comprises a nucleic acid sequence of SEQ ID NO: 19; The gene encoding the above E protein comprises a nucleic acid sequence of SEQ ID NO: 20; The gene encoding the above M protein comprises a nucleic acid sequence of SEQ ID NO: 21; The gene encoding the above 4b protein comprises a nucleic acid sequence of SEQ ID NO: 22; The gene encoding the above 4c protein comprises a nucleic acid sequence of SEQ ID NO: 23; The gene encoding the above 5a protein comprises a nucleic acid sequence of SEQ ID NO: 24; The gene encoding the above 5b protein comprises a nucleic acid sequence of SEQ ID NO: 25; The gene encoding the above N protein comprises a nucleic acid sequence of SEQ ID NO: 26; and An infectious bronchitis chimeric virus, wherein the gene encoding the above 6b protein comprises a nucleic acid sequence of SEQ ID NO:

27.

8. In the 7th paragraph, the infectious bronchitis chimeric virus comprises a nucleic acid sequence of sequence number 14.

9. In the first paragraph, the infectious bronchitis chimeric virus has the deposit number KCTC15444BP.

10. A vaccine composition against infectious bronchitis virus, comprising the infectious bronchitis chimeric virus of any one of claims 1 to 9.

11. A vaccine composition for infectious bronchitis virus in claim 10, wherein the vaccine composition is a live vaccine, an inactivated vaccine, a subunit vaccine, a vector vaccine, a chimeric vaccine, a DNA vaccine, or a cell vaccine.

12. A vaccine composition for infectious bronchitis virus, wherein the vaccine composition further comprises at least one selected from the group consisting of an antigen adjuvant, an efficacy enhancer, a preservative, a buffer, a surfactant, a carrier, an osmotic agent, an antioxidant, and a stabilizer.

13. A vaccine composition for infectious bronchitis virus, which is administered by at least one route selected from the group consisting of in ovo, intranasal, intratracheal, oral, intradermal, intramuscular, intraperitoneal, intravenous, and subconjunctival.

14. A method for producing a plasmid for producing an infectious clone of an infectious bronchitis virus, comprising a step of inducing a mutation in at least one base selected from the group consisting of the 12,345th base and the 12,336th base from the 5' end of the infectious bronchitis virus full-length gene.

15. A method for producing a plasmid in claim 14, wherein the base mutation is substituted with C.

16. A method for immunization, comprising administering to a subject in need of immunization against infectious bronchitis virus a vaccine composition comprising an infectious bronchitis chimeric virus of any one of claims 1 to 9.

17. A method for immunization according to claim 16, wherein the individual requiring immunization against the infectious bronchitis virus is a chicken, duck, goose, turkey, quail, pheasant, parrot, finch, hawk, crow, ostrich, emu, and cassowary.

Images