Composition for preventing or treating macular degeneration comprising pyruvate dehydrogenase kinase inhibitor

Abstract

The present invention relates to a composition for alleviating, inhibiting, treating or preventing macular degeneration. The composition according to the present invention has excellent effects of reducing angiogenesis due to macular degeneration and inhibiting vascular leakage, and thus can be used as a therapeutic agent for alleviating or treating macular degeneration, particularly age-related macular degeneration (AMD).

Description

Composition for preventing or treating macular degeneration comprising a pyruvate dehydrogenase kinase inhibitor

[0001] The present invention was made under the support of the Ministry of Science and ICT (MSIT) under the research project number RS-2024-00334982, the research management organization of the project is the National Research Foundation of Korea, the research project name is "Individual Basic Research", the research project title is "Study on a novel treatment mechanism for retinal degeneration through control of metabolic decoupling between retinal epithelial cells and photoreceptor cells", the main organization is Kyungpook National University Industry-Academic Cooperation Foundation, and the research period is from 2024.05.01 to 2029.04.30.

[0002] In addition, the present invention was made under the support of the Ministry of Science and ICT under the research number 2019R1A2C1084371, the research management specialized institution of the said project is the National Research Foundation of Korea, the research project name is "Individual Basic Research", the research project name is "Study on a novel treatment mechanism for neovascular age-related macular degeneration through mitochondrial energy metabolism reprogramming of immune cells and control of inflammatory activation", the main institution is Kyungpook National University, and the research period is from September 1, 2019 to February 29, 2024.

[0003] In addition, the present invention was made under the support of the Ministry of Science and ICT under the project number 2020-0-01808-002, and the research management specialized organization of the project is the Information and Communications Technology Planning and Evaluation Institute, the research project name is "Training of Information and Communications Broadcasting Innovation Talents", the research project name is "Research on Innovative Technology of Predictive Intelligence Based on Complex Information", the main organization is Kyungpook National University Industry-Academic Cooperation Foundation, and the research period is from January 1, 2024 to December 31, 2024.

[0004] In addition, the present invention was made with the support of the Ministry of Science and ICT, the Ministry of Health and Welfare, and the Ministry of Trade, Industry and Energy under the research number HN21C0923000021, and the research management specialized organization of the said project is the National Drug Development Foundation, the research project name is "New Drug Base Expansion Research", the research project name is "Discovery of Effective / Lead Substances for Oral Treatment of Age-Related Macular Degeneration", the main organization is Kyungpook National University, and the research period is from 2021.11.01 to 2024.10.31.

[0005] In addition, the present invention was made under the support of the Ministry of Health and Welfare under the project number HR22C1832010023, the research management specialized organization of the project is the Korea Health Industry Development Institute, the research project name is "Research-oriented hospital development R&D", the research project name is "Establishment of the world's first medical technology commercialization platform based on K-Leading Tech to secure global competitiveness", the main organization is Kyungpook National University Hospital, and the research period is from January 1, 2024 to December 31, 2024.

[0006] This patent application claims priority to Republic of Korea Patent Application No. 10-2023-0085045, filed with the Korean Intellectual Property Office on June 30, 2023, the disclosure of which is incorporated herein by reference.

[0007] The present invention relates to a composition for preventing or treating macular degeneration comprising a pyruvate dehydrogenase kinase inhibitor, and more particularly, the present invention relates to a composition for preventing or treating macular degeneration comprising a pyruvate dehydrogenase kinase (PDK) inhibitor.

[0008] Macular degeneration (AMD) is an eye disease characterized by degeneration of the macula, leading to vision impairment. Its causes are known to be related to age, family history, race, and smoking. Early onset of the disease causes blurred vision and distorted near vision, eventually leading to blindness.

[0009] Age-related macular degeneration (AMD) causes severe, irreversible vision loss and is a leading cause of blindness in people over 50 years of age. Epidemiological studies have reported a prevalence of 1.2% in the US population aged 52-64, with a higher prevalence of 20-37% in those aged 75 years and older, suggesting that the prevalence is expected to increase with increasing average age.

[0010] There are two types of age-related macular degeneration. The first is non-neovascular age-related macular degeneration, the most common, accounting for 85% of all cases. This dry form is characterized by oily deposits and atrophic changes in the retinal pigment epithelium. The second type, neovascular age-related macular degeneration, is characterized by choroidal neovascularization. Choroidal neovascularization is a newly formed blood vessel that tends to leak blood and fluid. This leads to the formation of lesions in the retina, which cause fibrous tissue to proliferate and photoreceptor loss, and this progressively leads to severe and irreversible vision loss.

[0011] In particular, according to a basic epidemiological survey on age-related macular degeneration in Korea published in 2010, the prevalence of age-related macular degeneration was 2.92% for early degeneration and 0.19% for late degeneration, but among late macular degeneration, non-neovascular macular degeneration accounted for 3.9%, and the rest were all observed as neovascular, indicating that the frequency of neovascular macular degeneration is much higher than in foreign countries.

[0012] Treatment options for neovascular age-related macular degeneration include photodynamic therapy (PDT) and intraocular injections of drugs that block vascular endothelial growth factor (VEGF). However, several large-scale, multicenter clinical trials have shown that intravitreal anti-vascular endothelial growth factor (anti-VEGF) injections yield superior outcomes compared to PDT.

[0013] Accordingly, various anti-vascular endothelial growth factor drugs have been developed for the treatment of neovascular age-related macular degeneration, and the representative drug among them is ranibizumab (Lucentis®), which binds to extracellular vascular endothelial growth factor and inhibits its activity. Ranibizumab has been reported to be an effective and safe treatment for patients with neovascular age-related macular degeneration through various clinical studies, and is widely used worldwide. However, as lesions frequently recur, the number of injections increases, placing a significant burden on patients. In some patients, lesions do not improve despite injections.

[0014] Meanwhile, vascular endothelial growth factor (VEGF) acts as a potent vasodilator, helping to relax the coronary arteries of the heart and maintain blood flow. Because patients with age-related macular degeneration are elderly and at high risk for cardiovascular disease, anti-VEGF injections carry the risk of serious side effects.

[0015] Accordingly, the present invention proposes a novel therapeutic composition that reduces the risk of side effects and provides an effective therapeutic effect for macular degeneration.

[0016] The present inventors have diligently researched and developed a treatment for macular degeneration with a reduced risk of side effects. As a result, the inventors have completed the present invention by confirming that a pyruvate dehydrogenase kinase (PDK) inhibitor reduces neovascularization and suppresses vascular leakage associated with macular degeneration.

[0017] Accordingly, the purpose of the present invention is to provide a pharmaceutical composition for preventing or treating macular degeneration.

[0018] Another object of the present invention is to provide a food composition for preventing or improving macular degeneration.

[0019] Another object of the present invention is to provide a pharmaceutical composition for preventing or treating neovascular ocular disease.

[0020] Another object of the present invention is to provide a food composition for preventing or improving neovascular eye disease.

[0021] Another object of the present invention is to provide a method for treating macular degeneration.

[0022] Another object of the present invention is to provide a method for treating neovascular eye disease.

[0023] Another object of the present invention is to provide novel uses of PDK inhibitors.

[0024] The present invention relates to a composition for preventing or treating macular degeneration comprising a pyruvate dehydrogenase kinase (PDK) inhibitor, and the composition according to the present invention can effectively treat and prevent macular degeneration and neovascular eye diseases while minimizing the risk of side effects by reducing neovascularization caused by macular degeneration and inhibiting vascular leakage.

[0025] Hereinafter, the present invention will be described in more detail.

[0026]

[0027] One aspect of the present invention is a pharmaceutical composition for alleviating, inhibiting, preventing or treating macular degeneration, comprising a pyruvate dehydrogenase kinase (PDK) inhibitor.

[0028] The term "pyruvate dehydrogenase kinase" in this specification, also called PDK, refers to a protein that inhibits the activity of pyruvate dehydrogenase by phosphorylating pyruvate dehydrogenase.

[0029] The term "pyruvate dehydrogenase kinase inhibitor" in this specification refers to a substance that inhibits the expression or activity of PDK, and may include any substance that inhibits expression by reducing the expression of PDK at the transcriptional level or promoting post-translational degradation into a protein by directly acting on a PDK gene or protein or indirectly acting on its ligand, or any substance that reduces the activity of PDK by interfering with its activity.

[0030] A pyruvate dehydrogenase kinase inhibitor may be a compound, nucleic acid, peptide, virus, or vector containing a nucleic acid that targets PDK and inhibits the expression or activity of PDK. Examples of pyruvate dehydrogenase kinase inhibitors include, but are not limited to, oligonucleotides that inhibit the expression of PDK mRNA, antibodies, aptamers, or compounds that inhibit the activity of PDK protein, and the like.

[0031] The term "oligonucleotide" as used herein means DNA or RNA, or a derivative thereof, containing a nucleic acid sequence complementary to the sequence of a specific mRNA, which binds to the complementary sequence in the mRNA and acts to inhibit the translation of the mRNA into protein.

[0032] The PDK inhibitor according to the present invention may be an oligonucleotide, and the PDK inhibitor may be DNA or RNA having a sequence complementary to PDK mRNA, or a derivative thereof, which may bind to mRNA and interfere with translation, translocation into the cytoplasm, maturation, etc. of the mRNA, or may inhibit any other biological function or activity of the mRNA.

[0033] The term "aptamer" as used herein refers to a single-stranded oligonucleotide, which is a nucleic acid molecule having binding activity toward a given target molecule. Aptamers can have various three-dimensional structures depending on their base sequences and can exhibit high affinity for specific substances, such as antigen-antibody reactions. The aptamer according to the present invention targets PDK mRNA and binds to said mRNA, thereby inhibiting the biological function or activity of said mRNA, thereby suppressing the expression or activity of PDK.

[0034] The term "siRNA" as used herein refers to a small RNA fragment, typically 21 to 25 nucleotides in size, that can mediate RNA interference or gene silencing. Because siRNA can inhibit the expression of target genes, it can be used as an efficient gene knockdown method or gene therapy. The siRNA, which can be generated by cleavage of double-stranded RNA by Dicer, can specifically bind to mRNA with a complementary sequence and suppress the expression of the mRNA.

[0035] The pyruvate dehydrogenase kinase inhibitor according to the present invention may be siRNA, and the siRNA can specifically bind to the mRNA of PDK and suppress the expression of the mRNA, thereby suppressing the expression or activity of PDK.

[0036] The term "antibody" as used herein refers to a proteinaceous molecule capable of specifically binding to an antigenic site of a protein or peptide molecule. Antibodies can be produced by conventional methods by cloning each gene into an expression vector to obtain a protein encoded by a marker gene, and then producing the obtained protein using conventional methods. The form of the antibody is not particularly limited, and any part thereof, such as a polyclonal antibody, a monoclonal antibody, an antibody fragment, or a recombinant antibody, that has antigen-binding properties is also included in the antibodies of the present invention. In the present invention, antibodies may include all immunoglobulin antibodies as well as specialized antibodies such as humanized antibodies. Furthermore, antibodies include not only complete forms having two full-length light chains and two full-length heavy chains, but also functional fragments of antibody molecules. Functional fragments of antibody molecules refer to fragments that possess at least an antigen-binding function, and may be Fab, F(ab'), F(ab') 2, and Fv.

[0037] The pyruvate dehydrogenase kinase inhibitor according to the present invention may be a compound. For example, the compound may be dichloroacetate (DCA), or GM10395 represented by the following chemical formula 1, or a salt thereof.

[0038] [Chemical Formula 1]

[0039]

[0040] The salt may be, but is not limited to, an acid addition salt formed by a free acid.

[0041] The acid may be an organic acid and / or an inorganic acid.

[0042] Organic acids may include, but are not limited to, citric acid, acetic acid, lactic acid, tartaric acid, maleic acid, fumaric acid, formic acid, propionic acid, oxalic acid, trifluoroacetic acid, benzoic acid, gluconic acid, metasulfonic acid, glycolic acid, succinic acid, 4-toluenesulfonic acid, glutamic acid, and aspartic acid.

[0043] Inorganic acids may include, but are not limited to, hydrochloric acid, hydrobromic acid, sulfuric acid, and phosphoric acid.

[0044] In one embodiment of the present invention, the pyruvate dehydrogenase kinase inhibitor may be a pyruvate dehydrogenase kinase 4 inhibitor.

[0045] The term "pyruvate dehydrogenase kinase 4 (PDK4)" in this specification is also named PDK4, and is a member of the PDK / BCKDK protein kinase family, which encodes a mitochondrial protein with a histidine kinase domain. PDK4 is located in the mitochondrial matrix and is known to phosphorylate one of the subunits of pyruvate dehydrogenase to inhibit the pyruvate dehydrogenase complex, and to reduce the conversion of pyruvate generated from the oxidation of glucose and amino acids into acetyl-CoA, thereby contributing to the regulation of glucose metabolism.

[0046] The term "macular degeneration" used herein refers to a disease in which degeneration occurs in the macula due to factors such as aging, family history, race, and smoking, and is primarily caused by aging. Macular degeneration is an eye disease in which, when it occurs, yellow deposits called drusen (accumulations of extracellular proteins and lipids) gradually accumulate in the macula (part of the retina) between the retinal pigment epithelium and the choroid.

[0047] In one embodiment of the present invention, the macular degeneration may be age-related macular degeneration (AMD).

[0048] The term "age-related macular degeneration" in this specification refers to a macular degeneration disease that occurs due to aging, progresses through three stages of early, intermediate, and late, based in part on the degree (size and number) of drusen, and can cause vision loss.

[0049] In one embodiment of the present invention, age-related macular degeneration may be early age-related macular degeneration (early AMD), intermediate age-related macular degeneration (intermediate AMD), or late age-related macular degeneration (late AMD).

[0050] In one embodiment of the present invention, the age-related macular degeneration may be late age-related macular degeneration.

[0051] The term "late-stage age-related macular degeneration" as used herein refers to a macular degeneration disease characterized by vision loss due to macular damage. Late-stage age-related macular degeneration is divided into dry AMD and wet AMD, depending on the type of damage. Dry AMD is a non-neovascular form of age-related macular degeneration characterized by geographic atrophy, while wet AMD is a neovascular form characterized by choroidal neovascularization.

[0052] In one embodiment of the present invention, age-related macular degeneration may be neovascular age-related macular degeneration (Neovascular AMD) or non-neovascular age-related macular degeneration (Non-neovascular AMD).

[0053] In one embodiment of the present invention, the age-related macular degeneration may be neovascular age-related macular degeneration.

[0054] In the present invention, the pharmaceutical composition may contain pyruvate dehydrogenase kinase in an effective amount of 0.0001 to 10,000 mg / kg, 0.001 to 1,000 mg / kg, 0.05 to 500 mg / kg, 0.01 to 300 mg / kg, 0.05 to 200 mg / kg, 0.1 to 100 mg / kg, 1 to 100 mg / kg, for example, but is not limited thereto.

[0055] In the present invention, the composition may be formulated and used in the form of oral formulations such as powders, granules, tablets, capsules, ointments, suspensions, emulsions, syrups, aerosols, etc., or in the form of parenteral formulations such as transdermal agents, suppositories, and sterile injection solutions, according to conventional methods.

[0056] In one embodiment of the present invention, the composition may further contain, in addition to the mixed extract, pharmaceutically suitable and physiologically acceptable carriers, excipients, and diluents, and other auxiliary agents.

[0057] In the present invention, carriers, excipients, and diluents may include, but are not limited to, lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methyl hydroxybenzoate, propyl hydroxybenzoate, talc, magnesium stearate, and mineral oil.

[0058] When formulating, diluents or excipients such as fillers, bulking agents, binders, wetting agents, disintegrating agents, and surfactants commonly used in the art can be used. Solid preparations for oral administration may include tablets, pills, powders, granules, capsules, etc., and such solid preparations may be prepared by mixing the extract with at least one excipient, for example, starch, calcium carbonate, sucrose or lactose, gelatin, etc. In addition to simple excipients, lubricants such as magnesium stearate and talc may also be used, but are not limited thereto.

[0059] Oral preparations include suspensions, solutions, emulsions, syrups, and ointments. In addition to commonly used simple diluents such as water and liquid paraffin, various excipients such as wetting agents, sweeteners, fragrances, and preservatives may be included, but are not limited to these.

[0060] Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, lyophilized preparations, suppositories, and transdermal preparations. Non-aqueous solutions and suspensions include, but are not limited to, propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate.

[0061] Suppository formulations may include, but are not limited to, witepsol, macrogol, tween 61, cocoa butter, laurin butter, and glycerogelatin.

[0062] In the present invention, the pharmaceutical composition may be administered orally or parenterally, and in the case of parenteral administration, may be administered by intravenous injection, subcutaneous injection, intramuscular injection, intraperitoneal injection, transdermal administration, ocular administration, or ocular topical administration.

[0063] In one embodiment of the present invention, ocular topical administration may be intraocular, periocular, retroocular, subretinal, central retinal, extrafoveal, subconjunctival, intravitreal, intracameral, or suprachoroidal.

[0064] Another aspect of the present invention is a food composition for alleviating, inhibiting or improving macular degeneration, comprising a pyruvate dehydrogenase kinase (PDK) inhibitor.

[0065] The food composition for alleviating, inhibiting or improving macular degeneration of the present invention contains a pyruvate dehydrogenase kinase inhibitor, similar to the pharmaceutical composition for alleviating, inhibiting, preventing or treating macular degeneration of the present invention described above. Therefore, the description of common contents between the two is omitted to avoid excessive complexity of the specification due to repeated description.

[0066] The food composition according to the present invention may include ingredients commonly added during food manufacturing, and may include, for example, proteins, carbohydrates, fats, nutrients, seasonings, and flavorings, but is not limited thereto.

[0067] Carbohydrates that may be included in the food composition according to the present invention include, but are not limited to, monosaccharides such as glucose and fructose, disaccharides such as maltose, sucrose, and oligosaccharides, polysaccharides such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol, and erythritol.

[0068] Flavoring agents that may be included in the food composition according to the present invention may include, but are not limited to, natural flavoring agents such as thaumatin and stevia extract, and synthetic flavoring agents such as saccharin and aspartame.

[0069] Another aspect of the present invention is a pharmaceutical composition for alleviating, inhibiting, preventing or treating neovascular eye disease, comprising a pyruvate dehydrogenase kinase inhibitor.

[0070] Another aspect of the present invention is a food composition for alleviating, suppressing or improving neovascular eye disease, comprising a pyruvate dehydrogenase kinase inhibitor.

[0071] The pharmaceutical composition for alleviating, suppressing, preventing or treating neovascular eye disease of the present invention and the food composition for alleviating, suppressing or improving neovascular eye disease contain the same active ingredient as the pharmaceutical composition for alleviating, suppressing, preventing or treating macular degeneration of the present invention, a pyruvate dehydrogenase kinase inhibitor, and therefore, the description of the common content between the two is omitted to avoid excessive complexity of the specification due to repeated description.

[0072] The term “neovascular eye disease” as used herein refers to a pathological angiogenesis-related disease occurring in the eye.

[0073] In one embodiment of the present invention, the neovascular eye disease may include corneal neovascularization, retinal neovascularization, choroidal neovascularization, intraocular neovascularization, neovascular glaucoma, proliferative diabetic retinopathy, neovascular macular degeneration, and retinopathy of prematurity.

[0074] Another aspect of the present invention relates to a method for treating or alleviating macular degeneration, comprising administering to a subject a pharmaceutical composition comprising a pyruvate dehydrogenase kinase inhibitor.

[0075] Another aspect of the present invention relates to a method for treating or alleviating a neovascular eye disease, comprising administering to a subject a pharmaceutical composition comprising a pyruvate dehydrogenase kinase inhibitor.

[0076] As used herein, the term "administration" refers to providing a given substance to a patient by any suitable method. The pharmaceutical composition of the present invention may be administered orally or parenterally via any conventional route as long as it can reach the target tissue. Furthermore, the composition of the present invention may be administered using any device capable of delivering the active ingredient to target cells.

[0077] The term "subject" as used herein includes, but is not limited to, a human, monkey, cow, horse, sheep, pig, chicken, turkey, quail, cat, dog, mouse, rat, rabbit or guinea pig, for example, but not limited to a human.

[0078] In one embodiment of the present invention, the pharmaceutical composition of the present invention may be administered alone, but may generally be administered mixed with a pharmaceutical carrier selected in consideration of the mode of administration and standard pharmaceutical practice.

[0079] The dosage of the pharmaceutical composition of the present invention may vary depending on the patient's age, weight, sex, dosage form, health condition, and disease severity, and may be administered once or several times a day at regular intervals at the discretion of a doctor or pharmacist.

[0080] For example, the daily dosage may be 1 to 1000 ug / mL based on the active ingredient content, but this is an average case and the dosage may be higher or lower depending on individual differences.

[0081] In one embodiment of the present invention, the pyruvate dehydrogenase kinase inhibitor may be a pyruvate dehydrogenase kinase 4 inhibitor.

[0082] In one embodiment of the present invention, the pyruvate dehydrogenase kinase 4 inhibitor may comprise GM10395 or a salt thereof.

[0083] Another aspect of the present invention is the use of a pyruvate dehydrogenase kinase inhibitor for alleviating, inhibiting, treating or preventing macular degeneration.

[0084] Another aspect of the present invention is the use of a pyruvate dehydrogenase kinase inhibitor for alleviating, suppressing, treating or preventing neovascular eye disease.

[0085] The present invention relates to a composition for alleviating, inhibiting, treating or preventing macular degeneration. The composition according to the present invention has an excellent effect of reducing neovascularization caused by macular degeneration and inhibiting vascular leakage, and thus can be used as a therapeutic agent for alleviating or treating macular degeneration, particularly, age-related macular degeneration (AMD).

[0086] Figure 1 is a graph comparing the expression levels of PDK isoforms (PDK1 to PDK4) in the retinal pigment epithelium (RPE) and choroid of choroidal neovascularization (CNV) mice and control mice.

[0087] Figure 2 is a graph comparing the expression levels of phosphorylated PDHE1α (p-PDHE1α) protein in the RPE and choroid of CNV mice and control mice.

[0088] Figure 3 is a photograph comparing the expression levels of PDK4 protein in the ocular tissues of CNV mice and control mice. The size of the scale bar in Figure 3 is 100 μm.

[0089] Figure 4 is a photograph comparing the expression levels of p-PDHE1α protein in the ocular tissues of CNV mice and control mice. The size of the scale bar in Figure 4 is 100 μm.

[0090] Figure 5 is a graph comparing the expression levels of PDK isoforms (PDK1 to PDK4) in the retinas of CNV mice and control mice.

[0091] Figure 6 is a diagram showing the results of evaluating the CNV lesion grade (0 to 2B) of CNV mice in which the Pdk4 gene is wild type or knocked out.

[0092] Figure 7 is a diagram comparing the CNV lesion areas of CNV mice in which the Pdk4 gene is wild type or knocked out. The size of the scale bar in Figure 7 is 100 μm.

[0093] Figure 8 is a graph showing the results of comparing the basal OCR, maximal OCR, and reserve OCR of each group after knocking down each gene by transfecting siRNA for Pdk isoform genes (Pdk1 to Pdk4) into primary human RPE in which oxygen consumption rate (OCR) was down-regulated by an inflammatory cytokine mixture (ICM).

[0094] Figure 9 is a graph showing the results of measuring the level of Pdk4 mRNA in primary human RPE cells when siRNA for Pdk4 was transfected into primary human RPE cells treated with ICM.

[0095] Figure 10 is a graph showing the results of measuring the mRNA levels of Il-1β, Il-6, Il-8, and Mcp-1 in primary human RPE cells in which Pdk4 was knocked down by transfecting siRNA against Pdk4 into primary human RPE cells treated with ICM.

[0096] Figure 11 is a graph showing the results of comparing the mRNA levels of IL-1β and IL-6 in primary human RPE cells when DCA or GM10395 was treated at different concentrations in primary human RPE cells treated with ICM.

[0097] Figure 12 is a diagram showing the results of confirming the amount of p-PDHE1α protein expression when DCA was treated at various concentrations in primary human RPE cells treated with ICM.

[0098] Figure 13 is a diagram showing the results of confirming the amount of p-PDHE1α protein expression when GM10395 was treated at various concentrations in primary human RPE cells treated with ICM.

[0099] Figure 14 is a graph showing the results of comparing the OCR of primary human RPE cells when DCA or GM10395 was treated at different concentrations in primary human RPE cells treated with ICM.

[0100] Figure 15 is a graph comparing mitochondrial peroxide levels in primary human RPE cells treated with ICM when treated with DCA (10 uM) or GM10395 (1 uM). The scale bar in Figure 15 is 50 μm.

[0101] Figure 16 is a graph comparing the mitochondrial area in primary human RPE cells treated with ICM when treated with DCA (10 uM) or GM10395 (1 uM). The size of the scale bar in Figure 16 is 20 μm.

[0102] Figure 17 is a graph showing the results of comparing the mRNA levels of Il-1β, Il-6, Il-8, and Mcp-1 in primary human RPE cells when DCA or GM10395 was treated at different concentrations in primary human RPE cells treated with ICM.

[0103] Figure 18 is a graph showing the results of comparing the expression levels of proinflammatory cytokines IL-6, IL-8, and MCP-1 in primary human RPE cells when DCA or GM10395 was treated at different concentrations in primary human RPE cells treated with ICM.

[0104] Figure 19 is a diagram showing the results of evaluating the CNV lesion grade (0 to 2B) of CNV mice orally administered DCA (250 mpk) or GM10395 (1 mpk).

[0105] Figure 20 is a diagram showing the results of comparing the CNV lesion areas of CNV mice orally administered DCA (250 mpk) or GM10395 (1 mpk). The size of the scale bar in Figure 20 is 100 μm.

[0106] Figure 21 is a diagram showing the results of comparing the expression levels of p-PDHE1α protein in RPE / choroid tissues obtained from CNV mice orally administered a control drug (saline) and GM10395 (1 mpk).

[0107] Figure 22 is a graph comparing the mRNA levels of Il-1β, Il-6, and Mcp-1 in RPE / choroid tissues obtained from CNV mice orally administered a control drug (saline) and GM10395 (1 mpk).

[0108] A pharmaceutical composition for alleviating, inhibiting, preventing or treating macular degeneration, comprising a pyruvate dehydrogenase kinase (PDK) inhibitor.

[0109] Hereinafter, the present invention will be described in more detail with reference to the following examples. However, these examples are only intended to illustrate the present invention, and the scope of the present invention is not limited by these examples.

[0110] Throughout this specification, "%" used to indicate the concentration of a particular substance is (wt / wt)% for solid / solid, (wt / vol)% for solid / liquid, and (vol / vol)% for liquid / liquid, unless otherwise stated.

[0111] Unless otherwise specified, all numbers, values ​​and / or expressions expressing ingredients, reaction conditions and quantities of ingredients used herein are to be understood as being modified in all instances by the term "about" because these numbers are approximations that inherently reflect, among other things, the various uncertainties of measurement encountered in obtaining such values.

[0112] Additionally, when a numerical range is disclosed herein, such range is continuous and includes all values ​​from the minimum value to the maximum value inclusive, unless otherwise specified.

[0113] Also, the term "or" in this specification is intended to mean an inclusive "or" rather than an exclusive "or." That is, where a connection or use between components is not otherwise specified or clear from context, i.e., if X includes A; X includes B; or X includes both A and B, "X includes A or B" can be applied to any of these cases.

[0114]

[0115] Example 1. Results

[0116] PDK4 was overexpressed in retinal pigment epithelial cells (RPE) in a laser-induced choroidal neovascularization (CNV) model.

[0117] To evaluate PDK, a key regulatory enzyme of mitochondrial metabolism in neovascular AMD, we assessed changes in the expression levels of PDK and p-PDHE1α in laser-induced CNV mice. One day after CNV induction, the expression levels of PDK4 and p-PDHE1α were significantly increased in CNV mice compared to the control group (Fig. 1, Table 1 and Fig. 2, Table 2). In contrast, PDK1, PDK2, and PDK3 were not increased in the RPE / choroid. Furthermore, immunofluorescence analysis revealed that PDK4 and p-PDHE1α were overexpressed in CNV mice compared to the control group, particularly in the RPE (Figs. 3 and 4). In contrast, no PDK isoform was increased in the retinal tissue (Fig. 5 and Table 3). Specific numerical values ​​of the graphs in Figs. 1, 2, and 5 are presented in Tables 1 to 3, respectively.

[0118] Relative protein expression level Control group CNVP value (P value) Mean ± standard error of the mean Mean ± standard error of the mean PDK11.0000.030.9590.0220.3035PDK21.0000.0790.7470.0530.0289PDK31.0000.0310.8150.0430.0084PDK41.0000.0579.7270.703<0.0001

[0119] Relative expression level Control group CNVP value (P value) Mean ± standard error of the mean Mean ± standard error of the mean pPDHE1α (S293) / HSP901.0000.1272.5100.2650.0002

[0120] Relative protein expression level Control group CNVP value (P value) Mean ± standard error of the mean Mean ± standard error of the mean PDK11.0000.1211.1410.0620.331 PDK21.0000.0581.0020.0550.983 PDK31.0000.1430.860.0680.402 PDK41.0000.0171.10.0790.253

[0121] These data indicate that mitochondrial metabolism in the RPE changes in response to CNV induction. Furthermore, among the isoforms, only PDK4 was involved in the metabolic shift. Interestingly, PDK4 protein levels in the retina remained unchanged, consistent with previous studies suggesting that energy metabolism in the neural retina primarily relies on glycolysis.

[0122]

[0123] Pdk4 deficiency showed a protective effect against CNV.

[0124] To evaluate the role of Pdk4 in neovascular AMD, wild-type (Pdk4 + / + ) and Pdk4 knockout (Pdk4 - / -) mice were compared for their neovascular phenotypes. Seven days after CNV induction, the proportion of grade 2B lesions, defined as clinically significant vascular leakage, was significantly reduced in Pdk4 knockout mice compared to wild-type mice (Fig. 6 and Table 4). Furthermore, in the evaluation of the choroidal flat-mount technique, the size of CNV lesions was reduced in Pdk4 knockout mice compared to wild-type mice (Fig. 7 and Table 5). Specific figures for the graphs in Fig. 6 and Fig. 7 are presented in Tables 4 and 5, respectively.

[0125] Lesion grade 012A2B control group 0243046 PDK4 knockout group 2449225

[0126] CNV lesion areaWild-type mousePdk4 knockout mouseP valueMean ± standard error of the meanMean ± standard error of the mean21.883.33811.321.2210.0041

[0127] These results indicate that genetic deletion of Pdk4 within the RPE attenuates neovascularization in CNV mice.

[0128]

[0129] Among the isoforms, only Pdk4 affected ICM-induced OCR downregulation.

[0130] To support the role of PDK4 in mitochondrial respiration, we compared oxygen consumption (OCR) in primary human RPE (hRPE) transiently transfected with siRNA (siPdk1, siPdk2, siPdk3, and siPdk4) for 48 h and subsequently treated with control drug (PBS) or an inflammatory cytokine mixture (ICM). Interestingly, among the Pdk isoforms, only the Pdk4 knockdown group was unaffected by the ICM-induced downregulation of basal, maximal, and spare oxygen consumption. Furthermore, only the Pdk4 knockdown group showed a significant upregulation of basal, maximal, and spare oxygen consumption compared to the other Pdk isoforms (Figure 8 and Table 6). Specific values ​​of the graph in Figure 8 are presented in Table 6.

[0131] Baseline OCRMaximum OCR Reserve CapacityMean ± Mean Standard ErrorMean ± Mean Standard ErrorMean ± Mean Standard ErrorControl56.381.573111.74.89155.343.738ICM47.410.84162.451.62715.041.778siPDK1+ ICM46.62.24349.673.3973.0721.904siPDK2+ ICM42.343.15766.084.71623.742.534siPDK3+ ICM45.131.86371.322.71226.192.481siPDK4+ ICM61.230.438121.73.02260.512.905

[0132] These results indicate that among the Pdk isoforms, only Pdk4 plays a critical role in regulating mitochondrial dynamics that affect cellular respiration.

[0133] Inflammatory cytokines, including IL-1β and MCP-1, are overexpressed in human CNV tissues and in a mouse model of laser-induced CNV. The RPE is a metabolically demanding tissue, fueled by abundant mitochondria and requiring high oxygen consumption. Impaired energy metabolism and RPE dysfunction under inflammatory conditions may contribute to the development and progression of AMD. Therefore, we measured mRNA levels of Pdk4, IL-1β, IL-6, IL-8, and Mcp-1 after transient knockdown of Pdk4 using siRNA (siPdk4) in ICM-derived primary hRPE cells. siPdk4 inhibited ICM-induced upregulation of Pdk4, IL-1β, IL-6, IL-8, and Mcp-1 compared to siControl (Fig. 9, Table 7 and Fig. 10, Table 8). Specific figures of the graphs of Figures 9 and 10 are shown in Tables 7 and 8, respectively.

[0134] Pdk4 mean ± standard error of the mean siControl 1.000 0.111 siControl+ ICM 0.574 0.062 siPDK 4 12.682 0.794 siPDK 4+ ICM 3.570 0.324

[0135] siControlsiPDK4siControl+ICMsiPDK4+ICMIl-1βmean1.001.17256.5133.5±mean standard error0.260.057.627.25Il-6mean1.001.8283.6247.0±mean standard error0.040.1212.563.5Il-8mean1.001.0227612162±mean standard error0.020.1176.2155.81Mcp-1mean1.0000.60139.7237.658±mean standard error0.0250.0240.0800.101

[0136]

[0137] GM10395, a small molecule targeting PDK4, reversed the metabolic shift toward OXPHOS in ICM-induced primary hRPE.

[0138] Pharmacological inhibition of the pan-PDK ATP binding pocket, such as dichloroacetate (DCA) or KPLH130, has been investigated in numerous metabolic diseases, such as diabetes and atherosclerosis, associated with mitochondrial dysfunction. Based on technological advancements, structural modifications of hit anthraquinones have enabled the identification of a novel series of allosteric PDK4 inhibitors optimized for the lipoamide binding site. Furthermore, in the present invention, we developed GM10395, a potential allosteric PDK4 inhibitor having the structure represented by the following chemical formula 1.

[0139] [Chemical Formula 1]

[0140]

[0141] To investigate the role of DCA in metabolic processes, relatively high doses (0.5–10 mM) of DCA were used in various cell lines, including HepG2, C2C12, HEK293, primary hepatocytes, and primary macrophages. In contrast, the effective dose of DCA in the present invention ranged from 1 to 50 μM in ICM-induced primary hRPE cells. These data were similar to previous studies using TGFβ-induced ARPE cells. Interestingly, the effective dose of GM10395 in primary hRPE cells, ranging from 0.5 to 5 μM, was lower than that of DCA, and these results were similar in other cell lines, including CD4+ T cells (Figure 11 and Table 9).

[0142] Next, we examined whether p-PDHE1α was dose-dependently reduced by DCA or GM10395 under ICM-induced inflammatory conditions in hRPE cells. Interestingly, the inhibitory effect of 0.5 μM GM10395 as a specific PDK4 inhibitor was comparable to that of 10 μM DCA (20-fold higher) as a pan-PDK inhibitor (Fig. 12, Table 10 and Fig. 13, Table 11).

[0143] Specific figures of the graphs in Figures 11 to 13 are shown in Tables 9 to 11, respectively.

[0144] Il-1βIl-6Mean ± standard error of the meanMean ± standard error of the meanControl1.00.31.00.1ICM 5 ng / mL888.961.0454.631.7ICM + DCA1 uM626.657.3369.94.9ICM + DCA10 uM589.512.9291.19.2ICM + DCA50 uM607.529.8304.118.1ICM + DCA1,000 uM892.341.0439.715.8ICM + GM103950.5 uM586.424.2272.87.0ICM + GM103951 uM619.654.2248.822.2ICM + GM103955 uM524.824.7246.25.0

[0145] pPDHE1α / HSP90 mean ± standard error of the mean control group 1.000 0.269 ICM 5 ng / mL 3.01 70.618 ICM + DCA 1 uM 2.27 80.385 ICM + DCA 10 uM 0.40 30.064

[0146] pPDHE1α / HSP90 mean ± standard error of the mean control group 1.000 0.251 ICM 5 ng / mL 2.336 0.182 ICM + GM 10395 0.5 uM 0.244 0.026 ICM + GM 10395 1 uM 0.111 0.003

[0147]

[0148] The neovascular phenotype in CNV lesions appears to be governed by RPE mitochondrial metabolism via PDK4 when activated by inflammatory stimuli. Therefore, to evaluate the effect of GM10395 on metabolic reprogramming under inflammatory conditions, the OCR of ICM-derived primary hRPE cells was measured. Both DCA and GM10395 increased maximal respiration. Interestingly, GM10395 significantly increased reserve respiratory capacity in a dose-dependent manner, whereas DCA did not increase reserve respiratory capacity (Figure 14 and Table 12). Specific values ​​for the graph in Figure 14 are presented in Table 12.

[0149] Baseline OCRMaximum OCR Reserve CapacityMean ± Mean Standard ErrorMean ± Mean Standard ErrorMean ± Mean Standard ErrorControl12.5401.34915.2300.6612.6921.126ICM10.2600.5079.6900.113-0.5730.607ICM + DCA1 uM15.7100.77614.9301.098-0.7780.966ICM + DCA10 uM20.6401.61820.0500.236-0.5921.496ICM + GM10395 0.5 uM15.2701.29416.1000.8650.8400.730ICM + GM103951 uM14.9001.11219.7900.1414.8961.097

[0150]

[0151] Next, to assess the drug's effect on mitochondrial oxidative stress, mitochondrial peroxide was assessed in ICM-induced primary hRPE cells. Consistent with the previous data, ICM-induced inflammatory conditions increased mitochondrial peroxide, which was alleviated by DCA and GM10395 (Figure 15 and Table 13). Specific values ​​for Figure 15 are presented in Table 13.

[0152] Mean fluorescence intensity Mean ± standard error of the mean Control group 337.8 1.38 ICM 5 ng / mL 403.6 2.41 ICM + DCA 10 uM 383.4 2.21 ICM + GM 10 395 1 uM 384.5 1.94

[0153] Additionally, morphological changes in mitochondrial cells were assessed by staining with TOM20, a mitochondrial outer membrane marker. Consistent with previous data, ICM-induced inflammatory conditions reduced mitochondrial mass in primary hRPE cells, a phenomenon that was alleviated by DCA and GM10395 (Figure 16 and Table 14). Specific values ​​for Figure 16 are presented in Table 14.

[0154] Mitochondrial area per cell (um) 2 ) Mean ± standard error of the mean Control group 332.18.741 ICM 5 ng / mL 159.05.320 ICM + DCA 10 uM 237.69.198 ICM + GM10395 1 uM 272.910.750

[0155] Furthermore, to evaluate the anti-inflammatory effects of GM10395, the mRNA and protein levels of proinflammatory cytokines were measured in ICM-induced primary hRPE cells after treatment with DCA and GM10395. DCA inhibited the ICM-induced upregulation of IL-1β, IL-6, IL-8, and Mcp-1 (Figure 17 and Table 15). Furthermore, GM10395 inhibited the ICM-induced upregulation of IL-1β, IL-6, IL-8, and Mcp-1. Additionally, DCA and GM10395 inhibited the ICM-induced upregulation of IL-6, IL-8, and MCP-1 protein levels (Figure 18 and Table 16). The specific numerical values ​​of the graphs in Figures 17 and 18 are presented in Tables 15 and 16, respectively.

[0156] Control group ICM5 ng / mLICM + DCA 1 uM1CM + DCA 10 uM1CM + GM10395 0.5 uMICM + GM10395 1 uMIl-1βmean 1.00930.9813.9613.9631.9595.5±standard error of the mean 0.1232.9930.0971.6218.2160.10Il-6mean 1.00454.6369.9291.1272.8248.8±standard error of the mean 0.0731.664.889.167.01 22.24Il-8Average 1.0062935653449149674347±Mean standard error 0.07375.8439.1307.2102.951.22Mcp-1Average 1.0019.3517.8713.8514.8413.09±Mean standard error 0.040.270.430.870.420.45

[0157] Control group ICM5 ng / mLICM + DCA 1 uM1CM + DCA 10 uM1CM + GM10395 0.5 uMICM + GM10395 1 uMIL-6 average 1493660032990320382663725830±standard error of the mean 1.753362.1329.8370.8471.9505.6 IL-8 average 27.836513956166538005347851547±standard error of the mean 3.98314391483561.3554.8640.6 MCP-1 average 41776679148817498743693929811±standard error of the mean 67.66927.7245822393227689.9

[0158]

[0159] GM10395, a PDK4 inhibitor, alleviated CNV in a laser-induced CNV model.

[0160] Next, we evaluated whether PDK inhibitors alleviate CNV by reducing inflammatory changes induced by metabolic reprogramming in the RPE. To evaluate the anti-angiogenic effect in CNV, we compared the neovascular phenotypes of CNV mice administered orally with the control drug, DCA (250 mpk) and GM10395 (1 mpk). Seven days after CNV induction, the proportion of Grade 2B lesions was significantly reduced in the DCA and GM10395 groups compared to the control group (Figure 19 and Table 17). Furthermore, in the choroidal flat-mount technique evaluation, the size of CNV lesions was reduced in mice administered DCA and GM10395 compared to the control group (Figure 20 and Table 18). The specific numerical values ​​of the graphs in Figures 19 and 20 are presented in Tables 17 and 18, respectively.

[0161] Lesion grade 012A2B control drug administration group 02.426.271.4 DCA administration group 1.948.140.79.3 GM10395 administration group 05935.95.1

[0162] CNV lesion area mean ± standard error of the mean Control drug group 27.9 24.33 DCA group 16.50 1.87 GM10395 group 18.03 2.13

[0163] While DCA and GM10395 showed similar anti-angiogenic effects, the amount of GM10395 was 1 / 250 of that of DCA, indicating a higher efficacy of GM10395.

[0164] Subsequently, changes in p-PDHE1α after oral administration of GM10395 were evaluated using immunoblotting of RPE / choroid tissues obtained from CNV mice. The expression of p-PDHE1α was decreased by GM10395 treatment (Fig. 21 and Table 19), which is similar to the results of dephosphorylation of p-PDHE1α by GM10395 in ICM-derived primary hRPE cells shown in Fig. 13. Specific values ​​for Fig. 21 are shown in Table 19.

[0165] pPDHE1α / HSP90 mean ± standard error of the mean Control drug administration group 1.00 0.15 GM10395 administration group 0.32 0.04

[0166] Additionally, to assess anti-inflammatory changes in RPE / choroid tissue after GM10395 treatment, mRNA levels of Il-1β, Il-6, and Mcp-1 were measured in laser-induced CNV mice. The GM10395 treatment group attenuated CNV-induced upregulation of Il-1β, Il-6, and Mcp-1 3 days after CNV induction (Figure 22 and Table 20). Specific values ​​for Figure 22 are presented in Table 20.

[0167] Il-1βIl-6Mcp-1Mean ± standard error of the meanMean ± standard error of the meanMean ± standard error of the meanControl drug administration group1.0000.0151.0000.2281.0000.113DCA administration group3.0000.30311.2500.8186.8580.125GM10395 administration group1.7290.1418.6350.3764.8160.150

[0168] Example 2. Discussion

[0169] For energy, the RPE relies almost exclusively on mitochondrial oxidative phosphorylation (OXPHOS), which allows photoreceptors to utilize glucose transported from the choroid through the RPE. This process is highly regulated in the RPE through the inhibition of glycolysis, thereby preserving glucose as an energy source for photoreceptors. However, AMD disrupts this metabolic ecosystem, forcing the RPE to rely on glycolysis to sustain its energy needs, a process referred to as metabolic reprogramming. This metabolic shift in mitochondria creates a proinflammatory environment in the RPE that further exacerbates the neovascular phenotype of AMD.

[0170] PDK-mediated glycolytic metabolism switching in the dorsal root ganglion leads to overexpression of proinflammatory cytokines, which contribute to painful diabetic neuropathy. Furthermore, pharmacological inhibition with DCA and Pdk2 / 4 deficiency attenuated proinflammatory cytokine expression, thereby reducing spinal cord neuroinflammation.

[0171] Similarly, metabolic reprogramming in RPE mitochondria creates a proinflammatory environment that exacerbates the neovascular phenotype of AMD. However, the link between metabolic reprogramming in human RPE and the neovascular phenotype of CNV has not yet been studied. Therefore, in the present invention, we evaluated this link using genetic deletion and small molecules, and identified PDK4 inhibitors as therapeutic targets for modulating mitochondrial dynamics.

[0172] Among PDK isoforms, only PDK4 was overexpressed in RPE by immunoblotting, whereas other PDK isoforms were not upregulated. In vitro experiments using primary hRPE cells demonstrated that only Pdk4 knockdown affected ICM-induced downregulation of OCR and proinflammatory cytokines, whereas other Pdk isoforms had no effect.

[0173] DCA, a structural analog of pyruvate and a PDK inhibitor, has demonstrated protective effects against various neurological disorders, including neurodegenerative diseases, glioma, and ischemic encephalopathy. However, DCA is known to have serious systemic side effects, including peripheral neuropathy, which necessitates the discovery of alternative PDK inhibitors, particularly those targeting PDK4. Therefore, in this study, we evaluated the effects of a novel small molecule, GM10395, which acts at much lower concentrations on mitochondrial dynamics.

[0174] GM10395, a small molecule targeting PDK4, increased maximal respiration and reserve respiration. Interestingly, reserve respiration capacity was significantly increased dose-dependently by GM10395, whereas this effect was not observed with DCA. Furthermore, GM10395 alleviated oxidative stress, as demonstrated by MitoSOX staining, and also mitigated mitochondrial fragmentation induced by inflammatory conditions. Furthermore, enhanced mitochondrial activity enhanced RPE's resilience to oxidative damage, supporting the important role of RPE mitochondria. Taken together, our data suggest that GM10395 protects RPE from metabolic reprogramming from OXPHOS to aerobic glycolysis.

[0175] Inflammatory activation of the RPE alters mitochondrial dynamics and the concomitant overexpression of proinflammatory cytokines. Palsson-McDermott et al. reported that inhibition of LPS-induced metabolic reprogramming attenuated inflammatory cytokine secretion. Similarly, in the present study, GM10395 dose-dependently inhibited proinflammatory cytokine production. Previous data suggest that GM10395 attenuates the inflammatory response in the RPE by reversing mitochondrial metabolism via PDK4.

[0176] Next, we investigated the effects of GM10395 in an in vivo neuroinflammation paradigm and confirmed that GM10395 reduced the expression of genes associated with immunomodulatory RPE phenotypes and neovascular phenotypes. Therefore, modulating RPE phenotypes through metabolic reprogramming may be used to improve clinical outcomes in CNV by reducing the direct neurotoxic potential of reactive RPE.

[0177] In conclusion, we have demonstrated that CNV increases the expression of PDK4 and phospho-PDH (p-PDH), inducing a switch to glycolytic metabolism along with inflammation in CNV lesions. Genetic deletion of PDK4 and small molecule PDK4 inhibitors alleviated CNV-induced neuroinflammation. Taken together, these findings suggest that modulating RPE metabolism through PDK4 regulation could be a novel therapeutic approach for neovascular AMD.

[0178]

[0179] Example 3. Method

[0180] animal testing

[0181] Male C57BL / 6J mice were used in all experiments. Pdk4 knockout mice (Pdk4 - / - ) populations were established in an in-house animal facility. All mice were housed on a pathogen-free platform with constant temperature (22°C), a 12-h light / dark cycle, and unrestricted access to chow diet and water. Seven-week-old mice were administered orally dichloroacetate (DCA 250 mg / kg; Sigma-Aldrich, 347795) or GM10395 (1 mg / kg; diluted to a concentration of 10 mg / mL in 1% DMSO / saline solution), or saline once daily from day −7 before CNV induction (day 0) to day +7 after CNV induction.

[0182]

[0183] Laser-induced CNV model

[0184] Eight-week-old male C57BL / 6J mice were used in all experiments. A 532-nm OcuLight GLx Laser System (IRIDEX Corporation) attached to a slit lamp was used to create CNV lesions. Four to ten lesions were created using the following laser parameters: 100 mW power, 100 μm spot size, and 0.1 s pulse duration, according to a previously described method. The appearance of a bubble at the photocoagulation site indicated successful destruction of Bruch's membrane. Retinal and choroidal tissues were collected at various time points for RNA isolation or choroidal flat-mount techniques. Mice were administered saline, DCA (250 mg / kg), GM10395 (1 mg / kg), or saline orally once daily from day -7 before CNV induction (day 0) to day +7 after CNV induction.

[0185]

[0186] fluorescein angiography

[0187] A Micron IV Retinal Imaging Microscope (Phoenix Technology Group, Pleasanton, CA, USA) was used for fluorescein imaging. After anesthesia and pupil dilation, 0.1 mL of 2% sodium fluorescein (Akorn, Lake Forest, IL, USA) was injected intraperitoneally, and images were acquired using StreamPix software 3 to 5 and 7 to 10 minutes later. A previously described scheme was used to grade the lesions: faint or mottled fluorescence without leakage was scored as 0; hyperfluorescence without increase in size or intensity was scored as 1 (mild leakage); hyperfluorescence of constant size but increasing intensity was scored as 2A (moderate leakage); and hyperfluorescence with increase in both size and intensity was scored as 2B (clinically significant leakage).

[0188]

[0189] Choroidal flat mount technique

[0190] On day 7 after CNV induction (+7 days), eyes were enucleated and fixed in 4% paraformaldehyde for 30 minutes. The retina was removed from the underlying choroid and sclera to generate choroidal flat mounts. Alexa Fluor 488-conjugated to isolectin B4 (1:100, Invitrogen, Carlsbad, CA, USA, I21411) was used to stain the eyecups overnight at 4°C. PermaFluor aqueous mount (Thermo Scientific, Waltham, MA, USA) was then used to flat mount the eyecups with the choroid facing upward and the sclera facing downward. Flat mount images were captured using an LSM 800 with an Airyscan detector (Carl Zeiss, Oberkochen, Germany). ImageJ software was used to measure CNV lesion size and analyzed according to methods described in a previous study.

[0191]

[0192] Immunohistochemical staining

[0193] On day 1 after CNV induction, enucleated mouse eyes were fixed with 4% paraformaldehyde for 1 h at room temperature, cryoprotected in 30% sucrose solution overnight at 4°C, and embedded in OCT compound. Eyes were cryosectioned at 15 μm thickness. For immunofluorescence, sections were blocked with blocking buffer (0.5% Triton, 0.2% BSA, and 5% donkey serum in PBS) for 1 h at room temperature and then incubated with primary antibodies overnight at 4°C. After washing, the samples were incubated with secondary antibodies for 1 h at room temperature. Rabbit anti-p-PDHE11α (1:100; MilliporeSigma, Burlington, MA, USA, AP1062), rabbit anti-PDK4 (1:200; Sigma-Aldrich, St. Louis, MO, USA, HPA056731) were used as primary antibodies, and Alexa Fluor 488-conjugated donkey anti-rabbit antibody (1:500; Thermo Fisher Scientific, Waltham, MA, USA, A21206) was used as secondary antibody.

[0194]

[0195] cell culture

[0196] Primary human RPE (hRPE) cells (Lonza, Walkersville, MD, USA) at passages 5 to 6 were used in the present invention. Primary hRPE cells were cultured in basal medium containing supplements (RtEGM Bulletkit; Lonza). For subculture, ReagentPack™ Subculture Reagents (Lonza, CC-5034), including Trypsin / EDTA (CC-5012), Trypsin Neutralizing Solution (CC-5002), and HEPES Buffered Saline Solution (CC5022), were used according to the manufacturer's instructions. Primary hRPE cells were cultured in basal medium containing supplements (RtEGM BulletKit; Lonza, 00195409) at 37°C in a 5% CO2 humidified incubator. Primary hRPE cells were seeded onto each culture plate in 2% FBS / RtEGM medium, and the medium was replaced with serum-free RtEGM medium after 24 h. Confluent primary hRPE cells were washed and treated with an inflammatory cytokine mixture (ICM) containing IL-1β (5 ng / mL), TNF-α (5 ng / mL), and IFN-γ (5 ng / mL) diluted in serum-free RtEGM medium for 24 h. Human recombinant IL-1β (201-LB-010 / CF), TNF-α (210-TA-100 / CF), and IFN-γ (285-IF-100 / CF) were purchased from R&D Systems (Minneapolis, MN, USA).

[0197]

[0198] siRNA transfection

[0199] Predesigned siRNAs targeting human Pdk1 (5163-1), Pdk2 (5164-1), Pdk3 (5165-1), and Pdk4 (5166-2) and siControl (SN-1003) were purchased from Bioneer (Daejeon, South Korea). The sequences of the specific siRNAs used for siRNA transfection are shown in Table 21.

[0200] Sequence number name sequence list (5'-> 3')1Human siPDK1_SenseGUGUAGAUUAGAGGGAUGU2Human siPDK1_AntisenseACAUCCCUCUAAUCUACAC3Human siPDK2_SenseGGAAAGGAGUUACACCCGU4Human siPDK2_AntisenseACGGGUGUAACUCCUUUCC5Human siPDK3_SenseCUAAACACAUAAGGAAGUAU6Human siPDK3_AntisenseAUACUUCCUAUGUGUUUAG7Human siPDK4_SenseCUCUUCAGUGCAAUUGGU8Human siPDK4_AntisenseAACCAAUUGCACUGAAGAG

[0201] siRNA transfection was performed using Lipofectamine RNAiMax and Opti-MEM (Thermo Fisher Scientific, Waltham, MA, USA) according to the manufacturer's instructions. Briefly, primary human RPE (hRPE) cells were cultured in 12-well plates and transfected with human PDK isoforms (siPdk1-4) and a negative control (siControl) at 60–70% confluency. The following day, siRNA-transfected primary hRPE cells were treated with ICM for 24 h and then harvested for qPCR and optical coherence tomography (OCR) analysis.

[0202]

[0203] quantitative real-time polymerase chain reaction (qPCR)

[0204] Total RNA was extracted from mouse tissues or primary hRPE cells using QIAzol lysis reagent (Qiagen, Waltham, MA, USA) according to the manufacturer's instructions. Total RNA was used for cDNA synthesis using a cDNA synthesis kit (Thermo Scientific, Waltham, MA, USA). qPCR analysis was performed on a ViiA7 real-time PCR system (Applied Biosystems, Hammonton, NJ, USA) using Luna Universal qPCR Master Mix (New England Biolabs, Ipswich, MA, USA). The sequences of specific primers used for real-time PCR are shown in Table 22.

[0205] 서열번호명칭서열목록 (5'-> 3')9Mouse IL-1β_Forward PrimerAGTTGACGGACCCCAAAAGAT10Mouse IL-1β_Reverse PrimerGTTGATGTGCTGCTGCGAGA11Mouse IL-6_Forward PrimerAAGTCGGAGGCTTAATTACACATGT12Mouse IL-6_Reverse PrimerCCATTGCACAACTCTTTTCTCATT13Mouse MCP-1_Forward PrimerGCATCCACGTGTTGGCTCA14Mouse MCP-1_Reverse PrimerCTCCAGCCTACTCATTGGGATCA15Mouse 36B4_Forward PrimerACCTCCTTCTTCCAGGCTTT16Mouse 36B4_Reverse PrimerCTCCAGTCTTTATCAGCTGC17Human IL-1β_Forward PrimerATGCACCTGTACGATCACTG18Human IL-1β_Reverse PrimerACAAAGGACATGGAGAACACC19Human IL-6_Forward PrimerAGTGAGGAACAAGCCAGAGC20Human IL-6_Reverse PrimerCAGGGGTGGTTATTGCATCT21Human IL-8_Forward PrimerGACATACTCCAAACCTTTCCACCC22Human IL-8_Reverse PrimerCCAGACAGAGCTCTCTTCCATCAG23Human MCP-1_Forward PrimerCTCATAGCAGCCACCTTCATTC24Human MCP-1_Reverse PrimerTCACAGCTTCTTTGGGACACTT25Human PDK4_Forward PrimerGTATGTTCCTCCTCACCTCCATCA26Human PDK4_Reverse PrimerTGTTGCCCGCATTGCAT27Human 36B4_Forward PrimerCAACCCAGCTCTGGAGAAAC28Human 36B4_Reverse PrimerGTGAGGTCCTCCTTGGTGAA

[0206] Western blot analysis

[0207] Mouse tissues or primary hRPE cells were lysed in RIPA buffer (Thermo Scientific, Waltham, MA, USA) containing a phosphatase inhibitor cocktail (Sigma-Aldrich, St. Louis, MO, USA). Protein concentration was measured using the BCA protein assay (Thermo Scientific, Waltham, MA, USA). Lysates were separated on Nupage 4–12% Bis-Tris Mini Protein Gel (Thermo Scientific, Waltham, MA, USA), and the dissolved proteins were transferred to a PVDF membrane (polyvinylidene difluoride membrane; EMD Millipore, Billerica, MA, USA). PVDF membranes were immunoblotted with the following primary antibodies: anti-PDK1 (Enzo Life Sciences, Farmingdale, NY, USA, ADI-KAP-PK112), anti-PDK2 (Abcam, Cambridge, MA, USA, ab68164), anti-PDK3 (Abnova, Taipei, Taiwan, PAB4563), anti-PDK4 (Abcam, Cambridge, MA, USA, ab110336), anti-p-PDHE1α (MilliporeSigma, Burlington, MA, USA, AP1062), anti-pyruvate dehydrogenase (Cell Signaling Technology, Danvers, MA, USA, 2784), anti-heat shock protein 90 (Cell Signaling Technology, Danvers, MA, USA, 4874), and anti-β-actin (Sigma-Aldrich, St. Louis, MO, USA, A5441). Anti-heat shock protein 90 was used as a loading control.

[0208]

[0209] Cytokine enzyme-linked immunosorbent assay (ELISA)

[0210] Secretion levels of human IL-6, IL-8, and MCP-1 in cell culture media were measured using ELISA kits according to the manufacturer's instructions. Uncoated human IL-6 (88-7066-76) and MCP-1 (88-7399-76) ELISA kits were purchased from Thermo Scientific (Waltham, MA, USA). Coated human IL-8 ELISA kit (D8000C) was purchased from R&D Systeem (Minneapolis, MN, USA). Results were expressed as pg / mL of sample.

[0211]

[0212] Oxygen consumption measurement

[0213] OCR was measured using an XFe96 Extracellular Flux Analyzer (Seahorse Biosciences, Billerica, MA, USA). Primary hRPE cells were seeded at 1.4 × 10 5Cells were seeded at a density of 10 cells / well. On day 3, cells were treated with ICM diluted in fresh serum-free medium with or without DCA and GM10395 for 24 h. Afterwards, cells were transferred to XFe96 cell culture plates (96-well) containing assay medium, and the assay plates were incubated for 5 h at 37 °C and 5% CO2. The assay medium consisted of XF DMEM medium pH 7.4 (Agilent TECHNOLOGIES, Santa Clara, CA, USA) supplemented with Seahorse XF 1.0 M Glucose Solution (25 mM), Seahorse XF 100 mM Pyruvate Solution (1 mM), and Seahorse XF 200 mM Glutamine Solution (2 mM). Inhibitors and uncouplers were used at the following concentrations: oligomycin A (1 μM, Sigma-Aldrich), FCCP (carbonyl cyanide 4-(trifluoro-methoxy) phenylhydrazone, 1 μM, Sigma-Aldrich), and rotenone (1 μM, Sigma-Aldrich). DAPI-stained cells were automatically counted using ImageXpress Micro Confocal Microscopy (Molecular Devices, San Jose, CA, USA) to normalize to cell number.

[0214]

[0215] Cellular peroxide detection

[0216] MitoSOX to detect mitochondrial superoxide formation in primary hRPE cells treated with ICM containing or not DCA (10 uM) or GM10395 (1 uM) for 24 h. TMRed Mitochondrial Superoxide Indicator (Thermo Scientific, Waltham, MA, USA, M36008) was used. Primary hRPE cells were seeded at 2 × 10 in black wall / clear bottom 96-well plates (Greiner Bio-One, Kremsmünster, Austria). 4 were seeded at a density of 10 cells / well. At the end of the experiment, primary hRPE cells were treated with MitoSOX (5 uM) and NucBlue TM Live ReadyProbes TM The cells were incubated in PBS containing reagent (Hoechst 33342) solution (Thermo Scientific, Waltham, MA, USA, R376505) at 37°C for 10 min. Mitochondrial superoxide images were acquired using an ImageXpress Micro Confocal High-Content Imaging System (Molecular Devices) in confocal mode (60 μm pinhole spinning) with a 10X Plan Fluor objective. Image planes were acquired using DAPI and TRITC. The average fluorescence intensity was automatically quantified using ImageXpress Micro Confocal Microscopy (Molecular Devices, San Jose, CA, USA).

[0217]

[0218] Immunofluorescence technique for mitochondrial morphology

[0219] Primary hRPE cells were seeded at 6 × 10 in black wall / clear bottom 96-well plates (Greiner Bio-One, Kremsmünster, Austria). 3Cells were seeded at a density of 10 cells / well. At the end of the experiment, primary hRPE cells were fixed with 4% paraformaldehyde and then permeabilized in PBS containing 0.1% Triton X-100 and 0.1 M glycine. After washing with PBS, cells were incubated overnight at 4 °C with primary antibody against TOM20 (translocase of outer mitochondrial membrane 20) (1:100; Santa Cruz Biotechnology, Santa Cruz, CA, USA, sc-11415). Alexa Fluor 594-conjugated donkey anti-rabbit antibody (1:100; Thermo Fisher Scientific, Waltham, MA, USA, A21207) was used as a secondary antibody and incubated for 2 h at room temperature. Nuclei were stained with DAPI solution (Thermo Fisher, Waltham, MA, USA, 62248). Images of primary hRPE cells were acquired using an ImageXpress Micro Confocal High-Content Imaging System (Molecular Devices) in confocal mode (60 μm pinhole spinning) with a 60X Plan Fluor objective. 2.4 mm z-stacks with a 0.4 mm inter-plane spacing were acquired using DAPI and Texas Red. Two-dimensional projections were generated to represent maximum intensity and processed using MetaXpress (Molecular Devices) using the “Flatten Background” function to provide clear mitochondrial structure. Mitochondrial area in each cell was quantified using the Fiji plugin (NIH) in ImageJ software.Total mitochondrial area contours were determined by thresholding low-pass filtered images. To analyze fluorescence intensity at the cellular level, image processing software was used to quantify fluorescent pixels by applying a region of interest (ROI) to individual cells. The average cellular fluorescence intensity was obtained by dividing the sum of the total fluorescence intensities obtained from each image by the number of cells in that image. For statistical analysis, the fluorescence intensity values ​​per cell were replicated according to the number of cells analyzed in each image, and the mean and standard error of the mean (SEM) were calculated based on these values.

[0220]

[0221] statistics

[0222] Data were presented using Prism v. 6.0 (GraphPad Software, San Diego, CA, USA), and statistical analyses were performed using IBM SPSS Statistics v. 21.0 (SPSS Inc., Chicago, IL, USA). Results are expressed as the mean ± standard error of the mean (mean ± SEM). A two-sample t-test was used to compare two groups. Multiple group comparisons were performed using one-way or two-way ANOVA with Tukey's multiple comparisons. Statistical significance was defined as P < 0.05.

[0223]

[0224] Research Approval

[0225] All mouse experiments followed the guidelines of the Statement for the Use of Animals in Ophthalmic and Vision Research of the Association for Research in Vision and Ophthalmology and were approved by the Animal Experimentation Ethics Committee of Kyungpook National University (Approval No. 2019-0104-1).

[0226]

[0227] While the present invention has been described in detail through representative examples above, those skilled in the art will understand that various modifications to the above-described embodiments are possible without departing from the scope of the present invention. Therefore, the scope of the present invention should not be limited to the described embodiments, but should be defined not only by the claims described below but also by all changes or modifications derived from the claims and equivalent concepts.

[0228] The purpose of the present invention is to provide a pharmaceutical composition for preventing or treating macular degeneration.

[0229] Another object of the present invention is to provide a food composition for preventing or improving macular degeneration.

[0230] Another object of the present invention is to provide a pharmaceutical composition for preventing or treating neovascular ocular disease.

[0231] Another object of the present invention is to provide a food composition for preventing or improving neovascular eye disease.

[0232] Another object of the present invention is to provide a method for treating macular degeneration.

[0233] Another object of the present invention is to provide a method for treating neovascular eye disease.

[0234] Another object of the present invention is to provide novel uses of PDK inhibitors.

Claims

1. A pharmaceutical composition for alleviating, inhibiting, preventing or treating macular degeneration, comprising a pyruvate dehydrogenase kinase (PDK) inhibitor.

2. A composition according to claim 1, wherein the pyruvate dehydrogenase kinase inhibitor is a pyruvate dehydrogenase kinase 4 (PDK4) inhibitor.

3. In the second paragraph, the pyruvate dehydrogenase kinase 4 inhibitor comprises GM10395 or a salt thereof represented by the following chemical formula 1: [Chemical Formula 1] .

4. A composition according to claim 1, wherein the macular degeneration is age-related macular degeneration (AMD).

5. A composition according to claim 4, wherein the age-related macular degeneration is late age-related macular degeneration (late AMD).

6. A pharmaceutical composition according to claim 4, wherein the age-related macular degeneration is neovascular age-related macular degeneration (Neovascular AMD).

7. A pharmaceutical composition according to claim 1, wherein the pharmaceutical composition is administered intraocularly, periocularly, retroocularly, subretinally, centrally, outside the fovea, subconjunctivally, intravitreally, intracamerally, or suprachoroidally.

8. A food composition for alleviating, inhibiting or improving macular degeneration, comprising a pyruvate dehydrogenase kinase (PDK) inhibitor.

9. A pharmaceutical composition for alleviating, inhibiting, preventing or treating neovascular ocular disease, comprising a pyruvate dehydrogenase kinase (PDK) inhibitor.

10. A composition according to claim 9, wherein the pyruvate dehydrogenase kinase inhibitor is a pyruvate dehydrogenase kinase 4 (PDK4) inhibitor.

11. In the 10th paragraph, the pyruvate dehydrogenase kinase 4 inhibitor comprises GM10395 or a salt thereof represented by the following chemical formula 1: [Chemical Formula 1] .

12. A composition according to claim 9, wherein the neovascular eye disease is corneal neovascularization, retinal neovascularization, choroidal neovascularization, intraocular neovascularization, neovascular glaucoma, proliferative diabetic retinopathy, neovascular macular degeneration, or retinopathy of prematurity.

13. A food composition for alleviating, suppressing or improving neovascular ocular disease, comprising a pyruvate dehydrogenase kinase (PDK) inhibitor.

Images