Recombinant vibrio sp. strain producing polyhydroxyalkanoates and method for producing polyhydroxyalkanoic acid by using same

Abstract

The present invention relates to a recombinant Vibrio sp. strain producing polyhydroxyalkanoates (PHA) and a method for producing polyhydroxyalkanoates using same. A recombinant Vibrio sp. dhg strain with an enhanced PHA production pathway was developed by inserting an optimized phaCAB gene from Cupriavidus necator into a Vibrio sp. dhg gene. Brown microalgae, a type of marine biomass, can be used as a carbon source, either directly or through processing, as a raw material for PHA production, thereby producing PHA in a manner that is environmentally friendly and highly efficient.

Description

Recombinant Vibrio spp. strain producing polyhydroxyalkanoic acid and method for producing polyhydroxyalkanoic acid using the same

[0001] The present invention relates to a recombinant Vibrio sp. strain producing polyhydroxyalkanoates (PHA) and a method for producing polyhydroxyalkanoates using the same, and more particularly, to a Vibrio sp. dhg strain improved by recombining it to produce polyhydroxyalkanoates and a method for producing polyhydroxyalkanoates using brown algae, a marine biomass.

[0002] The white bio industry is steadily growing, and demand for bioplastic production to address plastic pollution will continue to grow. Among these, polyhydroxyalkanoates (PHAs), known for their excellent biodegradability, have a promising market outlook. There is a strong need for technologies to produce them, particularly those that are environmentally friendly.

[0003] PHA is a type of biodegradable bioplastic that serves as a carbon storage source for microorganisms and accumulates in the form of granules within cells. Cupriavidus necator is a representative strain known to naturally produce large amounts of PHA. PHA, a type of polyester, has properties that vary depending on the composition of its monomers, and there are many different types. The most basic and representative of these is the homopolymer composed of the monomer 3-hydroxybutyrate (3HB).

[0004] While numerous examples of recombinant strains developed to increase PHA productivity have been published, relatively few studies have utilized marine biomass as a carbon source. Among these, brown macroalgae are a suitable next-generation biomass feedstock. Compared to terrestrial starch crops, brown algae grow rapidly and produce significantly more biomass per unit area. However, no studies have been reported on their direct use to produce PHA.

[0005] Although there have been many cases of developing various recombinant strains to increase PHA productivity, relatively few have utilized marine biomass as a carbon source, and no research has been reported on directly using brown algae to produce PHA. Therefore, the present invention aims to develop a recombinant strain capable of producing PHA, a bioplastic, with high productivity by introducing foreign genes into Vibrio sp. dhg, which has the metabolic ability to marine biomass such as brown algae, which is suitable as a next-generation biomass feedstock, and to develop and provide a method for producing polyhydroxyalkanoic acid using the strain.

[0006] The present invention provides a recombinant Vibrio sp. dhg characterized in that the phaC gene encoding PHA synthase, the phaA gene encoding 3-ketothiolase, and the phaB gene encoding acetoacetyl coenzyme A reductase are introduced from outside and transformed so that the above genes are expressed.

[0007] Meanwhile, in the present invention, the phaC gene, phaA gene, and phaB gene are preferably located on an operon.

[0008] Meanwhile, in the present invention, it is preferable to use the phaC gene, phaA gene, and phaB gene derived from Cupriavidus necator.

[0009] In addition, the present invention provides a method for producing polyhydroxyalkanoic acid, characterized by culturing the recombinant Vibrio sp. dhg using brown algae as a carbon source.

[0010] The present invention developed a recombinant Vibrio sp. dhg strain with an enhanced PHA production pathway, and can produce PHA with high productivity in an environmentally friendly manner by using brown algae, a marine biomass, as a carbon source, either directly or through processing, as a raw material for PHA production.

[0011] Figure 1 is a schematic diagram showing the synthetic route of polyhydroxybutyrate (PHB).

[0012] Figure 2 shows the PHA production results (PHB content) of the Vibrio natriegens wild type strain and Vibrio natriegens / pACYC_phaCAB.

[0013] Figure 3 is a schematic diagram of the production process of a recombinant Vibrio sp. dhg strain producing PHA.

[0014] Figure 4 shows the PHA production results (PHB content) of a recombinant Vibrio sp. dhg strain producing PHA.

[0015] Figure 5 is a schematic diagram of a process for producing a recombinant strain for PHA production of the present invention and a process for producing and analyzing PHA using the same.

[0016] Figure 6 shows the strains and plasmids used in the examples and experimental examples of the present invention.

[0017] Demand for bioplastic production to address plastic pollution is increasing, and among these, polyhydroxyalkanoates (PHAs) are a type of bioplastic with excellent biodegradability. While numerous recombinant strains have been developed to increase PHA productivity, relatively few have utilized marine biomass as a carbon source. Therefore, the present invention aims to develop a recombinant strain capable of metabolizing marine biomass, such as brown algae, suitable as a next-generation biomass feedstock, while also exhibiting high PHA productivity, and to provide a method for producing PHA using the strain.

[0018] A representative example of PHA is polyhydroxybutyrate (PHB), and its production process is as follows: 3-ketothiolase (phaA) converts acetyl-CoA into acetoacetyl-CoA, acetoacetyl coenzyme A (acetoacetyl-CoA) reductase (phaB) converts this into 3-hydroxybutyrate-CoA, and then PHA synthase (phaC) polymerizes this to synthesize PHB (Figure 1).

[0019] Accordingly, the present invention provides a recombinant Vibrio sp. dhg characterized in that it is transformed so that the phaC gene encoding PHA synthase, the phaA gene encoding 3-ketothiolase, and the phaB gene encoding acetoacetyl coenzyme A reductase are introduced from outside and expressed. The recombinant Vibrio sp. dhg transformed in this way can produce PHA.

[0020] At this time, the phaC gene, phaA gene, and phaB gene are preferably located on an operon. Meanwhile, the operon is preferably present as a phaCAB operon. In the present invention, in order to maximize the expression amount while maintaining the enzyme activity of the protein, codon optimization of the coding sequence, promoter optimization to maximize transcription efficiency, and operon and 5'-UTR (untranslated region) optimization were performed to maximize the efficiency of several genes expressed polycistronically. This was performed on a computer using the De novo DNA algorithm, and after removing some of the repetitive sequences and restriction enzyme recognition sequences based on the automatic design of the computer, it was completed through repeated modification-expression amount prediction work several times.

[0021] Meanwhile, in the present invention, the transformation preferably utilizes the natural transformation mechanism, which is characteristic of the genus Vibrio, in which genes from outside the cell are introduced into the cell and homologous recombination occurs. At this time, the efficiency of natural transformation can be increased by overexpressing the master regulator gene called tfox. The tfox gene is preferably derived from Vibrio cholerae.

[0022] Meanwhile, in the present invention, it is preferable to use the phaC gene, phaA gene, and phaB gene derived from Cupriavidus necator.

[0023] In addition, the present invention provides a method for producing polyhydroxyalkanoic acid, characterized by culturing the recombinant Vibrio sp. dhg using brown algae as a carbon source. At this time, the brown algae is not limited to any one belonging to the group, but for example, kelp can be used, and alginate and mannitol, which are sugars constituting brown algae, can also be used as a carbon source. In this way, PHA productivity can be increased by using brown algae or brown algae-simulating components as a carbon source and culturing the recombinant Vibrio sp. dhg.

[0024] Meanwhile, the term 'expression' used in the present invention means introducing an external gene into the strain to artificially express an enzyme that the Vibrio sp. dhg of the present invention cannot express on its own.

[0025] Meanwhile, according to the following experiment, the present invention introduced the phaCAB operon into the model strain Vibrio natriegens and transformed it to produce a recombinant strain, and it was confirmed that this strain had improved PHA productivity compared to the wild-type strain. Accordingly, the above operon was introduced into Vibrio sp. dhg, a marine microorganism with evolutionary similarity and which has the ability to metabolize brown algae components and a fast growth rate, and transformed it to produce a recombinant strain, and PHA productivity was significantly improved compared to the wild-type strain. In particular, the recombinant Vibrio sp. dhg of the present invention was able to improve PHA productivity even when cultured using brown algae or brown algae-mimetic components (a mixture of alginic acid and mannitol, which are the main sugars constituting brown algae) as a carbon source.

[0026]

[0027] Hereinafter, the present invention will be described in more detail through the following examples. However, the scope of the present invention is not limited to the following examples, but includes modifications of technical concepts equivalent thereto.

[0028]

[0029] The strains, plasmids, primers, and DNA sequences used in the examples and experimental examples of the present invention are shown in Tables 1 and 2 and Figure 6 below.

[0030] Primers usedPrimer nameSequence (5'→3')Sequence informationBsu36I_FRT_Priming_RCGACCCTCAGGGATCTCGCGATGCGAAGTTCSequence number 1SphI_Frt_FGAGCATGCAGATCTCGCGATGCGAAGTTCSequence number 2SphI_phaCAB_RCTGCATGCCTCAAATGCCTGAGGTTTCAGSequence number 3phaCAB_Frt_Gibson_RTTCGCATCGCGAGATCTGCATGCTCCAGCAAAAAACCCCTCAAGACCSequence number 4phaCAB_Gibson_Frt_BamHI_RGTATAGGAACTTCGCATCGCGAGATCTGGCAAAAAACCCCTCAAGACCCGSequence number 5phaCAB_UP_Gibson_Hom1_BamHI_FCTTTAACTATGAAATACCTGTTCTCTGTCAATTGGATATCGGCCGGCSequence number 6phaC_RTCATGCTTTTGCTTTAACGTAACGACSEQ ID NO: 7DHG_dns_recomb_check_RTGAATTCGTACCAGCCGTTTGGATCSEQ ID NO: 8DHG_dns_recomb_check_FGATGCGAATCGCCGCACTTCSEQ ID NO: 9Ddns_Hom1_Gibson_NcoI_FGTTTAACTTTAATAAGGAGATATACCCTTTCTTAGTGATTGGGTCACTCATTGSEQ ID NO: 10Ddns_Hom2_gibson_KpnI_RGTTTCTTTACCAGACTCGAGGGTACGCGTTGCGCTTCAAGCATCATGSEQ ID NO: 11FRT_Gibson_Ddns_Hom2_RTTGGTGAGGAGGATCCCTTAGGATTCCGAAGTTCCTATTCTGGSEQ ID NO: 12Ddns_Hom2_Gibson_FRT_FAATCCTAAGGGATCCTCCTCACCAATCGCGATGATCGSEQ ID NO. 13Ddns_Hom1_Gibson_FRT_RTACCCCATGGGGCTAAAGTCTTTAAAAAGTATGACTTTATCCATTCSEQ ID NO.14Frt_Gibson_DHGdnsHom_up_FTTAAAGACTTTAGCCCCATGGCTCGAGTGGATCCAGATCTCGCGATGSEQ ID NO: 15

[0031] DNA sequence usedGene nameSequence informationRemarksphaC (codon optimized)SEQ ID NO: 16phaA (codon optimized)SEQ ID NO: 17phaB (codon optimized)SEQ ID NO: 18phaCAB (total sequence)SEQ ID NO: 19Promoter, including UTRtfoXvcSEQ ID NO: 20flpSEQ ID NO: 21

[0032]

[0033] [Example 1: phaCAB gene discovery and DNA preparation]

[0034] The production pathway of PHB is as shown in Figure 1. 3-ketothiolase (phaA) converts acetyl-CoA into acetoacetyl-CoA, acetoacetyl coenzyme A (acetoacetyl-CoA) reductase (phaB) converts it into 3-hydroxybutyrate-CoA, and then PHA synthase (phaC) polymerizes it to synthesize a PHA polymer. In the case of the wild type Vibrio sp. dhg, PHA is accumulated in small amounts at the level of 1 to 2% (Figure 2). Therefore, in the present invention, the gene operon (phaCAB) of the Cupriavidus necator strain, which is the most widely used PHB strain, is used. CN operon, phaCAB CN It was decided to introduce the subscript 'CN' of operon (also italicized, same as below).

[0035] phaCAB, a foreign gene CNIn order to effectively express dhg, gene refactoring work was performed. In order to maximize the expression level while maintaining the amino acid sequence of the protein and enzyme activity, codon optimization of CDS (coding sequence), promoter optimization to maximize transcription efficiency, and operon and 5'-UTR (untranslated region) optimization to maximize the translation efficiency of multiple genes expressed polycistronically were performed. This work was performed on a computer using the algorithm of 'De Novo DNA (https: / www.denovodna.com / software / )', and after removing some repetitive sequences and restriction enzyme recognition sequences based on the automatic design of the computer, it was completed through several rounds of modification-expression level prediction work. Finally, the designed phaCAB CN The operon used the UP-J23119 promoter and was synthesized with homologous sequences attached to the ends for cloning into the pACYC plasmid (gBlocks, Integrated DNA Technologies).

[0036] The DNA was synthesized in two fragments, and the pACYCDuet vector was treated with restriction enzymes XhoI and PacI. The two synthesized DNA fragments were joined together by Gibson assembly, and then cloned into the chemically competent Mach-T1 strain by heat shock transformation. The resulting vector was transformed into Vibrio natriegens (V. nat), a model strain evolutionarily closer to and more widely studied than Vibrio sp. dhg.

[0037] The method for producing electrocompetent cells for plasmid transformation of Vibrio is as follows. The strain was inoculated into complex media LBv2 (Luria Broth supplemented with v2 salts (NaCl 20.4 mM, MgCl 2 3.14 mM, KCl 4.2 mM)) and grown overnight at 30℃ and 250 rpm. Then, it was subcultured into LBv2 to an OD (OD600) of 0.05 and grown in a flask to an OD of 0.3 to 0.6 and washed twice with electroporation buffer (680 mM sucrose, 7 mM K2HPO4). One 100 μl of competent cells was prepared per 5 ml of culture medium, and 100 to 1,000 ng of plasmid was added thereto, and a pulse was applied at 800 V and 200 Ω. In this way, the pACYC_phaCAB vector was transformed into Vibrio natriegens and selection was performed using LBv2 solid medium containing 10 μg / ml of chloramphenicol (Cm).

[0038]

[0039] [Experimental Example 1: Confirmation of Enhanced PHA Production Capacity through Plasmid Expression in Vibrio of Example 1]

[0040] This experimental example is phaCAB in Vibrio of Example 1 above. CN To confirm the improvement of PHA production capacity through plasmid expression, Vibrio natriegens / pACYC_phaCAB transformed with the pACYC_phaCAB vector and the Vibrio natriegens wild type strain were cultured on LBv2 complex medium to confirm the amount of PHA accumulation.

[0041] First, the cells were grown overnight in LBv2 medium, then inoculated into 50 ml of LBv2+glycerol (LBv2 complex medium with 10 g / L glycerol added) and cultured in a 250 ml baffled flask for 24 hours. As with the seed culture, the cells were cultured at 30°C and 250 rpm. After 24 hours, an amount equivalent to 10 g / L of glycerol was added while maintaining the salt concentration, and the cells were cultured for an additional 24 hours. At 48 hours, the culture medium was taken and placed in a conical tube, and a cell pellet was obtained using a swing rotator, which was then dried in a freeze dryer for more than 48 hours. After measuring the dry cell weight (DCW), the amount of PHB was determined through methanolysis and gas chromatography (GC) analysis.

[0042] Methanolysis was performed by placing approximately 50 mg of dry cells in a 12 ml PTFE vial, adding 2 ml of chloroform, 1.9 ml of 15% sulfuric acid in methanol, and 100 μl of benzoic acid (internal standard, final concentration 50 mg / l) in methanol. The reaction was performed in an oil bath at approximately 90°C for approximately 4 hours or in an oven at 65°C for more than 48 hours. After the reaction was completed, 2 ml of DDW (distilled distilled water) was added and vortexed. When layer separation occurred, the chloroform layer was collected and centrifuged to completely separate the water that followed. Finally, the sample was filtered using a hydrophobic filter to complete the preparation of the sample for GC. Reliability was increased by performing each reaction with a PHB standard (Sigma-Aldrich). GC analysis was performed using an Agilent 7890B instrument, and the settings are as shown in Table 3 below.

[0043] Gas chromatography (GC) equipment settings Rate (℃ / min) Value (℃) Hold time min Run time min Initial 90 11 Ramp 18 15 0 5 13.5 Ramp 21 5 20 0 4 20.833 Split ratio: 41.049:1, split flow: 31.239 ml / min, column: HP-5, injection: 1 ㎕

[0044]

[0045] The GC results obtained in this way were normalized by dividing the area value of each peak by the area of ​​the internal standard, benzoic acid peak (6.9~7.0 min), and then analyzed. As a result, as shown in Fig. 2, the Vibrio natriegens wild-type strain was measured to have a DCW of 9.13 g / L and a PHB content of 1.53%, and in the case of Vibrio natriegens / pACYC_phaCAB, a DCW of 9.60 g / L and a PHB content of 52.67% were measured. The formation of a similar level of biomass under the same conditions means that cell growth was not significantly inhibited by the introduced foreign gene, and at the same time, it was confirmed that PHB was well produced, so it was confirmed that phaCAB was present in the genome of Vibrio sp. dhg. CN The work was carried out to introduce operons.

[0046]

[0047] [Example 2: Production of a recombinant Vibrio sp. dhg strain for PHA production]

[0048] 1) pACYK_H1-phaCAB CN -CAT-H2 plasmid cloning process

[0049] phaCAB in the genome of Vibrio sp. dhg CNIn order to recombine, the dnslocus (DNA endonuclease) of chromosome 1 was targeted, and the loss of the corresponding gene is appropriate because it does not affect cell viability or growth. Genome recombination will be carried out using natural transformation and flp recombinase, which will be described later. For this, the homologous sequences upstream and downstream of the dnslocus had to be attached to both sides of the insert gene to be introduced. First, Vibrio sp. The gDNA of dhg was extracted and PCR amplified about 1 kb each upstream and downstream of the dnslocus. The frt-cat-frt sequence was obtained by PCR from pMD19-Hom1-cat-Hom2 (for V. nat dns, previous study), and overhangs were added to both the homology and frt-cat-frt sequences so that they had 25 bp of homology sequence for Gibson assembly. After treating the pACYK vector with restriction enzymes NcoI and PacI, the three DNA fragments of upstream, downstream, and frt-cat-frt were joined by Gibson assembly and cloned using Mach-T1 in the same process as above. The pACYK_H1_cat_H2 vector obtained in this way was treated with restriction enzyme BamHI and then PCR-amplified. CN The final 'pACYK_H1-phaCAB' was assembled with operon DNA fragments and Gibson CN -CAT-H2 plasmid' was obtained, and finally, tDNA (transfer DNA) was obtained by PCR amplification with primers attached to both ends of homology.

[0050]

[0051] 2)phaCAB in the genome of Vibrio sp. dhgCN operon recombination

[0052] Vibrio sp. dhg has natural competence, so it can import linear DNA from outside the cell into the cell, and when there is a sequence homologous to the genome, homologous recombination occurs. This series of processes is called natural transformation. This mechanism is influenced by a master regulator gene called tfoX, and the efficiency of natural transformation can be increased by overexpressing this gene. Therefore, pRSF_tfoX was added to Vibrio sp. dhg. VC _up (tfoX derived from Vibrio cholerae) was transformed using the electroporation method described above and selected using KLBv2 solid medium containing 100 μg / ml of kanamycin (Kan). The strain was inoculated into KLBv2 liquid medium containing 200 μg / ml of Kan and grown overnight at 30°C and 250 rpm, then subcultured onto KLBv2 + IPTG 100 μM medium to an OD of 0.05 and inducible for 3 hours at 30°C and 250 rpm. The promoter of the tfoX gene is pTac, and its expression is regulated by IPTG. Afterwards, 1,000 ng of tDNA was added to 350 μl of instant ocean media, and the induced strain was diluted to an OD of 0.05, mixed well, and incubated statically at 30°C for 5 hours. 1 ml of LBv2 was added as is, and recovery was performed for about 2 hours at 30°C and 250 rpm, and selection was performed using CLBv2 solid medium.

[0053] In the recombinant strain, phaCAB-cat was introduced into the dnslocus region, and pRSF_tfoX VCTo cure the _up vector, IPTG was added to 1,000 μM in CLBv2 liquid medium, grown overnight at 30°C, and then streaked onto CLBv2. When the colonies grew, they were patched onto CKLBv2, and colonies that grew only on CLBv2 medium were collected. The cured strain was transformed with pRSF_ptac_flp using electroporation as described above. After inoculating into KLBv2 + IPTG 100 μM liquid medium, the cells were grown overnight at 30°C and 250 rpm, and colonies that grew on KLBv2 solid medium but not on CKLBv2 medium were collected in the same way as in the curing method. Finally, the pRSF_ptac_flp vector was cured in the same way, and the final 'Vibrio sp. dhg △dns::phaCAB strain' was completed (Fig. 3).

[0054]

[0055] [Experimental Example 2: PHA production using the recombinant strain of Example 2]

[0056] This experimental example was intended to confirm PHA productivity using the recombinant Vibrio sp. dhg strain of Example 2. First, the recombinant Vibrio sp. dhg strain (Example 2) was cultured together with the Vibrio sp. dhg wild strain on 15 ml of LBv2+glycerol complex medium using a 125 ml baffled flask at 37°C and 250 rpm for 48 hours, and the specific conditions were as described above.

[0057] As a result, as shown in Fig. 4, the Vibrio sp. dhg wild strain showed 1.98% PHB accumulation, and the recombinant Vibrio sp. dhg strain (Example 2) showed 45.26% PHB accumulation. Under these conditions, DCW was also similar at 5.26 g / L and 5.82 g / L, respectively, confirming that PHB production was significantly increased without significantly inhibiting growth in Vibrio sp. dhg.

[0058] Meanwhile, coarsely ground kelp powder, a type of brown macroalgae, and alginate+mannitol (1:1 ratio), a sugar mimetic of kelp, were used as the sole carbon source in M9Na (M9 minimal medium with additional NaCl [42 mM Na2HPO4, 22 mM KH2PO4, 258.5 mM NaCl, 18.6 mM NH4Cl, 2 mM MgSO4, 0.1 mM CaCl2]) and used as the medium. 50 ml of the medium was placed in a 500 ml baffled flask and cultured at 37°C and 250 rpm, and the carbon source was added at 24 hours to supply a total of 20 g / L of carbon source. Mimetic medium (medium supplemented with alginate and mannitol) was prepared by collecting all the media at 24 hours and centrifuging them. After transferring all the cell mass to a limited medium without NH4Cl as a nitrogen source in M9Na, only carbon sources were provided and cultured for the remaining 24 hours. DCW measurement, methanolysis, and GC analysis were performed as described above, and accumulation amounts of 58.92% and 8.19% were calculated in the mimetic medium and kelp powder medium, respectively (Fig. 4). In this way, it was confirmed that PHA productivity was greatly increased when brown algae mimics were used, but when kelp powder was directly used as a carbon source, the productivity was relatively low.Since kelp powder was added without going through a pretreatment process, residues that the strain could not metabolize remained, and although it was filtered several times using a cell strainer (40 μm, 70 μm) to separate it from the cell mass, complete separation failed, so an accurate cell dry weight could not be measured. It is possible that the unseparated kelp residue inhibited the methanolysis reaction. Due to the limitations of the process described above, when brown algae was directly used, PHA productivity was measured to be lower than when a mimic was used. However, a significantly higher PHA productivity was confirmed compared to the wild-type strain, and it is highly likely that productivity will increase further if the process is improved.

[0059]

[0060] In summary, the present invention designed the phaCAB gene of Cupriavidus necator strain to produce PHA by using a computer algorithm to obtain the optimal expression level through codon optimization and optimization of UTR, promoter sequences, etc., and then inserted the gene thus produced into the Vibrio sp. dhg genome through homologous recombination to develop a recombinant strain with an enhanced PHA production pathway. Using this strain, brown algae and brown algae-simulating components were provided as the sole carbon source in the medium, and the results of gas chromatography analysis confirmed that the PHA productivity of the improved strain was significantly increased compared to that of the wild type (Fig. 5).

Claims

1. A recombinant Vibrio sp. dhg characterized by being transformed so that the phaC gene encoding PHA synthase, the phaA gene encoding 3-ketothiolase, and the phaB gene encoding acetoacetyl coenzyme A reductase are introduced from outside and expressed.

2. In paragraph 1, The above phaC gene, phaA gene, and phaB gene are, A recombinant Vibrio sp. dhg characterized by being located on an operon.

3. In paragraph 1, The above phaC gene, phaA gene, and phaB gene are, A recombinant Vibrio sp. dhg characterized by being derived from Cupriavidus necator.

4. A method for producing polyhydroxyalkanoic acid, characterized by culturing any one of recombinant Vibrio sp. dhg selected from items 1 to 3 using brown algae as a carbon source.

Images