HPLC-based assays for detecting multiple mRNA constructs

Abstract

The disclosure relates to methods for detecting at least a first mRNA and a second mRNA or two or more mRNAs in a multi-mRNA composition using reverse-phase high pressure liquid chromatography (RP-HPLC). The methods are particularly suitable for analyzing multi- mRNA compositions comprising first and second mRNAs or two or more mRNAs of similar lengths. The disclosed methods also find utility in assessing the quality and / or integrity of each of the at least first and second mRNAs or two or more mRNAs in a multi-mRNA composition. In addition, the disclosed methods can be used to calculate the proportion of each mRNA in a multi-mRNA composition.

Description

[0001] HPLC-BASED ASSAYS FOR DETECTING MULTIPLE MRNA CONSTRUCTS

[0002] CROSS-REFERENCE TO RELATED APPLICATION

[0003] [1] This application claims priority to, and the benefit of, European patent application EP23306994.7 filed on November 17, 2023, the contents of which is hereby incorporated by reference in its entirety.

[0004] SEQUENCE LISTING

[0005] [2] This application contains a Sequence Listing which has been submitted electronically in XML format and is hereby incorporated by reference in its entirety. The XML file, created on 31 October 2024, is named P51839WO -Sequence listing.xml and is 4 kilobytes in size.

[0006] FIELD

[0007] [3] The present disclosure relates to the separation of nucleic acids, for example messenger RNAs (mRNAs), with similar lengths from a mixture. In particular, the disclosure relates to preparative and analytical RP-HPLC methods for the characterization and separation of at least a first mRNA and a second mRNA of similar lengths from a mixture. The method can be utilized for characterizing and separating mRNAs from a mixture, before the mRNAs are packaged into lipid nanoparticles, or after the mRNAs have been extracted from lipid nanoparticles.

[0008] BACKGROUND

[0009] [4] Messenger RNA (“mRNA”) therapy is becoming an increasingly important approach for the treatment of a variety of diseases. mRNA therapy requires effective delivery of the mRNA to the patient and efficient production of the protein encoded by the mRNA within the patient’s body. mRNAs are typically encapsulated in lipid nanoparticles to protect mRNA from degradation before it can reach the target cells or tissue in a patient’s body. Some mRNA therapies (e.g., mRNA-based multicomponent vaccines or mRNA-based antibody therapies) include multiple different mRNAs that are similar in length. These mRNAs may be encapsulated in the same lipid nanoparticle, or in different lipid nanoparticles. [5] For example, mRNA-based multicomponent vaccines may be used to inoculate a patient against different strains or variants of a disease-causing agent (e.g., a multivalent influenza vaccine or a vaccine protection against multiple variants of SARS-CoV2), or against a combination of disease-causing agents (e.g., a combination vaccine protecting against infection with influenza and SARS-CoV2). Development of such multicomponent mRNA vaccines necessitates the development of methods which can be used to assess the presence and / or quality / integrity of multiple mRNAs encoding different antigens in a composition, e.g., after formulation of the vaccine. For instance, it is desirable to confirm whether lipid nanoparticle encapsulation of each mRNA has occurred, or whether each mRNA in an immunogenic composition remains intact after a prolonged period of storage.

[0010] [6] Methods have previously been developed to separate multiple mRNAs in a composition, e.g., for the purpose of ascertaining the quality and / or quantity of each mRNA. For example, WO 2014 / 144039 describes methods for the characterization of mRNA molecules during the mRNA production process. WO 2019 / 036683 describes liquid chromatography methods (e.g., HPLC-based methods) which enable separation of polynucleotides of various lengths, sequences, and / or base compositions. WO 2019 / 036685 describes gradient-based reversed phase HPLC methods for selectively separating polynucleotides comprising one or more hydrophobic portions, including poly-A-tailed mRNAs. WO 2021 / 254593 describes a method for determining the integrity of a mixture comprising at least two mRNAs with different sizes.

[0011] [7] Separating different mRNAs that have the same or similar lengths for assessing the presence and / or quality / integrity of each mRNA in a composition (e.g., a multicomponent vaccine) remains challenging with existing methods. Therefore, a need exists for methods that are capable of separating mRNAs having similar or the same lengths.

[0012] SUMMARY

[0013] [8] The development of a preparative and analytical reverse-phase high pressure liquid chromatography (RP-HPLC) method can be a complex process due to the number of parameters that can impact the resolution of the method. Parameters that may require adjustment may include, e.g., the size of the column, the composition and physical characteristics of the stationary phase, the solvent system, the temperature, the mobile phase gradient as well as the flow rate. These parameters may interact among themselves and thereby impact method performance.

[0014] [9] The present disclosure relates to analytical RP-HPLC methods that are capable of separating two or more mRNAs in a multi-mRNA composition. The methods are particularly suitable for analyzing multi-mRNA compositions comprising two or more mRNAs of similar or identical lengths. The disclosed methods also find utility in assessing the quality and / or integrity of each of the two or more mRNAs in a multi-mRNA composition. In addition, the disclosed methods can be used to calculate the proportion of each mRNA in a multi-mRNA composition.

[0015]

[0010] In one aspect, the disclosure relates to a method for detecting at least a first mRNA and a second mRNA in a composition using reverse-phase high pressure liquid chromatography (RP-HPLC), wherein said first mRNA and said second mRNA are of similar length, comprising: (i) providing an RP-HPLC column comprising a stationary phase, wherein the RP-HPLC column has a length of 150 mm or greater and the stationary phase comprises porous particles with a pore size of at least about 500 A; (ii) contacting the stationary phase at a flow rate with a mobile phase A comprising a first ion pairing reagent; (iii) adding the composition comprising the at least first and second mRNAs to the stationary phase; (iv) applying a gradient of the mobile phase A with a mobile phase B to the stationary phase, thereby separating the at least first and second mRNAs, wherein the mobile phase B comprises a first organic modifier; and (v) detecting the at least first and second mRNAs.

[0016]

[0011] The disclosure also relates to a method for detecting two or more mRNAs in a composition using reverse-phase high pressure liquid chromatography (RP-HPLC), comprising: (i) providing an RP-HPLC column comprising a stationary phase, wherein the RP-HPLC column is held at a temperature of less than 55°C ; (ii) contacting the stationary phase at a flow rate of less than 0.6 ml / min with a mobile phase A comprising a first ion pairing reagent; (iii) adding the composition comprising the two or more mRNAs to the stationary phase; (iv) applying a mobile phase B comprising a first organic modifier to the stationary phase, thereby separating the two or more mRNAs; and (v) detecting the two or more mRNAs using ultra violet (UV) detection.

[0012] In some embodiments, step (v) yields a chromatogram providing information about characteristics of the at least first and second mRNAs or the two or more mRNAs. In some embodiments, the characteristics include integrity and purity of said at least first and second mRNAs or the two or more mRNAs.

[0017]

[0013] In some embodiments, the chromatogram is used to calculate the ratios of said at least first and second mRNAs within the composition.

[0018]

[0014] In some embodiments, the at least first and second mRNAs or two or more mRNAs differ in length by no more than 50 nucleotides.

[0019]

[0015] In some embodiments, the porous particles have a size equal to or greater than about 4 pm. In some embodiments, the porous particles have a size of 8 pm or less. In some embodiments, the porous particles have a size from about 4 pm to about 8 pm. In a specific embodiment, the porous particles have a size of about 5 pm.

[0020]

[0016] In some embodiments, the porous particles have a pore size from about 500 A to about 5000 A. In some embodiments, the porous particles have a pore size of at least about 1000 A. In some embodiments, the porous particles have a pore size greater than 2000 A. In some embodiments, the porous particles have a pore size greater than 3000 A. In some embodiments, the porous particles have a pore size from about 2000 A to about 5000 A. In some embodiments, the porous particles have a pore size from about 3000 A to about 5000 A. In some embodiments, the porous particles have a pore size of about 4000 A.

[0021]

[0017] In some embodiments, the RP-HPLC column has a length of greater than 150 mm. In some embodiments, the RP-HPLC column has a length of greater than 200 mm. In some embodiments, the RP-HPLC column has a length from about 200 mm to about 300 mm. In a specific embodiment, the RP-HPLC column has a length of about 250 mm.

[0022]

[0018] In some embodiments, the RP-HPLC column has an inner diameter smaller than 5 mm. In some embodiments, the RP-HPLC column has an inner diameter from about 2 mm to about 5 mm, optionally wherein the column has an inner diameter of about 2 mm.

[0023]

[0019] In some embodiments, the first ion pairing reagent is hexylammonium acetate (HAA).

[0024]

[0020] In some embodiments, the first ion pairing reagent is at a concentration from about 75 mM to about 500 mM. In some embodiments, the first ion pairing reagent has a concentration of about 100 mM to about 400 mM. In some embodiments, the first ion pairing reagent has a concentration of about 150 mM to about 400 mM. In some embodiments, the first ion pairing reagent has a concentration of about 150 mM. In some embodiments, the first ion pairing reagent has a concentration of about 200 mM to about 400 mM. In some embodiments, the first ion pairing reagent has a concentration of about 200 mM. In some embodiments, the first ion pairing reagent is at a concentration of about 250 mM.

[0025]

[0021] In some embodiments, the mobile phase B further comprises the first ion pairing reagent. In some embodiments, the mobile phase B comprises the first ion pairing reagent at the same concentration as the mobile phase A.

[0026]

[0022] In some embodiments, the mobile phase A further comprises an organic modifier. In some embodiments, the organic modifier is at a concentration of 20% (v / v) to 60% (v / v). In some embodiments, the organic modifier is at a concentration of about 40% (v / v). In some embodiments, the organic modifier is the same as the organic modifier in mobile phase B.

[0027]

[0023] In some embodiments, the organic modifier is acetonitrile (ACN).

[0028]

[0024] In some embodiments, the organic modifier is about 40% (v / v) to about 100% (v / v) of the mobile phase B, e.g., about 50% (v / v) or 75% (v / v). In some embodiments, the organic modifier is about 50% (v / v) of the mobile phase B. In some embodiments, the organic modifier is about 70% (v / v) to about 80% (v / v) of the mobile phase B. In some embodiments, the organic modifier is about 75% (v / v) of the mobile phase B.

[0029]

[0025] In some embodiments, the flow rate is less than 0.6 ml / min. In some embodiments, the flow rate is about 0.2 ml / min to about 0.5 ml / min. In some embodiments, the flow rate is about 0.3 ml / min or about 0.4 ml / min.

[0030]

[0026] In some embodiments, the RP-HPLC column is held at a temperature from about 45°C to about 60°C. In some embodiments, the RP-HPLC column is held at a temperature of less than 55°C. In some embodiments, the RP-HPLC column is held at a temperature from about 45°C to about 55°C. In a specific embodiment, the RP-HPLC column is held at a temperature of about 50°C.

[0027] In some embodiments, the mobile phase A and / or mobile phase B has / have a pH from about 6 to about 8. In some embodiments, the pH is about 7, about 7.5 or about 8.

[0031]

[0028] In some embodiments, the composition comprising the at least first and second mRNAs or the two or more mRNAs, the mobile phase A and / or the mobile phase B comprise(s) an agent for chelating divalent cations. In some embodiments, the composition comprising the at least first and second mRNAs or the two or more mRNAs comprises an agent for chelating divalent cations. In some embodiments, the agent for chelating divalent cations is ethylenediaminetetraacetic acid (EDTA). In some embodiments, the agent for chelating divalent cations in the mobile phase has a concentration of about 0.1 mM to about 0.9 mM. In some embodiments, the agent for chelating divalent cations has a concentration of about 0.2 mM to about 0.3 mM, optionally where the concentration of the agent for chelating divalent cations is about 0.25 mM.

[0032]

[0029] In some embodiments, the mobile phase does not comprise an agent for chelating divalent cations.

[0033]

[0030] In some embodiments, the composition comprises the at least first and second mRNAs or the two or more mRNAs encapsulated in one or more lipid nanoparticles. In some embodiments, the composition comprises the at least first and second mRNAs or the two or more mRNAs encapsulated in the same lipid nanoparticle. In some embodiments, the composition comprises the at least first and second mRNAs or the two or more mRNAs encapsulated in different lipid nanoparticles. In some embodiments, the mRNAs are extracted from the lipid nanoparticles. In some embodiments, the extraction is performed using one or more organic solvent(s) or a detergent. In some embodiments, the detergent comprises Triton X-100. In some embodiments, the extraction is performed using a mixture of phenol and chloroform. In some embodiments, the extraction is performed using ammonium acetate in isopropanol.

[0034]

[0031] In some embodiments, the composition comprises the at least first and second mRNAs or the two or more mRNAs in purified form.

[0035]

[0032] In some embodiments, the at least first and second mRNAs or the two or more mRNAs encode homologous proteins. In some embodiments, the homologous proteins are antigens. In some embodiments, the at least first and second mRNAs or the two or more mRNAs encode antigens from at least a first virus and a second virus. In some embodiments, the first and second viruses are phylogenetically related to each other. In some embodiments, the at least first and second viruses are influenza viruses. In some embodiments, the antigens are hemagglutinin (HA) or neuraminidase (NA) proteins.

[0036]

[0033] In some embodiments, the porous particles are made of styrene and / or divinylbenzene.

[0037]

[0034] In some embodiments, the gradient ranges from about 40% of mobile phase B to about 70% of mobile phase B. In some embodiments, the at least first and second mRNAs or the two or more mRNAs separate at a gradient ranging from about 50% to about 68% of mobile phase B.

[0038]

[0035] In some embodiments, the at least first and second mRNAs or the two or more mRNAs differ in length by no more than 45 nucleotides. In some embodiments, the at least first and second mRNAs or the two or more mRNAs differ in length by no more than 40 nucleotides. In some embodiments, the at least first and second mRNAs or the two or more mRNAs differ in length by no more than 35 nucleotides. In some embodiments, the at least first and second mRNAs or the two or more mRNAs differ in length by no more than 30 nucleotides. In some embodiments, the at least first and second mRNAs or the two or more mRNAs differ in length by no more than 25 nucleotides. In some embodiments, the at least first and second mRNAs or the two or more mRNAs differ in length by no more than 20 nucleotides. In some embodiments, the at least first and second mRNAs or the two or more mRNAs differ in length by no more than 15 nucleotides. In some embodiments, the at least first and second mRNAs or the two or more mRNAs differ in length by no more than 10 nucleotides. In some embodiments, the at least first and second mRNAs or the two or more mRNAs differ in length by no more than 5 nucleotides. In some embodiments, the at least first and second mRNAs or the two or more mRNAs are of the same length.

[0039]

[0036] In some embodiments, the at least first and second mRNAs or the two or more mRNAs differ in G / C content.

[0040] BRIEF DESCRIPTION OF THE DRAWINGS

[0041]

[0037] Embodiments of the disclosure will be described, by way of example, with reference to the following drawings, in which:

[0038] Figure 1 illustrates an initial attempt of separating four similarly sized mRNAs in a mixture. Chromatograms of each of the four individual mRNAs that form part of the mixture are shown as an overlay with a representative chromatogram of the mixture. Only incomplete separation of the four mRNAs was achieved when non-optimized conditions were used. Two major peaks were observed.

[0042]

[0039] Figure 2 illustrates the effect of preheating the sample prior to chromatographic separation. An overlay of two representative chromatograms obtained with the same conditions as for Figure 1 are shown. Heating the sample prior to loading did not improve separation of the four mRNAs when non-optimized conditions were used. Two peaks were observed.

[0043]

[0040] Figure 3 illustrates the effect of alternative ion pairing reagents and organic modifiers on the separation of four similarly sized mRNAs in a mixture. Changing the reagents improved separation of the four mRNAs only slightly. Two peaks, each with a small shoulder indicating the emergence of an additional peak, were observed.

[0044]

[0041] Figure 4 illustrates the effects of using a longer column with a smaller inner diameter. In addition, a polymer-based stationary phase composed of smaller particles was used. Chromatograms of each of the four individual mRNAs that form part of the mixture are shown as an overlay with a representative chromatogram of the mixture. Using the column and stationary phase resulted in effective separation of the four mRNAs in the mixture.

[0045]

[0042] Figure 5 illustrates the effect of increasing the concentration of the first ion pairing reagent in mobile phase A or adding the first ion pairing reagent also to mobile phase B. Representative chromatograms are shown demonstrating the separation of the four mRNAs in the mixture.

[0046]

[0043] Figure 6 illustrates the effect of the column temperature on the separation of four similarly sized mRNAs. Representative chromatograms are shown.

[0047]

[0044] Figure 7 illustrates the effect of including an organic modifier in both mobile phases on the separation and detection of four mRNAs. Representative chromatograms are shown.

[0045] Figure 8 illustrates the effect of including a second organic modifier in mobile phase B before and after adjustments of the gradient. Representative chromatograms are shown.

[0048]

[0046] Figure 9 illustrates the broad applicability of the optimized conditions for separating various mRNAs of similar length in a mixture. The optimized conditions were successfully used to separate mRNAs different to the four test mRNAs used in Figures 1-8. Chromatograms of each of the three individual mRNAs that form part of the mixture are shown as an overlay with a representative chromatogram of the mixture.

[0049]

[0047] Figure 10 illustrates the broad applicability of the optimized conditions for separating up to eight mRNAs of similar or identical length in a mixture. Figure 10A shows an overlay of two representative chromatograms showing the separation of two mixtures 1 and 2, each containing different sets of four different mRNAs of similar or identical size. Figure 10B shows a representative chromatogram showing the separation of a composition that combined mixtures 1 and 2. Seven peaks were detected. Two of the eight mRNAs in the composition could not be further resolved into individual peaks.

[0050]

[0048] Figure 11 illustrates that only minor adjustments to the running conditions are needed to adapt the methods identified herein to a column with a different particle size in order to separate similarly sized mRNAs in a mixture. Figure 11 A shows a representative chromatogram showing the separation of a mixture comprising four similarly sized mRNAs using a column with a particle size of 1000 A. Figure 1 IB shows an overlay of the chromatogram shown in Figure 11 A with a representative chromatogram showing the separation of the same mixture using a column with a particle size of 4000 A.

[0051]

[0049] Figure 12 illustrates that columns comprising a plurality of porous particles with a pore size of less than 500 A cannot effectively separate similarly sized mRNAs in a mixture into distinct peaks using RP-HPLC and the optimized separation conditions identified herein. A representative chromatogram showing the incomplete separation of a mixture comprising four similarly sized mRNAs using a column with a particle size of 300 A is shown. DEFINITIONS

[0052]

[0050] In order for the present disclosure to be more readily understood, certain terms are first defined below. Additional definitions for the following terms and other terms are set forth throughout the Specification.

[0053]

[0051] As used in this Specification and the appended claims, the singular forms “a,” “an” and “the” include plural referents unless the context clearly dictates otherwise.

[0054]

[0052] Unless specifically stated or obvious from context, as used herein, the term “or” is understood to be inclusive and covers both “or” and “and”.

[0055]

[0053] As used herein, the term “mRNA” refers to a polyribonucleotide that encodes at least one peptide, polypeptide or protein. mRNA as used herein encompasses both modified and unmodified. mRNA may contain one or more coding and non-coding regions. mRNA can be purified from natural sources, produced using recombinant expression systems and optionally purified, in vitro transcribed, or chemically synthesized. Where appropriate, e.g., in the case of chemically synthesized molecules, mRNA can comprise nucleoside analogs, such as analogs having chemically modified bases or sugars, backbone modifications, etc. An mRNA sequence is presented in the 5’ to 3’ direction unless otherwise indicated. A typical mRNA comprises a 5’ cap, a 5’ untranslated region (5’ UTR), a protein-coding region, a 3’ untranslated region (3’ UTR), and a 3’ tail. In some embodiments, the tail structure is a poly(C) tail. More typically, the tail structure is a poly (A) tail.

[0056]

[0054] As used herein the term “sequence-optimized” is used to describe a nucleotide sequence that is modified relative to a naturally-occurring or wild-type nucleic acid. Such modifications may include, e.g., codon optimization as well as the use of 5’ UTRs and 3’ UTRs which are not normally associated with the naturally-occurring or wild-type nucleic acid. As used herein, the terms “codon optimization” and “codon-optimized” refer to modifications of the codon composition of a naturally-occurring or wild-type nucleic acid encoding a peptide, polypeptide or protein that do not alter its amino acid sequence, thereby improving protein expression of said nucleic acid. In the context of the present disclosure, “codon optimization” may also refer to the process by which one or more optimized nucleotide sequences are arrived at by removing with filters less than optimal nucleotide sequences from a list of nucleotide sequences, such as filtering by guanine-cytosine content, codon adaptation index, presence of destabilizing nucleic acid sequences or motifs, and / or presence of pause sites and / or terminator signals.

[0057]

[0055] As used herein, the term “template DNA” (or “DNA template”) relates to a DNA molecule comprising a nucleic acid sequence encoding an mRNA transcript to be synthesized by in vitro transcription. The template DNA is used as template for in vitro transcription in order to produce the mRNA transcript encoded by the template DNA. The template DNA comprises all elements necessary for in vitro transcription, particularly a promoter element for binding of a DNA-dependent RNA polymerase, such as, e.g., T3, T7 and SP6 RNA polymerases, which is operably linked to the DNA sequence encoding a desired mRNA transcript. The “template DNA” in the context of the present disclosure may be a linear or a circular DNA molecule. As used herein, the term “template DNA” may refer to a DNA vector, such as a plasmid DNA, which comprises a nucleic acid sequence encoding the desired mRNA transcript.

[0058]

[0056] The terms “reverse phase high performance liquid chromatography”, “reversed- phase high performance liquid chromatography, “RP-HPLC”, “reversed-phase ion-pairing high performance liquid chromatography”, “ultra high performance liquid chromatography”, “UHPLC” and “UPLC” are used interchangeably herein.

[0059]

[0057] As used herein, the term “about” refers to an interval of accuracy that a person skilled in the art will understand to still ensure the technical effect of the feature in question. The term indicates a deviation from the indicated numerical value of ±10%. In some embodiments, the deviation is ±5% of the indicated numerical value. In certain embodiments, the deviation is ±1% of the indicated numerical value.

[0060]

[0058] All technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs and as commonly used in the art to which this application belongs. The publications and other reference materials referenced herein to describe the background of the disclosure and to provide additional detail regarding its practice are hereby incorporated by reference.

[0061] DETAILED DESCRIPTION

[0062]

[0059] The present disclosure relates to a method for separating and detecting multiple mRNAs comprised in a composition, in particular multiple mRNAs of similar length. Each of the mRNAs comprise a different coding sequence, although the coding sequences may be closely related, e.g., may encode homologous proteins of the same or similar length.

[0063]

[0060] In particular, in one aspect, the present disclosure provides a method for detecting at least a first mRNA and a second mRNA in a composition using reverse phase high pressure liquid chromatography (RP-HPLC), wherein said first mRNA and said second mRNA are of similar length, comprising: (i) providing an RP-HPLC column comprising a stationary phase, wherein the RP-HPLC column has a length of 150 mm or greater and the stationary phase comprises a plurality of porous particles with a pore size of at least about 500 A; (ii) contacting the stationary phase at a flow rate with a mobile phase A comprising an ion pairing reagent; (iii) adding the composition comprising the at least first and second mRNAs to the stationary phase; (iv) applying a gradient of the mobile A with a mobile phase B to the stationary phase, thereby separating the at least first and second mRNAs, wherein the mobile phase B comprises a first organic modifier; and (v) detecting the at least first and second mRNAs.

[0064]

[0061] In another aspect, the disclosure provides a method for detecting two or more mRNAs in a composition using reverse-phase high pressure liquid chromatography (RP- HPLC), comprising: (i) providing an RP-HPLC column comprising a stationary phase, wherein the RP-HPLC column is held at a temperature of less than 55°C ; (ii) contacting the stationary phase at a flow rate of less than 0.6 ml / min with a mobile phase A comprising a first ion pairing reagent; (iii) adding the composition comprising the two or more mRNAs to the stationary phase; (iv) applying a mobile phase B comprising the ion pairing reagent and a first organic modifier to the stationary phase, thereby separating the two or more mRNAs; and (v) detecting the two or more mRNAs using UV detection.

[0065]

[0062] The inventors demonstrate herein that the disclosed methods can be used to separate three or more (e.g., four or more) mRNAs of similar or identical lengths. More specifically, the inventors demonstrate successful separation and detection of six different mRNAs of similar or identical lengths using RP-HPLC. Thus, in some embodiments, four mRNAs, or more than four mRNAs (e.g., 5, 6, 7 or 8 mRNAs), all of similar length, may be separated using a method in accordance with the disclosure.

[0066]

[0063] In some embodiments, a composition may comprise two sets of mRNAs, wherein the mRNAs in each set are similar in length. For example, in some embodiments, the mRNAs may encode two or more therapeutic peptides, polypeptides or proteins (including, e.g., prophylactic peptides, polypeptides or proteins such as antigens from viruses or bacteria). For example, the mRNAs may encode two or more (e.g., 3 or 4) haemagglutinin (HA) proteins and two or more (e.g., 3 or 4) neuraminidase (NA) proteins, wherein each HA and NA is derived from different, phylogenetically related influenza virus (e.g., from influenza A and influenza B). mRNAs

[0067] Structural elements of mRNAs

[0068]

[0064] A typical mRNA in accordance with the disclosure comprises a 5’ cap, a 5’ untranslated region (5’ UTR), a protein-coding region, a 3’ untranslated region (3’ UTR), and a 3’ tail.

[0069] 5 ’ cap

[0070]

[0065] In a specific embodiment, the mRNA of the disclosure comprises a 5’ cap with the following structure:

[0071]

[0066] Typically, a 5’ cap and / or a 3’ tail may be added after mRNA synthesis. The presence of the cap is important in providing resistance to nucleases found in most eukaryotic cells. The presence of a “tail” serves to protect the mRNA from exonuclease degradation. Alternatively, the 5’ cap and / or a 3’ tail sequences are included in the DNA template sequences used in in vitro transcription reaction.

[0072]

[0067] A 5’ cap is typically added as follows: first, an RNA terminal phosphatase removes one of the terminal phosphate groups from the 5’ nucleotide, leaving two terminal phosphates; guanosine triphosphate (GTP) is then added to the terminal phosphates via a guanylyl transferase, producing a 5’5’5 triphosphate linkage; and the 7-nitrogen of guanine is then methylated by a methyltransferase. Examples of cap structures include, but are not limited to, m7G(5’)ppp (5’(A,G(5’)ppp(5’)A and G(5’)ppp(5’)G. Additional cap structures are described in published U.S. Application No. US 2016 / 0032356 and published U.S. Application No. US 2018 / 0125989, which are incorporated herein by reference.

[0073] 3 ’ tail

[0074]

[0068] In one specific embodiment, the tail structure of the mRNA comprises a poly(A) tail. In another specific embodiment, the tail structure of the mRNA comprises a poly(C) tail. In some embodiments, the tail structure comprises at least 50 adenosine or cytosine nucleotides. In a typical embodiment, the tail structure is approximately 100-500 nucleotides in length.

[0075]

[0069] A poly(A) or poly(C) tail on the 3’ terminus of mRNA typically includes at least 50 adenosine or cytosine nucleotides, at least 150 adenosine or cytosine nucleotides, at least 200 adenosine or cytosine nucleotides, at least 250 adenosine or cytosine nucleotides, at least 300 adenosine or cytosine nucleotides, at least 350 adenosine or cytosine nucleotides, at least 400 adenosine or cytosine nucleotides, at least 450 adenosine or cytosine nucleotides, at least 500 adenosine or cytosine nucleotides, respectively. In some embodiments, a tail structure includes combination of poly(A) and poly(C) tails with various lengths described herein. In some embodiments, a tail structure includes at least 50%, 55%, 65%, 70%, 75%, 80%, 85%, 90%, 92%, 94%, 95%, 96%, 97%, 98%, or 99% adenosine nucleotides. In some embodiments, a tail structure includes at least 50%, 55%, 65%, 70%, 75%, 80%, 85%, 90%, 92%, 94%, 95%, 96%, 97%, 98%, or 99% cytosine nucleotides.

[0076] 5 ’ UTRs and 3 ’ UTRs

[0077]

[0070] Exemplary 5’ and 3’ UTR sequences are shown below:

[0078] 5' UTR sequence GGACAGAUCGCCUGGAGACGCCAUCCACGCUGUUUUGAC CUCCAUAGAAGACACCGGGACCGAUCCAGCCUCCGCGGC CGGGAACGGUGCAUUGGAACGCGGAUUCCCCGUGCCAAG AGUGACUCACCGUCCUUGACACG (SEQ ID NO: 1)

[0079] 3' UTR sequence 1 CGGGUGGCAUCCCUGUGACCCCUCCCCAGUGCCUCUCCU GGCCCUGGAAGUUGCCACUCCAGUGCCCACCAGCCUUGU CCUAAUAAAAUUAAGUUGCAUCAAGCU (SEQ ID NO: 2) 3' UTR sequence 2 GGGUGGCAUCCCUGUGACCCCUCCCCAGUGCCUCUCCUG GCCCUGGAAGUUGCCACUCCAGUGCCCACCAGCCUUGUC CUAAUAAAAUUAAGUUGCAUCAAAGCU (SEQ ID NO: 3)

[0080] Nucleotides / nucleosides

[0081]

[0071] The mRNA may be prepared with nucleotides comprising naturally-occurring or modified nucleosides. In some embodiments, the mRNA comprises or consists of naturally- occurring nucleosides (or unmodified nucleosides; i.e., adenosine, guanosine, cytidine, and uridine). In some embodiments, the mRNA comprises one or more modified nucleosides, such as nucleoside analogs (e.g., adenosine analog, guanosine analog, cytidine analog, or uridine analog). The presence of one or more nucleoside analogs may render an mRNA more stable and / or less immunogenic than a control mRNA with the same sequence but containing only naturally-occurring nucleosides.

[0082]

[0072] In some embodiments, the mRNA comprises both unmodified and modified nucleosides. In some embodiments, the one or more modified nucleosides is a nucleoside analog. In some embodiments, the one or more modified nucleosides comprises at least one modification selected from a modified sugar, and a modified nucleobase. In some embodiments, the mRNA comprises one or more modified intemucleoside linkages.

[0083]

[0073] In some embodiments, the one or more modified nucleosides is a nucleoside analog selected from the group consisting of 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolo-pyrimidine, 3-methyl adenosine, 5-methylcytidine, C-5 propynyl-cytidine, C-5 propynyl-uridine, 2-aminoadenosine, C 5 -bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-uridine, C5-propynyl-cytidine, C5-methylcytidine, 2-aminoadenosine, 7- deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8 -oxoguanosine, O(6)-methylguanine, pseudouridine (e.g., N-l-methyl-pseudouridine), 2-thiouridine, and 2-thiocytidine. See, e.g., U.S. Patent No. 8,278,036 or WO 2011 / 012316 for a discussion of 5-methyl-cytidine, pseudouridine, and 2-thio-uridine and their incorporation into mRNA. In some embodiments, the mRNA may be RNA wherein 25% of U residues are 2-thio-uridine and 25% of C residues are 5-methylcytidine. Teachings for the use of such modified RNA are disclosed in US Patent Publication US 2012 / 0195936 and international publication WO 2011 / 012316, both of which are hereby incorporated by reference in their entirety. Length of mRNAs

[0084]

[0074] Methods disclosed herein can be used to separate mRNAs of similar lengths. Such mRNAs are typically about 500-5000 nucleotides in length. For example, the two or more mRNAs or the first and second mRNAs may be 1000-3000 nucleotides in length. As shown herein, such mRNA can be separated using the methods disclosed herein, even if the identical or very similar in length, e.g., if each mRNA in a composition is about 1000, about 1500, about 2000, about 2500, or about 3000 nucleotides in length.

[0085]

[0075] In some embodiments, at least a first mRNA and a second mRNA differ in length by no more than 50 nucleotides. In some embodiments, the at least first and second mRNAs differ in length by no more than 45 nucleotides. In some embodiments, the at least first and second mRNAs differ in length by no more than 40 nucleotides. In some embodiments, the at least first and second mRNAs differ in length by no more than 35 nucleotides. In some embodiments, the at least first and second mRNAs differ in length by no more than 30 nucleotides. In some embodiments, the at least first and second mRNAs differ in length by no more than 25 nucleotides. In some embodiments, the at least first and second mRNAs differ in length by no more than 20 nucleotides. In some embodiments, the at least first and second mRNAs differ in length by no more than 15 nucleotides. In some embodiments, the at least first and second mRNAs differ in length by no more than 10 nucleotides. In some embodiments, the at least first and second mRNAs differ in length by no more than 5 nucleotides. In some embodiments, the at least first and second mRNAs are of the same length, i.e., the at least first and second mRNAs have the same number of nucleotides.

[0086] In Vitro Transcription

[0087]

[0076] mRNAs of the disclosure may be synthesized according to any of a variety of known methods. Various methods are described in published U.S. Application No. US 2018 / 0258423, and can be used to practice the present disclosure, all of which are incorporated herein by reference. For example, mRNAs according to the present disclosure may be synthesized via in vitro transcription (IVT). Briefly, IVT is typically performed with a linear or circular DNA template or DNA vector containing a promoter, a pool of ribonucleotide triphosphates, a buffer system that may include DTT and magnesium ions, and an appropriate RNA polymerase (e.g., T3, T7, or SP6 RNA polymerase), DNase I, pyrophosphatase, and / or RNase inhibitor. The exact conditions will vary according to the specific application.

[0088]

[0077] For the preparation of mRNA by IVT, a DNA template or DNA vector may be transcribed in vitro. A suitable DNA template or DNA vector typically has a promoter, for example a T3, T7 or SP6 promoter, for in vitro transcription, followed by desired nucleotide sequence for desired mRNA and a termination signal (terminator).

[0089] Post-synthesis purification

[0090]

[0078] Various methods may be used to purify mRNA after synthesis. In some embodiments, the mRNA is purified using Tangential Flow Filtration. Suitable purification methods include those described in published U.S. Application No. US 2016 / 0040154, published U.S. Application No. US 2015 / 0376220, published U.S. Application No. US 2018 / 0251755, published U.S. Application No. US 2018 / 0251754, U.S. Provisional Application No. 62 / 757,612 filed on November 8, 2018, and U.S. Provisional Application No. 62 / 891,781 filed on August 26, 2019, all of which are incorporated by reference herein and may be used to practice the present disclosure. It is advantageous to purify the mRNA of the disclosure which may be included in pharmaceutical compositions in some embodiments of the disclosure, as the purity requirements for mRNA products are more stringent for therapeutic applications.

[0091]

[0079] In some embodiments, the mRNA is purified before capping and tailing. In some embodiments, the mRNA is purified after capping and tailing. In some embodiments, the mRNA is purified both before and after capping and tailing. In some embodiments, the mRNA is purified either before or after or both before and after capping and tailing, by centrifugation. In some embodiments, the mRNA is purified either before or after or both before and after capping and tailing, by filtration. In some embodiments, the mRNA is purified either before or after or both before and after capping and tailing, by Tangential Flow Filtration (TFF).

[0092] Lipid Nanoparticles (LNPs)

[0093]

[0080] In accordance with the disclosure, mRNAs may be encapsulated in a lipid nanoparticle (LNP). Typically, a lipid nanoparticle suitable for use with the present disclosure comprises one or more cationic lipids, one or more non-cationic lipids (e.g., DOPE and / or cholesterol), and one or more PEG-modified lipids (e.g., DMG-PEG2K).

[0094]

[0081] A typical lipid nanoparticle for use with the disclosure is composed of four lipid components: a cationic lipid (e.g., a sterol -based cationic lipid), a non-cationic lipid (e.g., DOPE or DEPE), a cholesterol-based lipid (e.g., cholesterol) and a PEG-modified lipid (e.g., DMG-PEG2K). In a specific embodiment, the non-cationic lipid is DOPE. The molar ratio of cationic lipid to non-cationic lipid to cholesterol to PEG-modified lipid typically is between about 30-60:25-35:20-30: 1-15, respectively. An exemplary LNP in accordance with the disclosure may be composed of a cationic lipid selected from cKK-E12, cKK-ElO, OF-Deg-Lin and OF-02; a non-cationic lipid selected from DOPE and DEPE; a cholesterol- based lipid such as cholesterol; and a PEG-modified lipid such as DMG-PEG2K.

[0095]

[0082] In some embodiments, a lipid nanoparticle comprises no more than three distinct lipid components. An exemplary lipid nanoparticle is composed of three lipid components: a cationic lipid (e.g., a sterol-based cationic lipid), a non-cationic lipid (e.g., DOPE or DEPE) and a PEG-modified lipid (e.g., DMG-PEG2K). In a specific embodiment, the three distinct lipid components are HGT4002, DOPE and DMG-PEG2K. In an exemplary embodiment, HGT4002, DOPE and DMG-PEG2K are present in a molar ratio of approximately 60:35:5, respectively. Such LNPs may be particularly suitable for aerosol delivery of the mRNAs of the disclosure.

[0096]

[0083] The lipid nanoparticles for use in the disclosure can be prepared by various techniques which are presently known in the art. Such methods are described, e.g., in published U.S. Application No. US 2011 / 0244026, published U.S. Application No. US 2016 / 0038432, published U.S. Application No. US 2018 / 0153822, published U.S. Application No. US 2018 / 0125989 and U.S. Provisional Application No. 62 / 877,597, filed July 23, 2019, all of which are incorporated herein by reference.

[0097] Sample preparation mRNA compositions

[0098]

[0084] mRNAs encoding different peptides, polypeptides, or proteins may be combined together in a single composition. In some embodiments, the at least first mRNA and second mRNA or the two or more mRNAs are combined in a solvent (typically an aqueous solvent, e.g., water) to form a composition. It will be understood by the skilled person that multiple copies of the at least first mRNA and second mRNA or the two or more mRNAs are combined to form the compositions described herein.

[0099]

[0085] During separation, the at least first mRNA and second mRNA or the two or more mRNAs are dissolved in the mobile phase. The inventors have found that providing a composition comprising the at least first mRNA and second mRNA or the two or more mRNAs dissolved in an aqueous solution (e.g., water, optionally comprising a divalent cationic chelator such as EDTA) prior to injecting the mRNAs into the RP-HPLC system results in better separation than directly dissolving the at least first mRNA and second mRNA or the two or more mRNAs in the mobile phase (e.g., mobile phase A).

[0100]

[0086] The composition may also comprise one or more excipients selected from a sugar, a salt, a buffering agent or a chelating agent. In some embodiments, the sugar is a disaccharide, e.g., trehalose or sucrose. In some embodiments, the salt is NaCl. In some embodiments, the buffering agent comprises phosphate, Tris or citrate.

[0101]

[0087] In some embodiments, the chelating agent is a divalent cation chelator (e.g., ethylenediaminetetraacetic acid or EDTA). In some embodiments, the concentration of the chelating agent is from about 0.05 mM to about 1 mM. In some embodiments, the concentration of the chelating agent is from about 0.1 mM to about 0.9 mM. In some embodiments, the concentration of the chelating agent is from about 0.2 mM to about 0.3 mM. In some embodiments, the concentration of the chelating agent is about 0.25 mM. In some embodiments, the chelating agent is EDTA.

[0102]

[0088] The methods of the disclosure may be used to assess the quality / integrity of the at least first mRNA and second mRNA or two or more mRNAs in a composition. Such a composition may be a multi-mRNA composition for use in the prophylaxis or therapy of a disease or disorder. Such therapeutic compositions may include multivalent or multicomponent mRNA vaccines. Such therapeutic compositions may also include compositions comprising two or more mRNAs encoding therapeutic antibodies.

[0103]

[0089] In some embodiments, the molar ratio of two different mRNAs in the composition is 1 :4, 1 :3, 1 :2 or 1 : 1. In some embodiments, the ratio of the different mRNAs in the composition may be equimolar. For example, a composition comprising four different mRNAs may comprise the four mRNAs at a molar ratio of 1 : 1 : 1 : 1. In some embodiments, the different mRNAs may be present at different proportions in the composition. For example, a composition comprising four different mRNAs may comprise the four mRNAs at a molar ratio of 1 : 1 :2:2. In some embodiments, the mRNA concentration in the composition is about 0.8 mg / ml to 2 mg / ml (e.g., 0.8 mg / ml, 0.9 mg / ml, 1 mg / ml, 1.1 mg / ml, 1.2 mg / ml, 1.3 mg / ml, 1.4 mg / ml, 1.5 mg / ml, 1.6 mg / ml, 1.7 mg / ml, 1.8 mg / ml, 1.9 mg / ml, or 2 mg / ml). In some embodiments, the mRNA concentration in the composition is about 1 mg / ml.

[0104]

[0090] The mRNAs encoding different peptides, polypeptides, or proteins may be encapsulated in lipid nanoparticles. In some embodiments, the at least first and second mRNAs or the two or more mRNAs are encapsulated in lipid nanoparticles in the compositions described herein. In some embodiments, the at least first and second mRNAs or the two or more mRNAs are encapsulated in the same lipid nanoparticle. In some embodiments, the at least first and second mRNAs or the two or more mRNAs are encapsulated in separate lipid nanoparticles. The separate lipid nanoparticles may have the same lipid composition, or they may have different lipid compositions.

[0105]

[0091] In some embodiments, the at least first mRNA and second mRNA or the two or more mRNAs of a composition of the present disclosure comprises only two mRNA molecules. In some embodiments, the at least first mRNA and second mRNA or the two or more mRNAs comprises a plurality of different mRNA molecules, such as at least three different mRNA molecules, at least four different mRNA molecules, at least different five mRNA molecules, at least six different mRNA molecules, at least seven different mRNA molecules, at least eight different mRNA molecules, at least nine different mRNA molecules, or at least ten different mRNA molecules.

[0106]

[0092] Accordingly, in some embodiments, a composition of the present disclosure is a multivalent composition (e.g., a multivalent vaccine) comprising a plurality of different mRNA molecules. In some embodiments, the composition is a bivalent composition (e.g., a bivalent vaccine) comprising two different species of mRNA molecules. In some embodiments, the composition is a trivalent composition (e.g., a trivalent vaccine) comprising three different species of mRNA molecules. In some embodiments, the composition is a quadrivalent composition (e.g., a quadrivalent vaccine) comprising four different species of mRNA molecules. In some embodiments, the composition is a pentavalent composition (e.g., a pentavalent vaccine) comprising five different species of mRNA molecules. In some embodiments, the composition is a hexavalent composition (e.g., a hexavalent vaccine) comprising six different species of mRNA molecules. In some embodiments, the composition is a heptavalent composition (e.g., a heptavalent vaccine) comprising seven different species of mRNA molecules. In some embodiments, the composition is an octavalent composition (e.g., an octavalent vaccine) comprising eight different species of mRNA molecules. In some embodiments, the composition is a nonavalent composition (e.g., a nonavalent vaccine) comprising nine different species of mRNA molecules. In some embodiments, the composition is a decavalent composition (e.g., a decavalent vaccine) comprising ten different species of mRNA molecules. The mRNAs may be extracted from the vaccine before being separated and detected using the method of the present disclosure.

[0107]

[0093] In some embodiments, each of the different at least first mRNA and second mRNA or the two or more mRNAs in a composition of the disclosure shares at least 50%, such as at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% sequence identity with at least one other mRNA molecule in the composition, including all values and subranges therebetween.

[0108]

[0094] In some embodiments, the at least first and second mRNAs or the two or more mRNAs encode therapeutic peptides, polypeptides or proteins (including peptides, polypeptides or proteins used in disease prophylaxis), e.g., antigens or antibodies. In some embodiments, the at least first and second mRNAs or the two or more mRNAs encode antigens derived from first and second pathogens. Pathogens include bacteria and viruses.

[0109]

[0095] In some embodiments, each of the at least first mRNA and second mRNA or the two or more mRNAs encodes an antigen derived from a virus including, but not limited to an influenza virus, a coronavirus, a respiratory syncytial virus (RSV), a parainfluenza virus (PIV), a metapneumovirus (MPV), a human immunodeficiency virus (HIV), a herpesvirus, a human papilloma virus, a rotavirus virus, a norovirus, a varicella zoster virus, a hepatitis virus, a paramyxovirus, a monkey pox virus, a parvovirus, an Ebola virus, a dengue virus, a hantavirus, a Zika virus, a west Nile virus, a poliovirus, and a rabies virus.

[0096] In some embodiments, the at least first and second mRNAs or the two or more mRNAs encode antigens from a first pathogen and a second pathogen. In some embodiments, the at least first and second mRNAs or the two or more mRNAs encode antigens from two or more pathogens. In some embodiments, the first and second pathogen are phylogenetically related to each other. In some embodiments, the two or more pathogens are phylogenetically related to each other. In some embodiments, the antigens encoded by the first and second mRNAs or the two or more mRNAs are homologs derived from phylogenetically related pathogens (e.g., phylogenetically related viruses). For example, phylogenetically related viruses may be influenza viruses, e.g., circulating influenza viruses. For instance, the antigens encoded by the first and second mRNAs or the two or more mRNAs may be selected for inclusion in a seasonal influenza vaccine. In some embodiments, the at least first and second mRNAs or the two or more mRNAs encode antigens from an influenza A virus and an influenza B virus, respectively.

[0110]

[0097] In some embodiments, each of the at least first mRNA and second mRNA or the two or more mRNAs encodes hemagglutinin (HA), a nucleoprotein (NP), a neuraminidase (NA) protein, a matrix- 1 (Ml), a matrix-2 (M2), a non-structural protein- 1 (NS1) a non- structural protein-2 (NS2) from influenza A and / or influenza B. In some embodiments, the influenza protein is of human origin. In some embodiments, the influenza protein is of swine or bird origin. In some embodiments, the therapeutic protein is from an influenza A strain, such as one or more of HI, H2, H5, H6, H8, H9, Hl 1, Hl 3 and HI6 (phylogenetic group I) and / or one or more of H3, H4, H7, HIO, HI5 and H14 (phylogenetic group 2). In some embodiments, the antigens encoded by the first and second mRNAs are hemagglutinin (HA) proteins. In some embodiments, the antigens encoded by the first and second mRNAs are neuraminidase (NA) proteins. In some embodiments, the therapeutic protein comprises one or more HA proteins from an influenza B strain, such as a Victoria or Yamagata strain. In some embodiments the therapeutic protein comprises one or more HA protein from influenza A and influenza B. In some embodiments, the therapeutic protein comprises an HA protein from Group I and Group II influenza A and / or an HA protein from the Victoria and Yamagata.

[0111]

[0098] In some embodiments, each of the at least first mRNA and second mRNA or the two or more mRNAs encodes an influenza virus protein selected from Hl, H3, HA from a B / Victoria lineage, and / or HA from a B / Yamagata lineage. In some embodiments, the composition comprises four mRNA molecules, each mRNA molecule encoding a different influenza virus protein (e.g., a quadrivalent vaccine), such as an Hl from a first standard of care influenza virus strain, an H3 from a second standard of care influenza virus strain, an HA from a third standard of care influenza virus strain from the B / Victoria lineage, and an HA from a fourth standard of care influenza virus strain from the B / Yamagata lineage.

[0112]

[0099] In some embodiments, each of the at least first mRNA and second mRNA or the two or more mRNAs encodes an influenza virus protein selected from Nl, N2, NA from a B / Victoria lineage, and / or NA from a B / Yamagata lineage. In some embodiments, the composition comprises four mRNA molecules, each mRNA molecule encoding a different influenza virus protein (e.g., a quadrivalent vaccine), such as a Nl from a first standard of care influenza virus strain, a N2 from a second standard of care influenza virus strain, an NA from a third standard of care influenza virus strain from the B / Victoria lineage, and an NA from a fourth standard of care influenza virus strain from the B / Yamagata lineage.

[0113]

[0100] In some embodiments, each of the at least first mRNA and second mRNA or the two or more mRNAs encodes an antigen derived from an influenza virus, such as a strain of Influenza A, a strain of Influenza B, or combinations thereof. Examples of strains of Influenza A include, but are not limited to, A / Califomia / 07 / 2009, A / Japan / 305 / 1957, A / Vietnam / 1194 / 2004, A / Vietnam / 1203 / 2004, A / Netherlands / 219 / 2003, A / HongKong / 1073 / 1999, A / Perth / 16 / 2009, A / Wisconsin / 588 / 2019 and / or A / Tasmania / 503 / 2020. In some embodiments, the source of the at least one mRNA molecule in a composition of the present disclosure is from a strain of Influenza A, such as A / Wisconsin / 588 / 2019 and / or A / Tasmania / 503 / 2020. Examples of strains of Influenza B include, but are not limited to, B / Brisbane / 2008, B / Malaysia / 2004, B / Victoria / 1987, and / or B / Washington / 02 / 2019 (Victoria lineage) and / or B / PHUKET / 3073 / 2013, B / Florida / 2006, B / Mass / 2012, and / or B / Wisconsin / 2010 (Yamagata lineage). In some embodiments, the source of the at least first mRNA and second mRNA or the two or more mRNAs molecule in a composition of the present disclosure is a strain of Influenza B, such as B / Washington / 02 / 2019 and / or B / PHUKET / 3073 / 2013.

[0114]

[0101] In some embodiments, the at least first mRNA and second mRNA or the two or more mRNAs encodes one or more antibodies or fragments thereof. The term “antibody” includes monoclonal antibodies (including full-length antibodies, which have an immunoglobulin Fc region), antibody compositions with polyepitopic specificity, multispecific antibodies (e.g., bispecific antibodies, diabodies, and single-chain molecules), as well as antibody fragments. The term “immunoglobulin” (Ig) is used interchangeably with “antibody” herein.

[0115]

[0102] An “antibody fragment” comprises a portion of an intact antibody, typically the antigen binding and / or the variable region of the intact antibody. Examples of antibody fragments include Fab, Fab', F(ab')2 and Fv fragments; diabodies; linear antibodies; nanobodies; single-chain antibody molecules and multispecific antibodies formed from antibody fragments.

[0116]

[0103] In some embodiments, the proteins encoded by the first and second mRNAs or the two or more mRNAs are heavy chains of an antibody. In some embodiments, the proteins encoded by the first and second mRNAs are lights chains of an antibody. In some embodiments, the first and second mRNAs or the two or more mRNAs encode two or more full-length antibodies, wherein the heavy chains and light chains of each of the two or more full-length antibodies are encoded by separate mRNAs.

[0117] Extraction

[0118]

[0104] In some embodiments, the composition comprising the at least first mRNA and second mRNA or the two or more mRNAs are encapsulated in one or more lipid nanoparticles. In some embodiments, the lipid nanoparticle is a liposome.

[0119]

[0105] Accordingly, in some embodiments, the mRNAs are extracted from the one or more lipid nanoparticles before they can be separated by a method of the present disclosure. In some embodiments, the extraction of the mRNAs from the lipid nanoparticle is performed using phenol-chloroform. In some embodiments, the extraction of the mRNAs from the lipid nanoparticle is performed using a mixture of ammonium acetate and isopropanol.

[0120]

[0106] In other embodiments, the extraction of the mRNAs from the lipid nanoparticle is performed using a detergent. Suitable detergents include, e.g., a non -ionic detergent such as Triton X-100, Brij-35 and Brij-58. In some embodiments, the mRNA is purified after extraction from the lipid nanoparticles. For example, the detergent and / or lipids can be removed, e.g., by precipitating the mRNAs. The purified mRNA can then be resuspended in a suitable solution, e.g., water.

[0121]

[0107] In particular embodiments, a detergent is used for extracting the mRNAs which does not have to be removed from the extracted mRNA prior to analyzing it in a method of the disclosure. For example, it is desirable to use the extracted mRNA directly, e.g., without any intervening purification steps, for instance, if - in addition to detecting mRNAs of similar size in a composition - the integrity of the mRNAs in the composition is also assessed.

[0122] Column

[0123]

[0108] Prior art methods to separate mRNAs have utilized columns with a length of about 100 mm. The inventors of the present disclosure surprisingly found that a mixture of different mRNAs (e.g., at least first mRNA and second mRNA or the two or more mRNAs) of similar length or the same length can be separated more effectively when a longer RP- HPLC column is used. In addition, the use of stationary phase composed of porous particles with a large pore size (e.g., at least about 500 A) was also found to be advantageous.

[0124] Column length

[0125]

[0109] In some embodiments, the column has a length of about 150 mm or greater. In some embodiments, the column has a length greater than about 150 mm. In some embodiments, the column has a length greater than about 200 mm. In some embodiments, the column has a length between about 150 mm and about 300 mm. In some embodiments the column has a length of about 150 mm, about 200 mm, about 250 mm, or about 300 mm.

[0126] [HO] The inventors of the present disclosure found that columns with a length from about 200 mm to about 300 mm were particularly useful for performing the method of the disclosure. Accordingly, in particular embodiments, a column for use with a method of the disclosure has a length between about 200 mm and about 300 mm. In a specific embodiment, the column has a length of about 250 mm.

[0127] Column inner diameter

[0128] [Hl] Standard RP-HPLC columns come in a range of diameters. In some embodiments, the column has an inner diameter less than about 5 mm. In some embodiments, the column has an inner diameter greater than 2 mm. In some embodiments, the column has an inner diameter between about 2 mm and about 5 mm. In some embodiments, the column has an inner diameter of about 2 mm, about 3 mm, about 4 mm, or about 5 mm.

[0129]

[0112] For instance, in the examples the inventors usefully employed RP-HPLC columns with an inner diameter of 4.6 mm and 2.1 mm. Accordingly, in one specific embodiment, the column has an inner diameter of 4.6 mm. In another specific embodiment, the column has an inner diameter of 2.1 mm.

[0130]

[0113] In typical embodiments, the method of the disclosure uses an RP-HPLC column with a length of between about 150 mm and about 300 mm and an inner diameter of between about 2 mm and about 5 mm. In one particular embodiment, the column has a length of about 150 mm and an inner diameter of about 5 mm (e.g., 4.6 mm). In another particular embodiment, the column has a length of about 250 mm and an inner diameter of about 2 mm (e.g., 2.1 mm).

[0131]

[0114] The inner volume of a RP-HPLC column for use with the disclosure is typically approximately cylindrical in shape. In some embodiments, the inner volume is between about 800 mm3and about 2600 mm3. In some embodiments, the inner volume is about 800 mm3, about 900 mm3, about 1000 mm3, about 1100 mm3, about 1200 mm3, about 1300 mm3, about 1400 mm3, about 1500 mm3, about 1600 mm3, about 1700 mm3, about 1800 mm3, about 1900 mm3, about 2000 mm3, about 2100 mm3, about 2200 mm3, about 2300 mm3, about 2400 mm3, about 2500 mm3, or about 2600 mm3.

[0132]

[0115] In some embodiments, the inner volume of an RP-HPLC column for use with the disclosure is about 2400 mm3to about 2500 mm3. More typically, however, a smaller volume is sufficient, in particular when a long, thin column is used for the separation of multiple mRNAs of similar length. For example, the inventors have found an RP-HPLC column with an inner volume of about 800 mm3to about 900 mm3particularly suitable for use with the methods of the disclosure.

[0133] Stationary phase

[0134]

[0116] A chromatography column comprises a stationary phase that separates molecules suspended in a mobile phase by size as it traverses the column. A reverse-phase high pressure liquid chromatography (RP-HPLC) column typically comprises a non-polar stationary phase that includes aromatic hydrocarbons. As mRNAs traverse the column, aromatic rings of the mRNA nucleotides can interact with the aromatic hydrocarbons of the stationary phase. Typically, the stationary phase comprises a plurality of identical particles. Each particle is typically only a few pm in size. In some embodiments, the stationary phase comprises porous particles.

[0135]

[0117] The particles may be made from various materials. In some embodiments, the particles are macro-porous and made from a non-polar (e.g., hydrophobic) material. Suitable non-polar or hydrophobic materials for making such particles may include but are not limited to a synthetic aromatic hydrocarbon polymers such as polystyrene or poly(divinylbenzene). Accordingly, in some embodiments, the stationary phase comprises porous particles made of divinylbenzene. In other embodiments, the stationary phase comprises porous particles made of styrene. In some embodiments, stationary phase comprises porous particles made of styrene and divinylbenzene (e.g., polystyrenedi viny lb enzene)) .

[0136] Particle size

[0137]

[0118] An RP-HPLC column for use with the disclosure typically comprises a plurality of porous particles. The particles are typically spherical in size. In this context, the term “particle size” refers to the average diameter of the plurality of particles. In some embodiments, the particles have a size from about 4 pm to about 8 pm. In some embodiments, the particles have a size greater than about 4 pm. In some embodiments, the particles have a size less than about 8 pm. In some embodiments, the particles have a size of about 4 pm, about 5 pm, about 6 pm, about 7 pm, or about 8 pm. In particular embodiments, the particles have a size from about 5 pm to about 8 pm. For example, the inventors found that an RP-HPLC with a stationary phase composed of a plurality of particles with a size of about 5 pm could be used to effectively separate similarly sized mRNAs in a mixture. Accordingly, in a specific embodiment, the particles have a size of about 5 pm.

[0138] Pore size

[0139]

[0119] The porosity of a particle is typically described by reference to an average pore size. Porous particles for use with the present disclosure typically have wide pores (i.e., the particles are macro-porous). In some embodiments, the pore size is at least about 500 A. In some embodiments, the pore size is at least about 1000 A. In some embodiments, the pore size is from about 500 A to about 5000 A. In some embodiments, the pore size is greater than about 2000 A. In some embodiments, the pore size is greater than about 3000 A. In some embodiments, the pore size is from about 2000 A to about 5000 A. In some embodiments, the pore size is from about 3000 A to about 5000 A. In some embodiments, the pore size about 500 A, about 1000 A, about 2000 A, about 3000 A, about 4000 A, or about 5000 A, including all values and subranges therebetween.

[0140]

[0120] RP-HPLC columns comprising porous particles with a pore size from about 1000 A to about 5000 A were shown to be particularly suitable for use in the methods of the disclosure. Accordingly, in some embodiments, suitable particles have a pore size between about 1000 A and about 5000 A. In a specific embodiment, suitable particles have a pore size of about 1000 A or about 4000 A.

[0141]

[0121] In some embodiments, particles for use in the methods of the disclosure have a particle size from about 4 pm to about 8 pm and a pore size from about 500 A to about 5000 A (e.g., about 1000 A to about 4000 A).

[0142] Exemplary columns

[0143]

[0122] In specific embodiments, the methods disclosed herein use RP-UHPLC. UHPLC typically uses columns packed with particles smaller than 2 pm (e.g., 1.7 pm). UHPLC systems usually employ a pressure higher than 6000 psi (e.g., up to 15,000 psi), resulting in high flow rates for increased speed. In combination with the small particle size, UHPLC can provides superior resolution and sensitivity relative to conventional HPLC systems (see, e.g., Swartz, M.E., “Ultra Performance Liquid Chromatography (UPLC): an introduction”, SEPARATION SCIENCE REDEFINED (2005)).

[0144]

[0123] The inventors have found that, in the methods described herein, RP-UHPLC can advantageously be combined with columns having a length from about 150 mm to about 300 mm and an internal diameter from about 2 mm to about 5 mm and comprising a stationary phase comprising porous particles having (i) a size from about 4 pm to about 8 pm, and (ii) a pore size from about 500 A to about 5000 A (e.g., about 1000 A to about 4000 A), were shown to be particularly suitable for use in the method of the disclosure.

[0124] In some embodiments, the methods of the disclosure employ a column that has a length from about 200 mm to about 300 mm and an internal diameter from about 2 mm to about 5 mm and comprises a stationary phase comprising porous particles having (i) a size from about 5 pm to about 8 pm, and (ii) a pore size from about 500 A to about 5000 A (e.g., about 1000 A to about 4000 A). In particular embodiments, the methods of the disclosure employ columns that have a length of about 250 mm and an internal diameter of about 2.1 mm and comprise a stationary phase comprising porous particles having (i) a size of about 5 pm, and (ii) a pore size from about 1000 A to about 4000 A.

[0145]

[0125] The inventors found a column with the specification shown in Table A particularly useful for the separation of multiple mRNAs in a composition.

[0146] Table A. column specification

[0147] Separation conditions

[0148]

[0126] In order to achieve good separation of similarly sized mRNAs in a mixture, the separation conditions may be adjusted. Specific adjustments may depend on the particular RP-HPLC column that is employed in a method of the disclosure. Parameters that may be adjusted include the column temperature, the use of particular ion pairing reagents and organic modifiers in the mobile phase.

[0149] Column temperature

[0150]

[0127] To improve separation of larger nucleic acids that take on complex secondary structures, the RP-HPLC column is typically heated. In some embodiments, the RP-HPLC column is held at a temperature from about 40°C to about 65°C. In some embodiments, the RP-HPLC column has a temperature from about 45 °C to about 60 °C. In some embodiments, the temperature of the RP-HPLC column is about 60 °C or less. In some embodiments, the temperature of the RP-HPLC column is about 45 °C or greater. In some embodiments, the temperature of the RP-HPLC column is about 45 °C, about 46 °C, about 47 °C, about 48 °C, about 49 °C, about 50 °C, about 51 °C, about 52 °C, about 53 °C, about 54 °C, about 55 °C, about 56 °C, about 57 °C, about 58 °C, about 59 °C, or about 60 °C, including all values and subranges therebetween.

[0151]

[0128] The inventors of the present disclosure found that keeping the RP-HPLC column at a temperature from about 45 °C to about 55 °C (e.g., about 48 °C to about 55 °C) is particularly useful for the separation of a mixture of multiple mRNAs of similar length. Accordingly, in some embodiments, the column of the RP-HPLC column is held at a temperature of about 45 °C, about 46 °C, about 47 °C, about 48 °C, about 49 °C, about 50 °C, about 51 °C, about 52 °C, about 53 °C, about 54 °C, or about 55 °C, including all values and subranges therebetween. In a specific embodiment, the RP-HPLC column is held at a temperature of about 50 °C (e.g., ± 2 °C).

[0152] Mobile phase

[0153]

[0129] Reverse-phase High-Performance Liquid Chromatography (RP-HPLC) uses a nonpolar stationary phase and a polar mobile phase for separating analytes from each other. Typically, the mobile phase is an aqueous solution comprising a first ion pairing reagent. The ion pairing reagent facilities hydrophobic interactions with the non-polar stationary phase and electrostatic interactions with the negatively charged mRNA molecules, resulting in the formation of neutral complexes between ion pairing reagent and mRNA. As a results of these interactions, the neutral complexes can bind to the non-polar stationary phase (retention).

[0154]

[0130] The polarity of a mobile phase may be adjusted by the addition of a less polar or non-polar first organic modifier, which results in the elution of the bound mRNA molecules. The mobile phase may also comprise additional components such an acid, a base or a buffer to adjust and / or maintain the pH of the mobile phase.

[0155]

[0131] Typically, the adjustment of polarity is achieved by mixing a mobile phase A (or first mobile phase) with a mobile phase B (or second mobile phase). Gradual mixing is used to form a gradient of the non-polar mobile phase B, resulting in the elution of the bound mRNA molecules at different times, depending on their nucleotide composition.

[0132] In a typical embodiment, mobile phase A comprises the first ion pairing reagent (e.g., in water), and mobile phase B comprises the first organic modifier (e.g., in water). Separation of the at least first and second mRNAs or the two more mRNAs occurs because the first mRNA and the second mRNA, or the two or more mRNAs, are eluted from the stationary phase at different concentrations of the first ion pairing reagent and the first organic modifier.

[0156]

[0133] In the methods disclosed herein, hexylammonium acetate (HAA) has been found to be a particularly useful first ion pairing reagent. Accordingly, in some embodiments, the first ion pairing reagent is HAA. In other embodiments, the first ion pairing reagent is triethylammonium acetate (TEAA), dibutylammonium acetate (DBAA) or hexafluoroisopropanol (HFIP).

[0157]

[0134] In some embodiments, the concentration of the first ion pairing reagent in the mobile phase A is from about 75 mM to about 500 mM, including all values and subranges therebetween. In some embodiments, the first ion pairing reagent has a concentration of about 100 mM. In some embodiments, the first ion pairing reagent has a concentration of about 150 mM. In some embodiments, the first ion pairing reagent has a concentration of about 200 mM. In some embodiments, the first ion pairing reagent has a concentration of about 250 mM. In some embodiments, the first ion pairing reagent has a concentration of about 300 mM. In some embodiments, the first ion pairing reagent has a concentration of about 350 mM. In some embodiments, the first ion pairing reagent has a concentration of about 400 mM. In some embodiments, the first ion pairing reagent has a concentration of about 450 mM.

[0158]

[0135] A range of concentrations of the first ion pairing reagent were found to be useful. In particular embodiments, the first ion pairing reagent has a concentration of about 100 mM to about 400 mM. In some embodiments, the first ion pairing reagent has a concentration of about 150 mM to about 400 mM, e.g. about 200 mM to about 400 mM. In one specific embodiment, the first ion pairing reagent has a concentration of about 150 mM. In another specific embodiment, the first ion pairing reagent has a concentration of about 200 mM. In another specific embodiment, the first ion pairing reagent has a concentration of about 250 mM. In further specific embodiments, the first ion pairing reagent has a concentration of about 400 mM.

[0136] Acetonitrile (ACN) and methanol are the most commonly used organic modifiers in RP-HPLC. Acetonitrile and methanol may provide different selectivity. In some embodiments, acetonitrile may be used interchangeably, or in combination, with methanol in the methods of the disclosure. Acetonitrile has a lower UV cut-off than methanol (190 nm vs 205 nm), making it more suitable for use in applications requiring low UV detection wavelengths. For example, mRNA can be detected by using a wavelength of 260 nm. Accordingly, in some embodiments, the first organic modifier is acetonitrile. In other embodiments, the first organic modifier may be an alcohol, e.g., methanol.

[0159]

[0137] In some embodiments, the organic modifier is about 40% (v / v) to about 100% (v / v) of the mobile phase B. In some embodiments, the organic modifier is about 50% (v / v) of the mobile phase B. In some embodiments, the organic modifier is about 70% (v / v) to about 80% (v / v) of the mobile phase B. In some embodiments, the organic modifier is about 75% (v / v) of the mobile phase B.

[0160]

[0138] As demonstrated in the examples, using HAA as the first ion pairing agent and acetonitrile as the organic modifier results in good separation of mRNAs of similar length.

[0161]

[0139] In order to achieve different concentrations of the first organic modifier for elution of the mRNA from the stationary phase, mobile phase B is added to mobile phase A at different percentages, resulting in a gradient of mobile phase B in mobile phase A. Adjustments made to the components of the mobile phase (e.g., the additional presence of a first ion pairing reagent in mobile phase B; and / or the additional presence a first organic modifier in mobile phase A as well as in mobile phase B) can alter the retention time of each mRNA of the at least first mRNA and second mRNA or two or more mRNAs in the stationary phase. Alteration of the gradient can be used to optimize separation of the first and second or two or more mRNAs in a composition.

[0162]

[0140] To achieve greater flexibility in adjusting the gradient, mobile phase A can additionally include the first organic modifier and / or mobile phase B can additionally include the first ion pairing reagent. If the first organic modifier is added to mobile phase A, then the concentration of the first organic modifier in mobile phase B can be reduced. The skilled person understands that the concentration of the first organic modifier in mobile phase A is selected to avoid premature elution of the mRNAs.

[0141] As demonstrated herein, addition of the first organic modifier to mobile phase A allows for a wider gradient range of mobile phase B to be used for the separation of the at least first mRNA and second mRNA or the two or more mRNAs. Accordingly, in some embodiments, the mobile phase A further comprises a first organic modifier. In some embodiments, the first organic modifier is at a concentration of about 20% (v / v) to about 60% (v / v), including all values and subranges therebetween. In some embodiments, the organic modifier is at a concentration of about 40% (v / v).

[0163]

[0142] Separation of the at least first mRNA and second mRNA can be further improved by including the first ion pairing reagent in mobile phase B, as well as mobile phase A. Accordingly, in some embodiments, the mobile phase B further comprises the first ion pairing reagent. In some embodiments, the mobile phase B comprises the first ion pairing reagent at the same concentration as the mobile phase A. In a particular embodiment, the mobile phase B comprises the first ion pairing reagent at a concentration of about 150 mM. In another particular embodiment, the mobile phase B comprises the first ion pairing reagent at a concentration of about 200 mM.

[0164]

[0143] A mobile phase A comprising a first ion pairing reagent at a concentration of about 200 mM was shown to be particularly useful for use in the method of the disclosure, when used with a mobile phase B comprising the first ion pairing reagent at a concentration of about 200 mM. In a specific embodiment, the first ion pairing reagent is hexylammonium acetate (HA A).

[0165]

[0144] In some embodiments, the retention time of the mRNA in the stationary phase is adjusted by the addition of a second organic modifier to mobile phase B. For example, a second organic modifier can be used to modify the resolution of peaks for the first and second mRNAs or at least two mRNAs in the resulting chromatogram. In some embodiments, the first organic modifier is acetonitrile and the second organic modifier is methanol.

[0166]

[0145] In some embodiments, the pH of the mobile phase is about pH 8 or less. In some embodiments, the pH of the mobile phase is about pH 6 or greater. In some embodiments, the pH is from about pH 6 to about pH 8. In some embodiments, the pH is from about pH 7.0 to about pH 8.0. In some embodiments, the pH is about pH 7.0, about pH 7.1, about pH 7.2, about pH 7.3, about pH 7.4, about pH 7.5, about pH 7.6, about pH 7.7, about pH 7.8, about pH 7.9, or about pH 8.0.

[0167]

[0146] A mobile phase comprising a pH from about pH 7 to about pH 8 was shown to be particularly useful for use in the method of the disclosure. In a specific embodiment, the pH of the mobile phase is about pH 7.

[0168]

[0147] In some embodiments, the mobile phase comprises a chelating agent. In some embodiments, the chelating agent is a divalent cation chelator. In some embodiments, the divalent cation chelator is ethylenediaminetetraacetic acid (EDTA). In some embodiments, any divalent cation chelator that is suitable for the present disclosure can be used.

[0169]

[0148] In some embodiments, the concentration of the chelating agent in the mobile phase is from about 0.1 mM to about 0.9 mM, including all values and subranges therebetween. In some embodiments, the concentration of the chelating agent in the mobile phase is from about 0.2 mM to about 0.3 mM. In some embodiments, the concentration of the chelating agent in the mobile phase is about 0.25 mM. In some embodiments, the mobile phase does not comprise an agent for chelating divalent cations.

[0170] Elution gradient

[0171]

[0149] In some embodiments, the at least first mRNA and the second mRNAs or the two or more mRNAs separate at a gradient ranging from about 50% to about 70% of mobile phase B. In some embodiments, the at least first and second mRNAs or the two or more mRNAs separate at a gradient ranging from about 54% to about 68% of mobile phase B. In some embodiments, the at least first and second mRNAs or the two or more mRNAs separate at a gradient ranging about 56% to about 64% of mobile phase B.

[0172] Flow rate

[0173]

[0150] The mobile phase traverses the stationary phase at a certain flow rate. The inventors of the present disclosure found that adjusting the flow rate can improve separation of the at least first and second mRNAs. In some embodiments, the flow rate is about 1 ml / min or less. In some embodiments, the flow rate is about 0.1 ml / min or greater. In some embodiments, the flow rate is from about 0.1 ml / min to about 1 ml / min. In some embodiments, the flow rate is from about 0.1 ml / min to about 0.7 ml / min. In some embodiments, the flow rate is about 0.1 ml / min, about 0.2 ml / min, about 0.3 ml / min, about 0.4 ml / min, about 0.5 ml / min, about 0.6 ml / min, or about 0.7 ml / min.

[0174]

[0151] The inventors found that a flow rate from about 0.4 ml / min to about 0.6 ml / min is particularly suitable to separate mRNAs of similar length using the methods of the disclosure. In some embodiments, the flow rate is about 0.6 ml / min. In some embodiments, the flow rate is about 0.5 ml / min. In some embodiments, the flow rate is about 0.4 ml / min. In a particular embodiment, the flow rate is about 0.3 ml / min.

[0175] Exemplary separation conditions

[0176]

[0152] In specific embodiments, a method is provided for detecting two or more mRNAs of similar length or of the same length in a composition using reverse phase ultrahigh pressure liquid chromatography (RP-UHPLC), the method comprising providing an RP- HPLC column comprising a stationary phase, wherein the RP-UHPLC column is held at a temperature of 48-52°C (e.g., about 50°C); contacting the stationary phase at a flow rate of about 0.2-0.4 ml / min (e.g., about 0.3 ml / min) with a mobile phase A comprising a first pairing reagent (e.g., HAA) at a concentration of 100-400 mM; adding the composition comprising the two or more mRNAs to the stationary phase; applying a gradient of the mobile phase A with a mobile phase B to the stationary phase, wherein the mobile phase B comprises a first organic modifier (e.g., acetonitrile) at a concentration of 50-80% (v / v), thereby separating the two or more mRNAs; and detecting the two or more mRNAs, e.g., using ultra violet (UV) detection.

[0177]

[0153] In further specific embodiments, a method is provided for detecting two or more mRNAs of similar length or of the same length in a composition using reverse phase ultrahigh pressure liquid chromatography (RP-UHPLC), the method comprising providing an RP-UHPLC column comprising a stationary phase, wherein the RP-UHPLC column has a length of 150 mm or greater and the stationary phase comprises a plurality of porous particles with a pore size of about 500-5000 A (e.g., about 1000- 4000 A), wherein the RP- UHPLC column is held at a temperature of about 45-55°C (e.g., about 50°C); contacting the stationary phase at a flow rate of 0.2-04 ml / min (e.g., about 0.3 ml / min) with a mobile phase A comprising a first ion pairing reagent (e.g., HAA); adding the composition comprising the two or more mRNAs to the stationary phase; applying a gradient of the mobile phase A with a mobile phase B to the stationary phase thereby separating the two or more mRNAs, wherein the mobile phase B comprises a first organic modifier (e.g., acetonitrile); and detecting the at least first and second mRNAs, e.g., using ultra violet (UV) detection.

[0178]

[0154] In some embodiments, the mobile phase A further comprises the first organic modifier present in the mobile phase B. In some embodiments, the mobile phase B comprises the first ion pairing reagent present in the mobile phase A.

[0179]

[0155] In some embodiments, the mobile phase A comprises the first ion pairing reagent only. In some embodiments, the mobile phase B comprises the first organic modifier.

[0180]

[0156] In some embodiments, the mobile phase B comprises a second organic modifier (e.g., methanol). In some embodiments, the mobile phase A comprises a second ion pairing reagent (e.g., triethylammonium acetate (TEAA), dibutylammonium acetate (DBAA) or hexafluoroisopropanol (HFIP)).

[0181]

[0157] In some embodiments, the mobile phase A and the mobile phase B include water as the solvent. In some embodiments, the mobile phase A and the mobile phase B further comprise a buffering agent (e.g., triethyl amine (TEA)). In some embodiments, the pH of the mobile phase A and the mobile phase B is about 7-7.5 (e.g., about 7).

[0182]

[0158] In some embodiments, the RP-UHPLC column has a length of about 200-300 mm (e.g., about 250 mm) and an inner diameter between about 2-5 mm (e.g., 2.1 mm).

[0183]

[0159] In some embodiments, the stationary phase comprises a plurality of porous particles with a size between about 4-8 pm (e.g., about 5 pm) and a pore size of about 500-5000 A (e.g., about 1000 A or 4000 A). In some embodiments, the stationary phase comprises polystyrene and divinylbenzene polymers.

[0184]

[0160] In some embodiments, the gradient is about 54%-64% of the mobile phase B.

[0185]

[0161] The inventors found the conditions listed in Table B particularly useful for the separation of multiple mRNAs in a composition.

[0186] Table B. Separation conditions

[0187] Detection

[0188] Examples of detectors or detection systems include but are not limited to absorbance detectors (e.g., UV / VIS detectors), fluorescence detectors, electrochemical detectors, and mass spectrometric detectors. In a typical embodiment, methods of the disclosure use an absorbance detector to detect the mRNAs after separation. mRNA can readily be detected at 260 nm using UV detection.

[0189] REPRESENTATIVE EMBODIMENTS OF THE PRESENT DISCLOSURE

[0190] 1. A method for detecting at least a first mRNA and a second mRNA in a composition using reverse phase high pressure liquid chromatography (RP-HPLC), wherein said first mRNA and said second mRNA are of similar length, comprising:

[0191] (i) providing an RP-HPLC column comprising a stationary phase, wherein the RP-HPLC column has a length of 150 mm or greater and the stationary phase comprises a plurality of porous particles with a pore size of at least 500 A;

[0192] (ii) contacting the stationary phase at a flow rate with a mobile phase A comprising a first ion pairing reagent;

[0193] (iii) adding the composition comprising the at least first and second mRNAs to the stationary phase;

[0194] (iv) applying a gradient of the mobile phase A with a mobile phase B to the stationary phase, thereby separating the at least first and second mRNAs, wherein the mobile phase B comprises a first organic modifier; and

[0195] (v) detecting the at least first and second mRNAs. 2. The method of embodiment 1, wherein the at least first and second mRNAs differ in length by no more than 50 nucleotides.

[0196] 3. The method of embodiment 1 or 2, wherein the porous particles have a size equal to or greater than about 4 pm.

[0197] 4. The method of any one of the preceding embodiments, wherein the porous particles have a size of 8 pm or less.

[0198] 5. The method of any one of the preceding embodiments, wherein the porous particles have a size from about 4 pm to about 8 pm, optionally wherein the porous particles have a size of about 5 pm.

[0199] 6. The method of any one of the preceding embodiments, wherein the porous particles have a pore size of at least about 1000 A.

[0200] 7. The method of any one of the preceding embodiments, wherein the porous particles have a pore size of up to about 5000 A.

[0201] 8. The method of any one of the preceding embodiments, wherein the porous particles have a pore size from about 1000 A to about 4000 A.

[0202] 9. The method of any one of the preceding embodiments, wherein the porous particles have a pore size of about 1000 A or about 4000 A.

[0203] 10. The method of any one of the preceding embodiments, wherein the RP-HPLC column has a length of greater than 150 mm.

[0204] 11. The method of any one of the preceding embodiments, wherein the RP-HPLC column has a length of greater than 200 mm. 12. The method of any one of the preceding embodiments, wherein the RP-HPLC column has a length from about 200 mm to about 300 mm, optionally wherein the length is about 250 mm.

[0205] 13. The method of any one of the preceding embodiments, wherein the RP-HPLC column has an inner diameter smaller than 5 mm.

[0206] 14. The method of any one of the preceding embodiments, wherein the RP-HPLC column has an inner diameter from about 2 mm to about 5 mm.

[0207] 15. The method of any one of the preceding embodiments, wherein the first ion pairing reagent is hexylammonium acetate (HAA).

[0208] 16. The method of any one of the preceding embodiments, wherein the first ion pairing reagent is at a concentration of about 75 mM to about 500 mM.

[0209] 17. The method of embodiment 16, wherein the first ion pairing reagent is at a concentration of about 150 mM to about 400 mM, e.g. about 200 mM to about 400 mM.

[0210] 18. The method of embodiment 16 or 17, wherein the first ion pairing reagent is at a concentration of about 150 mM.

[0211] 19. The method of embodiment 16 or 17, wherein the first ion pairing reagent is at a concentration of about 200 mM. 0. The method of embodiment 16 or 17, wherein the first ion pairing reagent is at a concentration of about 250 mM. 1. The method of any one of the preceding embodiments, wherein the mobile phase A further comprises an organic modifier. 22. The method of embodiment 21, wherein the organic modifier is at a concentration of about 20% (v / v) to about 60% (v / v).

[0212] 23. The method of embodiment 22, wherein the organic modifier is at a concentration of about 40% (v / v).

[0213] 24. The method of any one of embodiments 21-23, wherein the organic modifier is the same as the organic modifier in mobile phase B.

[0214] 25. The method of any one of the preceding embodiments, wherein the organic modifier is acetonitrile.

[0215] 26. The method of any one of the preceding embodiments, wherein the organic modifier is from about 40% (v / v) to about 100% (v / v) of the mobile phase B, e.g., about 50% (v / v) or 75% (v / v).

[0216] 27. The method of embodiment 26, where the organic modifier is about 50% (v / v) of the mobile phase B.

[0217] 28. The method of embodiment 26, where the organic modifier is about 75% (v / v) of the mobile phase B.

[0218] 29. The method of any one of the preceding embodiments, wherein the mobile phase B further comprises the first ion pairing reagent.

[0219] 30. The method of embodiment 29, wherein the mobile phase B comprises the first ion pairing reagent at the same concentration as the mobile phase A.

[0220] 31. The method of any one of the preceding embodiments, wherein the flow rate is less than 0.6 ml / min. 32. The method of any one of the preceding embodiments, wherein the flow rate is from about 0.2 to about 0.5 ml / min, e.g., about 0.3 ml / min or about 0.4 ml / min.

[0221] 33. The method of any one of the preceding embodiments, wherein the RP-HPLC column is held at a temperature of about 45°C to about 60°C.

[0222] 34. The method of any one of the preceding embodiments, wherein the RP-HPLC column is held at a temperature of less than 55°C.

[0223] 35. The method of any one of the preceding embodiments, wherein the RP-HPLC column is held at a temperature of about 45°C to about 55°C.

[0224] 36. The method of embodiment 35, wherein the temperature is about 50°C.

[0225] 37. The method of any one of the preceding embodiments, wherein the mobile phase A and / or mobile phase B has / have a pH from about 6 to about 8.

[0226] 38. The method of embodiment 37, wherein the pH is about 7, about 7.5 or about 8.

[0227] 39. The method of any preceding embodiment, wherein the composition comprising the at least first and second mRNAs, the mobile phase A and / or the mobile phase B comprise(s) an agent for chelating divalent cations.

[0228] 40. The method of embodiment 39, wherein the agent for chelating divalent cations is ethylenediaminetetraacetic acid (EDTA).

[0229] 41. The method of embodiment 39 or 40, wherein the concentration of the agent for chelating divalent cations in the mobile phase A and / or mobile phase B ranges from about 0.1 mM to about 0.9 mM. 42. The method of embodiment 41, wherein the concentration of the agent for chelating divalent cations is from about 0.2 mM to about 0.3 mM, optionally where the concentration of the agent for chelating divalent cations is about 0.25 mM.

[0230] 43. The method of any preceding embodiment, wherein the mobile phase A and / or mobile phase B does not comprise an agent for chelating divalent cations.

[0231] 44. The method of any preceding embodiment, wherein the composition comprises the at least first and second mRNAs encapsulated in the same lipid nanoparticle.

[0232] 45. The method of any preceding embodiment, wherein the composition comprises the at least first and second mRNAs encapsulated in different lipid nanoparticles.

[0233] 46. The method of embodiment 44 or 45, wherein the mRNAs are extracted from the lipid nanoparticles, optionally wherein the extraction is performed using one or more organic solvents or a detergent.

[0234] 47. The method of any preceding embodiment, wherein the composition comprises the at least first and second mRNAs in purified form.

[0235] 48. The method of any one of the preceding embodiments, wherein step (v) yields a chromatogram providing information about characteristics of the at least first and second mRNAs.

[0236] 49. The method of embodiment 48, wherein the characteristics include integrity and purity of said at least first and second mRNAs.

[0237] 50. The method of embodiment 48 or 49, wherein the chromatogram is used to calculate the ratios of said at least first and second mRNAs within the composition.

[0238] 51. The method any one of the preceding embodiments, wherein the at least first and second mRNAs encode homologous proteins. 52. The method of any one of the preceding embodiments, wherein the at least first and second mRNAs encode antigens from at least a first virus and a second virus, optionally wherein the first and second viruses are phylogenetically related to each other.

[0239] 53. The method of embodiment 52, wherein the at least first and second viruses are influenza viruses.

[0240] 54. The method of embodiment 52 or 53, wherein the antigens are hemagglutinin (HA) or neuraminidase (NA) proteins.

[0241] 55. The method of any one of the preceding embodiments, wherein the porous particles are made of styrene and / or divinylbenzene.

[0242] 56. The method of any one of the preceding embodiments, wherein the gradient ranges from about 40% of mobile phase B to about 70% of mobile phase B.

[0243] 57. The method of any one of the preceding embodiments, wherein the at least first and second mRNAs differ in length by no more than 45 nucleotides.

[0244] 58. The method of any one of the preceding embodiments, wherein the at least first and second mRNAs differ in length by no more than 40 nucleotides.

[0245] 59. The method of any one of the preceding embodiments, wherein the at least first and second mRNAs differ in length by no more than 35 nucleotides.

[0246] 60. The method of any one of the preceding embodiments, wherein the at least first and second mRNAs differ in length by no more than 30 nucleotides.

[0247] 61. The method of any one of the preceding embodiments, wherein the at least first and second mRNAs differ in length by no more than 25 nucleotides. 62. The method of any one of the preceding embodiments, wherein the at least first and second mRNAs differ in length by no more than 20 nucleotides.

[0248] 63. The method of any one of the preceding embodiments, wherein the at least first and second mRNAs differ in length by no more than 15 nucleotides.

[0249] 64. The method of any one of the preceding embodiments, wherein the at least first and second mRNAs differ in length by no more than 10 nucleotides.

[0250] 65. The method of any one of the preceding embodiments, wherein the at least first and second mRNAs differ in length by no more than 5 nucleotides.

[0251] 66. The method of any one of the preceding embodiments, wherein the at least first and second mRNAs are of the same length.

[0252] 67. The method of any one of the preceding embodiments, wherein the at least first and second mRNAs differ in G / C content.

[0253] 68. A method for detecting two or more mRNAs in a composition using reverse phase high pressure liquid chromatography (RP-HPLC), comprising:

[0254] (i) providing an RP-HPLC column comprising a stationary phase, wherein the RP- HPLC column is held at a temperature of less than 55°C;

[0255] (ii) contacting the stationary phase at a flow rate of less than 0.6 ml / min with a mobile phase A comprising a first ion pairing reagent;

[0256] (iii) adding the composition comprising the two or more mRNAs to the stationary phase;

[0257] (iv) applying a mobile phase B comprising a first organic modifier to the stationary phase, thereby separating the two or more mRNAs; and

[0258] (v) detecting the two or more mRNAs using ultra violet (UV) detection. 69. The method of embodiment 68, wherein the first ion pairing reagent is hexylammonium acetate (HA A).

[0259] 70. The method of embodiment 68 or 69, wherein the first ion pairing reagent is at a concentration of about 75 mM to about 500 mM.

[0260] 71. The method of embodiment 70, wherein the ion pairing reagent is at a concentration of about 200 mM to about 400 mM.

[0261] 72. The method of any one of the embodiments 68 to 71, wherein the mobile phase A further comprises an organic modifier.

[0262] 73. The method of embodiment 72, wherein the organic modifier is at a concentration of about 20% (v / v) to about 60% (v / v).

[0263] 74. The method of embodiment 73, wherein the organic modifier is at a concentration of about 40% (v / v).

[0264] 75. The method of any one of embodiments 72 to 74, wherein the organic modifier is the same as the organic modifier in mobile phase B.

[0265] 76. The method of any one of embodiment 75, wherein the organic modifier is acetonitrile.

[0266] 77. The method of any one of embodiments 68 to 76, wherein the organic modifier is from about 40% (v / v) to about 100% (v / v) of the mobile phase B.

[0267] 78. The method of any one of embodiments 68 to 77, wherein the mobile phase B further comprises the first ion pairing reagent.

[0268] 79. The method of embodiment 78, wherein the mobile phase B comprises the first ion pairing reagent at the same concentration as the mobile phase A. 80. The method of any one of embodiments 68 to 79, wherein the gradient ranges from about 40% of mobile phase B to about 70% of mobile phase B.

[0269] 81. The method of any one of embodiments 68 to 80, wherein the flow rate is about 0.3 ml / min or about 0.4 ml / min.

[0270] 82. The method of any one of embodiments 68 to 81, wherein the temperature is from about 45 °C to about 55 °C.

[0271] 83. The method of embodiment 82, wherein the temperature is about 50 °C.

[0272] 84. The method of any one of embodiments 68 to 83, wherein the mobile phase A and the mobile phase B have a pH from about 6.5 to about 7.5.

[0273] 85. The method of embodiment 84, wherein the pH is about 7.

[0274] 86. The method of any of embodiments 68 to 85, wherein the mobile phase comprises an agent for chelating divalent cations.

[0275] 87. The method of embodiment 86, wherein the agent for chelating divalent cations is EDTA.

[0276] 88. The method of embodiments 86 or 87, wherein the concentration of the agent for chelating divalent cations in the second mobile phase ranges from about 0.1 mM to about 0.9 mM.

[0277] 89. The method of embodiment 88, wherein the concentration of the agent for chelating divalent cations is from about 0.2 mM to about 0.3 mM.

[0278] 90. The method of any of embodiments 68 to 89, wherein the composition comprises the two or more mRNAs encapsulated in the same lipid nanoparticle. 91. The method of any of embodiments 68 to 90, wherein the composition comprises the two or more mRNAs in purified form.

[0279] 92. The method of any of embodiments 68 to 91, wherein step (v) yields a chromatogram providing information about characteristics of the two or more mRNAs.

[0280] 93. The method of embodiment 92, wherein the characteristics include integrity and purity of said two or more mRNAs.

[0281] 94. The method of embodiment 92 or 93, wherein the chromatogram is used to calculate the ratios of said at least first and second mRNAs within the composition.

[0282] 95. The method of any of embodiments 68 to 94, wherein the two or more mRNAs encode proteins that are similar in size.

[0283] 96. The method of any of embodiments 68 to 95, wherein the two or more mRNAs encode homologous proteins.

[0284] 97. The method of any of embodiments 68 to 96, wherein the two or more mRNAs encode antigens from a first virus and a second virus, optionally wherein the first and second viruses are phylogenetically related to each other.

[0285] 98. The method of embodiment 97, wherein the first and second viruses are influenza viruses.

[0286] 99. The method of embodiment 97 or 98, wherein the antigens are hemagglutinin (HA) or neuraminidase (NA) proteins.

[0287] EXAMPLES

[0288]

[0162] The following examples are included for illustrative purposes only and are not intended to limit the scope of the disclosure. Example 1. mRNA sample preparation

[0289]

[0163] mRNAs were synthesized as described in published U.S. Application No. US 2018 / 0258423, which is incorporated herein by reference. Briefly, 4 different mRNAs were synthesized via in vitro transcription (IVT) in separate reactions. Each reaction comprised a circular DNA template, a pool of ribonucleotide triphosphates, an SP6 RNA polymerase and a suitable buffer. The IVT reactions were terminated by the addition of DNase I.

[0290]

[0164] Each of the DNA templates included an mRNA sequence operationally linked to an SP6 promoter. Each mRNA sequence encompassed in 5’ to 3’ order: a 5’ UTR, a coding sequence and a 3 ’ UTR. The coding sequence of each of the 4 mRNAs encoded a different influenza HA antigen. Accordingly, the nucleic acid composition of each coding sequence is different, as can be seen from Table 1 :

[0291] Table 1

[0292]

[0165] The in vitro synthesized mRNAs were purified. Afterwards, a 5’ cap and a poly-A tail were added to each mRNA in a separate reaction, and the capped and tailed mRNAs were purified. For subsequent experiments, the 4 purified mRNAs were mixed in water at a ratio of 1 : 1 : 1 : 1 at an mRNA concentration of 1 mg / ml.

[0293] Example 2. Column selection

[0294]

[0166] This example illustrates how column length and the composition of the column’s stationary phase impact the ability to separate mRNAs of similar length using reverse-phase high-pressure liquid chromatography (RP-HPLC).

[0295]

[0167] Columns 1-5 shown in Table 2 were tested for their capability to resolve a mixture of the 4 mRNAs prepared in Example 1. The different test columns differed from each other in their length and diameter as well as in the composition of the stationary phase. All stationary phases were porous particles varying in size between 1-8 pm. The pore size also varied. Table 2

[0296]

[0168] None of the 5 tested columns provided a satisfactory resolution of all 4 mRNAs in the mixture. Column 4 yielded the best resolution of individual mRNAs. This column had the largest pore size and was the second-longest of the tested columns.

[0169] This example demonstrates that both the length of the column and the pore size of the stationary phase impact the resolution of mRNAs in a mixture where each mRNA is of similar length. A column with a length of 150 mm or greater and a pore size greater than 1000 A provided the best resolution.

[0297] Example 3. Separation conditions

[0170] This example illustrates the use of different ion pairing reagents and organic modifiers in the mobile phases to separate similarly sized mRNAs from a mixture.

[0298]

[0171] In order to improve the resolution between mRNAs of similar length, Column 4 of Example 2 was tested with different separation conditions. Different combinations of ion pairing reagents (HAA, HFIP) and organic modifiers (acetonitrile, methanol) were tested as shown in Table 3. The asterisk (*) indicated that the mRNA mixture was pre-heated for 10 minutes at 70°C prior to injection.

[0299] Table 3

[0300]

[0172] The gradient and flow rate are shown in Table 4. For each test run, the column was maintained at a temperature of 55 °C.

[0301] Table 4

[0302]

[0173] The tested conditions all resulted in comparable separation of the 4 mRNAs using Column 4. As was observed in Example 2, none of the conditions resulted in complete resolution of each mRNA as separate peak.

[0303]

[0174] Figure 1 shows an illustrative chromatogram using condition I, which employed HAA as the ion pairing reagent and acetonitrile as the organic modifier. The chromatogram labelled “mixture” was obtained by separating 4 HA mRNAs (HA mRNA 1, HA mRNA 2, HA mRNA 3, and HA mRNA 4) shown in Table 1 using column 4 (see Table 2) and condition I (see Table 3). Under these conditions, HA mRNA 1 and HA mRNA 2 could be resolved as separate peaks (at 14.435 minutes and 14.648 minutes), whereas HA mRNA 3 was visible as a shoulder only (at 15.99 minutes) in a larger peak (at 15.625 minutes) also including HA mRNA 4. Each mRNA was also run separately, as indicated in the figure.

[0304]

[0175] Using condition 1, HA mRNAs 1 and 2 and HA mRNAs 3 and 4 could not completely be separated, when the mixture was injected, resulting in a chromatogram with only two clearly distinguishable peaks.

[0305]

[0176] The use of 100% acetonitrile in condition I resulted in partial precipitation of the mRNA in mobile phase B. To prevent precipitation, 6 M urea was added to the mRNA sample. The addition of urea improved solubility of the mRNAs in the mRNA sample, but did not improve separation of the mRNAs.

[0306]

[0177] In order to prevent precipitation while avoiding the use of urea, the acetonitrile concentration in mobile phase B was reduced to 75% in condition II. Figure 2 shows an illustrative chromatogram using conditions Ila and lib (see Table 3) to separate the 4 HA mRNAs shown in Table 1 using column 4 (of Table 2). The only difference between these conditions (Ila and lib) was that for condition lib the mixture was pre-heated prior to injection for 10 minutes at 70°C prior to injection to denature the HA mRNAs. The preheating step resulted in longer retention times for each HA mRNA, but did not increase resolution. Under these conditions, only two clearly distinguishable peaks were identified in each of these conditions: in condition Ila, at 18.014 minutes and 19.041 minutes; in condition lib, at 18.352 minutes and 19.486 minutes.

[0307]

[0178] To determine whether separation of the 4 HA mRNAs could be improved by adjusting the separation conditions further, HFIP was used as ion pairing reagent and methanol as the organic modifier in condition III. As can be seen from Figure 3, condition III resulted in a similar separation pattern of the 4 HA mRNAs (see Table 1) as conditions I, Ila and lib. The chromatogram was obtained using column 4 (see Table 2). In condition III, HFIP was used as the ion pairing reagent and methanol as the organic modifier. Only two clearly distinguishable peaks were identified (at 5.904 minutes and 9.145 minutes), each with a small shoulder. This indicates that the first peak comprised HA mRNA 2 and mRNA 1 and that the second peak comprised HA mRNA4 and mRNA 3, as indicated in the figure. HA mRNAs 1 and 2 and HA mRNAs 3 and 4 could not completely be separated when the mixture was injected, resulting in a chromatogram with only two clearly distinguishable peaks.

[0308]

[0179] This example demonstrates that the use of different ion pairing reagents and organic modifiers in the mobile phases yields comparable results.

[0309] Example 4. Column optimization

[0310]

[0180] This example illustrates that the use of a column having a length greater than 150 mm can separate similarly sized mRNAs from a mixture.

[0181] Under the conditions tested in Example 3, HA mRNAs 1 and 2 and HA mRNAs 3 and 4 could not completely be separated. To determine whether extending the length of the column and thus the stationary phase could improve separation of the mRNAs in the test mixture, a new Column 6 was prepared. This column was 250 mm long and its stationary phase was comprised of particles with the same pore size as that of column 4 of Table 2. The column specification is summarized in Table 5.

[0311] Table 5

[0312]

[0182] Various conditions were tested to adapt the method established for Column 4 of Table 2 for use with new Column 6. Heating the column to 50°C resulted in better resolution of the peaks than heating it to 55°C. Further lowering the temperature to 45°C did not result in improved resolution of peaks. Similarly, heating the column to 60°C also did not improve peak separation. Indeed, the distance between peaks became smaller.

[0313]

[0183] In the previous examples, the flow of the mobile phases was set at 1 ml / min. To investigate whether reducing the flow rate would improve peak separation, the following flow rates were tested: 0.35 ml / min, 0.4 ml / min and 0.5 ml / min. The best peak profile was observed with 0.4 ml / min.

[0314]

[0184] In Example 3, two ion pairing reagents (HAA in water and HFIP in TEA buffer) were tested. These experiments were repeated. The use of TEA-buffered HFIP did not yield a better peak resolution, and therefore subsequent experiments were performed with HAA as the ion paring reagent. Using 100 mM HAA resulted in a better resolution of peaks than using 75 mM HAA.

[0315]

[0185] Better peak separation was also observed when the mRNA sample was prepared in water rather than mobile phase A.

[0316]

[0186] Accordingly, the conditions shown in Table 6 were used subsequently with Column 6: Table 6

[0317]

[0187] It was further observed that the elution of the mRNA occurred at 60%-64% of mobile phase B.

[0318]

[0188] The mixture of 4 HA mRNAs described in Example 1 was applied to Column 6 (see Table 5) and separated using the conditions described in Table 6. In addition, each of the individual mRNAs were also applied to Column 6 under identical conditions. An overlay of the five recorded chromatograms of an illustrative experiment in shown in Figure 4. The chromatogram labelled “mixture” was obtained by separating the 4 mRNAs shown in Table 1. Four peaks were identifiable. Each mRNA was also run separately, as indicated in the figure, allowing each peak to be matched to one of the four mRNAs. As can be seen from Figure 4, these conditions resulted in the detection of separate peaks of mRNAs 1 and 2. Distinct peaks representing mRNAs 3 and 4 were also observed. In contrast to the peaks representing mRNAs 1 and 2, the peaks representing mRNAs 3 and 4 could not be completely separated under the test conditions described in Table 6. However, to determine the presence of all 4 mRNAs in a mixture, a complete separation of the peaks is not required.

[0319]

[0189] This Example demonstrates that the separation conditions used in the preceding examples can be adapted for use with a column that has a length greater than 150 mm. The identified conditions were able to separate 4 similarly sized mRNAs (2 being of the same size and two differing by about 50 nucleotides) in a mixture into distinct peaks using RP- HPLC.

[0320] Example 5. Elution gradient and pH

[0321]

[0190] This Example illustrates that the elution gradient and pH of the mobile phases require careful adjustment to achieve acceptable peak separation of similarly sized mRNAs in a mixture using RP-HPLC.

[0191] In order to explore how the pH of mobile phases A and B affects peak separation, various conditions were tested using Column 6 of Example 4 (see Table 5). It was found that the pH of the mobile phase plays an important role in peak separation. Some preparations with a pH less than 7 for mobile phases A and B did not result in the separation of the 4 mRNAs from the mixture. Adjusting the mobile phases to a pH between pH 7 and 8 (e.g., 7 or 7.5) resulted in acceptable peak separation.

[0322]

[0192] It was found in Example 4 that the elution of the mRNAs occurs at 60%-64% of mobile phase B. To determine whether this range could be narrowed down, various gradients were tested. Gradients of 58.5%-60.5%, 58%-60.5% and 58%-61 % of mobile phase B resulted in acceptable peak separation. In contrast, no peak separation was observed when a gradient of 60%-63% or 61%-64% of mobile phase B was applied, indicating that the gradient requires careful adjustment.

[0323]

[0193] This Example demonstrates that the pH of mobile phases A and B as well as the elution gradient require careful adjustment to separate a mixture of similarly sized mRNAs during RP-HPLC.

[0324] Example 6. Composition of the mobile phases

[0325]

[0194] This Example illustrates that the presence of an ion pairing reagent in mobile phase B is not required to achieve effective separation of similarly sized mRNAs in a mixture. This Example also demonstrates that better resolution can be obtained when the same ion paring reagent is present in both mobile phase A and mobile phase B.

[0326]

[0195] In the preceding examples, mobile phase A and mobile phase B each comprised an ion pairing reagent. It was hypothesized that the presence of an ion pairing reagent in mobile phase B is not required for effective separation. Therefore, experiments were performed in which only mobile phase A comprised an ion pairing reagent. These experiments employed the column listed in Table 5. The flow rate and column temperature were as described in Table 6. The test conditions are shown in Table 7. Table 7

[0327]

[0196] The 4 similarly sized mRNAs of Table 1 were diluted in water in the presence of 0.25 mM EDTA. Condition A resulted in effective separation of 2 of the mRNAs, resulting in the detection of three peaks. When conditions B-E were used, 4 distinct peaks representing each of the 4 mRNAs in the mixture were observed. These data confirm the hypothesis that the presence of an ion pairing reagent in mobile phase B is not required for effective separation of similar sized mRNAs in a mixture.

[0328]

[0197] To explore the effects of adding back an ion pairing reagent, the experiment was repeated comparing conditions C and E from Table 7 with a modified version of condition A, in which 200 mM HAA was added to mobile phase B, shown in Table 8. The running conditions were essentially identical to those in Table 6, the only difference being that the flow rate was adjusted to 0.3 ml / min. As can be seen from Figures 5A and 5B, separation of mRNAs was improved with a higher concentration of an ion pairing reagent when the flow rate was reduced.

[0329]

[0198] As can be seen from Figure 5C the presence of the ion pairing reagent in both mobile phase A and mobile phase B further improved peak resolution. Moreover, it allowed using a lower concentration of the ion pairing reagent in mobile phase A.

[0330] Table 8

[0331] Example 7. Column temperature

[0332]

[0199] This Example illustrates the effects of column temperature on the separation of the mRNAs.

[0200] The optimized conditions from Example 6 were used to determine what effect variation of the column temperature would have on sample separation. Mobile phase A comprised 200 mM HAA in water, mobile phase B comprised 75% acetonitrile (v / v) and 200 mM HAA in water, as shown in Table 8.

[0333]

[0201] The flow rate was adjusted to 0.3 ml / min. The column described in Table 5 was used in each experiment. A mixture of the 4 mRNAs described in Table 1 were used in each experiment. The mRNA was diluted in water + 0.25 mM EDTA. The column temperature was set to 40°C, 50°C and 55°C, respectively. The results of these experiments are summarized in Figure 6.

[0334] As can be seen from Figure 6A, the mRNAs were not separated when the column temperature was set to 40°C. In contrast, the four mRNAs were effectively separated when the column temperature was set to 55°C (Figure 6C). Optimal separation of the four mRNAs was observed when the column temperature was set to 50°C, as shown in Figure 6B.

[0335]

[0202] This example demonstrates that holding the RP-HPLC column at a temperature of 45-55°C results in separation of similarly sized mRNAs and that holding it at less than 55°C (e.g., at about 50°C) improves their separation.

[0336] Example 8. Elution gradient

[0337]

[0203] This Example illustrates that a narrow gradient at 57-61% of mobile phase B can result in effective separation of similarly sized mRNAs in a mixture.

[0338]

[0204] As illustrated in Example 6, mobile phase A with 250 mM HAA and a mobile phase B with 75% acetonitrile results in effective separation of similarly sized mRNAs in a mixture. Different gradients between mobile phase A and mobile phase B were tested to determine whether the separation conditions could be further improved. Using the column of Table 5 and a flow rate of 0.3 ml / min, effective separation of a mixture comprising all 4 HA mRNAs listed in Table 1 was achieved when gradients of 58-60%, 58-61%, or 57.5- 60% of mobile phase B were used.

[0339]

[0205] This Example demonstrates that effective separation can be achieved using a narrow gradient in the range of 57-61% of mobile phase B. Example 9. Presence of an organic modifier in both mobile phases

[0340]

[0206] This Example illustrates that addition of an organic modifier to both mobile phase A and mobile phase B can further improve separation.

[0341]

[0207] For this experiment, a UPLC System with the column described in Table 5 was used to separate a 1 : 1 : 1 : 1 mixture of the four HA mRNAs listed in Table 1. The flow rate was 0.3 mL / min and the column temperature was set to 50°C. Nucleic acids were detected with a UV detector at 260 nm.

[0342]

[0208] Mobile phase A was composed of 200 mM HAA and 40% (v / v) acetonitrile in water at pH 7. Mobile phase B was composed of 200 mM HAA and 50% (v / v) acetonitrile in water at pH 7. The mobile phase compositions are summarized in Table 9. Providing the organic modifier in both mobile phases provides greater flexibility for adjusting the gradient.

[0343] Table 9

[0344]

[0209] The gradient shown in Table 10 was used. As can be seen from Figure 7, a further improvement in the separation of the four mRNA peaks could be achieved.

[0345] Table 10

[0346]

[0210] This Example illustrates that addition of an organic modifier such as acetonitrile to both mobile phase A and mobile phase B can further improve separation by allowing greater flexibility for gradient adjustments. For example, using a gradient of 50%-64% of mobile phase B, further improved peak separation was observed. Example 10. Separation of mRNAs using two organic modifiers

[0347]

[0211] This Example illustrates that addition of a second organic modifier to mobile phase B also allows for adjustments of the sample retention time and allows for effective separation of similarly sized mRNAs.

[0348]

[0212] The same UPLC system, column and running conditions as described in Example 9 were used to separate a 1 : 1 : 1 : 1 mixture of the four mRNAs listed in Table 1.

[0349]

[0213] Separation of the four mRNAs was performed using a mobile phase A comprising 300 mM HAA at pH 7 and a mobile phase B comprising 75% (v / v) acetonitrile (condition C of Table 7). For comparison, the separation of the four mRNAs was also performed using a mobile phase A comprising 300 mM HAA in water at pH 7 and a mobile phase B comprising 75% (v / v) acetonitrile and 5% (v / v) methanol in water (the “second condition”). In both instances, the gradient shown in Table 11 was applied.

[0350] Table 11

[0351]

[0214] As can be seen from Figures 8A and 8B, under both conditions (condition C of Table 7 and the “second condition”), separation of the four mRNAs was observed. The presence of the second organic modifier reduced the retention time to elution and peak detection. Peak 3 and peak 4 (from left to right) could not be completely separated under either test condition.

[0352]

[0215] To improve separation, the experiment was repeated using the mobile phases A and B of the “second condition” with the gradient shown in Table 12.

[0353] Table 12

[0354]

[0216] As can be seen from Figure 8C, using the gradient shown in Table 12, peak separation could be improved at the cost of longer retention times.

[0355]

[0217] This example demonstrates that the presence of a second organic modifier can be used to adjust sample retention time. Gradient adjustments allow for effective separation of similarly sized mRNA.

[0356] Example 11. Separation of mRNAs using two ion pairing reagents

[0357]

[0218] This example explores whether addition of a second ion pairing reagent to mobile phase A allows for better separation of similarly sized mRNAs.

[0358]

[0219] The experiments described in Examples 3 and 4 investigated whether the addition of a second ion pairing reagent to mobile phase A can improve the separation of similarly sized mRNAs. This example explores alternative combinations of first and second ion pairing reagents in mobile phase A.

[0359]

[0220] For this experiment, a UPLC System with the column described in Table 5 was used to separate a 1 : 1 : 1 : 1 mixture of the four HA mRNAs listed in Table 1. The flow rate was 0.3 mL / min and the column temperature was set to 50°C. Nucleic acids were detected with a UV detector at 260 nm.

[0360]

[0221] As in Example 10, separation of the four mRNAs was performed using a mobile phase A comprising 300 mM HAA at pH 7 and a mobile phase B comprising 75% (v / v) acetonitrile (condition C of Table 7), using the gradient shown in Table 11.

[0361]

[0222] The experiment was repeated by adding tri ethylammonium acetate (TEAA; 100 mM), dibutylammonium acetate (DBAA, 50 mM) or hexafluoroisopropanol (HFIP; 100 mM), respectively, as a second ion pairing to mobile phase A.

[0362]

[0223] Taking into account the results of this first experiment, the gradient was then adjusted and the experiment was repeated. Under each test condition, addition of the second ion pairing reagent required adjustment of the gradient to achieve separation of the four mRNAs into distinct peaks. None of the test conditions resulted in an improved separation relative to the conditions identified in Example 6.

[0363]

[0224] This example demonstrates that addition of a second ion pairing reagent does not improve separation of similarly size mRNAs relative to previously optimized conditions using a single ion pairing reagent.

[0364] Example 12. Separation of other multi-RNA compositions

[0365]

[0225] This example illustrates that the methods identified in the preceding examples can be used to separate compositions of mRNAs of similar lengths that differ from the compositions used in those examples.

[0366]

[0226] The same UPLC system, column and running conditions as described in Example 9 were used to separate a 1 : 1 : 1 mixture of the three mRNAs listed in Table 13, each encoding an antigen from a different respiratory virus (RV). Samples containing each of the three mRNAs separately were run in parallel to confirm effective separation. Mobile phase A comprised 200 mM HAA in water at pH 7, and mobile phase B comprised 200 mM HAA and 75% (v / v) acetonitrile, as shown in Table 8.

[0367] Table 13

[0368]

[0227] Figure 9 shows the separation and detection of each mRNA individually, overlaid with the separation and detection of the three mRNAs from the mixture.

[0369]

[0228] This example demonstrates that the methods identified in the preceding examples to separate a mixture of four similarly sized mRNAs can be used to effectively separate other composition comprising mRNAs of similar lengths, confirming the broad applicability of the identified methods. Example 13. Separation of multiple mRNAs identical in length

[0370]

[0229] This example illustrates that the methods identified in the preceding examples can be used to separate mixtures of eight different mRNAs having the same or very similar lengths.

[0371]

[0230] In this example, the same separation conditions as in Example 12 were used to separate a 1 : 1 : 1 : 1 mixture of the four influenza neuraminidase (NA)-encoding mRNAs shown in Table 14 (“mixture 1”) and, separately, the four influenza haemagglutinin (HA) mRNAs of Table 1 (“mixture 2”). The coding sequences of each of these four NA mRNAs were from different influenza viruses. Two NA mRNAs comprised 1653 nucleic acids, and two NA mRNAs comprised 1644 nucleic acids. The successful separation and detection of the four NA mRNAs from each mixture is shown in Figure 10A. This experiment confirms that the methods identified in the preceding examples can be used separate multiple mRNAs that have the same or very similar lengths.

[0372] Table 14

[0373]

[0231] In a second experiment, the HA mRNAs shown in Table 1 were combined with the NA mRNAs shown in Table 14 to form a third mixture. In this third mixture, three pairs of these mRNAs were identical in length, specifically HA mRNAs 1 and 2, NA mRNAs 1 and 2, and NA mRNAs 3 and 4. Using the same experimental conditions, six of the mRNAs were successfully separated and detected, as shown in Figure 10B. As can be seen by comparison with Figure 10A, two of the mRNAs, one HA mRNA and one NA mRNA, had identical retention times under test conditions and therefore an overlapping peak comprising these two mRNAs could not be resolved into separate peaks.

[0374]

[0232] This example illustrates that the methods identified in the preceding examples can be used to separate mixtures of eight mRNAs having the same or very similar lengths using conditions optimized for four of a total of eight mRNAs in a mixture. Further adjustments to the gradient should allow separation of the two overlapping peaks. Example 14. Pore size

[0375]

[0233] This example illustrates that only minor adjustments to the running conditions are needed to adapt the methods identified in preceding examples to a column with a different pore size.

[0234] A UPLC system was fitted with liquid chromatography column as shown in Table

[0376] 15. As in previous experiments, the stationary phase was formed by rigid macroporous particles made from aromatic hydrocarbon polymers (polystyrene-divinylbenzene).

[0377] Table 15

[0378]

[0235] Although the pore size of the stationary phase was four times smaller than in, e.g., Examples 12 and 13, only minor adjustments to the running conditions were required to resolve a mixture of the 4 HA mRNAs prepared in Example 1 (0.125 mg / ml of each mRNA). The compositions of the mobile phases are shown in Table 16.

[0379] Table 16

[0380]

[0236] The flow rate was adjusted to 0.26 ml / min because of the maximum pressure limit of the column. The column temperature was adjusted to 49°C. The elution gradient was adjusted as shown in Table 17 to keep the same elution volumes.

[0381] Table 17

[0237] As shown in Figure 11 A, the running conditions adjusted for the smaller pore size of the stationary phase achieved separation of the four mRNAs into distinct peaks. Figure

[0382] 1 IB shows an overlay of the chromatogram shown in Figure 11 A with a previously obtained chromatogram of the same mixture of mRNA using the same column loaded with a stationary phase comprising particles of the same composition with a pore size of 4000 A. As can be seen from Figure 1 IB, the smaller pore size of 1000 A resulted in slightly wider, well-separated peaks.

[0383]

[0238] This example illustrates that only minor adjustments to the running conditions are needed to adapt the methods identified in preceding examples to a column with a different pore size. The results also indicate that adjustments to the pore size may further improve separation of similarly sized mRNAs.

[0384] Example 15. Minimum pore size

[0385]

[0239] This Example illustrates that the use of a column comprising a plurality of porous particles with a pore size less than 500 A cannot effectively separate similarly sized mRNAs from a mixture using optimized separation conditions identified in preceding examples.

[0386]

[0240] In order to further explore how the column pore size affects peak separation, a UPLC system was fitted with a liquid chromatography column with a pore size of 300 A. Apart from pore size, the column was identical to the columns described in Table 5 (with a pore size of 4000 A) and Table 15 (with a pore size of 1000 A). The column specification is summarized in Table 18.

[0387] Table 18

[0388]

[0241] A mixture of four mRNAs as described in Example 1 was applied to the column and separated using the conditions as described in Example 14.

[0389]

[0242] As shown in Figure 12, only two distinct peaks were observed, demonstrating effective separation of the four mRNAs could not be achieved with a column having a pore size below 500 A. This contrasts with the effective separation of the same four mRNAs that was achieved using identical columns with pore sizes of 1000 A and 4000 A under identical conditions, as shown in Figure 1 IB, indicating that RP-HPLC columns with a length of 150 mm or greater and a stationary phase comprising a plurality of porous particles with a pore size of at least 500 A are suitable to separate two or more mRNAs of similar length.

[0390]

[0243] This Example demonstrates that columns comprising a plurality of porous particles with a pore size of less than 500 A cannot effectively separate similarly sized mRNAs in a mixture into distinct peaks using RP-HPLC and optimized separation conditions identified in preceding examples.

[0391] Example 16. Separation of multiple mRNAs of different proportions

[0392]

[0244] This example illustrates that the methods identified in the preceding examples can be used to accurately determine the ratios of different mRNAs within a multi-mRNA composition.

[0393]

[0245] A mixture of four mRNAs was encapsulated in liquid nanoparticles. Each mRNA sequence encompassed in 5’ to 3’ order: a 5’ UTR, a coding sequence and a 3’ UTR. The coding sequence of each of the 4 mRNAs encoded an influenza HA antigen derived from H1-A / H1N1 (A / Wisconsin / 588 / 2019), B Yamagata (B / Phuket / 3073 / 2013), H3-A / H3N2 (A / Darwin / 6 / 2021), and B-Victoria (B / Austria / 1359417 / 2021), respectively.

[0394]

[0246] To extract the mRNAs from lipid nanoparticles, a solution of 60 mM ammonium acetate in isopropanol was added to each sample. The samples were mixed using a vortex and centrifuged for 5 minutes at 14,000 g at 4°C, following which the supernatant was removed from each sample. The pellets were rinsed with isopropanol, mixed through manual inversion and again centrifuged for 5 minutes at 14,000 g at 4°C. Following removal of the supernatant, the mRNA pellet of each sample was dissolved in RNase free water to a final concentration of 1 mg / ml.

[0395]

[0247] A LTPLC system was fitted with a liquid chromatography column identical to the column described in Table 5. The running conditions as shown in Table 19 and the gradient as shown in Table 10 were used to separate mixtures with different proportions of the

[0396] 4 mRNAs. Table 19

[0397]

[0248] During manufacturing of the LNPs, the 4 mRNAs were combined in the ratios indicated in Table 20, based on which the percentages indicated as “theoretical results” were calculated. As can be seen from the results in Table 20, the proportions of each mRNA in each mixture were close to the expected “theoretical results”, indicating that the ratios of the different mRNAs could be accurately determined using UPLC.

[0398]

[0249] The same mixtures were also analyzed using droplet digital PCR (ddPCR). As also shown in Table 20, ddPCR values were further removed from the expected “theoretical results”, indicating that this method is less accurate than the disclosed UPLC-based method at determining the ratios of different mRNA in the mixtures.

[0399] Table 20

[0400]

[0250] During manufacturing of LNPs comprising multiple different RNAs, the methods described herein can be used for quality assurance. For example, a standard can be prepared that contains each mRNA at the ratios used for the manufacturing of the LNPs encapsulating the different mRNAs.

[0401]

[0251] In order to calculate the ratio of each mRNA in a sample of the manufactured LNPs, the retention time of each peak on a chromatogram is compared to that of the corresponding standard. The relative deviation of the sample from the standard can be determined according to Formula 1 : 100

[0252] The determination of ratios for each peak is then carried out using Formula 2:

[0402]

[0253] This example illustrates that UPLC-based methods disclosed herein can accurately determine the ratios of different mRNAs within a multi-mRNA composition and can be used for quality assurance during manufacturing of such compositions. Moreover, these methods are more accurate at such ratio determination than other quantification techniques, such as ddPCR.

[0403]

[0254] While the foregoing disclosure has been described in some detail by way of illustration and example for purposes of clarity and understanding, it will be clear to one of ordinary skill in the art from a reading of this disclosure that various changes in form and detail can be made without departing from the true scope of the disclosure and may be practiced within the scope of the appended claims. For example, all constructs, methods, and / or component features, steps, elements, or other aspects thereof can be used in various combinations.

[0404]

[0255] All patents, patent applications, websites, other publications or documents, accession numbers and the like cited herein are incorporated by reference in their entirety for all purposes to the same extent as if each individual item were specifically and individually indicated to be so incorporated by reference.

Claims

CLAIMS1. A method for detecting at least a first mRNA and a second mRNA in a composition using reverse phase high pressure liquid chromatography (RP-HPLC), wherein said first mRNA and said second mRNA are of similar length, comprising:(i) providing an RP-HPLC column comprising a stationary phase, wherein the RP-HPLC column has a length of 150 mm or greater and the stationary phase comprises a plurality of porous particles with a pore size of at least 500 A;(ii) contacting the stationary phase at a flow rate with a mobile phase A comprising a first ion pairing reagent;(iii) adding the composition comprising the at least first and second mRNAs to the stationary phase;(iv) applying a gradient of the mobile phase A with a mobile phase B to the stationary phase, thereby separating the at least first and second mRNAs, wherein the mobile phase B comprises a first organic modifier; and(v) detecting the at least first and second mRNAs.

2. The method of claim 1, wherein the at least first and second mRNAs differ in length by no more than 50 nucleotides, optionally wherein the at least first and second mRNAs are of the same length.

3. The method of claim 1 or 2, wherein the porous particles have a size equal to or greater than about 4 pm, e.g., about 4 pm to about 8 pm.

4. The method of any one of the preceding claims, wherein the porous particles have a pore size of at least about 1000 A, e.g., about 1000 A to about 4000 A.

5. The method of any one of the preceding claims, wherein the RP-HPLC column has a length of greater than 150 mm, e.g., between about 200 mm to about 300 mm.

6. The method of any one of the preceding claims, wherein the RP-HPLC column has an inner diameter smaller than 5 mm, e.g., between about 2 mm to about 5 mm.

7. The method of any one of the preceding claims, wherein the first ion pairing reagent is hexylammonium acetate (HAA).

8. The method of any one of the preceding claims, wherein the first ion pairing reagent is at a concentration of about 75 mM to about 500 mM, e.g., about 150 mM, 200 mM or about 250 mM.

9. The method of any one of the preceding claims, wherein the mobile phase A further comprises an organic modifier, optionally wherein the organic modifier is at a concentration of about 20% (v / v) to about 60% (v / v), e.g. about 40% (v / v).

10. The method of claim 9, wherein the organic modifier is the same as the organic modifier in mobile phase B.

11. The method of any one of the preceding claims, wherein the organic modifier is acetonitrile.

12. The method of any one of the preceding claims, wherein the organic modifier is from about 40% (v / v) to about 100% (v / v) of the mobile phase B, e.g., about 50% (v / v) or 75% (v / v).

13. The method of any one of the preceding claims, wherein the mobile phase B further comprises the first ion pairing reagent, optionally the mobile phase B comprises the first ion pairing reagent at the same concentration as the mobile phase A.

14. The method of any one of the preceding claims, wherein the flow rate is less than 0.6 ml / min, e.g., about 0.3 ml / min or about 0.4 ml / min.

15. The method of any one of the preceding claims, wherein the RP-HPLC column is held at a temperature of about 45°C to about 60°C, e.g., about 45°C to about 55°C.

16. The method of any one of the preceding claims, wherein the mobile phase A and / or mobile phase B has / have a pH from about 6 to about 8, optionally wherein the pH is about 7, about 7.5 or about 8.

17. The method of any one of the preceding claims, wherein the composition comprising the at least first and second mRNAs, the mobile phase A and / or the mobile phase B comprise(s) an agent for chelating divalent cations, optionally wherein the agent for chelating divalent cations is ethylenediaminetetraacetic acid (EDTA).

18. The method of claim 17, wherein the concentration of the agent for chelating divalent cations in the mobile phase A and / or mobile phase B ranges from about 0.1 mM to about 0.9 mM, optionally wherein the concentration of the agent for chelating divalent cations is from about 0.2 mM to about 0.3 mM, e.g. about 0.25 mM.

19. The method of any one of the preceding claims, wherein the mobile phase A and / or mobile phase does not comprise an agent for chelating divalent cations.

20. The method of any one of the preceding claims, wherein the composition comprises the at least first and second mRNAs encapsulated in the same lipid nanoparticle or in different lipid nanoparticles.

21. The method of claim 20, wherein the mRNAs are extracted from the lipid nanoparticles, optionally wherein the extraction is performed using one or more organic solvents or a detergent.

22. The method of any one of the preceding claims, wherein the composition comprises the at least first and second mRNAs in purified form.

23. The method of any one of the preceding claims, wherein step (v) yields a chromatogram providing information about characteristics of the at least first and second mRNAs, optionally wherein the characteristics include integrity and purity of said at least first and second mRNAs.

24. The method of claim 23, wherein the chromatogram is used to calculate the ratios of said at least first and second mRNAs within the composition.

25. The method any one of the preceding claims, wherein the at least first and second mRNAs encode homologous proteins.

26. The method of any one of the preceding claims, wherein the at least first and second mRNAs encode antigens from at least a first virus and a second virus, optionally wherein the first and second viruses are phylogenetically related to each other, optionally wherein:(a) the at least first and second viruses are influenza viruses; and / or(b) the antigens are hemagglutinin (HA) or neuraminidase (NA) proteins.

27. The method of any one of the preceding claims, wherein the porous particles are made of styrene and / or divinylbenzene.

28. The method of any one of the preceding claims, wherein the gradient ranges from about 40% of mobile phase B to about 70% of mobile phase B.

29. The method of any one of the preceding claims, wherein the at least first and second mRNAs differ in G / C content.

Images