A single-plasmid system for enhanced crispr-CAS9 mediated homologous recombination

Abstract

The present invention provides a single homologous recombination vector comprising components of the CRISPR-Cas system to insert transgenic DNA in cells. This vector shortens the production time and allow for easy generation of genetically modified cells. The invention allows the user to test multiple tags and to generate homozygous modified cell line using the homologous recombination vector. The invention can be used to generate knockout cells, to generate cell lines with knockin genes, to generate cell lines with point mutations, to generate cell lines for drug screening against any target, to create transgenic animals.

Description

[0001]Attorney Docket No.206017-0222-00WO A SINGLE-PLASMID SYSTEM FOR ENHANCED CRISPR-CAS9 MEDIATED HOMOLOGOUS RECOMBINATION STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT This invention was made with government support under HG012241 awarded by the National Institutes of Health. The government has certain rights in the invention. CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Provisional Patent Application No. 63 / 600,259, filed November 17, 2023, which is hereby incorporated herein by reference in its entirety. REFERENCE TO A "SEQUENCE LISTING" SUBMITTED AS AN XML FILE The Sequence Listing written in the XML file: “206017-0222- 00WO_SequenceListing.xml”; created on November 8, 2024, and 70, 642 bytes in size, is hereby incorporated by reference. BACKGROUND OF THE INVENTION The development of modified cell lines via CRISPR has necessitated a two-component system: (1) a vector for the expression of the CRISPR protein, guided to the target locus by a single-guide RNA (sgRNA) or purified CRISPR protein coupled with synthetic sgRNA, to induce a double-strand break in the targeted DNA; and (2) a donor recombination plasmid harboring the desired tag and homology arms for precise insertion at the target genomic location. This conventional method, although effective, entails a multistep process, which could potentially introduce unwarranted complexity and variability, particularly in high-throughput settings. Thus, there is a need in the art for improved compositions and methods for the development of modified cell lines via CRISPR-mediated homologous recombination. This invention satisfies this unmet need. SUMMARY OF INVENTION In one embodiment, the invention relates to a homology directed repair (HDR) template vector (ONE-HDR template vector) comprising a nucleic acid molecule, wherein the nucleic acid molecule comprises one or more nucleotide sequences encoding a bacterial negative selection marker, a nucleotide sequence comprising an insertion cassette, wherein the insertion cassette comprises a nucleic acid sequence to be inserted into the genome of a cell, a nucleotide sequence encoding a guide RNA (gRNA) scaffold sequence, and a nucleotide sequence encoding a Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR)-associated (cas) endonuclease operably linked to a mammalian promoter sequence. In one embodiment, the insertion cassette comprises one or more nucleotide sequences selected from the group consisting of a nucleotide sequence encoding a eukaryotic cell selection marker sequence, a nucleotide sequence encoding protein purification tag, a nucleotide sequence encoding a reporter marker sequence, an exogenous gene sequence, a promoter sequence, a nucleotide sequence encoding a P2A linker sequence, a termination sequence, a nucleotide sequence encoding a messenger RNA (mRNA) stabilization sequence, or a combination thereof. In one embodiment, the protein purification tag is selected from the group consisting of chitin binding protein (CBP), maltose binding protein (MBP), glutathione- S-transferase (GST), poly(His), biotin / streptavidin, V5-tag, Myc-tag, HA-tag, NE-tag, His-tag, Flag tag, Halo-tag, Snap-tag, Fc-tag, Nus-tag, BCCP, Thioredoxin, SnooprTag, SpyTag, Isopeptag, SBP-tag, S-tag, AviTag, Calmodulin. In one embodiment, the the reporter marker is selected from the group consisting of chloramphenicol-acetyl transferase (CAT), β-galactosyltransferase, horseradish peroxidase, luciferase, NanoLuc®, alkaline phosphatase, and a fluorescent protein. In one embodiment, the the fluorescent protein is selected from the group consisting of Green Fluorescent Protein (GFP), Red Fluorescent Protein (RFP), mCherry, mRuby3, mtagBFP2 and mClover3. In one embodiment, the eukaryotic cell selection marker sequence is selected from the group consisting of a Zeocin™ resistance marker, a neomycin resistance marker, a puromycin resistance marker, a blasticidin resistance marker and a hygromycin resistance marker. In one embodiment, the the one or more bacterial negative selection markers comprises the ccdb gene. In one embodiment, the ONE-HDR template vector comprises two nucleic acid sequences encoding bacterial negative selection markers flanking the insertion cassette. In one embodiment, the CRISPR-Cas endonuclease comprises CRISPR- Cas9 endonuclease. In one embodiment, the ONE-HDR template vector of comprises SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3. In one embodiment, the present invention relates to a HDR targeting vector (ONE-HDR targeting vector) comprising a nucleic acid molecule, wherein the nucleic acid molecule comprises one or more recombination arms, wherein the one or more recombination arms comprises a nucleotide sequence having homology to a target nucleotide sequence, and wherein the one or more recombination arms comprises a left recombination arm and a right recombination arm, a nucleotide sequence comprising an insertion cassette, wherein the insertion cassette comprises a nucleic acid sequence to be inserted into the genome of a cell, a nucleotide sequence comprising a guide RNA scaffold sequence, and a nucleotide sequence encoding a CRISPR-Cas endonuclease operably linked to a mammalian promoter. In one embodiment, the insertion cassette comprises one or more nucleotide sequences selected from the group consisting of a nucleotide sequence encoding a eukaryotic cell selection marker sequence, a nucleotide sequence encoding protein purification tag, a nucleotide sequence encoding a reporter marker sequence, an exogenous gene sequence, a promoter sequence, a nucleotide sequence encoding a P2A linker sequence, a termination sequence, a nucleotide sequence encoding a messenger RNA (mRNA) stabilization sequence, or a combination thereof. In one embodiment, the protein purification tag is selected from the group consisting of chitin binding protein (CBP), maltose binding protein (MBP), glutathione- S-transferase (GST), poly(His), biotin / streptavidin, V5-tag, Myc-tag, HA-tag, NE-tag, His-tag, Flag tag, Halo-tag, Snap-tag, Fc-tag, Nus-tag, BCCP, Thioredoxin, SnooprTag, SpyTag, Isopeptag, SBP-tag, S-tag, AviTag, Calmodulin. In one embodiment, the the reporter marker is selected from the group consisting of chloramphenicol-acetyl transferase (CAT), β-galactosyltransferase, horseradish peroxidase, luciferase, NanoLuc®, alkaline phosphatase, and a fluorescent protein. In one embodiment, the the fluorescent protein is selected from the group consisting of Green Fluorescent Protein (GFP), Red Fluorescent Protein (RFP), mCherry, mRuby3, mtagBFP2 and mClover3. In one embodiment, the the eukaryotic cell selection marker sequence is selected from the group consisting of a Zeocin™ resistance marker, a neomycin resistance marker, a puromycin resistance marker, a blasticidin resistance marker and a hygromycin resistance marker. In one embodiment, the right recombination arm further comprises at least one single guide RNA (sgRNA) sequence, operably linked to a promoter. In one embodiment, the promoter comprises a transfer RNA (tRNA) promoter. In one embodiment, the one or more recombination arms comprise a nucleic acid sequence selected from the group consisting of SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, and SEQ ID NO:8. In one embodiment, the ONE-HDR targeting vector comprises a nucleic acid sequence selected from the group consisting of SEQ ID NO: 12 and SEQ ID NO: 13. In one embodiment, the CRISPR-Cas endonuclease comprises CRISPR- Cas9 endonuclease. In one embodiment, the present invention relates to a method of generating a genetically modified cell, comprising: contacting a cell containing an endogenous chromosomal target DNA sequence with at least one ONE-HDR targeting vector of claim 11, such that the CRISPR-Cas endonuclease cleaves double stranded DNA of the target sequence, wherein the target sequence in the genome of the target cell, is a site which is at least partially complementary to the sgRNA, such that homologous recombination between the one or more recombination arms of the ONE-HDR targeting vector and the endogenous chromosomal target DNA sequence occurs and promotes integration of the insertion cassette of the ONE-HDR targeting vector into the genome of the cell. In one embodiment, the contacting comprises transfecting the cell with the ONE-HDR targeting vector. In one embodiment, the cell is contacted with two or more ONE-HDR targeting vectors. In one embodiment, the cell is from a human. In one embodiment, the cell is from a mouse. In one embodiment, the target sequence is in the proximity of an actively transcribed gene. In one embodiment, the target sequence is in the proximity of a silent gene. In one embodiment, the present invention relates to a genetically modified cell made according to the methods disclosed herein. In one embodiment, the cell is a knock-out cell. In one embodiment, the cell is a knock-in cell. In one embodiment, the cell is a mouse cell. In one embodiment, the cell is a human cell. In one embodiment, the present invention relates to a method of generating a genetically modified animal in which a desired nucleic acid has been introduced, comprising: obtaining a primary cell comprising an endogenous chromosomal target DNA sequence into which it is desired to introduce said nucleic acid; contacting the cell with a ONE-HDR targeting vector of claim 11, such that the CRISPR- Cas endonuclease cleaves double stranded DNA of the target sequence, wherein the target sequence in the genome of the target cell, is a site which is at least partially complementary to the sgRNA, such that homologous recombination between the one or more recombination arms of the ONE-HDR targeting vector and the endogenous chromosomal target DNA sequence occurs and promotes integration of the insertion cassette of the ONE-HDR targeting vector into the genome of the cell; and generating an animal from said primary cell in which homologous recombination has occurred. In one embodiment, the animal is selected from the group consisting of a mammal, a marsupial, an avian, an amphibian and a fish. In one embodiment, the insertion cassette comprises a nucleotide sequence selected from the group consisting of a nucleotide sequence which disrupts a gene after homologous recombination, a nucleotide sequence which replaces a gene after homologous recombination, a nucleotide sequence which introduces a gene after homologous recombination, and a nucleotide sequence which introduces a regulatory site after homologous recombination. In one embodiment, the target sequence is in the proximity of an actively transcribed gene. In one embodiment, the target sequence is in the proximity of a silent gene. In one embodiment, the present invention relates to a genetically modified animal made according to the methods described herein. BRIEF DESCRIPTION OF THE DRAWINGS The following detailed description of embodiments of the invention will be better understood when read in conjunction with the appended drawings. It should be understood that the invention is not limited to the precise arrangements and instrumentalities of the embodiments shown in the drawings. Figure 1, comprising Figure 1A through Figure 1C, presents representative illustrations depicting components of the ONE-Homology Directed Repair (HDR) system and the requisite steps for constructing a site-specific ONE-HDR targeting vector. Figure 1A depicts a representative illustration of a backbone vector (ONE-HDR template vector). The ONE-HDR template vector was digested with restriction enzymes to excise the segments containing the bacterial negative selection marker CCDB cassettes. BamHI and BpiI restriction enzymes were utilized (arrows indicate their respective sites flanking the CCDB cassettes). Figure 1B depicts a representative illustration of pre-designed synthetic left and right recombination arms which are combined and cloned with the digested ONE-HDR template vector utilizing the Gibson assembly method. The right recombination arm is linked at its 3’ terminal to a single guide RNA (sgRNA) operably linked at its 5’ terminal to a transfer RNA (tRNA) promoter. Figure 1C depicts a representative illustration of the assembled ONE-HDR targeting vector which was then transformed into ccdB sensitive E. coli. Figure 2 depicts a representative list of examples of protein tags and eukaryotic selection genes that can be utilized with the ONE-HDR system to label endogenous proteins via facilitating homologous recombination. Figure 3, comprising Figure 3A through Figure 3C, presents representative illustrations depicting components of the ONE-Homology Directed Repair (HDR) system and the requisite steps for constructing a site-specific ONE-HDR targeting vector. Figure 3A depicts a representative illustration of a backbone vector (ONE-HDR template vector). The ONE-HDR template vector was digested with restriction enzymes to excise the segments containing the bacterial negative selection marker CCDB cassettes. BamHI and BpiI restriction enzymes were utilized (arrows indicate their respective sites flanking the CCDB cassettes). Figure 3B depicts a representative illustration of pre-designed synthetic left and right recombination arms which are combined and cloned with the digested ONE-HDR template vector utilizing the Gibson assembly method. The right recombination arm is linked at its 3’ terminal to a single guide RNA (sgRNA) operably linked at its 5’ terminal to a transfer RNA (tRNA) promoter. The left and right recombination arms further comprise a CRISPR double strand break (DBS) site at their 5’ and 3’ terminals wherein the DSB sites are designed based upon the genomic CRISPR target site. Figure 3C depicts a representative illustration of the assembled ONE-HDR targeting vector which was then transformed into ccdB sensitive E. coli. Figure 4 depicts a representative protocol for developing a gene-specific ONE-HDR targeting vector. The figure outlines the key steps, carried out over three days, required for the assembly and validation of the final vector. Figure 5 depicts a representative protocol for developing cell lines with a gene-specific ONE-HDR targeting vector. The figure outlines the key steps required to transfer a ONE-HDR targeting vector into mammalian cells, along with the suggested time for initiating antibiotic selection of modified cells and for the validation and characterization of modified cells. Figure 6 presents a representative image depicting the development of a HEK293T cell line with the endogenous Moesin protein (MSN) tagged with mRuby3 and selected with Blasticidin. Figure7 presents a representative image depicting the development of an induced pluripotent stem cell (iPSC) line with endogenous Beta Tubulin (TUBB) tagged with mClover3 and selected with puromycin. Figure 8 presents a representative image depicting the development of an induced pluripotent stem cell line with endogenous HSP90B1 (located in the endoplasmic reticulum) tagged with mClover3 and selected with puromycin. Figure 9, comprising Figure 9A through Figure 9C, presents a representative image depicting the development of an Induced Pluripotent Stem Cell Line with Multiplex Labeling. Figure 9A depicts a representative merged image from two fluorescent channels showcasing two distinctly labeled endogenous proteins. Figure 9B depicts a representative image presenting the endogenous HNRNPA2B1 nuclear protein tagged with miRFP670. Figure 9C depicts a representative image presenting endogenous Beta Tubulin (TUBB) tagged with mClover3. The cells were selected using a mixture of puromycin and nourseothricin. Figure 10, comprising Figure 10A through Figure 10D, presents a representative image depicting the development of a U2OS Cell Line with Triple Multiplex Labeling. Figure 10A depicts a representative merged image of all the fluorescent channels showing three labeled endogenous proteins. Figure 10B depicts a representative image presenting the endogenous HNRNPA2B1 nuclear protein was tagged with miRFP670. Figure 10C depicts a representative image presenting the endogenous EZR protein was tagged with mRuby3 and is displayed in grey pseudo color. Figure 10D depicts a representative image presenting the endogenous LC3B protein (a marker of autophagic vesicles) tagged with mClover3. Cells were selected using a mix of Puromycin, Zeocin, and Blasticidin. Figure 11, comprising Figure 11A and Figure 11B, presents a representative image depicting the generation of a HeLa Cell Line Harboring a Single- Point Mutation in the NPC1 Gene, mimicking a Mutation Identified in Niemann-Pick Type C1 Disease Patients. The mutation was engineered to study phenotypic alterations, particularly in lysosomal characteristics. Cells were stained with Lysotracker to delineate lysosomal structures and assess their enlargement indicative of the disease phenotype. Figure 11A depicts a representative image of a clone of HeLa cells homozygous for the I1061T mutation in the NPC1 gene. Figure 11B depicts a representative image of Control unedited HeLa cells. Figure 12, comprising Figure 12A and 12B, depicts representative images detecting lysosomal enlargement in muscle cells harboring a Pompe disease mutation (NM_000152.5(GAA).-32-13T>G). Two induced pluripotent stem cell (iPSC) lines were developed using CRISPR-mediated endogenous tagging with the ONE-HDR system. The nuclear protein HNRNPA2B1 was tagged with miRFP670, and the lysosomal protein LAMP1 with mRuby3. The cell line in Figure 12B was additionally modified to carry a single-point mutation that causes Pompe disease, also using the ONE-HDR system. After differentiation into muscle cells, the mutated cells exhibited increased lysosome size and brightness, indicative of lysosomal glycogen accumulation characteristic of Pompe disease. Figure 12A, merged fluorescent image of muscle cells differentiated from the control iPSC line, showing normal lysosomal morphology with tagged HNRNPA2B1 and LAMP1. Figure 12B, merged fluorescent image of muscle cells differentiated from the Pompe disease-mutated iPSC line, displaying enlarged and brighter lysosomes due to the disease-causing mutation. Figure 13, comprising Figure 13A through 13D, present representative images depicting the development of an induced pluripotent stem cell line with endogenous tagging of a constitutively expressed gene (HNRNPA2B1) and a silent gene (ACTN2). An induced pluripotent stem cell (iPSC) line was developed using CRISPR- mediated endogenous tagging with the ONE-HDR system. The constitutively expressed nuclear protein HNRNPA2B1 was tagged with miRFP670 (displayed in blue), and the silent gene ACTN2 was tagged with mRuby3 (displayed in red). Figure 13A, merged fluorescent image of iPSC cells before cardiomyocyte differentiation, showing expression of HNRNPA2B1 (blue) and absence of ACTN2 expression (red). Figure 13B, fluorescent image of the ACTN2 channel alone in iPSC cells before differentiation, confirming lack of ACTN2 expression. Figure 13C, merged fluorescent image of differentiated cardiomyocytes, displaying expression of both HNRNPA2B1 (blue) and ACTN2 (red), indicating successful differentiation. Figure 13D, fluorescent image of the ACTN2 channel alone in cardiomyocytes after differentiation, demonstrating expression of ACTN2. DETAILED DESCRIPTION The invention is based, in part, on the development of a single-plasmid which provides all necessary elements for CRISPR-Cas9 mediated homologous recombination. The single plasmid serves as a homology donor plasmid template (ONE- HDR template vector) engineered to streamline the process of tagging genes. In one embodiment, the invention provides methods and compositions for the development of genetically modified cell lines. In one embodiment, the modified cell lines comprise cells in which one or more alleles of a gene are tagged or labeled. In one embodiment, the modified cell lines comprise cells in which one or more alleles of a gene are disrupted. In one embodiment, the modified cell lines comprise cells in which one or more alleles of a gene contain one or more point mutations. In one embodiment, the modified cell lines comprise cells in which one or more non-coding regions of the genome contain one or more point mutations. In one embodiment, the invention provides a ONE-Homology Directed Recombination (HDR) system for the generation of genetically modified cells lines and methods for use of the ONE-HDR system for generation of genetically modified cells lines. In one embodiment, the ONE-HDR system comprises a first and a second DNA molecule for use in the development of genetically modified cell lines. In one embodiment, the first DNA molecule comprises a template vector (ONE- HDR template vector). In one embodiment, the second DNA molecule comprises a targeting vector (ONE-HDR targeting vector). In one embodiment, the ONE-HDR template vector comprises a template for the generation of the ONE-HDR targeting vector. In one embodiment, the ONE-HDR targeting vector comprises a vector for use in a method of inserting at least one DNA sequence into a targeted site within the genome of at least one host cell for the development of at least one genetically modified cell line. In one embodiment, the ONE-HDR template vector comprises one or more nucleotide sequences, wherein the one or more nucleotides sequences comprises a first and a second nucleotide sequence encoding a bacterial negative selection marker, an insertion cassette, a nucleotide sequence encoding a guide RNA (gRNA) scaffold sequence, and a nucleotide sequence encoding a clustered regularly interspaced short palindromic repeat (CRISPR)-associated (Cas) endonuclease enzyme, wherein the nucleotide sequence encoding the CRISPR-Cas endonuclease enzyme is operably linked to a mammalian promoter sequence. In one embodiment, the insertion cassette comprises one or more nucleotide sequences, wherein the one or more nucleotide sequences comprises at least one nucleotide sequence encoding a eukaryotic cell selection marker, at least one nucleotide sequence encoding a protein purification tag, at least one nucleotide sequence encoding a reporter marker, a nucleotide sequence encoding at least one exogenous gene, at least one promoter, at least one P2A linker, at least one termination sequence, and at least one nucleotide sequence encoding a messenger RNA (mRNA) stabilization sequence. In one embodiment the insertion cassette is flanked on either side by the first and second nucleotide sequences encoding a bacterial negative selection marker. In one embodiment, the first nucleotide sequence encoding a bacterial negative selection marker is flanked on either side by a first restriction enzyme cleavage site for cleavage by a first restriction enzyme. In one embodiment, the second nucleotide sequence encoding a bacterial negative selection marker is flanked on either side by a second restriction enzyme cleavage site for cleavage by a second restriction enzyme. In one embodiment, the bacterial negative selection marker comprises the ccdB gene encoding the CcdB toxin. In one embodiment, the ONE-HDR template vector comprises a nucleic acid sequence as set forth in SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3. In one embodiment, the ONE-HDR targeting vector comprises one or more nucleotide sequences, wherein the one or more nucleotides sequences comprises a left recombination arm, a right recombination arm, an insertion cassette of the ONE-HDR template vector, wherein the insertion cassette of the ONE-HDR template vector is flanked at its 5’ end by the left recombination arm and at its 3’ end by the right recombination arm, at least one nucleotide sequence encoding a single guide RNA (sgRNA) sequence operably linked to a promoter sequence, a nucleotide sequence encoding a guide RNA (gRNA) scaffold sequence, and a nucleotide sequence encoding a CRISPR-Cas endonuclease enzyme, wherein the nucleotide sequence encoding the CRISPR-Cas endonuclease enzyme is operably linked to a mammalian promoter sequence. In one embodiment, the nucleotide sequence encoding the CRISPR-Cas endonuclease enzyme is linked at its 5’ or 3’ to a nucleotide sequence encoding a fluorescent protein, wherein the fluorescent protein is linked at either its N or C terminal to the CRISPR-Cas endonuclease enzyme. In one embodiment, the left recombination arm comprises a nucleic acid sequence having sequence homology to a first target nucleic acid sequence in a host genome. In one embodiment, the right recombination arm comprises a nucleic acid sequence having sequence homology to a second target nucleic acid sequence in a host genome. In one embodiment, the right recombination arm further comprises at its 3’ terminal at least one promoter sequence where in the at least one promoter sequence is operably linked to a nucleotide sequence encoding at least one sgRNA sequence. In one embodiment, the left recombination arm is flanked on either side by the first restriction enzyme cleavage site of the first nucleotide sequence encoding a bacterial negative selection marker. In one embodiment, the right recombination arm is flanked on either side by the second restriction enzyme cleavage site of the second nucleotide sequence encoding a bacterial negative selection marker. In one embodiment, the present invention provides methods for the generation of the ONE-HDR targeting vector from the ONE-HDR template vector comprising digesting the ONE-HDR template vector with the first and second restriction enzymes and subsequently incubating a first and second nucleic acid with the restriction enzyme digested ONE-HDR template vector, wherein the incubation comprises a Gibson assembly procedure, wherein the first nucleic acid comprises the left recombination arm of the ONE-HDR targeting vector and the second nucleic acid comprises the right recombination arm ONE-HDR targeting vector, and wherein following the incubation, the left recombination arm replaces the nucleotide sequence encoding the first bacterial negative selection marker in the ONE-HDR template vector and the right recombination arm replaces the nucleotide sequence encoding the second bacterial negative selection marker in the ONE-HDR template vector, thereby generating the ONE-HDR targeting vector. In one embodiment, the ONE-HDR targeting vector, when generated, comprises a functional CRISPR-Cas system, wherein the functional CRISPR-Cas system comprises all the essential and non-essential components known in the art. In one embodiment, the invention provides a method for tagging a gene or gene product in a cell, comprising: (a) introducing the ONE-HDR targeting vector into a cell, (b) selecting for a cell wherein the insertion cassette of the ONE-HDR targeting vector has integrated into the genome. In one embodiment, the invention provides a method for knocking down or knocking out a gene in a cell, comprising: (a) introducing the ONE-HDR targeting vector into a cell, (b) selecting for a cell wherein the insertion cassette of ONE-HDR targeting vector has integrated into the genome. In one embodiment, the invention provides a method for generating one or more point mutations in the genome of a cell, comprising: (a) introducing the ONE-HDR targeting vector into a cell wherein the insertion cassette of the ONE-HDR targeting vector comprises an exogenous DNA sequence, wherein the exogenous DNA sequence contains the one or more point mutations to be generated; and (b) selecting for a cell wherein the insertion cassette of the ONE-HDR targeting vector has integrated into the genome. In one embodiment, the point mutation is in an actively transcribed gene. In one embodiment, the point mutation is in a silent gene. In one embodiment, the invention provides a method for tagging a plurality of genes or gene products in a cell, comprising: (a) introducing a plurality of ONE-HDR targeting vectors into a cell, (b) selecting for a cell wherein a plurality of insertion cassette of the ONE-HDR targeting vectors has integrated into the genome. In one embodiment, the gene is an actively transcribed gene. In one embodiment, the gene is a silent gene. In another embodiment, the invention provides a method of producing a cell library, comprising: (a) introducing a plurality of ONE-HDR targeting vectors into a plurality of cells; (b) selecting for cells wherein the insertion cassettes of the plurality of ONE-HDR targeting vectors have integrated into the genome. In one embodiment, a cell library is a tagged cell library. In one embodiment, a library is a knockdown cell library. In one embodiment, a library is a knockout cell library. In one embodiment, the invention includes a cell produced by a method of the invention. In one embodiment, the cell is a mammalian cell, and it may be a human cell. In certain embodiments, the invention includes cells comprising an integrated insertion cassette of the ONE-HDR targeting vector of the invention. The invention also provides libraries, arrays, and collections of cells of the invention. In another embodiment, the invention provides an animal produced by a method of the invention. In certain embodiments, the animal is a mammal, and in one embodiment, the animal is a mouse. In one embodiment, the insertion cassette of the ONE-HDR targeting vector corresponds to a portion of a gene. In one embodiment, the gene is a reporter gene. In another embodiment, the gene is associated with a disease or disorder. In one embodiment, the gene is an actively transcribed gene. In one embodiment, the gene is a silent gene. In certain embodiments of the invention, the integrated insertion cassette of the ONE-HDR targeting vector is located in-frame 5’ or 3’ to a gene after recombination, serving to tag the targeted gene or protein, wherein the protein is tagged at either its N or C terminal. In certain embodiments of the invention, the integrated insertion cassette of the ONE-HDR targeting vector is located in a transcribed region of a gene after recombination, serving to knockdown or knockout the targeted gene or protein. In one embodiment, the gene is an actively transcribed gene. In one embodiment, the gene is a silent gene. In one embodiment, a cell of the invention comprises a disrupted gene. In some embodiments, the disrupted gene is disrupted by an integrated insertion cassette of the ONE-HDR targeting vector. In certain embodiments, the insertion cassette further comprises a promoter, and in one embodiment, the promoter is an inducible promoter. In one embodiment, the insertion cassette is integrated into the genome of the cell. In one embodiment, the gene is an actively transcribed gene. In one embodiment, the gene is a silent gene. In one embodiment, a cell comprises a single allele of a gene having an integrated insertion cassette after recombination. In an alternative embodiment, a cell comprises both alleles of a gene having integrated insertion cassettes after recombination. The invention further provides a collection of cells of the invention, wherein each cell comprises a different disrupted gene. In one embodiment, the gene is an actively transcribed gene. In one embodiment, the gene is a silent gene. Definitions Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods and materials are described. As used herein, each of the following terms has the meaning associated with it in this section. The articles “a” and “an” are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, “an element” means one element or more than one element. “About” as used herein when referring to a measurable value such as an amount, a temporal duration, and the like, is meant to encompass variations of ±20%, ±10%, ±5%, ±1%, or ±0.1% from the specified value, as such variations are appropriate to perform the disclosed methods. Allele: An “allele” is a single copy of a gene and may be one of a pair or of a series of copies or variant forms of a gene. Allelic: The term “allelic” connotes the existence of more than one copy or form of a particular gene. Thus, a gene is said to be allelic if it has more than one allele. As used herein, an “array” is an integral collection of objects that may be arranged in a systematic manner or in some predetermined fashion. An “array” can be, for example, an integral collection of vessels or an integral collection of wells. That is, an “array” can be a collection of objects that are formed as a unit with another part. An “array” also can be a surface upon which an integral collection of substances are arranged in a systematic manner. An “array of cells” is a collection of cells, arranged in a systematic manner. An “array of cells,” or a “cell array,” represents, for example, a non-random arrangement of cell types or cells in which a gene is disrupted, contained within an integral collection of vessels or wells. A “cell” of the instant invention may be, but is not limited to, a host cell, a target cell, a healthy cell, a mutated cell, a cell with disease or disorder characteristics (“diseased cell”), a transformed cell or a modified cell. A “cell” in this description may also denote a culture of such cells. A modified cell may be a cell that contains within its genome an integrated “construct” or an integrated “exogenous segment.” Such a cell may be regarded as a “knockout.” A modified cell may contain a polynucleotide whose expression is regulated by a biological factor or groups of such factors. In this respect, a modified cell may be a cell that contains a regulatable gene. A “clone” is a number of cells with identical genomes, derived from a single ancestral cell. Thus, a group of genetically identical cells produced by mitotic divisions from one original cell, are “clones.” According to the instant invention, a clone represents at least one cultured, preferably non-frozen cell, or plurality of such cells, each tracing its lineage to one cell. The term “construct” denotes an artificially assembled polynucleotide molecule, such as a cloning vector or plasmid, that can exist in linear or circular forms. Typically, a construct will include elements such as a gene, a gene fragment, or a polynucleotide sequence of particular interest, juxtaposed with other elements in the construct, such as a cell selection marker, a reporter marker, an appropriate control sequence, a promoter, a termination sequence, a splice acceptor site, a splice donor site, and restriction endonuclease recognition sequences. A construct may be, for example, a “HDR donor vector” or a “HDR vector” or a “ONE-HDR template vector”. A construct, or a part of it, may be integrated into a genome of a cell or into an in vitro-prepared preparation of a cell genome. “Disrupted” means the hindering of the expression of an endogenous gene product. In one embodiment, an allele of a gene is “disrupted” if any part of the allele nucleotide sequence contains a construct. Thus, a nucleotide sequence naturally present in a cell genome can be “disrupted” by the integration of another nucleotide sequence between a 5″ end and a 3′ end of the former sequence. The nucleotide sequence that disrupts a gene in a cell genome may be flanked by regions that, but for the presence of the sequence, together encode a polypeptide. Disruption of a gene by a construct, for example, may result in non-expression of a gene product in a cell or in the expression of a partially or totally non-functional gene product or an altered gene product. A polynucleotide sequence in a construct is regarded as being downstream or 3′ to a second polynucleotide sequence in the construct, if the 5′ end of the former sequence is located after the 3′ end of the latter sequence. A nucleotide sequence is “exogenous” to a cell if it is not naturally a part of that cell genome, or it is deliberately inserted into the genome of the cell. A nucleotide sequence may be deliberately inserted into a cell genome by human intervention or automated means. An exogenous nucleotide sequence, such as the sequence of a construct, or a portion thereof, may be referred to as an “exogenous segment.” An exogenous segment may contain functional elements present in the intact construct, such as an antibiotic resistance gene. A “gene” contains not only the exons and introns of the gene but also other non-coding and regulatory sequences, such as enhancers, promoters and the transcriptional termination sequence (e.g. the polyadenylation sequence). As used in this description, a gene does not include any construct that is inserted therein by human intervention or by automation. A gene may be allelic in nature. The “genome” of a cell includes the total DNA content in the chromosomes of the cell, including the DNA content in other organelles of the cell, such as mitochondria or, for a plant cell, chloroplasts. A “genomic sequence” of a cell refers to the nucleotide sequence of a genomic DNA fragment of the cell. Suitable host cells may be non-mammalian eukaryotic cells, such as yeast, or preferably, prokaryotic cells, such as bacteria. For instance, the host cell may be a strain of E. coli. A “genetically modified cell” refers to a cell wherein the genome or any genetic material of the cell is altered through the methods and compositions described herein, to be distinct from a cell that has not been altered through the methods and compositions described herein. Examples of the alteration of the genome or any genetic material of the cell include, without limitation, the incorporation of one or more sequences of exogenous DNA. The term “homologous recombination” refers to the process of DNA recombination based on sequence homology of nucleic acid sequences in a construct with those of a target sequence, such as a target allele, in a genome or DNA preparation. Accordingly, the nucleic acid sequences present in the construct are identical or highly homologous, that is, they are more than 60%, preferably more than 70%, highly preferably more than 80%, and most preferably more than 90% sequence identity to a target sequence located within a cell genome. In a particular embodiment, the homologous recombination vector has 95%-98% sequence identity to a target sequence located within a cell genome. The word “integral” means formed as a unit with another part. Accordingly, applying the characterization of “integral” to a collection of elements, such as of wells or of vessels, indicates a purposeful accumulation of interrelated elements that are arranged in some predetermined fashion. An “integral” plurality of elements may refer to some but not necessarily to all elements of an array, for example. “Integral” also may be used to describe the contents within wells or vessels of an inventive array. “Isolated” means to separate from another substance so as to obtain pure or in a free state. Accordingly, an “isolated polynucleotide,” is a polynucleotide that has been separated from other nucleic acids, such as from a genome of a cell or from a genomic DNA preparation, or from other cellular compositions. “Knockdown” means causing a reduction in the expression of one or more targeted genes or alleles. Knockdown may be accomplished by any of a variety of “knockdown reagents” or “knockdown molecules”, and these terms are used interchangeably. “Knockdown reagents” include, for example, antisense RNA, ribozymes, and dsRNA. A “knockdown cell” refers to a cell comprising a knockdown reagent, and a “knockdown animal” refers to an animal comprising a knockdown reagent. Similarly, a “knockdown plant” refers to a plant comprising a knockdown reagent. “Knockout” means having a specific single gene or allele(s) of a gene disrupted from a genome by genetic manipulation. Accordingly, a “single-allele, knockout cell” refers to a cell in which a single allele of a gene has been disrupted such that its gene product is not expressed. Similarly, a transgenic “knockout mouse” or other animal, is one that comprises cells containing a disrupted gene or allele. In this description, “library” denotes an integral collection of two or more constituents. A constituent means “an essential part” of the library. A constituent of a library may be a cell or a nucleic acid. For instance, in addition to a cell library, a library may contain a collection of constructs, polynucleotides or RNA molecules. A library may contain a collection of selected drugs or compounds. A library may comprise an integral collection of “pooled” constituents physically present in one vessel. Alternatively, a library may be an integral collection of constituents produced by the inventive methodology that are stored separately from one another. A “marker sequence” refers to either a cell selection marker sequence or a reporter marker sequence. A selection marker sequence encodes a selection marker and may be a host cell selection marker or a target cell selection marker. A reporter marker sequence encodes a reporter marker. The term “naturally occurring” connotes to the fact that the object so qualified can be found in nature and has not been modified by human intervention. Thus, a nucleotide sequence is “naturally occurring” if it exists in nature and has not been modified by human intervention. If a polynucleotide is naturally occurring, the nucleotide sequence of the polynucleotide also is “naturally occurring.” Likewise, if a genome of a cell is “naturally occurring,” the nucleotide sequence of the genome is “naturally occurring.” A “nucleic acid” refers to DNA and RNA molecules. Thus, a vector, a plasmid, a construct, a polynucleotide, an mRNA or a cDNA are all examples of a nucleic acid. A polynucleotide may be “obtained” by performing steps to physically separate the polynucleotide from other nucleic acids, such as from a cell genome. Alternatively, a polynucleotide may be “obtained” from a nucleic acid template by performing a PCR reaction to produce specific copies of the polynucleotide. Further still, a polynucleotide may be “obtained” by designing and chemically synthesizing the polynucleotide using nucleotide sequence information, such as that available in databases. The term “operably linked” refers to a juxtaposition of genetic elements in a relationship permitting them to function in their intended manner. Such elements include, for instance promoters, regulatory sequences, polynucleotides of interest and termination sequences, which when “operably linked” function as intended. Elements that are “operably linked” are also “in frame” with one another. Origin of replication: refers to a sequence of DNA at which replication is initiated. Polynucleotide library: A polynucleotide library is an integral collection of at least two polynucleotides. The term “random insertion” refers to the process by which a nucleic acid is integrated into an unspecified region of a genome or DNA preparation. A “regulatable gene” is a gene or polynucleotide sequence whose transcription is modified or whose resultant mRNA transcript is degraded such that the transcript is not transcribed to produce a complete protein as encoded by the gene or polynucleotide sequence. A regulatable gene may be one whose mRNA, while intact, is not translated by the host cell enzymes. In general, a regulatable gene is one that permits its expression at specific times or under specific conditions. For instance, a regulatable gene is one which is driven by an inducible promoter. An “insertion cassette” is a construct containing functional elements that facilitate the tagging, selection or both of a transformed cell in which the insertion construct has integrated. Such elements may include a “marker sequence” and “antibiotic resistance gene” nucleotide sequences. An “insertion cassette” may be designed to integrate into any part of a gene. In this regard, an “insertion cassette” may be a designed to integrate, in frame, downstream from a target gene. Alternatively, an “insertion cassette” may be a designed to integrate in the coding sequence of a gene, thereby disrupting the gene. A polynucleotide sequence in a construct is regarded as being upstream or 5′ to a second polynucleotide sequence in the construct, if the 3′ end of the former sequence is located before the 5′ end of the latter sequence. Ranges: throughout this disclosure, various aspects of the invention can be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 2.7, 3, 4, 5, 5.3, and 6. This applies regardless of the breadth of the range. Description In one embodiment, the invention provides methods and compositions for the development of genetically modified cell lines. In one embodiment, the modified cell lines comprise cells in which one or more alleles of a gene are tagged or labeled. In one embodiment, the modified cell lines comprise cells in which one or more alleles of a gene are disrupted. In one embodiment, the modified cell lines comprise cells in which one or more alleles of a gene contain one or more point mutations. In one embodiment, the modified cell lines comprise cells in which one or more one or more non-coding regions of the genome contain one or more point mutations. The present invention relates to ONE-HDR template vectors which are modular backbones that can easily accommodate any tag and any selection antibiotic. The ONE-HDR template vector of the invention in combination with recombination arms are used to form ONE-HDR targeting vectors. In one embodiment, the ONE-HDR targeting vector, when generated, comprises a functional CRISPR-Cas system. The ONE- HDR targeting vectors target and recombine exogenous DNA, from the ONE-HDR template vector, into the genome of a target cell, wherein the exogenous DNA comprises material for the generation of modified cell lines, e.g., a eukaryotic cell selection marker, a reporter tag, a protein purification tag, etc. Therefore, the present invention also relates to a method of using ONE-HDR targeting vectors to produce a cell that contains one or more tagged or inactivated alleles, and / or cells that contain one or more point mutations. Cells generated using the methods of the invention are valuable in evaluating the therapeutic or diagnostic utilities of genes tagged, inactivated or expressed in these cells. Compositions In one embodiment, the invention provides a ONE-Homology Directed Recombination (HDR) system for the generation of genetically modified cells lines and methods for us of the ONE-HDR system for generation of genetically modified cells lines. In one embodiment, the ONE-HDR system comprises a first and a second DNA molecule for use in the development of genetically modified cell lines. In one embodiment, the first DNA molecule comprises a template vector (ONE- HDR template vector). In one embodiment, the second DNA molecule comprises a targeting vector (ONE-HDR targeting vector). In one embodiment, the ONE-HDR template vector comprises a template for the generation of the ONE-HDR targeting vector. In one embodiment, the ONE-HDR targeting vector comprises a vector for use in a method of inserting at least one DNA sequence into a targeted site within the genome of at least one host cell for the development of at least one genetically modified cell line. ONE-HDR Template Vector A ONE-HDR template vector of the invention provides a nucleic acid molecule comprising an insertion cassette. In one embodiment, an insertion cassette comprises a reporter marker, or a marker for recognition of a tagged gene. In one embodiment, an insertion cassette comprises a marker for purification of a tagged gene. In one embodiment, the ONE-HDR template vector comprises one or more nucleotide sequences, wherein the one or more nucleotide sequence comprises a first and a second nucleotide sequence encoding a bacterial negative selection marker, an insertion cassette, a nucleotide sequence encoding a guide RNA (gRNA) scaffold sequence, and a nucleotide sequence encoding a clustered regularly interspaced short palindromic repeat (CRISPR)-associated (Cas) endonuclease enzyme, wherein the nucleotide sequence encoding the CRISPR-Cas endonuclease enzyme is operably linked to a mammalian promoter sequence. In one embodiment, the CRISPR-Cas endonuclease enzyme comprises CRISPR-Cas9. In one embodiment, the insertion cassette comprises one or more nucleotide sequences, wherein the one or more nucleotide sequence comprises at least one nucleotide sequence encoding a eukaryotic cell selection marker, at least one nucleotide sequence encoding a protein purification tag, at least one nucleotide sequence encoding a reporter marker, a nucleotide sequence encoding at least one exogenous gene, at least one promoter, at least one P2A linker, at least one termination sequence, and at least one nucleotide sequence encoding a messenger RNA (mRNA) stabilization sequence. In one embodiment the insertion cassette is flanked on either side by the first and second nucleotide sequences encoding a bacterial negative selection marker. In one embodiment, the first nucleotide sequence encoding a bacterial negative selection marker is flanked on either side by a first restriction enzyme cleavage site for cleavage by a first restriction enzyme. In one embodiment, the second nucleotide sequence encoding a bacterial negative selection marker is flanked on either side by a second restriction enzyme cleavage site for cleavage by a second restriction enzyme. In one embodiment, the bacterial negative selection marker comprises the ccdB gene encoding the CcdB toxin. In one embodiment, the ONE-HDR template vector comprises a nucleic acid sequence as set forth in SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3. In one embodiment, the ONE-HDR template vector is designed for C-terminal gene tagging and comprises the nucleic acid as set forth in SEQ ID NO:1. In one embodiment, the ONE- HDR template vector is designed for C-terminal tagging of silent genes and comprises the nucleic acid as set forth in SEQ ID NO:2. In one embodiment, the ONE-HDR template vector is designed for N-terminal gene tagging and comprises the nucleic acid as set forth in SEQ ID NO:3. In one embodiment, the insertion cassette comprises one or more nucleotide sequences, wherein the one or more nucleotide sequence comprises at least one nucleotide sequence encoding a reporter marker or at least one protein purification tag, at least one nucleotide sequence encoding a P2A peptide sequence, at least one nucleotide sequence encoding a eukaryotic antibiotic resistance gene, and at least one nucleotide sequence encoding a mRNA stabilization sequence. In one embodiment, the insertion cassette comprises one or more nucleotide sequences, wherein the one or more nucleotide sequence comprises at least one nucleotide sequence encoding a reporter marker or at least one protein purification tag, wherein the at least one reporter marker or at least one protein purification tag is operably linked to a polyA signal, at least one nucleotide sequence encoding a eukaryotic antibiotic resistance gene, wherein the at least one nucleotide sequence encoding a eukaryotic antibiotic resistance gene is operably linked to a mammalian promoter at its 5’ terminal, and wherein the at least one eukaryotic antibiotic resistance gene is operably linked to at least one mRNA stabilization sequence at is 3’ terminal. In one embodiment, the insertion cassette comprises one or more nucleotide sequences, wherein the one or more nucleotide sequence comprises at one nucleotide sequence encoding a eukaryotic antibiotic resistance gene, at least one nucleotide sequence encoding a P2A peptide sequence, and at least one nucleotide sequence encoding a reporter marker or at least one protein purification tag, wherein the at least one reporter or at least one protein purification tag marker is operably linked to a flexible linker at is 3’ terminal. In one embodiment, the ONE-HDR template comprises a nucleotide sequence encoding a CRISPR-Cas endonuclease enzyme, wherein the nucleotide sequence encoding the CRISPR-Cas endonuclease enzyme is operably linked to a mammalian promoter sequence and wherein the nucleotide sequence encoding the CRISPR-Cas endonuclease enzyme comprises a sequence as set forth in SEQ ID NO:11 and wherein the mammalian promoter sequence comprises a sequence as set forth in SEQ ID NO:10. In one embodiment, the ONE-HDR template vector may include combinations of an origin of replication, cell selection marker sequences, mRNA stabilization sequence, exogenous gene sequence, termination sequence, internal ribosomal entry sequence (IRES), promoter sequences, translation initiation sequences, recombinase recognition sites, and other functional elements. A reporter marker comprises a molecule, including polypeptide as well as polynucleotide, the expression of which in a cell confers a detectable trait to the cell. In various embodiments, reporter markers include, but are not limited to, chloramphenicol- acetyl transferase(CAT), β-galactosyltransferase, horseradish peroxidase, luciferase, NanoLuc®, alkaline phosphatase, HaloTag®, and fluorescent proteins including, but not limited to, green fluorescent proteins (e.g. GFP, TagGFP, T-Sapphire, Azami Green, Emerald, mWasabi, mClover3), red fluorescent proteins (e.g. mRFP1, JRed, HcRed1, AsRed2, AQ143, mCherry, mRuby3, mPlum), yellow fluorescent proteins (e.g. EYFP, mBanana, mCitrine, PhiYFP, TagYFP, Topaz, Venus), orange fluorescent proteins (e.g. DsRed, Tomato, Kusabria Orange, mOrange, mTangerine, TagRFP), cyan fluorescent proteins (e.g. CFP, mTFP1, Cerulean, CyPet, AmCyan1), blue fluorescent proteins (e.g. Azurite, mtagBFP2, EBFP, EBFP2, Y66H), near-infrared fluorescent proteins (e.g. iRFP670, iRFP682, iRFP702, iRFP713 and iRFP720), infrared fluorescent proteins (e.g. IFP1.4), and photoactivatable fluorescent proteins (e.g. Kaede, Eos, IrisFP, PS-CFP). In one embodiment, the insertion cassette may include tags, e.g., to facilitate identification and / or purification of a target protein. Tags for use in the methods of the invention include, but are not limited to, chitin binding protein (CBP), maltose binding protein (MBP), glutathione-S-transferase (GST), poly(His), biotin / streptavidin, V5-tag, Myc-tag, HA-tag, NE-tag, His-tag, Flag tag, HaloTag®, Snap-tag, Fc-tag, Nus- tag, BCCP, Thioredoxin, SnooprTag, SpyTag, Isopeptag, SBP-tag, S-tag, AviTag, Calmodulin, or any combination of sequences appropriate for use in a method of tagging a protein. The target protein and associated tag can be purified from target cells or target cell culture medium by any method known in the art for purifying polypeptides. Examples of such methods include salt fractionation, high pressure liquid chromatography, antibody column chromatography, affinity tag column chromatography, and acrylamide gel electrophoresis. Such methods are well known to those skilled in the art. A eukaryotic selection marker sequence can be used to eliminate target cells in which an insertion cassette has not been properly inserted or to eliminate host cells in which the HDR vector has not been properly transfected. A selection marker sequence can be a positive selection marker reporter marker or negative selection marker. Positive selection markers permit the selection for cells in which the gene product of the marker is expressed. This generally comprises contacting cells with an appropriate agent that, but for the expression of the positive selection marker, kills or otherwise selects against the cells. For suitable positive and negative selection markers, see Table I in U.S. Pat. No.5,464,764. Examples of selection markers also include, but are not limited to, proteins conferring resistance to compounds such as antibiotics, proteins conferring the ability to grow on selected substrates, proteins that produce detectable signals such as luminescence, catalytic RNAs and antisense RNAs. A wide variety of such markers are known and available, including, for example, a Zeocin™ resistance marker, a blasticidin resistance marker, a neomycin resistance (neo) marker (Southern & Berg, J. Mol. Appl. Genet.1: 327-41 (1982)), a puromycin (puro) resistance marker; a hygromycin resistance (hyg) marker (Te Riele et al., Nature 348:649-651 (1990)), thymidine kinase (tk), hypoxanthine phosphoribosyltransferase (hprt), the bacterial guanine / xanthine phosphoribosyltransferase (gpt), which permits growth on MAX (mycophenolic acid, adenine, and xanthine) medium, and members of the streptothricin-class of aminoglycoside antibiotics produced by Streptomyces species, including, for example, nourseothricin. See Song et al., Proc. Nat'l Acad. Sci. U.S.A.84:6820-6824 (1987). Other selection markers include histidinol-dehydrogenase, chloramphenicol-acetyl transferase (CAT), dihydrofolate reductase (DHFR), β-galactosyltransferase and fluorescent proteins such as GFP. Expression of a fluorescent protein can be detected using a fluorescent activated cell sorter (FACS). Expression of β-galactosyltransferase also can be sorted by FACS, coupled with staining of living cells with a suitable substrate for β-galactosidase. A selection marker also may be a cell-substrate adhesion molecule, such as integrins which normally are not expressed by the mouse embryonic stem cells, miniature swine embryonic stem cells, and mouse, porcine and human hematopoietic stem cells. Eukaryotic cell selection marker can be of mammalian origin and can be thymidine kinase, aminoglycoside phosphotransferase, asparagine synthetase, adenosine deaminase or metallothionine. The cell selection marker can also be neomycin phosphotransferase, hygromycin phosphotransferase or puromycin phosphotransferase, which confer resistance to G418, hygromycin and puromycin, respectively. Suitable prokaryotic and / or bacterial selection markers include proteins providing resistance to antibiotics, such as kanamycin, tetracycline, and ampicillin. In one embodiment, a bacterial selection marker includes a protein capable of conferring selectable traits to both a prokaryotic host cell and a mammalian target cell. Bacterial negative selection markers permit the selection against cells in which the gene product of the marker is expressed. In some embodiments, the presence of appropriate agents causes cells that express “negative selection markers” to be killed or otherwise selected against. Alternatively, the expression of negative selection markers alone kills or selects against the cells. Such bacterial negative selection markers include a polypeptide or a polynucleotide that, upon expression in a cell, allows for negative selection of the cell. Illustrative of suitable negative selection markers are (i) herpes simplex virusthymidine kinase (HSV-TK) marker, for negative selection in the presence of any of the nucleoside analogs acyclovir, gancyclovir, and 5-fluoroiodoamino-Uracil (FIAU), (ii) various toxin proteins such as the diphtheria toxin, the tetanus toxin, the cholera toxin and the pertussis toxin, (iii) hypoxanthine-guanine phosphoribosyl transferase (HPRT), for negative selection in the presence of 6-thioguanine, (iv) activators of apoptosis, or programmed cell death, such as the bc12-binding protein (BAX), (v) the cytidine deaminase (codA) gene of E. coli. and (vi) phosphotidyl choline phospholipase D. In one embodiment, the negative selection marker requires host genotype modification (e.g. ccdB, tolC, thyA, rpsl and thymidine kinases.) In accordance with the present invention, the selection marker usually is selected based on the type of the cell undergoing selection. For instance, it can be eukaryotic (e.g., yeast), prokaryotic (e.g., bacterial) or viral. In such an embodiment, the selection marker sequence is operably linked to a promoter that is suited for that type of cell. In another embodiment, more than one selection marker is used. In such an embodiment, selection markers can be introduced wherein at least one selection marker is suited for one or more of target or host cells. In one embodiment, the host cell selection marker sequence and the target cell selection marker sequence are within the same open-reading frame and are expressed as a single protein. For example, the host cell and target cell selection marker sequence may encode the same protein, such as blasticidin S deaminase, which confers resistance to Blasticidin for both prokaryotic and eukaryotic cells. The host cell and the target cell marker sequence also may be expressed as a fusion protein. In another embodiment, the host cell and the target cell selection marker sequence are expressed as separate proteins. In one embodiment, expression of endogenous genes, selectable markers or reporters encoded by the insertion cassette of the invention may be driven from an endogenous promoter following integration of the cassette into the genome. Alternatively, or additionally, expression of markers or reporters may be driven from a promoter included within the insertion cassette of the ONE-HDR template vector, which integrates into the genome together with the marker or reporter sequence. In certain embodiments, this promoter drives constitutive, high level expression of the marker or reporter gene, thereby facilitating selection or identification of cells having undergone a HDR event. One example of such a promoter is the EF-1 alpha promoter. In other embodiments, a promoter may be inducible and drive expression only when specific conditions are met. A promoter can be selected based on the type of host or target cell or the desired level of expression of an exogenous gene. Suitable promoters include but are not limited to the ubiquitin promoters, the herpes simplex thymidine kinase promoters, human cytomegalovirus (CMV) promoters / enhancers, EF-1 alpha promoters, SV40 promoters, β-actin promoters, immunoglobulin promoters, regulatable promoters such as metallothionein promoters, adenovirus late promoters, and vaccinia virus 7.5K promoters. The promoter sequence also can be selected to provide tissue-specific transcription. In certain embodiments, an IRES sequence may be included in the insertion cassette to improve the translation of a downstream gene. In one embodiment, the IRES may improve the translation of an exogenous gene sequences, a eukaryotic cell selection marker sequence or a reporter marker sequence. The IRES site can be located within the insertion cassette and may be a mammalian internal ribosome entry site, such as an immunoglobulin heavy chain binding protein internal ribosome binding site. In one embodiment, the IRES sequence is selected from encephalomyocarditis virus, poliovirus, piconaviruses, picorna-related viruses, and hepatitis A and C. Examples of suitable IRES sequences can be found in U.S. Pat. No.4,937,190, in European patent application 585983, and in PCT applications W09611211, WO09601324, and WO09424301, respectively. In one embodiment, a ONE-HDR template vector comprises a translational initiation sequence or enhancer, such as the so-called “Kozak sequence” (Kozak, J. Cell Biol.108: 229-41 (1989)) or “Shine-Delgarno” sequence. These sequences may be located in the insertion cassette, 3′ to an IRES site but 5′ to an endogenous gene sequence, reporter marker sequence or selection marker sequence. In one embodiment, an insertion cassette of the invention comprises one or more mRNA stabilization sequence. An mRNA stabilization sequence may alter the half- life of an mRNA molecule encoding a target gene and fused to the sequence such that the reading frame is maintained. In one embodiment the mRNA stabilization sequence is a polynucleotide sequence that increases the half-life of a linked mRNA. In one embodiment the mRNA stabilization sequence is a polynucleotide sequence that decreases the half-life of a linked mRNA. In one embodiment, a mRNA stabilization sequence is a poly(A) tail which protects the mRNA molecule from enzymatic degradation in the cytoplasm. In one embodiment, a mRNA stabilization sequence is a MALAT1 3’ stabilization sequence. In one embodiment, the ONE-HDR template vector comprises a transcription termination sequence. A typical transcriptional termination sequence includes a polyadenylation site (poly A site). In one embodiment, a poly A site is the SV40 poly A site. These sequences may be located in the insertion cassette, 3′ to an endogenous gene sequence, reporter marker sequence or selection marker sequence. In one embodiment, the ONE-HDR template vector comprises one or more termination / stop codon(s) in one or more reading frames at the 3′ end of an endogenous gene sequence, reporter marker sequence or selection marker sequence, such that translations of these sequences, if they encode polypeptides, are terminated at the stop codon(s). Recombinase recognition sites may be used for insertion, inversion or replacement of DNA sequences, or for creating chromosomal rearrangements such as inversions, deletions and translocations. For example, two recombinase recognition sites in an insertion vector may be in the same orientation, to allow removal or replacement of the sequence between these two recombinase recognition sites upon contact with a recombinase. Two recombinase recognition sites may also be incorporated in opposite orientations, to allow the sequence between these two sites to be inverted upon contact with a recombinase. Such an inversion can be used to regulate the function of an insertion cassette or a portion thereof. Therefore, changing the orientation of the construct may switch on or off the construct's effect. For example, two recombinase recognition sites may flank a selection marker sequence, allowing removal or inactivation of the selection marker sequence. Examples of suitable recombinase recognition sites include frt sites and lox sites, which can be recognized by flp and cre recombinases, respectively. In one embodiment, the ONE-HDR template vector comprises an origin of replication capable of initiating DNA synthesis in a suitable host cell. Preferably, the origin of replication is selected based on the type of host cell. For instance, it can be eukaryotic (e.g., yeast) or prokaryotic (e.g., bacterial) or a suitable viral origin of replication may be used. Preferably, an origin of replication is capable of initiating DNA synthesis in the host cell but does not function in the target cell. In one embodiment, one or more components of the ONE-HDR template vector can be integrated into traditional plasmid backbones to facilitate the applications of the present invention. These backbones include, but are not limited to, pUC57, lentiviral plasmids, DNA minicircles, and Nanoplasmids. Each of these backbones offers unique advantages, allowing for flexibility and adaptability in the construction and application of ONE-HDR targeting vectors. All of the above-described functional elements can be used in any combination to produce the ONE-HDR template vector of the present invention. CRISPR-Cas endonuclease enzyme In some embodiments, the ONE-HDR template vector of the present invention comprises a nucleotide sequence encoding a Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR)-associated (cas) endonuclease operably linked to a mammalian promoter sequence. In some embodiments the nucleotide sequence the mammalian promoter sequence comprises the sequence set forth in SEQ ID NO:10. In some embodiments the nucleotide sequence encoding the cas endonuclease comprises the sequence set forth in SEQ ID NO: 11. In some embodiments, CRISPR (clustered regularly interspaced short palindromic repeats) loci refers to certain genetic loci encoding factors of class I, II, or III DNA cleavage systems, for example, used by bacterial and archaeal cells to destroy foreign DNA (Horvath and Barrangou, 2010, Science 327:167-170). Components of CRISPR systems are taken advantage of herein in a heterologous manner for DNA targeting in cells. In some embodiments, the type II CRISPR / Cas system from bacteria employs a single guide RNA (sgRNA) comprising a crRNA (CRISPR RNA) and tracrRNA (trans-activating CRISPR RNA) to guide the Cas endonuclease to its DNA target. The crRNA contains a region complementary to one strand of the double strand DNA target and a region that base pairs with the tracrRNA (trans-activating CRISPR RNA) forming a RNA duplex that directs the Cas endonuclease to cleave the DNA target. CRISPR systems belong to different classes, with different repeat patterns, sets of genes, and species ranges. The number of CRISPR-associated genes at a given CRISPR locus can vary between species (Haft et al. (2005) Computational Biology, PLoS Comput Biol 1(6): e60. doi:10.1371 / journal.pcbi.0010060). The term “Cas gene” herein refers to a gene that is generally coupled, associated or close to, or in the vicinity of flanking CRISPR loci. The terms “Cas gene”, “CRISPR-Cas”, and “CRISPR-associated (Cas) gene” are used interchangeably herein. The term “Cas endonuclease” herein refers to a protein encoded by a Cas gene. A Cas endonuclease herein, when in complex with a suitable polynucleotide component, is capable of recognizing, binding to, and optionally nicking or cleaving all or part of a specific DNA target sequence. A Cas endonuclease described herein comprises one or more nuclease domains. Cas endonucleases of the disclosure includes those having a HNH or HNH-like nuclease domain and / or a RuvC or RuvC-like nuclease domain. A Cas endonuclease of the disclosure includes a Cas9 protein, a Cpf1 protein, a C2c1 protein, a C2c2 protein, a C2c3 protein, Cas3, Cas 5, Cas7, Cas8, Cas10, or complexes of these. As used herein, the terms “guide polynucleotide / Cas endonuclease complex”, “guide polynucleotide / Cas endonuclease system”, “guide polynucleotide / Cas complex”, “guide polynucleotide / Cas system”, “guided Cas system”, “gRNA”, “sgRNA”, “sgRNA-gRNA scaffold”, are used interchangeably herein and refer to at least one guide polynucleotide and at least one Cas endonuclease that are capable of forming a complex, wherein said guide polynucleotide / Cas endonuclease complex can direct the Cas endonuclease to a DNA target site, enabling the Cas endonuclease to recognize, bind to, and optionally nick or cleave (introduce a single or double strand break) the DNA target site. A guide polynucleotide / Cas endonuclease complex herein can comprise Cas protein(s) and suitable polynucleotide component(s) of any of the four known CRISPR systems (Horvath and Barrangou, 2010, Science 327:167-170) such as a type I, II, or III CRISPR system. A Cas endonuclease unwinds the DNA duplex at the target sequence and optionally cleaves at least one DNA strand, as mediated by recognition of the target sequence by a polynucleotide (such as, but not limited to, a crRNA or guide RNA) that is in complex with the Cas protein. Such recognition and cutting of a target sequence by a Cas endonuclease typically occurs if the correct protospacer-adjacent motif (PAM) is located at or adjacent to the 3′ end of the DNA target sequence. Alternatively, a Cas protein herein may lack DNA cleavage or nicking activity, but can still specifically bind to a DNA target sequence when complexed with a suitable RNA component. (See also U.S. Patent Application US 2015-0082478 A1, published on Mar.19, 2015 and US 2015- 0059010 A1, published on Feb.26, 2015, both are hereby incorporated in its entirety by reference). A guide polynucleotide / Cas endonuclease complex can cleave one or both strands of a DNA target sequence. A guide polynucleotide / Cas endonuclease complex that can cleave both strands of a DNA target sequence typically comprises a Cas protein that has all of its endonuclease domains in a functional state (e.g., wild type endonuclease domains or variants thereof retaining some or all activity in each endonuclease domain). Thus, a wild type Cas protein (e.g., a Cas9 protein disclosed herein), or a variant thereof retaining some or all activity in each endonuclease domain of the Cas protein, is a suitable example of a Cas endonuclease that can cleave both strands of a DNA target sequence. A Cas9 protein comprising functional RuvC and HNH nuclease domains is an example of a Cas protein that can cleave both strands of a DNA target sequence. A guide polynucleotide / Cas endonuclease complex that can cleave one strand of a DNA target sequence can be characterized herein as having nickase activity (e.g., partial cleaving capability). A Cas nickase typically comprises one functional endonuclease domain that allows the Cas to cleave only one strand (i.e., make a nick) of a DNA target sequence. For example, a Cas9 nickase may comprise (i) a mutant, dysfunctional RuvC domain and (ii) a functional HNH domain (e.g., wild type HNH domain). As another example, a Cas9 nickase may comprise (i) a functional RuvC domain (e.g., wild type RuvC domain) and (ii) a mutant, dysfunctional HNH domain. Non-limiting examples of Cas9 nickases suitable for use herein are disclosed in U.S. Patent Appl. Publ. No.2014 / 0189896, which is incorporated herein by reference. A pair of Cas9 nickases can be used to increase the specificity of DNA targeting. In general, this can be done by providing two Cas9 nickases that, by virtue of being associated with RNA components with different guide sequences, target and nick nearby DNA sequences on opposite strands in the region for desired targeting. Such nearby cleavage of each DNA strand creates a double strand break (i.e., a DSB with single-stranded overhangs), which is then recognized as a substrate for non-homologous- end-joining, NHEJ (prone to imperfect repair leading to mutations) or homologous recombination, HR. Each nick in these embodiments can be at least about 5, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 (or any integer between 5 and 100) bases apart from each other, for example. One or two Cas9 nickase proteins herein can be used in a Cas9 nickase pair. For example, a Cas9 nickase with a mutant RuvC domain, but functioning HNH domain (i.e., Cas9 HNH+ / RuvC−), could be used (e.g., Streptococcus pyogenes Cas9 HNH+ / RuvC−). Each Cas9 nickase (e.g., Cas9 HNH+ / RuvC−) would be directed to specific DNA sites nearby each other (up to 100 base pairs apart) by using suitable RNA components herein with guide RNA sequences targeting each nickase to each specific DNA site. A Cas protein can be part of a fusion protein comprising one or more heterologous protein domains (e.g., 1, 2, 3, or more domains in addition to the Cas protein). Such a fusion protein may comprise any additional protein sequence, and optionally a linker sequence between any two domains, such as between Cas and a first heterologous domain. Examples of protein domains that may be fused to a Cas protein herein include, without limitation, epitope tags (e.g., histidine [His], V5, FLAG, influenza hemagglutinin [HA], myc, VSV-G, thioredoxin [Trx]), reporters (e.g., glutathione-5-transferase [GST], horseradish peroxidase [HRP], chloramphenicol acetyltransferase [CAT], beta-galactosidase, beta-glucuronidase [GUS], luciferase, green fluorescent protein [GFP], HcRed, DsRed, cyan fluorescent protein [CFP], yellow fluorescent protein [YFP], blue fluorescent protein [BFP]), and domains having one or more of the following activities: methylase activity, demethylase activity, transcription activation activity (e.g., VP16 or VP64), transcription repression activity, transcription release factor activity, histone modification activity, RNA cleavage activity and nucleic acid binding activity. A Cas protein can also be in fusion with a protein that binds DNA molecules or other molecules, such as maltose binding protein (MBP), S-tag, Lex A DNA binding domain (DBD), GAL4A DNA binding domain, and herpes simplex virus (HSV) VP16. A Cas protein herein can be from any of the following genera: Aeropyrum, Pyrobaculum, Sulfolobus, Archaeoglobus, Haloarcula, Methanobacteriumn, Methanococcus, Methanosarcina, Methanopyrus, Pyrococcus, Picrophilus, Themioplasnia, Corynebacterium, Mycobacterium, Streptomyces, Aquifrx, Porphvromonas, Chlorobium, Thermus, Bacillus, Listeria, Staphylococcus, Clostridium, Thermoanaerobacter, Mycoplasma, Fusobacterium, Azarcus, Chromobacterium, Neisseria, Nitrosomonas, Desulfovibrio, Geobacter, Myrococcus, Campylobacter, Wolinella, Acinetobacter, Erwinia, Escherichia, Legionella, Methylococcus, Pasteurella, Photobacterium, Salmonella, Xanthomonas, Yersinia, Streptococcus, Treponema, Francisella, or Thermotoga. See also U.S. patent applications 62 / 162,377 filed May 15, 2015 and 62 / 162,353 filed May 15, 2015 (both applications incorporated herein by reference) for more examples of Cas proteins. A guide polynucleotide / Cas endonuclease complex in certain embodiments can bind to a DNA target site sequence, but does not cleave any strand at the target site sequence. Such a complex may comprise a Cas protein in which all of its nuclease domains are mutant, dysfunctional. For example, a Cas9 protein herein that can bind to a DNA target site sequence, but does not cleave any strand at the target site sequence, may comprise both a mutant, dysfunctional RuvC domain and a mutant, dysfunctional HNH domain. A Cas protein herein that binds, but does not cleave, a target DNA sequence can be used to modulate gene expression, for example, in which case the Cas protein could be fused with a transcription factor (or portion thereof) (e.g., a repressor or activator, such as any of those disclosed herein). The Cas endonuclease gene herein can encode a Type II Cas9 endonuclease, such as but not limited to, Cas9 genes listed in SEQ ID NOs: 462, 474, 489, 494, 499, 505, and 518 of WO2007 / 025097, published Mar.1, 2007, and incorporated herein by reference. In another embodiment, the Cas endonuclease gene is a microbe or optimized Cas9 endonuclease gene. The Cas endonuclease gene can be operably linked to a SV40 nuclear targeting signal upstream of the Cas codon region and a bipartite VirD2 nuclear localization signal (Tinland et al. (1992) Proc. Natl. Acad. Sci. USA 89:7442-6) downstream of the Cas codon region. The Cas endonuclease gene includes a plant or microbial codon optimized Streptococcus pyogenes Cas9 gene that can recognize any genomic sequence of the form N(12-30)NGG can in principle be targeted or a Cas9 endonuclease originated from an organism selected from the group consisting of Brevibacillus laterosporus, Lactobacillus reuteri MIc3, Lactobacillus rossiae DSM 15814, Pediococcus pentosaceus SL4, Lactobacillus nodensis JCM 14932, Sulfurospirillum sp. SCADC, Bifidobacterium thermophilum DSM 20210, Loktanella vestfoldensis, Sphingomonas sanxanigenens NX02, Epilithonimonas tenax DSM 16811, Sporocytophaga myxococcoides and Psychroflexus torquis ATCC 700755, wherein said Cas9 endonuclease can form a guide RNA / Cas endonuclease complex capable of recognizing, binding to, and optionally nicking or cleaving all or part of a DNA target sequence. Other Cas endonuclease systems have been described in U.S. patent applications 62 / 162,377 filed May 15, 2015 and 62 / 162,353 filed May 15, 2015, both applications incorporated herein by reference. “Cas9” (formerly referred to as Cas5, Csn1, or Csx12) herein refers to a Cas endonuclease of a type II CRISPR system that forms a complex with a crNucleotide and a tracrNucleotide, or with a single guide polynucleotide, for specifically recognizing and cleaving all or part of a DNA target sequence. Cas9 protein comprises a RuvC nuclease domain and an HNH (H-N-H) nuclease domain, each of which can cleave a single DNA strand at a target sequence (the concerted action of both domains leads to DNA double-strand cleavage, whereas activity of one domain leads to a nick). In general, the RuvC domain comprises subdomains I, II and III, where domain I is located near the N-terminus of Cas9 and subdomains II and III are located in the middle of the protein, flanking the HNH domain (Hsu et al, Cell 157:1262-1278). A type II CRISPR system includes a DNA cleavage system utilizing a Cas9 endonuclease in complex with at least one polynucleotide component. For example, a Cas9 can be in complex with a CRISPR RNA (crRNA) and a trans-activating CRISPR RNA (tracrRNA). In another example, a Cas9 can be in complex with a single guide RNA (sgRNA). The amino acid sequence of a Cas9 protein described herein, as well as certain other Cas proteins herein, may be derived from a Streptococcus (e.g., S. pyogenes, S. pneumoniae, S. thermophilus, S. agalactiae, S. parasanguinis, S. oralis, S. salivarius, S. macacae, S. dysgalactiae, S. anginosus, S. constellatus, S. pseudoporcinus, S. mutans), Listeria (e.g., L. innocua), Spiroplasma (e.g., S. apis, S. syrphidicola), Peptostreptococcaceae, Atopobium, Porphyromonas (e.g., P. catoniae), Prevotella (e.g., P. intermedia), Veillonella, Treponema (e.g., T. socranskii, T. denticola), Capnocytophaga, Finegoldia (e.g., F. magna), Coriobacteriaceae (e.g., C. bacterium), Olsenella (e.g., O. profusa), Haemophilus (e.g., H. sputorum, H. pittmaniae), Pasteurella (e.g., P. bettyae), Olivibacter (e.g., O. sitiensis), Epilithonimonas (e.g., E. tenax), Mesonia (e.g., M. mobilis), Lactobacillus (e.g., L. plantarum), Bacillus (e.g., B. cereus), Aquimarina (e.g., A. muelleri), Chryseobacterium (e.g., C. palustre), Bacteroides (e.g., B. graminisolvens), Neisseria (e.g., N. meningitidis), Francisella (e.g., F. novicida), or Flavobacterium (e.g., F. frigidarium, F. soli) species, for example. As another example, a Cas9 protein can be any of the Cas9 proteins disclosed in Chylinski et al. (RNA Biology 10:726-737 and U.S. patent application 62 / 162,377, filed May 15, 2015), which are incorporated herein by reference. Accordingly, the sequence of a Cas9 protein herein can comprise, for example, any of the Cas9 amino acid sequences disclosed in GenBank Accession Nos. G3ECR1 (S. thermophilus), WP_026709422, WP_027202655, WP_027318179, WP_027347504, WP_027376815, WP_027414302, WP_027821588, WP_027886314, WP_027963583, WP_028123848, WP_028298935, Q03JI6 (S. thermophilus), EGP66723, EGS38969, EGV05092, EHI65578 (S. pseudoporcinus), EIC75614 (S. oralis), EID22027 (S. constellatus), EIJ69711, EJP22331 (S. oralis), EJP26004 (S. anginosus), EJP30321, EPZ44001 (S. pyogenes), EPZ46028 (S. pyogenes), EQL78043 (S. pyogenes), EQL78548 (S. pyogenes), ERL10511, ERL12345, ERL19088 (S. pyogenes), ESA57807 (S. pyogenes), ESA59254 (S. pyogenes), ESU85303 (S. pyogenes), ETS96804, UC75522, EGR87316 (S. dysgalactiae), EGS33732, EGV01468 (S. oralis), EHJ52063 (S. macacae), EID26207 (S. oralis), EID33364, EIG27013 (S. parasanguinis), EJF37476, EJ019166 (Streptococcus sp. BS35b), EJU16049, EJU32481, YP_006298249, ERF61304, ERK04546, ETJ95568 (S. agalactiae), TS89875, ETS90967 (Streptococcus sp. SR4), ETS92439, EUB27844 (Streptococcus sp. B521), AFJ08616, EUC82735 (Streptococcus sp. CM6), EWC92088, EWC94390, EJP25691, YP_008027038, YP_008868573, AGM26527, AHK22391, AHB36273, Q927P4, G3ECR1, or Q99ZW2 (S. pyogenes), which are incorporated by reference. A variant of any of these Cas9 protein sequences may be used, but should have specific binding activity, and optionally endonucleolytic activity, toward DNA when associated with an RNA component herein. Such a variant may comprise an amino acid sequence that is at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the amino acid sequence of the reference Cas9. Alternatively, a Cas9 protein may comprise an amino acid sequence that is at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to any of the foregoing amino acid sequences, for example. Such a variant Cas9 protein should have specific binding activity, and optionally cleavage or nicking activity, toward DNA when associated with an RNA component herein. A Cas protein herein such as a Cas9 can comprise a heterologous nuclear localization sequence (NLS). A heterologous NLS amino acid sequence herein may be of sufficient strength to drive accumulation of a Cas protein in a detectable amount in the nucleus of a yeast cell herein, for example. An NLS may comprise one (monopartite) or more (e.g., bipartite) short sequences (e.g., 2 to 20 residues) of basic, positively charged residues (e.g., lysine and / or arginine), and can be located anywhere in a Cas amino acid sequence but such that it is exposed on the protein surface. An NLS may be operably linked to the N-terminus or C-terminus of a Cas protein herein, for example. Two or more NLS sequences can be linked to a Cas protein, for example, such as on both the N- and C-termini of a Cas protein. Non-limiting examples of suitable NLS sequences herein include those disclosed in U.S. Pat. No.7,309,576, which is incorporated herein by reference. The Cas endonuclease can comprise a modified form of the Cas9 polypeptide. The modified form of the Cas9 polypeptide can include an amino acid change (e.g., deletion, insertion, or substitution) that reduces the naturally-occurring nuclease activity of the Cas9 protein. For example, in some instances, the modified form of the Cas9 protein has less than 50%, less than 40%, less than 30%, less than 20%, less than 10%, less than 5%, or less than 1% of the nuclease activity of the corresponding wild-type Cas9 polypeptide (US patent application US20140068797 A1, published on Mar.6, 2014). In some cases, the modified form of the Cas9 polypeptide has no substantial nuclease activity and is referred to as catalytically “inactivated Cas9” or “deactivated cas9 (dCas9).” Catalytically inactivated Cas9 variants include Cas9 variants that contain mutations in the HNH and RuvC nuclease domains. These catalytically inactivated Cas9 variants are capable of interacting with sgRNA and binding to the target site in vivo but cannot cleave either strand of the target DNA. The terms “functional fragment”, “fragment that is functionally equivalent” and “functionally equivalent fragment” of a Cas endonuclease are used interchangeably herein, and refer to a portion or subsequence of the Cas endonuclease sequence of the present disclosure in which the ability to recognize, bind to, and optionally nick or cleave (introduce a single or double strand break in) the target site is retained. The terms “functional variant”, “Variant that is functionally equivalent” and “functionally equivalent variant” of a Cas endonuclease are used interchangeably herein, and refer to a variant of the Cas endonuclease of the present disclosure in which the ability to recognize, bind to, and optionally nick or cleave (introduce a single or double strand break in) the target site is retained. Fragments and variants can be obtained via methods such as site-directed mutagenesis and synthetic construction. Any guided endonuclease can be used in the methods disclosed herein. Such endonucleases include, but are not limited to Cas9 and Cpf1 endonucleases. Many endonucleases have been described to date that can recognize specific PAM sequences (see for example Jinek et al. (2012) Science 337 p 816-821, U.S. patent applications 62 / 162,377 filed May 15, 2015 and 62 / 162,353 filed May 15, 2015 and Zetsche B et al. 2015. Cell 163, 1013) and cleave the target DNA at a specific position. It is understood that based on the methods and embodiments described herein utilizing a guided Cas system one can now tailor these methods such that they can utilize any guided endonuclease system. The term “off-target site effects” and “off-target effects” are used interchangeably and include any alteration in an off-target site that is due to the activity of an endonuclease cleavage, wherein the alteration include, for example: (i) a replacement of at least one nucleotide, (ii) a deletion of at least one nucleotide, (iii) an insertion of at least one nucleotide, or (iv) any combination of (i)-(iii), as well as any integration of a template or donor DNA at an unintended site. The unintended site can be any site in the genome of the organism that is not the target site. Several approaches have been explored to improve the specificity and decrease off-target site effects of Cas endonucleases, including reducing the amount of enzyme active in the cell, shortening the section of the guide RNA complementary to the target, deploying pairs of engineered nicking Cas9s (Nicolas et al., Human Gene Therapy.2015, 26(7): 425-431), and structure-guided protein engineering (Slaymaker et al., Science.2015. DOI: 10.1126 / science.aad5227). Many of these approaches remain to have limitations, often decreasing on-target editing efficiency. ONE-HDR Targeting Vector In one embodiment, the ONE-HDR targeting vector of the present invention is generated through digestion of the ONE-HDR template vector and ligation of the insertion cassette of the ONE-HDR template vector, the nucleotide sequence encoding the gRNA scaffold sequence of the ONE-HDR template vector and the nucleotide sequence encoding the CRISPR-Cas endonuclease operably linked a to a mammalian promoter sequence of the ONE-HDR template vector, to a first nucleic acid sequence having sequence homology to a first target nucleic acid sequence and a second nucleic acid sequence having sequence homology to a second target nucleic acid sequence, wherein the first nucleic acid sequence having sequence homology to a first target nucleic acid sequence is ligated to the 5’ end of the insertion cassette and the second nucleic acid sequence having sequence homology to a second target nucleic acid sequence is linked to the 3’ end of the insertion cassette. In one embodiment, the first nucleic acid sequence having sequence homology to a first target nucleic acid sequence comprises a left recombination arm. In one embodiment, the second nucleic acid sequence having sequence homology to a second target nucleic acid sequence comprises a right recombination arm. In one embodiment, the right recombination arm is linked at its 3’ terminal to at least one promoter sequence where in the at least one promoter sequence is operably linked to a nucleotide sequence encoding at least one sgRNA sequence. In one embodiment, the at least one promoter sequence comprises a transfer RNA (tRNA) promoter sequence comprising a sequence as set forth in SEQ ID NO:9. The tRNA promoter includes a DNA encoding any one tRNA known in the art such as but limiting to tRNA-Lysine (tRNA- Lys; see Acker et al.2008. Nucleic acid res.36(18):5832-5844), a tRNA-Glutamine (tRNA-Glu), a tRNA-Valine (tRNA Val; Marck et al.2006. Nuceic Acid Res. 34(6):1816-1835) or any other tRNA active in a cell, a tRNA-leucine (tRNA Leu, tRNA- leu(2), tRNA-leu(3)), a tRNA-isoleucine (tRNA-ile), a tRNA-tryptophan (tRNA-trp), a tRNA-tyrosine (tRNA-tyr), a tRNA-histidine (tRNA-his; tRNA-his). As described herein, in a microbial cell (such as, but not limited to Yarrowia) having a recombinant DNA construct comprising a tRNA operably linked to a DNA encoding a guide RNA (gRNA), the DNA fragment encoding the tRNA can act as a promoter capable of expression of a tRNA-guide RNA fusion molecule. In one embodiment, the present invention provides methods for the generation of the ONE-HDR targeting vector from the ONE-HDR template vector comprising digesting the ONE-HDR template vector with the first and second restriction enzymes and subsequently incubating a first and second nucleic acid with the restriction enzyme digested ONE-HDR template vector, wherein the incubation comprises a Gibson assembly procedure, wherein the first nucleic acid comprises the left recombination arm of the ONE-HDR targeting vector and the second nucleic acid comprises the right recombination arm ONE-HDR targeting vector, and wherein following the incubation, the left recombination arm replaces the nucleotide sequence encoding the first bacterial negative selection marker in the ONE-HDR template vector and the right recombination arm replaces the nucleotide sequence encoding the second bacterial negative selection marker in the ONE-HDR template vector, thereby generating the ONE-HDR targeting vector. The left recombination arm and the right recombination arm allow the ONE-HDR targeting vector sequence to recombine with desired DNA sequences i.e., the first target nucleic acid sequence and the second target nucleic acid sequence. The recombination event results in integration of the nucleic acid sequence of the insertion cassette into the target DNA. In one embodiment, the target DNA is genomic DNA of a target cell, therefore the insertion cassette is integrated into the genome of the target cell. In one embodiment, the left recombination arm additionally comprises a double strand break (DSB) site at its 5’ terminal, wherein the DSB site is specific to the first target nucleic acid sequence and is cleaved by the CRISPR-Cas enzyme upon expression. In one embodiment, the right recombination arm additionally comprises a DSB site at its 3’ terminal, wherein the DSB site is specific to the second target nucleic acid sequence and is cleaved by the CRISPR-Cas enzyme upon expression. The presence of these DSB sites promotes CRISPR-induced breaks after introduction of the ONE-HDR targeting vector into mammalian cells and CRISPR protein expression thereby releasing the insertion cassette flanked by the first and right recombination arms from the ONE- HDR targeting vector as a linear DNA molecule. These templates facilitate the generation of recombination arms that will incorporate a CRISPR double-strand break (DSB) site specific to the desired targeting gene. The presence of these DSB sites promotes CRISPR-induced breaks in the ONE-HDR targeting vector after mammalian cell transfection / electroporation and CRISPR protein expression. By releasing the entire recombination cassette from the circular plasmid, the template becomes more effectively utilized to promote homologous recombination, thereby enhancing recombination efficiency. Additionally, promoting the CRISPR break in the ONE-HDR targeting vector reduces the half-life of the vector in the cells, allowing for rapid elimination (Figure 1 through Figure 3). In one embodiment, the ONE-HDR targeting vector of the present invention comprises, in the 5′ to 3′ order, a left recombination arm, the insertion cassette of the ONE-HDR template vector, a right recombination arm, a promoter sequence operably linked to a nucleotide sequence encoding at least one sgRNA sequence, a gRNA scaffold sequence, and a nucleotide sequence encoding a CRISPR-Cas endonuclease operably linked to a mammalian promoter sequence. In one embodiment, the ONE-HDR targeting vector of the present invention comprises, in the 5′ to 3′ order, a left recombination arm, the insertion cassette of the ONE-HDR template vector, wherein the insertion cassette of the ONE-HDR template vector comprises one or more nucleotide sequences, wherein the one or more nucleotide sequence comprises at least one nucleotide sequence encoding a reporter marker or at least one protein purification tag, at least one nucleotide sequence encoding a P2A peptide sequence, at least one nucleotide sequence encoding a eukaryotic antibiotic resistance gene, and at least one nucleotide sequence encoding a mRNA stabilization sequence, a right recombination arm, a promoter sequence operably linked to a nucleotide sequence encoding at least one sgRNA sequence, a gRNA scaffold sequence, and a nucleotide sequence encoding a CRISPR-Cas endonuclease operably linked to a mammalian promoter sequence. In one embodiment, the ONE-HDR targeting vector of the present invention comprises, in the 5′ to 3′ order, a left recombination arm, the insertion cassette of the ONE-HDR template vector, wherein the insertion cassette of the ONE-HDR template vector comprises one or more nucleotide sequences, wherein the one or more nucleotide sequence comprises at least one nucleotide sequence encoding a reporter marker or at least one protein purification tag, wherein the at least one reporter marker or at least one protein purification tag is operably linked to a polyA signal, at least one nucleotide sequence encoding a eukaryotic antibiotic resistance gene, wherein the at least one nucleotide sequence encoding a eukaryotic antibiotic resistance gene is operably linked to a mammalian promoter at its 5’ terminal, and wherein the at least one eukaryotic antibiotic resistance gene is operably linked to at least one mRNA stabilization sequence at is 3’ terminal, a right recombination arm, a promoter sequence operably linked to a sgRNA sequence, a gRNA scaffold sequence, and a nucleotide sequence encoding a CRISPR-Cas endonuclease operably linked to a mammalian promoter sequence. In one embodiment, the ONE-HDR targeting vector of the present invention comprises, in the 5′ to 3′ order, a left recombination arm, the insertion cassette of the ONE-HDR template vector, wherein the insertion cassette of the ONE-HDR template vector comprises one or more nucleotide sequences, wherein the one or more nucleotide sequence comprises at one nucleotide sequence encoding a eukaryotic antibiotic resistance gene, at least one nucleotide sequence encoding a P2A peptide sequence, and at least one nucleotide sequence encoding a reporter marker or at least one protein purification tag, wherein the at least one reporter or at least one protein purification tag marker is operably linked to a flexible linker at is 3’ terminal, a right recombination arm, a promoter sequence operably linked to a nucleotide sequence encoding at least one sgRNA sequence, a gRNA scaffold sequence, and a nucleotide sequence encoding a CRISPR-Cas endonuclease operably linked to a mammalian promoter sequence. In one embodiment, the ONE-HDR targeting vector comprises a functional CRISPR-Cas system, wherein the functional CRISPR-Cas system comprises a CRISPR-Cas endonuclease, a sgRNA, a gRNA scaffold, and combinations thereof. In one embodiment, the ONE-HDR targeting vector comprises a functional CRISPR-Cas system, wherein the functional CRISPR-Cas system comprises the essential and non- essential components known in the art for the effective functioning of a CRISPR-Cas system. In one embodiment, the ONE-HDR targeting vector comprises a functional CRISPR-Cas system, wherein the functional CRISPR-Cas system is capable of functioning when the ONE-HDR targeting vector is introduced into a target cell, wherein the target cell is a mammalian cell or any other cell type as described elsewhere herein, and wherein the functioning comprises nicking or cleaving a target sequence in the genome of the target cell, wherein the target site in the genome of the target cell, is a site which is at least partially complementary to the sgRNA. In various embodiments, the insertion cassette of the ONE-HDR targeting vector may include, but is not limited to, any combination of exogenous gene sequence, reporter marker sequence, cell selection marker sequence, mRNA stabilization sequence, termination sequence, IRES, promoter sequence, translation initiation sequence, recombinase recognition sites, and other functional elements, as described in detail above. Recombination arms The left recombination arm and the right recombination arm allow the HDR vector sequence to recombine with desired DNA sequences i.e., the first target nucleic acid sequence and the second target nucleic acid sequence. The recombination event results in integration of the nucleic acid sequence of the insertion cassette into the target DNA. In one embodiment, the target DNA is genomic DNA of a target cell, therefore the insertion cassette is integrated into the genome of the target cell. In one embodiment, the left recombination arm comprises the sequence as set forth in SEQ ID NO:4. In one embodiment, the right recombination arm comprises the sequence as set forth in SEQ ID NO:5. In one embodiment, the left recombination arm additionally comprises a double strand break (DSB) site at its 5’ terminal, wherein the DSB site is specific to the first target nucleic acid sequence and is cleaved by the CRISPR-Cas enzyme upon expression. In one embodiment, the right recombination arm additionally comprises a DSB site at its 3’ terminal, wherein the DSB site is specific to the second target nucleic acid sequence and is cleaved by the CRISPR-Cas enzyme upon expression. The presence of these DSB sites promotes CRISPR-induced breaks after introduction of the ONE-HDR targeting vector into mammalian cells and CRISPR protein expression thereby releasing the insertion cassette flanked by the first and right recombination arms from the ONE- HDR targeting vector as a linear DNA molecule. In one embodiment, the left recombination arm additionally comprising a DSB site comprises the sequence as set forth in SEQ ID NO:6. In one embodiment, the right recombination arm additionally comprising a DSB site comprises the sequence as set forth in SEQ ID NO:7. In one embodiment, the ONE-HDR system is utilized to insert single point mutations into genomic DNA. In one embodiment, for the introduction of a point mutation in the exon of a target gene, an intron region with an optimal CRISPR cutting site that is no more than 1000 bp distant from the single point mutation site is identified and a synthetic construct is designed to facilitate homologous recombination following the induction of a CRISPR DSB at the target site. In one embodiment, the synthetic construct comprises the sequence as set forth in SEQ ID NO:8. In one embodiment, left and right recombination arms, each around 400-500 bp long, adjacent to the site are selected and appropriately incorporated into SEQID NO: 8. In one embodiment, the CRISPR cutting site is within an intron of the target gene. In one embodiment, the CRISPR cutting site is within an exon of the target gene. In one embodiment, for the introduction of a point mutation, one of the recombination arms comprises the desired mutation. This mutation in the recombination arm ensures that, during the homologous recombination process, the desired point mutation is introduced into the target gene. In one embodiment, the sequence linking the two recombination arms, which is similar to the genomic CRISPR cutting site, is appropriately mutated, and thus distinguishable from the target sequence, in order to prevent the CRISPR-Cas endonuclease from cutting the ONE-HDR targeting vector. In various embodiments, a recombination arm may be at least about 25 bp, at least 25-50 bp, at least 50-100 bp, at least 100-300 bp, at least 300-1000 bp, at least 1000-2000 bp, at least 2000-5000 bp, at least 5000-7000 bp or more than 7000 bp. In various embodiments a recombination arm comprises a nucleic acid sequence having more than 60%, more than 70%, more than 80%, more than 90%, more than 95%, more than 98%, or 100% sequence identity to a target nucleic acid sequence. In one embodiment, a target nucleic acid sequence is a genomic DNA sequence. The instant invention is not limited as to the genomic location which a recombination arm targets. That is, a recombination arm may have more than 60%, more than 70%, more than 80%, more than 90%, more than 95%, more than 98%, or 100% sequence identity to an exonic sequence, an intronic sequence, an intergenic sequence, a 3’ UTR sequence, a 5’ UTR sequence, a promoter sequence, a chromosomal sequence or an extrachromosomal sequence. In one embodiment, the left recombination arm and the right recombination arm may target sequences proximal to each other. The genomic sequence targeted by the two recombination arms may be non-continuous or continuous in the genome of the target cell before integration of the insertion cassette. As used herein, two nucleotide sequences are continuous if the 3′ end of one nucleotide sequence is covalently linked to the 5′ end of the other nucleotide sequence without any intervening nucleotide residue. In one embodiment, two recombination arms target genomic sequences less than 10 kb, less than 9 kb, less than 8 kb, less than 7 kb, less than 6 kb, less than 5 kb, less than 4 kb, less than 3 kb, less than 2 kb or less than 1 kb apart. In one embodiment, two recombination arms target genomic sequences more than 10 kb, more than 9 kb, more than 8 kb, more than 7 kb, more than 6 kb, more than 5 kb, more than 4 kb, more than 3 kb, more than 2 kb or more than 1 kb apart. The ONE-HDR targeting vector can be prepared in various ways. For example, the first and right recombination arms may be obtained from available genome database or gene expression database for human or other species. The two sequences may be amplified with primers designed to incorporate restriction enzyme cleavage sites, digested with restriction enzymes and then ligated into a digested ONE-HDR template vector using methods as appreciated in the art. In one embodiment, two recombination arms are ligated with a digested ONE-HDR template vector to generate a ONE-HDR targeting vector using the Gibson assembly method (Gibson et al., Nat Methods, 2009, 6:343-345). In one embodiment, a ONE-HDR targeting vector generated using the Gibson assembly method is linear, such that the linearized product comprises: (1) a left recombination arm (2) an insertion cassette, having a reporter marker, a selection marker or a combination thereof; and (3) a right recombination arm. This linearized product is an embodiment of the ONE-HDR targeting vector of the present invention. Single guide RNA (sgRNA) As used herein, the term “single guide RNA” (sgRNA), relates to a RNA sequence that can form a complex with a Cas endonuclease and enables the Cas endonuclease to recognize, bind to, and optionally cleave a target sequence. In some embodiments, the sgRNA can comprise at least one nucleotide, phosphodiester bond or linkage modification such as, but not limited, to Locked Nucleic Acid (LNA), 5-methyl dC, 2,6-Diaminopurine, 2′-Fluoro A, 2′-Fluoro U, 2′-O-Methyl RNA, phosphorothioate bond, linkage to a cholesterol molecule, linkage to a polyethylene glycol molecule, linkage to a spacer 18 (hexaethylene glycol chain) molecule, or 5′ to 3′ covalent linkage resulting in circularization. In some embodiments, the sgRNA includes a first nucleotide sequence domain that can hybridize to a nucleotide sequence in a target sequence and a second nucleotide sequence that is part of a Cas endonuclease recognition (CER) domain and binds physically to the Cas endonuclease. Accordingly, in some embodiments, the sgRNA comprises a structure that binds to a Cas endonuclease and targets the Cas endonuclease to a specific target sequence, e.g., a gene or genomic region. In some embodiments, the sgRNA comprises a first nucleotide sequence domain that can hybridize to a nucleotide sequence in a target sequence, e.g., a gene or genomic region. In some embodiments, the sgRNA comprises a first nucleotide sequence domain that can hybridize to a nucleotide sequence in a target DNA and when the sgRNA is inserted into the ONE-HDR targeting vector, is linked at its 3’ terminal to a gRNA scaffold, wherein the gRNA scaffold is part of a Cas endonuclease recognition (CER) domain and binds physically to the Cas endonuclease. Accordingly, in some embodiments, the sgRNA linked to the gRNA scaffold comprises a first nucleotide sequence domain, the sgRNA, that can hybridize to a nucleotide sequence in a target sequence and a second nucleotide sequence, the gRNA scaffold sequence, that is part of a Cas endonuclease recognition (CER) domain and binds physically to the Cas endonuclease. Accordingly, in some embodiments, the sgRNA linked to the gRNA scaffold comprises a structure that binds to a Cas endonuclease and targets the Cas endonuclease to a target sequence, e.g., a gene or genomic region. In some embodiments, the sgRNA is linked to the gRNA scaffold by a nucleotide sequence, wherein the the nucleotide sequence can be at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100 nucleotides in length. In another embodiment, the nucleotide sequence can comprise a tetraloop sequence, such as, but not limiting to a GAAA tetraloop sequence. In some embodiments, the sgRNA disclosed herein can range in length from, but not limited to, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more nucleotides. In some embodiments, the sgRNA hybridizes to at least a part of a target sequence (e.g., target genome sequence), and the sgRNA may have a complementary sequence to the target sequence. In some embodiments, the target sequence herein is a first target sequence that hybridizes to a second target sequence adjacent to a PAM site described herein. In some embodiments, the target sequence may comprise the first target sequence or the second target sequence. “Complementarity” refers to the ability of a nucleic acid to form hydrogen bond(s) with another nucleic acid sequence by either traditional Watson-Crick or other non-traditional types. A percent complementarity indicates the percentage of residues in a nucleic acid molecule which can form hydrogen bonds (e.g., Watson-Crick base pairing) with a second nucleic acid sequence (e.g., 5, 6, 7, 8, 9, 10 out of 10 being 50%, 60%, 70%, 80%, 90%, and 100% complementary). “Perfectly complementary” means that all the contiguous residues of a nucleic acid sequence will hydrogen bond with the same number of contiguous residues in a second nucleic acid sequence. “Substantially complementary” as used herein refers to a degree of complementarity that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% over a region of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, or more nucleotides, or refers to two nucleic acids that hybridize under stringent conditions. As used herein, “conditions” for hybridization refer to conditions under which a nucleic acid having complementarity to a target sequence predominantly hybridizes with the target sequence, and substantially does not hybridize to non-target sequences. Conditions are generally sequence-dependent, and vary depending on a number of factors. In general, the longer the sequence, the higher the temperature at which the sequence specifically hybridizes to its target sequence. Non- limiting examples of stringent conditions are described in detail in Tijssen (1993), Laboratory Techniques in Biochemistry And Molecular Biology-Hybridization With Nucleic Acid Probes Part 1, Second Chapter “Overview of principles of hybridization and the strategy of nucleic acid probe assay”, Eisevier, N.Y. “Hybridization” refers to a reaction in which one or more polynucleotides react to form a complex that is stabilized via hydrogen bonding between the bases of the nucleotide residues. The hydrogen bonding may occur by Watson Crick base pairing, Hoogstein binding, or in any other sequence specific manner. The complex may comprise two strands forming a duplex structure, three or more strands forming a multi stranded complex, a single self- hybridizing strand, or any combination of these. A hybridization reaction may constitute a step in a more extensive process, such as the initiation of PCR, or the cleavage of a polynucleotide by an enzyme. A sequence capable of hybridizing with a given sequence is referred to as the “complement” of the given sequence. In some embodiments, the sgRNA sequence has the nucleotide sequence having at least about 80, 85, 90, 95 or 100% sequence identity to a target sequence. As used herein, the term “about” may refer to a range of values that are similar to the stated reference. In certain embodiments, the term “about” refers to a range of values that fall within 15, 10, 9, 8,7, 6, 5, 4, 3, 2, 1 percent or less of the stated reference value. In some embodiments, the sgRNA sequence has the nucleotide sequence having one, two, three, four or five nucleotide additions, deletions and / or substitutions from a target sequence. Such additions, deletions and / or substitutions may be at the 3′-end or 5′-end of the nucleotide sequence. In additional embodiments, the sgRNA is about 17, 18, 19, 20, 21, 22, 23 or 24 nucleotide long. In one embodiment, the sgRNA sequence comprises a protospacer adjacent motif. A “protospacer adjacent motif” (PAM) herein refers to a short nucleotide sequence adjacent to a target sequence (protospacer) that is recognized (targeted) by a guide polynucleotide / Cas endonuclease system described herein. The Cas endonuclease may not successfully recognize a target sequence if the target sequence is not followed by a PAM sequence. The sequence and length of a PAM herein can differ depending on the Cas protein or Cas protein complex used. The PAM sequence can be of any length but is typically 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 nucleotides long. Target sequence In one embodiment, the target sequence is a site at or around which the Cas endonuclease cleaves double stranded DNA of the target sequence. In one embodiment, the target sequence is a region of a eukaryotic genome, wherein the eukaryotic genome is a mammalian genome. In one embodiment, the target sequence is a coding sequence of DNA, wherein the coding sequence encodes the sequence of a mRNA or RNA molecule. In one embodiment, the target sequence is a non-coding sequence, wherein the non-coding sequence does not encode the sequence of a mRNA or RNA molecule. In one embodiment, the target sequence is a naturally occurring sequence. In one embodiment, the target sequence is a non-naturally occurring sequence or a synthetic sequence, wherein the non-naturally occurring sequence or synthetic sequence occurs within the genome of a eukaryotic cell. In one embodiment, the target sequence is a region of DNA within a eukaryotic cell, wherein the region of DNA comprises a mitochondrial genome. In one embodiment, the target sequence is a naturally occurring sequence. In one embodiment, the target sequence is a non-naturally occurring sequence or a synthetic sequence, wherein the non-naturally occurring sequence or synthetic sequence occurs within the mitochondrial genome of a eukaryotic cell. In one embodiment, the target sequence is a region of DNA within a eukaryotic cell, wherein the region of DNA within a eukaryotic cell comprises an episome. The terms “target site”, “target sequence”, “target site sequence, “target DNA”, “target locus”, “genomic target site”, “genomic target sequence”, “genomic target locus” and “protospacer”, are used interchangeably herein and refer to a polynucleotide sequence such as, but not limited to, a nucleotide sequence on a chromosome, episome, or any other DNA molecule in the genome (including chromosomal, choloroplastic, mitochondrial DNA, plasmid DNA) of a cell, at which a guide polynucleotide / Cas endonuclease complex can recognize, bind to, and optionally nick or cleave. The target site can be an endogenous site in the genome of a cell, or alternatively, the target site can be heterologous to the cell and thereby not be naturally occurring in the genome of the cell, or the target site can be found in a heterologous genomic location compared to where it occurs in nature. As used herein, terms “endogenous target sequence” and “native target sequence” are used interchangeable herein to refer to a target sequence that is endogenous or native to the genome of a cell and is at the endogenous or native position of that target sequence in the genome of the cell. Cells include, but are not limited to, human, non-human, animal, bacterial, fungal, insect, yeast, non-conventional yeast, and plant cells as well as plants and seeds produced by the methods described herein. An “artificial target site”, “artificial target sequence”, “non-naturally occurring sequence”, or “synthetic sequence” are used interchangeably herein and refer to a target sequence that has been introduced into the genome of a cell. Such an artificial target sequence can be identical in sequence to an endogenous or native target sequence in the genome of a cell but be located in a different position (i.e., a non-endogenous or non- native position) in the genome of a cell. An “altered target site”, “altered target sequence”, “modified target site”, “modified target sequence” are used interchangeably herein and refer to a target sequence as disclosed herein that comprises at least one alteration when compared to non-altered target sequence. Such “alterations” include, for example: (i) replacement of at least one nucleotide, (ii) a deletion of at least one nucleotide, (iii) an insertion of at least one nucleotide, or (iv) any combination of (i)-(iii). Methods for “modifying a target site” and for “altering a target site” are used interchangeably herein and refer to methods for producing an altered target site. The length of the target DNA sequence (target site) can vary, and includes, for example, target sites that are at least 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more nucleotides in length. It is further possible that the target site can be palindromic, that is, the sequence on one strand reads the same in the opposite direction on the complementary strand. The nick / cleavage site can be within the target sequence or the nick / cleavage site could be outside of the target sequence. In another variation, the cleavage could occur at nucleotide positions immediately opposite each other to produce a blunt end cut or, in other Cases, the incisions could be staggered to produce single-stranded overhangs, also called “sticky ends”, which can be either 5′ overhangs, or 3′ overhangs. Active variants of genomic target sites can also be used. Such active variants can comprise at least 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the given target site, wherein the active variants retain biological activity and hence are capable of being recognized and cleaved by a Cas endonuclease. Assays to measure the single or double- strand break of a target site by an endonuclease are known in the art and generally measure the overall activity and specificity of the agent on DNA substrates containing recognition sites. ONE-HDR target vector for protein overexpression In one embodiment, the ONE-HDR target vector is used to overexpress proteins. In one embodiment, the ONE-HDR target vector facilitates the insertion of an overexpression cassette into any genomic region and comprises a nucleic acid sequence as set forth in SEQ ID NO:12. In one embodiment, the ONE-HDR target vector comprises a locus specific ONE-HDR target vector and facilitates the insertion of an overexpression cassette at the well-known safe harbor locus (AAV1) and comprises a nucleic acid sequence as set forth in SEQ ID NO:13. In one embodiment, a template for cloning a sequence of a recombinant protein into a ONE-HDR target vector for protein overexpression at the AAV1 locus comprises a nucleic acid sequence as set forth in SEQ ID NO:14. Methods In one embodiment, the invention provides methods and compositions for the development of genetically modified cell lines. In one embodiment, the modified cell lines comprise cells in which one or more alleles of a gene are tagged or labeled. In one embodiment, the modified cell lines comprise cells in which one or more alleles of a gene are disrupted. In one embodiment, the modified cell lines comprise cells in which one or more alleles of a gene contain one or more point mutations. In one embodiment, the modified cell lines comprise cells in which one or more one or more non-coding regions of the genome contain one or more point mutations. In one embodiment, the invention provides a method for tagging a gene or gene product in a cell, comprising: (a) introducing the ONE-HDR targeting vector into a cell, wherein the ONE-HDR targeting vector comprises an insertion cassette as describe elsewhere herein, (b) selecting for a cell wherein the insertion cassette of the ONE-HDR targeting vector has integrated into the genome. In one embodiment, the invention provides a method for knocking down or knocking out a gene in a cell, comprising: (a) introducing the ONE-HDR targeting vector into a cell, wherein the ONE-HDR targeting vector comprises an insertion cassette as describe elsewhere herein, (b) selecting for a cell wherein the insertion cassette of ONE-HDR targeting vector has integrated into the genome. In one embodiment, the invention provides a method for generating one or more point mutations in the genome of a cell, comprising: (a) introducing the ONE-HDR targeting vector into a cell wherein the insertion cassette of the ONE-HDR targeting vector comprises an exogenous DNA sequence, wherein the exogenous DNA sequence contains the one or more point mutations to be generated as describe elsewhere herein; and (b) selecting for a cell wherein the insertion cassette of the ONE-HDR targeting vector has integrated into the genome. In one embodiment, the invention provides methods and compositions for the development of genetically modified cell lines. In one embodiment, the method comprises contacting a cell to be genetically modified with a ONE-HDR targeting vector of the present invention, wherein the ONE-HDR targeting vector of the present invention when introduced into the cell, expresses components of a CRISPR-Cas system, that nicks or cleaves a target site in the genome of the target cell, wherein the nicking or cleaving permits the incorporation of an insertion cassette of the ONE-HDR targeting vector, as described elsewhere herein, to be incorporated into the genome of the cells via homologous recombination, wherein the homologous recombination is facilitated by one or more recombination arms, of the ONE-HDR targeting vector as described elsewhere herein. In one embodiment, the components of a CRISPR-Cas system comprise a CRISPR-Cas endonuclease, a sgRNA, a gRNA scaffold, or any combination thereof. In one embodiment, the target site in the genome of the target cell, is a site which is at least partially complementary to the sgRNA. In one embodiment, the recombination arms of the ONE-HDR targeting vector hybridize to the homologous target sequence, e.g., genomic region, and recombination between the recombination arms of the ONE-HDR targeting vector and the target sequence allows integration of the insertion cassette of the ONE-HDR targeting vector into the genome of the target cell. In one preferred embodiment, the insertion cassette comprising a reporter marker, a eukaryotic cell selection marker sequence, or both integrates downstream of an open reading frame in a manner such that the reading frame is not disrupted (i.e. in-frame integration), allowing for generation of a tagged or fusion protein. In one embodiment, one allele of a gene is modified through the method of the invention. In another embodiment, all the alleles of the same gene in a cell are modified through the method of the invention. The invention provides methods of reducing the expression of an endogenous gene in a cell, plant or animal by introducing an insertion cassette into the endogenous gene such that expression of the gene is disrupted. Thus, the invention provides an efficient and precise way to produce a “knockout” cell that is unable to produce a transcript or to express a gene product. The target cells thus made, are useful to evaluate the therapeutic or diagnostic utilities of the inactivated genes, and to screen for compounds that affect the expression and function of the genes. In one embodiment, method of the invention may be used to indirectly modulate the expression of a gene whose expression is regulated (e.g. activated or inhibited) by a target gene. The effect of the targeted gene upon the regulated gene may be normal, or it may be a consequence of an abnormal imbalance induced by a disease state. The invention also provides methods of expressing of an exogenous gene or polynucleotide sequence (e.g. transgene) in a cell, plant, or animal. Thus, in one embodiment, the invention provides a knock-in method for expressing a gene in a cell. The exogenous sequence may be on an insertion cassette and integrated into the genome of the cell, plant, or animal. In one embodiment, the integration site for the insertion cassette comprising an exogenous gene is intergenic. Transcription of the exogenous gene in the cell may be regulated by either an exogenous promoter or an endogenous promoter. Accordingly, in one embodiment, the insertion cassette comprising the exogenous gene further comprises a promoter sequence. In certain embodiments, the promoter driving expression of the exogenous gene is conditionally regulated, by any available method, including those described above. In some embodiments of the invention, an exogenous gene may be operably linked to a tag, a reporter marker, a selection marker, or any combination of functional elements as described previously. In some embodiments, the introduction of the ONE-HDR system into an animal may be via systemic transfection with nanoparticles or tissue-specific electroporation into various tissues such as the lungs, liver, spleen, kidneys, heart, muscles, testicles, and intra uterine embryos. Cells A ONE-HDR targeting vector of the present invention can be used to tag, knock-in or knock-out genes, or generate point mutations, in the genome of any type of target cell. In one embodiment, the target cell is a HEK293T cell, a HeLa cell, a U2OS cell, or an induced pluripotent stem cells (iPSC). A ONE-HDR targeting vector can be introduced into a target cell by any methods as appreciated in the art, including but not limited to, electroporation, viral infection, retrotransposition, microinjection, lipofection, liposome-mediated transfection, calcium phosphate precipitation, DEAE-dextran, and ballistic or “gene gun” penetration. Special chemicals or constructs may be provided to increase recombination levels and therefore promote integration of the insertion cassette. In one embodiment, such a construct may provide a nick (cleavage of one strand of a double- stranded DNA molecule) or cut (cleavage of both strands of a double-stranded DNA molecule) at or near the target sequence of one or more recombination arms of the ONE- HDR targeting vector. Therefore, in one embodiment, the ONE-HDR targeting vector of the invention may be provided in combination with one or more constructs encoding TALENS, Zinc Finger Endonucleases, CRISPR or another method of generating a nick or cut near the target sequence of one or more recombination arm of the ONE-HDR targeting vector. In one embodiment, target cells are prokaryotic cells. In one embodiment, target cells are eukaryotic cells. In one embodiment, a target cell is a mammalian cell, such as a murine or human cell. The target cell may be a somatic cell or a germ cell. The germ cell may be a stem cell, such as embryonic stem cells (ES cells), including murine embryonic stem cells. The target cell may be a non-dividing cell, such as a neuron, or alternatively, the target cell can proliferate in vitro under certain culturing conditions. The target cell may be chosen from commercially available mammalian cell lines. The target cell may be a primary cell isolated from a subject. A target cell may be any type of diseased cell, including cells with abnormal phenotypes that can be identified using biological or biochemical assays. For instance, the diseased cell may be a tumor cell. In one embodiment, a reporter sequence in the insertion cassette of an ONE-HDR targeting vector integrates in-frame downstream from at least one allele of at least one gene in a target cell’s genomic DNA, serving to tag the gene. Cells that have a single gene tagged by insertion of a construct have become singly tagged. Cells that have multiple genes tagged by insertion of a multiple constructs have become multiply tagged. In one embodiment, the invention relates to libraries of singly or multiply tagged cells. Method of using the Cells ONE-HDR targeting vectors may be prepared and used to activate, inactivate or tag any one or a combination of genes in cells or to generate one or more point mutations in the genome of a cell. In one embodiment, the gene or combination of genes are associated with a disease phenotype. In one embodiment, the gene or combination of genes are not associated with a known diseased phenotype. The cells thus modified may be screened for a diseased phenotype in order to identify the gene or genes that may be involved in the development of the phenotype. A ONE-HDR targeting vector with a reporter marker also may be used to tag a gene or combination of genes that is associated with a disease phenotype. When a ONE-HDR targeting vector comprises a eukaryotic cell selection marker sequence or a reporter marker sequence and is inserted into a gene in the genome of a target cell, such that the selection or reporter marker sequence are expressed under a variety of circumstances, then the target cell can be used for drug discovery and functional genomics. The target cell that reports the modulation of the expression of the selection marker or the reporter marker sequence in response to a variety of stimuli, such as hormones and other physiological signals, may be identified. Thus, the gene disrupted in the target cell is involved in responding to the stimuli. These stimuli may relate to a variety of known or unknown pathways that are modulated by known or unknown modulators. Chemicals that modulate the target cell's response to the stimuli also can be identified. In one embodiment, modified cells of the invention can be used to screen for drugs or compounds that regulate (e.g. reduce or increase) the expression of the targeted genes. In one embodiment, the ONE-HDR targeting vector also comprises a reporter marker sequence. A drug or compound library may be applied to the target cell, in which the reporter marker sequence is inserted into an expressed gene, to screen for candidates that may regulate the expression of the reporter marker sequence, and therefore, the expression of the gene. In one embodiment, the cell in which one, two or multiple genes are disrupted or tagged by an insertion cassette from a ONE-HDR targeting vector, may be used to screen for compounds that regulate the expression of one tagged gene but do not regulate expression of another. For example, to identify compounds that regulate the expression of a tagged gene associated with a disease phenotype but not a housekeeping gene or a closely related gene. Therefore, in one embodiment, the present invention can be used to determine the specificity of drug candidates on a chosen target gene. In one embodiment, modified cells of the invention can be used to identify compounds capable of inducing expression of a silent gene in a target cell. For instance, an insertion cassette from a ONE-HDR targeting vector may integrate in a target cell may be incorporated into the genome of the target cell. In such an embodiment, a selection marker encoded by the integration cassette may be operably linked to a promoter sequence and therefore expressed independently of a reporter marker that serves to tag a target gene. Compounds or drugs that are capable of inducing transcription of the non- actively transcribed genomic sequence can therefore be identified by screening for the reporter marker. Libraries Based upon the information provided herein, numerous polynucleotide and cell libraries can be produced. These libraries include, but are not limited to, libraries of (i) ONE-HDR template vectors, (ii) ONE-HDR targeting vectors, (iii) cells with a single tagged gene, (iv) single gene knock-out cells, produced by integration of an insertion cassette into a gene, (v) single gene knock-in cells, produced by integration of an insertion cassette for expression of an exogenous gene into the genome of a cell, (vi) cells with multiple tagged genes, (vii) multi-gene knock-out cells, produced by integration of multiple insertion cassettes into multiple genes and (viii) multi-gene knock- in cells, produced by integration of an insertion cassette for expression of multiple exogenous genes into the genome of a cell. In one embodiment, a ONE-HDR targeting vector library may be constructed using information within a genome database or a gene expression database. For example, each gene in the genome database or the gene expression database may be identified and a ONE-HDR targeting vector directed to the gene may then be prepared. In one embodiment, a ONE-HDR targeting vector library may comprise vectors for tagging genes. In one embodiment, a ONE-HDR targeting vector library may comprise vectors for generation of knock-in cells. In one embodiment, a ONE-HDR targeting vector library may comprise vectors for generation of knock-out cells. The ONE-HDR targeting vectors so prepared compose a vector library, representing the entire set of the genes, or any subset thereof, in the genome database or the gene expression database. A eukaryotic cell selection marker sequence, a reporter marker sequence, or a combination thereof may be included in each ONE-HDR targeting vector. A cell library of the present invention may comprise, for example, at least 2 or more cells. A cell library may contain between 5-10 cells, 10-20 cells, 20-30 cells, 30-40 cells, 40-50 cells, 50-100 cells, 100-500 cells, 500-1,000 cells, 1,000-5,000 cells, 5,000-10,000 cells, 10,000-20,000 cells, 20,000-50,000 cells or more than 50,000 cells. The cell library may represent, for example, anywhere from 1 to 25 tagged, expressed, modified or disrupted genes, at least about 25 different genes, or at least about 50 different genes, preferably at least about 100 different genes, more preferably 1,000 different genes, highly preferably 5,000 different genes, and most preferably 10,000 different genes, such as at least 20,000 different genes. For example, the cell library may represent at least about 40,000, or at least about 75,000, different genes. Each of these represented genes corresponds to a cell in the cell library, and at least one allele of the gene is tagged, expressed, modified or disrupted in the corresponding cell by an insertion cassette, preferentially, more than one allele of the gene is tagged, expressed, modified or disrupted. In one embodiment, the cell library consists of clones of a single parent cell. The number of tagged, expressed, modified or disrupted genes in the cell library may be up to the maximum number of genes present in the genome of the parent cell. A cell library can be essentially a collection of cells, either maintained in individual liquid stocks or grown as a mixed, single liquid stock. A cell library, therefore, may be a collection of cell cultures each of which represents cells containing an allele tagged, modified or disrupted by the inventive methodology. In this regard, a cell library containing alleles tagged, modified or disrupted by a construct of the instant invention, also may comprise cell colonies isolated on growth media in a culture dish. For instance, each colony on the culture dish can comprise a tagged, expressed, modified or disrupted gene that may be the same gene tagged, expressed, modified or disrupted in other colonies that are stored on the same culture dish. In one embodiment, the cell library may comprise a mixture of cell cultures in one liquid stock solution. A cell culture may contain the same or different tagged, expressed, modified or disrupted gene to another cell culture in the library. In one embodiment, therefore, the tagged, expressed, modified or disrupted gene in a given cell in a cell library is different from the tagged, expressed, modified or disrupted gene in any other cell of the library. The cell library of this embodiment may be part of or a subset of another cell library. In one embodiment, a cell library may contain cells each of which contain the same tagged, modified or disrupted gene. In this case, the function of the insertion cassette (e.g. expression of a full length protein vs expression of a protein fragment) may be the same or different for each cell. In one embodiment, a cell library of the present invention may be prepared by introducing a library of ONE-HDR targeting vectors into a plurality of target cells. These ONE-HDR targeting vectors, comprising a eukaryotic cell selection marker sequence, may insert into the genomes of the target cells, tagging, expressing or disrupting different genes in the genomes. The modified cells may be selected for the selectable trait conferred by the eukaryotic cell selection marker sequence. In one embodiment, mouse ES cells, such as early passage mouse ES cells, are used to construct a cell library of the present invention. The cell library thus made becomes a genetic tool for the comprehensive study of the mouse genome. Since ES cells can be injected back into a blastocyst and incorporated into normal development and ultimately the germ line, the mutated ES cells in the library effectively represent collection of mutant transgenic mouse strains. The resulting phenotypes of the mutant transgenic mouse strains, and therefore, the function of the disrupted genes, may be rapidly identified and characterized. The resulting transgenic mice may also be bred with other mouse strains and back crossed to produce congenic or recombinant congenic animals that allow for the evaluation of the targeted gene in different genetic backgrounds. A representative listing various strains and genetic manipulations that can be used to practice the above aspects of the present invention (including the ES cell libraries) can be found in Genetic Variants and Strains of the Laboratory Mouse, 3rd Ed., Vols.1 and 2, Oxford University Press, New York, 1996. A similar methodology can be used to construct virtually any non-human transgenic or knockout animal. These non-human transgenic or knockout animals include pigs, rats, rabbits, cattle, goats, non-human primates such as chimpanzee, and other animal species, particularly mammalian species. Any ONE-HDR targeting vector described in the present invention can be employed to make a cell, a cell library, or a transgenic or knockout animal, as described above. EXPERIMENTAL EXAMPLES The invention is further described in detail by reference to the following experimental examples. These examples are provided for purposes of illustration only, and are not intended to be limiting unless otherwise specified. Thus, the invention should in no way be construed as being limited to the following examples, but rather, should be construed to encompass any and all variations which become evident as a result of the teaching provided herein. Without further description, it is believed that one of ordinary skill in the art can, using the preceding description and the following illustrative examples, make and utilize the present invention and practice the claimed methods. The following working examples therefore are not to be construed as limiting in any way the remainder of the disclosure. Example 1: An Efficient Method for the Fast Generation of Homologous Recombination Vectors For Cell Line Development In this work, a novel single-plasmid system, encapsulating all essential elements for CRISPR mediated homologous recombination, thereby further simplifying the genome editing workflow is unveiled. This system called ONE-HDR embodies an innovative design that allows the rapid assembly of the sgRNA sequence and the right (3’ arm) homology recombination arm as a contiguous construct on the right side of the tagging cassette. In the same reaction, the left (5’ arm) homology arm is introduced as an additional synthetic construct on the opposing side of the tagging cassette. Furthermore, the plasmid backbone is engineered to overexpress the CRISPR protein, thus encompassing all required components within a single plasmid. This design not only expedites the plasmid construction process, but also significantly reduces the variables involved in the gene tagging process, and enhances the efficiency of generating tagged cell lines. In the present invention disclosure, a new system that allows having all the necessary elements for inducing genomic modification in a single plasmid is described. The key aspect of this design is that it facilitates building this plasmid in a single step. The novelty that allows this new plasmid is the way the genetic elements were positioned to incorporate the sgRNA sequence and the right (3’ arm) homology recombination arm as a single construct on the right side of the genetic information to be inserted. Additionally, the left (5’ arm) homology arm is provided as an additional synthetic construct to be inserted on the left side of the genetic information to be inserted. The plasmid backbone also has the sequence to overexpress the CRISPR protein, so all the elements are present in a single plasmid. The new single plasmid vector for CRISPR knock-in insertions was tested by tagging one gene in a human cell line. The endogenous Moesin protein (Gene symbol:MSN) was tagged with a red fluorescent protein and selected a cell line of pure modified cells after the insertion of the tag. Additionally, in this design, it is possible to add CRISPR cutting sites flaking both recombination arms. Thus, it facilitates the damage of the plasmid by CRISPR to limit the duration of the gene-editing process and increase the recombination efficiency by releasing the homology recombination cassette from the plasmid. Utilizing this innovative technology, genes across a spectrum of cell types including HEK293T, HeLa, U2OS, and induced pluripotent stem cells (iPSC) were tagged. Furthermore, multiplexing capabilities, successfully tagging up to three genes within the same cell line, was achieved, amplifying the breadth of its applicability. This system has greater efficiency in small and large animal models to cause the incorporation of new genetic information for protein overexpression. This system offers a more efficient method for knock-in genomic modifications because it uses a single plasmid to promote the insertions in the genome. Every cell receiving a copy of the plasmid will have all the necessary elements for gene editing. A single plasmid system can be delivered without using viral vectors by using nanoparticles. This feature could be advantageous because the use of viruses could cause unwanted side effects. To evaluate the efficacy and efficiency of the novel single-plasmid system, a series of experiments using known cancer cell lines (HeLa, HEK293T, U2OS) as well as induced pluripotent stem cells (iPSCs) for tagging genes of proteins localized in specific subcellular organelles were performed. iPSCs were included due to the known complexity associated with performing gene editing in these cells. These results demonstrate the robustness of the system even in challenging cells such as iPSC, underscoring its potential as a versatile tool for advancing product development for performing functional genomics and drug discovery. In this invention, a homology donor plasmid template (ONE-HDR template vector) engineered to streamline the creation of donor templates (ONE-HDR targeting vectors) for tagging genes with a variety of protein tags such as fluorescent tags, luminescent tags, epitope tags, purification tags, biotinylation tags, degradation tags, among others, at or near the C-terminal region of the encoded protein is presented. This system, encapsulated within a single plasmid, provides all necessary elements for CRISPR-Cas9 mediated gene tagging. The vector comprises three distinct cassettes: (1) a cassette designed to facilitate homologous recombination with a tag at the CRISPR cutting site on the targeted gene, (2) a cassette for expressing a gene-specific single-guide RNA (sgRNA), and (3) a cassette for overexpressing the CRISPR protein in mammalian cells. The homologous recombination cassette is engineered to necessitate the replacement of existing cassettes containing the lethal bacterial gene CcdB during plasmid assembly, thereby allowing for the insertion of gene-specific recombination arms flanking the tag (Figure 1). Moreover, a eukaryotic selection gene, paired with a MALAT sequence, is seamlessly connected to the tag sequence via a P2A peptide sequence, ensuring precise and efficient selection of cells that have integrated the tag at the designated genomic locus. The gene-specific plasmid generation process requires identifying an optimal sgRNA sequence to induce a CRISPR double-strand break at the targeted gene, alongside identifying left and right recombination sequences (arms) around the cutting site. In the empty plasmid backbone, the sgRNA overexpression module is strategically positioned on the right side of the homologous recombination-promoting cassette. This positioning is pivotal for the single-step rapid assembly of a gene-specific targeting plasmid, facilitated by inserting a synthetic construct for the right recombination arm, which also houses a small tRNA promoter and the gene-specific sgRNA sequence, thereby streamlining the plasmid construction process while retaining high fidelity and efficiency in gene tagging operations. Upon identifying the sgRNA and homologous recombination arm sequences, two synthetic DNA fragments are designed and synthesized. One fragment contains the left arm recombination site information, while the other encompasses the right arm recombination site, followed by a tRNA promoter to drive sgRNA expression and the gene-specific sgRNA sequence. To assemble the gene-specific targeting plasmid, the empty vector is digested with BamHI and BpiI to remove the CCDB modules, and the two synthetic arms are inserted using a Gibson recombination procedure (Figure 1). Here, the ONE-HDR vectors, designed to facilitate the tagging of genes with mClover3, mRuby3, mtagBFP2, Nanoluc luciferase, and Halotag, as well as enabling the selection of modified cells with Puromycin, Blasticidin, Zeocin, Hygromycin, and Nourseothricin is introduced (Figure 2). In the ONE-HDR system, the modules containing the tag and the eukaryotic selection gene are effortlessly replaceable through a Gibson assembly reaction. Consequently, this system can be tailored to insert any type of protein tag and any eukaryotic selection gene, showcasing its adaptability for diverse applications. Three additional versions of the ONE-HDR system to cater to diverse gene tagging requirements have been generated. One version is tailored to facilitate gene tagging at the N-terminal site. Another version is designed for tagging genes at the C- terminal end that are not constitutively expressed; this version includes the expression of the eukaryotic selection gene driven by a small constitutive promoter. The third version features the CRISPR protein sequence fused with a fluorescent protein, enabling the visualization and sorting of cells that have received the plasmid post-transfection or electroporation. The cassettes of the ONE-HDR system can be integrated into traditional plasmid backbones to facilitate various gene editing applications. These backbones include, but are not limited to, pUC57, lentiviral plasmids, DNA minicircles, and Nanoplasmids. Each of these backbones offers unique advantages, allowing for flexibility and adaptability in the construction and application of ONE-HDR vectors. The ONE-HDR system finds its applications sprawling across a myriad of fields, paving the way for innovative explorations and interventions at the genomic level. In the realm of functional genomics, the ONE-HDR system serves as a robust tool enabling meticulous tagging and monitoring of endogenous proteins within living cells, thus shedding light on intricate cellular processes and genetic networks. In the field of drug discovery, the tailored tagging facilitated by the ONE- HDR system serves as a tool in the identification and validation of novel drug targets, while empowering high-throughput screening assays with real-time detection of protein expression and dynamics. The ONE-HDR system also significantly expedites the development of gene therapies by providing a streamlined approach for precise genomic modifications, including single point mutations and the generation of gene knockouts. Moreover, its capacity to accommodate multiple tags and antibiotic resistance genes enables multiplexing, allowing for the tagging of multiple genes in a single cell line, thereby broadening the spectrum of its utility in complex studies and the generation of multi- feature cell lines. In the domain of in vivo gene editing of animal models, the ONE-HDR system showcases its versatility by facilitating systemic administration of a single ONE- HDR plasmid. This can be achieved via systemic transfection with nanoparticles or tissue-specific electroporation into various tissues such as the lungs, liver, spleen, kidneys, heart, muscles, testicles, and intra uterine embryos, thereby propelling forward the frontier of in vivo genomic exploration and modifications. A novel set of plasmids and a streamlined methodology that allows the construction of targeting vectors for HDR repair in a single step has been developed. The novel targeting vectors (ONE-HDR targeting vector) allow the insertion of multiple tags for downstream applications such as fluorescent labeling (mClover3 and mRuby3), luminescence (NanoLuc®) and protein purification tags (3x-flag, Halo-tag). Also, these vectors allow in-frame expression of eukaryotic antibiotics (Puromycin, Zeocin™, Blasticidin, etc) for rapid selection of modified cells. The ONE-HDR targeting vector carries all the necessary elements for a functional CRISPR-Cas system including the sgRNAs, a Cas endonuclease, and gRNA scaffold sequences (Figure 1). A backbone plasmid, or template vector (ONE-HDR template vector), was developed to facilitate the creation of ONE-HDR targeting vectors for gene knockin or knockout generation of cell lines and organisms. The system contains multiple characteristics to accelerate the process of vector generation and pure clone cell selection. This includes cloning of the left and right recombination arms, wherein the right recombination arm carries a tRNA promoter driving the expression of a single guide RNA (sgRNA) in a single step with 100% accuracy. This is possible due to the incorporation of dual expression cassettes for the toxic protein CcdB. The two CcdB cassettes must be replaced with the recombination arms in order to obtain viable E. coli colonies (Figure 1 through Figure 3). The backbone can be quickly modified to include any protein marker for protein tagging. As an example, vectors with fluorescent proteins (mClover3, mRuby3), luminicense (NanoLuc®) and purification tags (Halotag and 3X-Flag) have all been generated (Figure 2). The backbone can be quickly modified to include any resistance gene against toxic antibiotics for eukaryotic cells. As an example, vectors with resistance genes against Puromycin, Blasticidin and Zeocin have all been developed (Figure 2). The system allows the selection of pure clones of modified cells in 7-15 days by allowing the expression of the resistance gene only in the cells that were modified by homologous recombination (Figure 4 and Figure 5). The system allows the user to test multiple tags (Fluorescence, Luminescence, tag for protein purification, etc) against the same target gene by designing only 1 set of homologous recombination arms and cloning those in different vectors with each of the tags of interest. The system allows the user to generate homozygous modified cell clones by using the same homologous recombination vector with two different resistance genes against antibiotics for eukaryotic cells. Materials and Methods A protocol for the assembly of a ONE-HDR targeting vector for CRISPR- mediated Homologous Recombination was developed (Figure 1 through Figure 5). 1. Digest 500 ng of the chosen ONE-HDR template vector backbone plasmid with BamHI and BpiI in a final volume of 20 uL. (Thermo Fisher FastDigest enzymes or New England Biolabs CutSmart enzymes are recommended.) 2. Dilute the synthetic left and right recombination arms in TE buffer to a final concentration of 12.5 ng / uL. 3. Perform a Gibson assembly reaction by mixing 2 uL of the digested vector reaction, 1 uL of each recombination arm, 6 uL of molecular biology grade water, and 10 uL of NEBuilder master mix (New England Biolabs). Incubate the mixture at 50 Celsius for 15 minutes. 4. Transform 2 uL of the NEBuilder assembly reaction into a chemically competent E. coli strain sensitive to the CcdB gene (e.g., DH5a, JM109, STBL3). 5. Allow growth overnight at 37 Celsius. 6. The following day, grow 2-3 colonies, extract the plasmids, and validate by sequencing. 7. Select a plasmid with the correct sequence and extract larger quantities of that plasmid for future use for mammalian cell transfection / electroporation. A Protocol for the assembly of a ONE-HDR targeting vector for introducing single point mutations via CRISPR-mediated Homologous Recombination was developed. 1. Digest 500 ng of the ONE-HDR template vector backbone having a fluorescent tagged CRISPR protein with BamHI and BpiI in a final volume of 20 uL. (Thermo Fisher FastDigest enzymes or New England Biolabs CutSmart enzymes are recommended.) 2. Dilute the synthetic recombination construct in TE buffer to a final concentration of 25 ng / uL. 3. Perform a Gibson assembly reaction by mixing 2 uL of the digested vector reaction, 1 uL of the recombination construct, 7 uL of molecular biology grade water, and 10 uL of NEBuilder master mix (New England Biolabs). Incubate the mixture at 50 Celsius for 15 minutes. 4. Transform 2 uL of the NEBuilder assembly reaction into a chemically competent E. coli strain sensitive to the CCDB gene (e.g., DH5a, JM109, STBL3). 5. Allow growth overnight at 37 Celsius. 6. The following day, grow 2-3 colonies, extract the plasmids, and validate by sequencing. A Protocol for the assembly of a ONE-HDR vector for promoting recombinant protein overexpression at the AAV1 locus via CRISPR-mediated Homologous Recombination. 1. Digest 500 ng of the ONE-HDR vector backbone for protein overexpression at the AAV1 locus with XhoI in a final volume of 20 uL. (Thermo Fisher FastDigest enzymes or New England Biolabs CutSmart enzymes are recommended.) 2. Dilute the synthetic recombinant protein gene construct in TE buffer to a final concentration of 25 ng / uL. 3. Perform a Gibson assembly reaction by mixing 2 uL of the digested vector reaction, 1 uL of the recombination construct, 7 uL of molecular biology grade water, and 10 uL of NEBuilder master mix (New England Biolabs). Incubate the mixture at 50 Celsius for 15 minutes. 4. Transform 2 uL of the NEBuilder assembly reaction into a chemically competent E. coli strain sensitive to the CCDB gene (e.g., DH5a, JM109, STBL3). 5. Allow growth overnight at 37 Celsius. 6. The following day, grow 2-3 colonies, extract the plasmids, and validate by sequencing. Results Generation of mammalian cell lines edited with the ONE-HDR system. The following approach was employed to develop multiple mammalian cell lines with tagged endogenous genes, exemplified by the procedure for tagging the MSN protein (Figure 6). Initially, CRISPR cutting sites in the last exon of the MSN gene, near the C-terminal end of the encoded protein were identified. A unique cutting site with a low probability of occurrence in other regions of the human genome was selected. Subsequently, left and right recombination arms (approximately 350-500 bp long) were chosen adjacent to the CRISPR cutting site. The sequences of these arms were incorporated into the respective left and right design templates by replacing the letter "X" (SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7). Additionally, the sgRNA sequence to induce the CRISPR Double Strand Break (DSB) was included in the right arm template by replacing the letter "n." Upon finalizing the design of the recombination arms, they were synthesized as double-stranded synthetic DNA fragments by a commercial provider. Utilizing these arms, a ONE-HDR vector (as indicated above) was assembled to induce a DSB at the last exon of the MSN gene, triggering homologous recombination for an in-frame insertion of a red fluorescent protein (mRuby3) at the C- terminal end of the MSN protein. The constructed ONE-HDR vector targeting MSN was transfected into HEK293T cells, and post 72 hours, the cells were assessed to validate the expression of red fluorescent protein on the cell membrane. Cells were harvested 72 hours post-transfection and re-seeded in culture media containing a selection antibiotic for eukaryotic cells (Blasticidin). Seven days post-transfection, the formation of positive colonies exhibiting red fluorescence was validated by confocal microscopy. Generation of induced Pluripotent Stem Cells (iPSC) edited with the ONE-HDR system: TUBB protein tagged with the fluorescent protein mClover3. The ONE-HDR system was utilized to develop multiple induced Pluripotent Stem Cells lines with tagged endogenous genes (Figure 7 through 9). The procedure for tagging the b-tubulin (TUBB) protein with the fluorescent protein mClover3 serves as an exemplar (Figure 7). A ONE-HDR vector was constructed to tag the b-Tubulin gene at the C- terminal with mClover3, adhering to the previously described procedure for plasmid assembly. The ONE-HDR vector targeting b-Tubulin was introduced into iPSC cells using a Lonza 4D nucleofector device, in alignment with the manufacturer's recommendations. The culture media was replaced daily.120 hours post-electroporation, cells were harvested and counted using an automated cell counter.2 million cells were seeded in a well of a 24-well plate with Puromycin (1-3µM) added to select for colonies of edited cells. The culture media, inclusive of Puromycin, was refreshed daily until no viable cells remained in the control wells with unedited cells. Edited cells were expanded and characterized using confocal microscopy, PCR genotyping, and DNA sequencing. This methodical approach demonstrates the utility and efficiency of the ONE-HDR system in tagging endogenous genes within iPSCs, showcasing its potential for advancing stem cell research and related applications. Generation of induced Pluripotent Stem Cells (iPSC) edited with the ONE-HDR system: HSP90B1 protein tagged with the fluorescent protein mClover3. A ONE-HDR vector was constructed to tag the endogenous HSP90B1 (located in the endoplasmic reticulum) gene at the C-terminal with mClover3 in an iPSC, adhering to the previously described procedure for plasmid assembly (Figure 8). Positive cells were selected with puromycin. Development of an Induced Pluripotent Stem Cell Line with Multiplex Labeling. A ONE-HDR vector was constructed to tag the endogenous HNRNPA2B1 nuclear protein with miRFP670 and endogenous Beta Tubulin (TUBB) tagged with mClover3 in iPSC, adhering to the previously described procedure for plasmid assembly. (Figure 9). Cells were selected using a mixture of puromycin and nourseothricin. Development of a U2OS Cell Line with Triple Multiplex Labeling. A ONE-HDR vector was constructed to tag endogenous HNRNPA2B1 nuclear protein with miRFP670, endogenous EZR protein with mRuby3 and endogenous LC3B protein with mClover3 in a U20S cell line, adhering to the previously described procedure for plasmid assembly (Figure 10). Cells were selected using a mix of Puromycin, Zeocin, and Blasticidin. Generation of mammalian cell lines with single point mutations edited with the ONE-HDR system. A single point mutation in the NPC1 gene of HeLa cell lines, mimicking a mutation found in patients with the lysosomal storage disease Niemann-Pick type C1 (NPC1) disease, was developed (Figure 11). This mutation changes Isoleucine at position 1061 to Threonine. The steps below detail the procedure carried out using the ONE-HDR system to achieve this genetic alteration. Initially, a CRISPR cutting site was identified in an intron close to the exon that encodes the codon to be mutated. This step is crucial for ensuring the accuracy of the gene editing process. After identifying the CRISPR cutting site, left and right recombination arms, each around 400-500 bp long, adjacent to the site were selected. The sequences of these arms were incorporated into the provided template, replacing the placeholder "X” (SEQ ID NO:8). Additionally, the sgRNA sequence needed to cause the CRISPR Double Strand Break (DSB) was included in the template by replacing the placeholder “n.” Once the design was finalized, it was synthesized as double-stranded synthetic DNA fragments by a commercial provider. This construct was then used to create a ONE-HDR vector as shown above, for inducing a DSB at the NPC1 gene, triggering homologous recombination to insert the desired mutation. The assembled ONE-HDR vector targeting NPC1 was transfected into HeLa cells. Twenty-four hours after transfection, fluorescent cells expressing fluorescent tagged CRISPR were individually sorted into 96 well plates using a single cell dispenser. Ten days after sorting, the individual clones were harvested and re-seeded into 24 well plates. Ten percent of the cells from each clone were used for PCR genotyping to identify clones homozygous for the mutation. Clones with the desired mutation were expanded, validated by DNA sequencing, and cryopreserved for future analysis. This approach demonstrated the effectiveness and precision of the ONE- HDR system in creating targeted single point mutations within mammalian cell lines, highlighting its applicability in a broad range of applications in genetic research and therapeutic development. Example 2: DNA Sequences of the present invention. ONE-HDR Vector for C-terminal tagging Underlined: BamHI (nucleotides 1-6 and nucleotides 682-687 of SEQ ID NO:1) XhoI (nucleotides 700-705 and nucleotides 736-741 of SEQ ID NO:1), HindIII (nucleotides 808-813 and nucleotides 827-832 of SEQ ID NO:1), BpiI (nucleotides 1015- 1020 and nucleotides 1409-1414 of SEQ ID NO:1); Italic: CCDB gene (nucleotides 7- 641 and nucleotides 1021-1366 of SEQ ID NO:1); NNNNN: Place for Inserting the labeling tag such as fluorescent protein or purification tags (nucleotides 709-735 of SEQ ID NO:1); lower case italic: P2A peptide sequence (nucleotides 751-807 of SEQ ID NO:1); NNNNN: Eukaryotic Antibiotic Resistance gene (nucleotides 817-826 of SEQ ID NO:1); Bold: mRNA stabilization sequence (nucleotides 836-1008 of SEQ ID NO:1); Dashed underline: gRNA Scaffold sequence (nucleotides 1421-1492 of SEQ ID NO: 1); XXXXX: Mammalian promoter for CRISPR expression (nucleotides 1589-1604 of SEQ ID NO:1); ZZZZZ: sequence encoding CRISPR Cas9 Protein sequence (nucleotides 1605-1633 of SEQ ID NO:1). (SEQ ID NO:1) ggatccGGCTTACTAAAAGCCAGATAACAGTATGCGTATTTGCGCGCTGATTTTTGCG GTATAAGAATATATACTGATATGTATACCCGAAGTATGTCAAAAAGAGGTGTGCTAT GAAGCAGCGTATTACAGTGACAGTTGACAGCGACAGCTATCAGTTGCTCAAGGCAT ATATGATGTCAATATCTCCGGTCTGGTAAGCACAACCATGCAGAATGAAGCCCGTC GTCTGCGTGCCGAACGCTGGAAAGCGGAAAATCAGGAAGGGATGGCTGAGGTCG CCCGGTTTATTGAAATGAACGGCTCTTTTGCTGACGAGAACAGGGACTGGTGAAAT GCAATTCAAGGTTTACACTTACAAACGTGAGTCCCGCTATCGTCTGTTTGTTGATGT GCAAAGTGACATTATTGACACCCCCGGTCGTCGCATGGTCATTCCGCTGGCAAGT GCGCGTCTTTTATCTGACAAGGTTTCGCGTGAGTTGTATCCAGTTGTCCACATCGG AGATGAGAGTTGGCGTATGATGACTACCGATATGGCCAGTGTCCCAGTGTCAGTTA TTGGGGAAGAGGTAGCTGATTTAAGTCATCGTGAAAATGACATTAAGAACGCTATC AACTTAATGTTCTGGGGTATCTGAATGTCAGGCTCCGTTATACACAGCCAGTCT GCAGGTCGACggatccCaaggcggtggaCTCGAGATGNNNNNNNNNNNNNNNNNNNN NNNNNNNCTCGAGggatctggagcaacaaacttctcactactcaaacaagcaggtgacgtggaggagaatccc TTTGGCCTTTCCCTAGCTTTtAAAAAAAAAAAGCAAAAGACGCTGGTGGC TGGCACTCCTGGTTTCCAGGACGGGGTTCAAGTCCCTGCGGTGTCTTTG CTTACCTGGGTCTTCTTTACACTTTATGCTTCCGGCTCGTATGTTGTAAGGAGGTA TGCAGTTTAAGGTTTACACCTATAAAAGAGAGAGCCGTTATCGTCTGTTTGTGGATG TACAGAGTGATATTATTGACACGCCCGGGCGACGGATGGTGATCCCCCTGGCCAG TGCACGTCTGCTGTCAGATAAAGTCTCCCGTGAACTTTACCCGGTGGTGCATATCG GGGATGAAAGCTGGCGCATGATGACCACCGATATGGCCAGTGTGCCGGTCTCCGT TATCGGGGAAGAAGTGGCTGATCTCAGCCACCGCGAAAATGACATCAAAAACGCC ATTAACCTGATGTTCTGGGGAATATAAATGTCAGGCTCCGTTATACACAGCCAGT CTGCAGGTCGACGAGAAGACCTGTTTTAGAGCTAGAAATAGCAAGTTAAAAT AAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCtttttTGTT TTAGAGCTAGgatTAGCAAGTTcgagTAAGGCTcctgaGTTtttagcgcgtgcgccaattctgcaga ZZZ ONE-HDR Vector for C-terminal tagging of silent genes Underlined: BamHI (nucleotides 1-6 and nucleotides 682-687 of SEQ ID NO:2), XhoI (nucleotides 700-705 and nucleotides 719-724 of SEQ ID NO:2), (NheI (nucleotides 847-852 and nucleotides 865-870 of SEQ ID NO:2), HindIII (nucleotides 871-876 and nucleotides 896-901 of SEQ ID NO:2), BpiI (nucleotides 1084-1089 and nucleotides 1478-1483 of SEQ ID NO:2); Italic: CCDB gene (nucleotides 7-635 and nucleotides 1090-1435 of SEQ ID NO:2); NNNNN: Place for Inserting the labeling tag such as fluorescent protein or purification tags (nucleotides 708-718 of SEQ ID NO:2); lower case italic: PolyA Signal (nucleotides 725-846 of SEQ ID NO:2); YYYY=Mammalian Promoter for Eukaryotic Antibiotic Resistance gene (nucleotides 853-864 of SEQ ID NO:2); NNNNN: Eukaryotic Antibiotic Resistance gene (nucleotides 886-895 of SEQ ID NO:2); Bold: mRNA stabilization sequence (nucleotides 905-1077 of SEQ ID NO:2); Dashed underline: gRNA scaffold sequence (nucleotides 1490-1561 of SEQ ID NO:2); XXXXX: Mammalian promoter for CRISPR expression (nucleotides 1658-1673 of SEQ ID NO:2); ZZZZZ: sequence encoding CRISPR Cas9 Protein sequence (nucleotides 1674-1690 of SEQ ID NO:2). (SEQ ID NO:2) ggatccGGCTTACTAAAAGCCAGATAACAGTATGCGTATTTGCGCGCTGATTTTTGCG GTATAAGAATATATACTGATATGTATACCCGAAGTATGTCAAAAAGAGGTGTGCTAT GAAGCAGCGTATTACAGTGACAGTTGACAGCGACAGCTATCAGTTGCTCAAGGCAT ATATGATGTCAATATCTCCGGTCTGGTAAGCACAACCATGCAGAATGAAGCCCGTC GTCTGCGTGCCGAACGCTGGAAAGCGGAAAATCAGGAAGGGATGGCTGAGGTCG CCCGGTTTATTGAAATGAACGGCTCTTTTGCTGACGAGAACAGGGACTGGTGAAAT GCAATTCAAGGTTTACACTTACAAACGTGAGTCCCGCTATCGTCTGTTTGTTGATGT GCAAAGTGACATTATTGACACCCCCGGTCGTCGCATGGTCATTCCGCTGGCAAGT GCGCGTCTTTTATCTGACAAGGTTTCGCGTGAGTTGTATCCAGTTGTCCACATCGG AGATGAGAGTTGGCGTATGATGACTACCGATATGGCCAGTGTCCCAGTGTCAGTTA TTGGGGAAGAGGTAGCTGATTTAAGTCATCGTGAAAATGACATTAAGAACGCTATC AACTTAATGTTCTGGGGTATCTGAATGTCAGGCTCCGTTATACACAGCCAGTCT GCAGGTCGACggatccCaaggcggtggaCTCGAGATGNNNNNNNNNNCTCGAGaacttgtt tattgcagcttataatggttacaaataaagcaatagcatcacaaatttcacaaataaagcatttttttcactgcattctagttgtg gtttgtccaaactcatcaatgtatcttaGCTAGCYYYYYYYYYYYYGCTAGCAAGCTTACCAC CATGNNNNNNNNNNAAGCTTtaaATTCGTCAGTAGGGTTGTAAAGGTTTTTC TTTTCCTGAGAAAACAACCTTTTGTTTTCTCAGGTTTTGCTTTTTGGCCTT TCCCTAGCTTTtAAAAAAAAAAAGCAAAAGACGCTGGTGGCTGGCACTCC TGGTTTCCAGGACGGGGTTCAAGTCCCTGCGGTGTCTTTGCTTACCTGGG TCTTCTTTACACTTTATGCTTCCGGCTCGTATGTTGTAAGGAGGTATGCAGTTTAAG GTTTACACCTATAAAAGAGAGAGCCGTTATCGTCTGTTTGTGGATGTACAGAGTGAT ATTATTGACACGCCCGGGCGACGGATGGTGATCCCCCTGGCCAGTGCACGTCTGC TGTCAGATAAAGTCTCCCGTGAACTTTACCCGGTGGTGCATATCGGGGATGAAAGC TGGCGCATGATGACCACCGATATGGCCAGTGTGCCGGTCTCCGTTATCGGGGAAG AAGTGGCTGATCTCAGCCACCGCGAAAATGACATCAAAAACGCCATTAACCTGATG TTCTGGGGAATATAAATGTCAGGCTCCGTTATACACAGCCAGTCTGCAGGTCGA CGAGAAGACCTGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCC GTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCtttttTGTTTTAGAGCTAGgat TAGCAAGTTcgagTAAGGCTcctgaGTTtttagcgcgtgcgccaattctgcagacaaatggctctagaggtac cXXXXXXXXXXXXXXXXZZZZZZZZZZZZZZZZZ ONE-HDR Vector for N-terminal tagging Underlined: BamHI (nucleotides 1-6 and nucleotides 682-687 of SEQ ID NO:3), HindIII (nucleotides 688-693 and nucleotides 710-715 of SEQ ID NO:3), NheI (nucleotides 716-721 and nucleotides 788-793 of SEQ ID NO:3), XhoI (nucleotides 794- 799 and nucleotides 816-821 of SEQ ID NO:3), BpiI (nucleotides 852-857 and nucleotides 1246-1251 of SEQ ID NO:3); Italic: CCDB gene (nucleotides 7-675 and nucleotides 858-1245 of SEQ ID NO:3); NNNNN: Eukaryotic Antibiotic Resistance gene (nucleotides 700-709 of SEQ ID NO:3); lower case italic: P2A peptide sequence (nucleotides 731-787 of SEQ ID NO:3); NNNNN: Place for Inserting the labeling tag such as fluorescent protein or purification tags (nucleotides 806-815 of SEQ ID NO:3); Bold: flexible linker (nucleotides 822-824 of SEQ ID NO:3); Dashed underline: gRNA scaffold sequence (nucleotides 1258-1329 of SEQ ID NO:3); XXXXX: Mammalian promoter for CRISPR expression (nucleotides 1429-1441 of SEQ ID NO:3); ZZZZZ: sequence encoding CRISPR Cas9 Protein sequence (nucleotides 1442-1458 of SEQ ID NO:3). (SEQ ID NO:3) ggatccGGCTTACTAAAAGCCAGATAACAGTATGCGTATTTGCGCGCTGATTTTTGCG GTATAAGAATATATACTGATATGTATACCCGAAGTATGTCAAAAAGAGGTGTGCTAT GAAGCAGCGTATTACAGTGACAGTTGACAGCGACAGCTATCAGTTGCTCAAGGCAT ATATGATGTCAATATCTCCGGTCTGGTAAGCACAACCATGCAGAATGAAGCCCGTC GTCTGCGTGCCGAACGCTGGAAAGCGGAAAATCAGGAAGGGATGGCTGAGGTCG CCCGGTTTATTGAAATGAACGGCTCTTTTGCTGACGAGAACAGGGACTGGTGAAAT GCAATTCAAGGTTTACACTTACAAACGTGAGTCCCGCTATCGTCTGTTTGTTGATGT GCAAAGTGACATTATTGACACCCCCGGTCGTCGCATGGTCATTCCGCTGGCAAGT GCGCGTCTTTTATCTGACAAGGTTTCGCGTGAGTTGTATCCAGTTGTCCACATCGG AGATGAGAGTTGGCGTATGATGACTACCGATATGGCCAGTGTCCCAGTGTCAGTTA TTGGGGAAGAGGTAGCTGATTTAAGTCATCGTGAAAATGACATTAAGAACGCTATC AACTTAATGTTCTGGGGTATCTGAATGTCAGGCTCCGTTATACACAGCCAGTCTGC AGGTCGACggatccAAGCTTgccaccNNNNNNNNNNAAGCTTGCTAGCggatctggagcaa ACCTGGGTCTTCTTTACACTTTATGCTTCCGGCTCGTATGTTGTAAGGAGGTATGC AGTTTAAGGTTTACACCTATAAAAGAGAGAGCCGTTATCGTCTGTTTGTGGATGTAC AGAGTGATATTATTGACACGCCCGGGCGACGGATGGTGATCCCCCTGGCCAGTGC ACGTCTGCTGTCAGATAAAGTCTCCCGTGAACTTTACCCGGTGGTGCATATCGGGG ATGAAAGCTGGCGCATGATGACCACCGATATGGCCAGTGTGCCGGTCTCCGTTAT CGGGGAAGAAGTGGCTGATCTCAGCCACCGCGAAAATGACATCAAAAACGCCATT AACCTGATGTTCTGGGGAATATAAATGTCAGGCTCCGTTATACACAGCCAGTCTGC AGGTCGACGAGAAGACCTGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGG CTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCtttttTGTTTTAGA GCTAGgatTAGCAAGTTcgagTAAGGCTcctgaGTTtttagcgcgtgcgccaattctgcagacaaatggc tctagaggtaccXXXXXXXXXXXXXXXXZZZZZZZZZZZZZZZZZ Template sequences for the design of the left recombination arm for the assembly of a ONE-HDR vector for CRISPR-mediated Homologous Recombination. X: sequence of the left arm recombination site. (SEQ ID NO:4) tgctggccttttgctcaggatccXXXXXXXXXXXXXXggatcccaaggcggtggactcga Template sequences for the design of the right recombination arm for the assembly of a ONE-HDR vector for CRISPR-mediated Homologous Recombination. X: sequence of the right arm recombination site; n: 20 nucleotides of the gene-specific sgRNA sequence. (SEQ ID NO:5) cctgcggtgtctttgcttXXXXXXXXXXXXXXXcatgtggttccatggtgtaatggttagcactctggactctgaatcc agcgatccgagttcaaatctcggtggaacctnnnnnnnnnnnnnnnnnnnngttttagagctagaaatagcaa Alternative template sequences for the design of the left recombination arm for the assembly of a ONE-HDR vector for CRISPR-mediated Homologous Recombination with DSB site y: 23 nucleotides of gene-specific CRISPR DSB sequence; X: sequence of the left arm recombination site. (SEQ ID NO:6) tgctggccttttgctcaggatccyyyyyyyyyyyyyyyyyyyyyyyXXXXXXXXXXXXXXggatccCaagg cggtggaCTCGA Alternative template sequences for the design of the right recombination arm for the assembly of a ONE-HDR vector for CRISPR-mediated Homologous Recombination with DSB site X: sequence of the right arm recombination site; y: 23 nucleotides of gene- specific CRISPR DSB sequence; n: 20 nucleotides of gene-specific sgRNA. (SEQ ID NO:7) CCTGCGGTGTCTTTGCTTXXXXXXXXXXXXXXXyyyyyyyyyyyyyyyyyyyyyyycatg tGGTTCCATGGTGTAATGGTTAGCACTCTGGACTCTGAATCCAGCGATCCGAG TTCAAATCTCGGTGGAACCTnnnnnnnnnnnnnnnnnnnnGTTTTAGAGCTAGAAATA GCAA Template sequence for introducing single point mutations at genomic sites with the ONE-HDR system. X: sequence designed to promote homologous recombination at the CRISPR DSB site (this sequence contains the desired single point mutation along with an additional nucleotide mutation to obliterate the CRISPR PAM recognition site within the construct, preventing CRISPR DSB of the donor recombination vector); n: 20 nucleotides of gene-specific sgRNA. (SEQ ID NO:8) TgctggccttttgctcaggatccXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXcatgtGGTTCCATGGTGTAATGGTTAGCACTCTGGACTCTGAATCCAG CGATCCGAGTTCAAATCTCGGTGGAACCTnnnnnnnnnnnnnnnnnnnnGTTTTAGAG CTAGAAATAGCAA DNA Sequence of the tRNA promoter (SEQ ID NO:9) catgtGGTTCCATGGTGTAATGGTTAGCACTCTGGACTCTGAATCCAGCGATCCG AGTTCAAATCTCGGTGGAACCT DNA Sequence of the promoter for inducing CRISPR expression (SEQ ID NO:10) GGCATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTT CATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCC TGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTT CCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTT ACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTCCG CCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGT ACATGACCTTACGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATC GCTATTACCATGGTGATGCGGTTTTGGCAGTACACCAATGGGCGTGGATAGC GGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGT TTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAATAACCCCGC CCCGTTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGC AGAGGTCGTTTAGTGAACCGTCAGATCACTAGTAGCTTTATTGCGGTAGTTTA TCACAGTTAAATTGCTAACGCAGTCAGTGCTCGACTGATCACAGGTAAGTAT CAAGGTTACAAGACAGGTTTAAGGAGGCCAATAGAAACTGGGCTTGTCGAGA CAGAGAAGATTCTTGCGTTTCTGATAGGCACCTATTGGTCTTACTGACATCCA CTTTGCCTTTCTCTCCACAGaccggtgccacc DNA Sequence of the CRISPR / espCas9(1.1) (SEQ ID NO:11) ATGCCAAAGAAGAAGCGGAAGGTCGGTATCCACGGAGTCCCAGCAGCCGAC AAGAAGTACAGCATCGGCCTGGACATCGGCACCAACTCTGTGGGCTGGGCCG TGATCACCGACGAGTACAAGGTGCCCAGCAAGAAATTCAAGGTGCTGGGCAA CACCGACCGGCACAGCATCAAGAAGAACCTGATCGGAGCCCTGCTGTTCGAC AGCGGCGAAACAGCCGAGGCCACCCGGCTGAAGAGAACCGCCAGAAGAAGA TACACCAGACGGAAGAACCGGATCTGCTATCTGCAAGAGATCTTCAGCAACG AGATGGCCAAGGTGGACGACAGCTTCTTCCACAGACTGGAAGAGTCCTTCCT GGTGGAAGAGGATAAGAAGCACGAGCGGCACCCCATCTTCGGCAACATCGT GGACGAGGTGGCCTACCACGAGAAGTACCCCACCATCTACCACCTGAGAAAG AAACTGGTGGACAGCACCGACAAGGCCGACCTGCGGCTGATCTATCTGGCCC TGGCCCACATGATCAAGTTCCGGGGCCACTTCCTGATCGAGGGCGACCTGAA CCCCGACAACAGCGACGTGGACAAGCTGTTCATCCAGCTGGTGCAGACCTAC AACCAGCTGTTCGAGGAAAACCCCATCAACGCCAGCGGCGTGGACGCCAAG GCCATCCTGTCTGCCAGACTGAGCAAGAGCAGACGGCTGGAAAATCTGATCG CCCAGCTGCCCGGCGAGAAGAAGAATGGCCTGTTCGGAAACCTGATTGCCCT GAGCCTGGGCCTGACCCCCAACTTCAAGAGCAACTTCGACCTGGCCGAGGAT GCCAAACTGCAGCTGAGCAAGGACACCTACGACGACGACCTGGACAACCTG CTGGCCCAGATCGGCGACCAGTACGCCGACCTGTTTCTGGCCGCCAAGAACC TGTCCGACGCCATCCTGCTGAGCGACATCCTGAGAGTGAACACCGAGATCAC CAAGGCCCCCCTGAGCGCCTCTATGATCAAGAGATACGACGAGCACCACCAG GACCTGACCCTGCTGAAAGCTCTCGTGCGGCAGCAGCTGCCTGAGAAGTACA AAGAGATTTTCTTCGACCAGAGCAAGAACGGCTACGCCGGCTACATTGACGG CGGAGCCAGCCAGGAAGAGTTCTACAAGTTCATCAAGCCCATCCTGGAAAAG ATGGACGGCACCGAGGAACTGCTCGTGAAGCTGAACAGAGAGGACCTGCTG CGGAAGCAGCGGACCTTCGACAACGGCAGCATCCCCCACCAGATCCACCTGG GAGAGCTGCACGCCATTCTGCGGCGGCAGGAAGATTTTTACCCATTCCTGAA GGACAACCGGGAAAAGATCGAGAAGATCCTGACCTTCCGCATCCCCTACTAC GTGGGCCCTCTGGCCAGGGGAAACAGCAGATTCGCCTGGATGACCAGAAAG AGCGAGGAAACCATCACCCCCTGGAACTTCGAGGAAGTGGTGGACAAGGGC GCTTCCGCCCAGAGCTTCATCGAGCGGATGACCAACTTCGATAAGAACCTGC CCAACGAGAAGGTGCTGCCCAAGCACAGCCTGCTGTACGAGTACTTCACCGT GTATAACGAGCTGACCAAAGTGAAATACGTGACCGAGGGAATGAGAAAGCC CGCCTTCCTGAGCGGCGAGCAGAAAAAGGCCATCGTGGACCTGCTGTTCAAG ACCAACCGGAAAGTGACCGTGAAGCAGCTGAAAGAGGACTACTTCAAGAAA ATCGAGTGCTTCGACTCCGTGGAAATCTCCGGCGTGGAAGATCGGTTCAACG CCTCCCTGGGCACATACCACGATCTGCTGAAAATTATCAAGGACAAGGACTT CCTGGACAATGAGGAAAACGAGGACATTCTGGAAGATATCGTGCTGACCCTG ACACTGTTTGAGGACAGAGAGATGATCGAGGAACGGCTGAAAACCTATGCCC ACCTGTTCGACGACAAAGTGATGAAGCAGCTGAAGCGGCGGAGATACACCG GCTGGGGCAGGCTGAGCCGGAAGCTGATCAACGGCATCCGGGACAAGCAGT CCGGCAAGACAATCCTGGATTTCCTGAAGTCCGACGGCTTCGCCAACAGAAA CTTCATGCAGCTGATCCACGACGACAGCCTGACCTTTAAAGAGGACATCCAG AAAGCCCAGGTGTCCGGCCAGGGCGATAGCCTGCACGAGCACATTGCCAATC TGGCCGGCAGCCCCGCCATTAAGAAGGGCATCCTGCAGACAGTGAAGGTGGT GGACGAGCTCGTGAAAGTGATGGGCCGGCACAAGCCCGAGAACATCGTGAT CGAAATGGCCAGAGAGAACCAGACCACCCAGAAGGGACAGAAGAACAGCCG CGAGAGAATGAAGCGGATCGAAGAGGGCATCAAAGAGCTGGGCAGCCAGAT CCTGAAAGAACACCCCGTGGAAAACACCCAGCTGCAGAACGAGAAGCTGTA CCTGTACTACCTGCAGAATGGGCGGGATATGTACGTGGACCAGGAACTGGAC ATCAACCGGCTGTCCGACTACGATGTGGACCATATCGTGCCTCAGAGCTTTCT GGCGGACGACTCCATCGACAACAAGGTGCTGACCAGAAGCGACAAGAACCG GGGCAAGAGCGACAACGTGCCCTCCGAAGAGGTCGTGAAGAAGATGAAGAA CTACTGGCGGCAGCTGCTGAACGCCAAGCTGATTACCCAGAGAAAGTTCGAC AATCTGACCAAGGCCGAGAGAGGCGGCCTGAGCGAACTGGATAAGGCCGGC TTCATCAAGAGACAGCTGGTGGAAACCCGGCAGATCACAAAGCACGTGGCA CAGATCCTGGACTCCCGGATGAACACTAAGTACGACGAGAATGACAAGCTGA TCCGGGAAGTGAAAGTGATCACCCTGAAGTCCAAGCTGGTGTCCGATTTCCG GAAGGATTTCCAGTTTTACAAAGTGCGCGAGATCAACAACTACCACCACGCC CACGACGCCTACCTGAACGCCGTCGTGGGAACCGCCCTGATCAAAAAGTACC CTGCGCTGGAAAGCGAGTTCGTGTACGGCGACTACAAGGTGTACGACGTGCG GAAGATGATCGCCAAGAGCGAGCAGGAAATCGGCAAGGCTACCGCCAAGTA CTTCTTCTACAGCAACATCATGAACTTTTTCAAGACCGAGATTACCCTGGCCA ACGGCGAGATCCGGAAGGCGCCTCTGATCGAGACAAACGGCGAAACCGGGG AGATCGTGTGGGATAAGGGCCGGGATTTTGCCACCGTGCGGAAAGTGCTGAG CATGCCCCAAGTGAATATCGTGAAAAAGACCGAGGTGCAGACAGGCGGCTTC AGCAAAGAGTCTATCCTGCCCAAGAGGAACAGCGATAAGCTGATCGCCAGA AAGAAGGACTGGGACCCTAAGAAGTACGGCGGCTTCGACAGCCCCACCGTG GCCTATTCTGTGCTGGTGGTGGCCAAAGTGGAAAAGGGCAAGTCCAAGAAAC TGAAGAGTGTGAAAGAGCTGCTGGGGATCACCATCATGGAAAGAAGCAGCTT CGAGAAGAATCCCATCGACTTTCTGGAAGCCAAGGGCTACAAAGAAGTGAA AAAGGACCTGATCATCAAGCTGCCTAAGTACTCCCTGTTCGAGCTGGAAAAC GGCCGGAAGAGAATGCTGGCCTCTGCCGGCGAACTGCAGAAGGGAAACGAA CTGGCCCTGCCCTCCAAATATGTGAACTTCCTGTACCTGGCCAGCCACTATGA GAAGCTGAAGGGCTCCCCCGAGGATAATGAGCAGAAACAGCTGTTTGTGGAA CAGCACAAGCACTACCTGGACGAGATCATCGAGCAGATCAGCGAGTTCTCCA AGAGAGTGATCCTGGCCGACGCTAATCTGGACAAAGTGCTGTCCGCCTACAA CAAGCACCGGGATAAGCCCATCAGAGAGCAGGCCGAGAATATCATCCACCT GTTTACCCTGACCAATCTGGGAGCCCCTGCCGCCTTCAAGTACTTTGACACCA CCATCGACCGGAAGAGGTACACCAGCACCAAAGAGGTGCTGGACGCCACCC TGATCCACCAGAGCATCACCGGCCTGTACGAGACACGGATCGACCTGTCTCA GCTGGGAGGCGACAAAAGGCCGGCGGCCACGAAAAAGGCCGGCCAGGCAAA AAAGAAAAAGTAA DNA sequence structure of a ONE-HDR Target Vector for Protein Overexpression Underlined: XbaI (nucleotides 11-16 and nucleotides 27-32 of SEQ ID NO:12), XhoI (nucleotides 33-38 and nucleotides 714-719 of SEQ ID NO:12), HindIII (nucleotides 786-791 and nucleotides 803-808 of SEQ ID NO:12), AscI (nucleotides 983- 989 of SEQ ID NO:12); LLL: Left (5’) Recombination Arm (nucleotides 1-10 of SEQ ID NO:12); NNN: mammalian promoter for recombinant protein (nucleotides 17-26 of SEQ ID NO:12); Uppercase italics: CCDB gene (nucleotides 39-713 of SEQ ID NO:12); Lowercase: P2A peptide sequence (nucleotides 720-785 of SEQ ID NO:12); NNNNN: Eukaryotic Antibiotic Resistance gene (nucleotides 792-802 of SEQ ID NO:12); Bold: mRNA stabilization sequence (nucleotides 809-982 of SEQ ID NO:12); RRR: Right (3’) Recombination Arm (nucleotides 991-1000 of SEQ ID NO:12); XXX: tRNA promoter (nucleotides 1001-1010 of SEQ ID NO:12); MMM: sgRNA sequence (20bp) (nucleotides 1011-1030 of SEQ ID NO:12); Dashed underline: gRNA Scaffold (nucleotides 1031- 1106 of SEQ ID NO:12); YYY: Mammalian Promoter for CRISPR expression (nucleotides 1203-1212 of SEQ ID NO;12); ZZZ: sequence encoding CRISPR Cas9 Protein Sequence (nucleotides 1213-1241 of SEQ ID NO:12). (SEQ ID NO:12) LLLLLLLLLLTCTAGANNNNNNNNNNTCTAGACTCGAGGGCTTACTAAAAGCCA GATAACAGTATGCGTATTTGCGCGCTGATTTTTGCGGTATAAGAATATATACTGATA TGTATACCCGAAGTATGTCAAAAAGAGGTGTGCTATGAAGCAGCGTATTACAGTGA CAGTTGACAGCGACAGCTATCAGTTGCTCAAGGCATATATGATGTCAATATCTCCG GTCTGGTAAGCACAACCATGCAGAATGAAGCCCGTCGTCTGCGTGCCGAACGCTG GAAAGCGGAAAATCAGGAAGGGATGGCTGAGGTCGCCCGGTTTATTGAAATGAAC GGCTCTTTTGCTGACGAGAACAGGGACTGGTGAAATGCAGTTTAAGGTTTACACCT ATAAAAGAGAGAGCCGTTATCGTCTGTTTGTGGATGTACAGAGTGATATTATTGACA CGCCCGGGCGACGGATGGTGATCCCCCTGGCCAGTGCACGTCTGCTGTCAGATA AAGTCTCCCGTGAACTTTACCCGGTGGTGCATATCGGGGATGAAAGCTGGCGCAT GATGACCACCGATATGGCCAGTGTGCCGGTCTCCGTTATCGGGGAAGAAGTGGCT GATCTCAGCCACCGCGAAAATGACATCAAAAACGCCATTAACCTGATGTTCTGGGG AATATAAATGTCAGGCTCCGTTATACACAGCCAGTCTGCAGGTCGACCTCGAGggat ctggagcaacaaacttctcactactcaaacaagcaggtgacgtggaggagaatcccgggcctAAGCTTNNNNNNN NNNNAAGCTTATTCGTCAGTAGGGTTGTAAAGGTTTTTCTTTTCCTGAGA AAACAACCTTTTGTTTTCTCAGGTTTTGCTTTTTGGCCTTTCCCTAGCTTT tAAAAAAAAAAaAGCAAAAGACGCTGGTGGCTGGCACTCCTGGTTTCCAG GACGGGGTTCAAGTCCCTGCGGTGTCTTTGCTTGGCGCGCCRRRRRRRRRR XXXXXXXXXXMMMMMMMMMMMMMMMMMMMMGTTTTAGAGCTAGAAA TAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGA GTCGGTGCtttttTGTTTTAGAGCTAGgatTAGCAAGTTcgagTAAGGCTcctgaGTTttta gcgcgtgcgccaattctgcagacaaatggctctagaggtaccYYYYYYYYYYZZZZZZZZZZZZZZZZZ ZZZZZZZZZZZZ DNA sequence structure of a ONE-HDR Target Vector for Protein Overexpression at the human AAV1 Locus Underlined XbaI (nucleotides 418-423 and nucleotides 648-653 of SEQ ID NO:13), XhoI (nucleotides 654-659 and nucleotides 1335-1340), HindIII (nucleotides 1407-1412 and nucleotides 1424-1429), AscI (nucleotides 1604-1611); Double underline: Left (5’) Recombination Arm for the AAV1 locus (nucleotides 1-417 of SEQ ID NO:13); Lowercase: Mammalian EF1a core promoter for recombinant protein overexpression (nucleotides 424-647 of SEQ ID NO:12); Uppercase italics: CCDB gene (nucleotides 660-1334 of SEQ ID NO:12); Lowercase underlined: P2A peptide sequence (nucleotides 1341-1406 of SEQ ID NO:13); NNNNN: Eukaryotic Antibiotic Resistance gene (nucleotides 1413-1423 of SEQ ID NO:13); Bold: mRNA stabilization sequence (nucleotides 1430-1603 of SEQ ID NO:13); Bold double underlined: Right (3’) Recombination Arm for the AAV1 locus (nucleotides 1612-1932 of SEQ ID NO:13); Dot underline: tRNA promoter sequence (nucleotides 1933-2009 of SEQ ID NO:13); Lowercase italics: sgRNA sequence for AAV1 site (20bp) (nucleotides 2010-2029 of SEQ ID NO:13); Dashed underline: gRNA Scaffold (nucleotides 2030-2105 of SEQ ID NO:13); YYY: Mammalian Promoter for CRISPR expression (nucleotides 2202-2211 of SEQ ID NO:13); ZZZ: sequence encoding CRISPR Cas9 Protein Sequence (nucleotides 2212-2240 of SEQ ID NO:13). (SEQ ID NO:13) TTCTGGGGCCTGTGCCATCTCTCGTTTCTTAGGATGGCCTTCTCCGACGGATG TCTCCCTTGCGTCCCGCCTCCCCTTCTTGTAGGCCTGCATCATCACCGTTTTTC TGGACAACCCCAAAGTACCCCGTCTCCCTGGCTTTAGCCACCTCTCCATCCTC TTGCTTTCTTTGCCTGGACACCCCGTTCTCCTGTGGATTCGGGTCACCTCTCAC TCCTTTCATTTGGGCAGCTCCCCTACCCCCCTTACCTCTCTAGTCTGTGCTAGC TCTTCCAGCCCCCTGTCATGGCATCTTCCAGGGGTCCGAGAGCTCAGCTAGTC TTCTTCCTCCAACCCGGGCCCCTATGTCCACTTCAGGACAGCATGTTTGCTGC CTCCAGGGATCCTGTGTCCCCGAGCTGGGACCACCTTATATTCTCTAGAgggcag agcgcacatcgcccacagtccccgagaagttggggggaggggtcggcaattgatccggtgcctagagaaggtggcgcggg gtaaactgggaaagtgatgtcgtgtactggctccgcctttttcccgagggtgggggagaaccgtatataagtgcagtagtcgccg tgaacgttctttttcgcaacgggtttgccgccagaacacaggaccggtactagTCTAGACTCGAGGGCTTACTA AAAGCCAGATAACAGTATGCGTATTTGCGCGCTGATTTTTGCGGTATAAGAATATAT ACTGATATGTATACCCGAAGTATGTCAAAAAGAGGTGTGCTATGAAGCAGCGTATT ACAGTGACAGTTGACAGCGACAGCTATCAGTTGCTCAAGGCATATATGATGTCAAT ATCTCCGGTCTGGTAAGCACAACCATGCAGAATGAAGCCCGTCGTCTGCGTGCCG AACGCTGGAAAGCGGAAAATCAGGAAGGGATGGCTGAGGTCGCCCGGTTTATTGA AATGAACGGCTCTTTTGCTGACGAGAACAGGGACTGGTGAAATGCAGTTTAAGGTT TACACCTATAAAAGAGAGAGCCGTTATCGTCTGTTTGTGGATGTACAGAGTGATATT ATTGACACGCCCGGGCGACGGATGGTGATCCCCCTGGCCAGTGCACGTCTGCTG TCAGATAAAGTCTCCCGTGAACTTTACCCGGTGGTGCATATCGGGGATGAAAGCTG GCGCATGATGACCACCGATATGGCCAGTGTGCCGGTCTCCGTTATCGGGGAAGAA GTGGCTGATCTCAGCCACCGCGAAAATGACATCAAAAACGCCATTAACCTGATGTT CTGGGGAATATAAATGTCAGGCTCCGTTATACACAGCCAGTCTGCAGGTCGA CCTCGAGggatctggagcaacaaacttctcactactcaaacaagcaggtgacgtggaggagaatcccgggcctAAG CTTNNNNNNNNNNNAAGCTTATTCGTCAGTAGGGTTGTAAAGGTTTTTCTT TTCCTGAGAAAACAACCTTTTGTTTTCTCAGGTTTTGCTTTTTGGCCTTTC CCTAGCTTTtAAAAAAAAAAaAGCAAAAGACGCTGGTGGCTGGCACTCCT GGTTTCCAGGACGGGGTTCAAGTCCCTGCGGTGTCTTTGCTTGGCGCGCC CCAGGGCCGGTTAATGTGGCTCTGGTTCTGGGTACTTTTATCTGTCCCCT CCACCCCACAGTGGGGCCACTAGGGACAGGATTGGTGACAGAAAAGCCC CATCCTTAGGCCTCCTCCTTCCTAGTCTCCTGATATTGGGTCTAACCCCC ACCTCCTGTTAGGCAGATTCCTTATCTGGTGACACACCCCCATTTCCTGG AGCCATCTCTCTCCTTGCCAGAACCTCTAAGGTTTGCTTACGATGGAGCC AGAGAGGATCCTGGGAGGGAGAGCTTGGCAGGGGGTGGGAGGGAAGGG GGGGATGCGTGACCTGCCCGGTTCcatgtGGTTCCATGGTGTAATGGTTAGCA CTCTGGACTCTGAATCCAGCGATCCGAGTTCAAATCTCGGTGGAACCTgggacca ccttatattcccaGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTA TCAACTTGAAAAAGTGGCACCGAGTCGGTGCtttttTGTTTTAGAGCTAGgatTAG CAAGTTcgagTAAGGCTcctgaGTTtttagcgcgtgcgccaattctgcagacaaatggctctagaggtaccYY YYYYYYYYZZZZZZZZZZZZZZZZZZZZZZZZZZZZZ Template for cloning a sequence of a recombinant protein into a ONE- HDR target vector for protein overexpression at the AAV1 locus. In this template, the placeholder "X" represents the sequence of a recombinant protein containing a ribosomal binding site (Kozak), the initiation codon ATG and without a stop codon. (SEQ ID NO:14) aggaccggtactagTCTAGACTCGAGXXXXXXXXXXXCTCGAGggatctggagcaacaaactt CCDB Gene sequence (SEQ ID NO:15) GGCTTACTAAAAGCCAGATAACAGTATGCGTATTTGCGCGCTGATTTTTGCGG TATAAGAATATATACTGATATGTATACCCGAAGTATGTCAAAAAGAGGTGTG CTATGAAGCAGCGTATTACAGTGACAGTTGACAGCGACAGCTATCAGTTGCT CAAGGCATATATGATGTCAATATCTCCGGTCTGGTAAGCACAACCATGCAGA ATGAAGCCCGTCGTCTGCGTGCCGAACGCTGGAAAGCGGAAAATCAGGAAG GGATGGCTGAGGTCGCCCGGTTTATTGAAATGAACGGCTCTTTTGCTGACGA GAACAGGGACTGGTGAAATGCAATTCAAGGTTTACACTTACAAACGTGAGTC CCGCTATCGTCTGTTTGTTGATGTGCAAAGTGACATTATTGACACCCCCGGTC GTCGCATGGTCATTCCGCTGGCAAGTGCGCGTCTTTTATCTGACAAGGTTTCG CGTGAGTTGTATCCAGTTGTCCACATCGGAGATGAGAGTTGGCGTATGATGA CTACCGATATGGCCAGTGTCCCAGTGTCAGTTATTGGGGAAGAGGTAGCTGA TTTAAGTCATCGTGAAAATGACATTAAGAACGCTATCAACTTAATGTTCTGGG GTATCTGATTTACACTTTATGCTTCCGGCTCGTATGTTGTAAGGAGGTATGCA GTTTAAGGTTTACACCTATAAAAGAGAGAGCCGTTATCGTCTGTTTGTGGATG TACAGAGTGATATTATTGACACGCCCGGGCGACGGATGGTGATCCCCCTGGC CAGTGCACGTCTGCTGTCAGATAAAGTCTCCCGTGAACTTTACCCGGTGGTGC ATATCGGGGATGAAAGCTGGCGCATGATGACCACCGATATGGCCAGTGTGCC GGTCTCCGTTATCGGGGAAGAAGTGGCTGATCTCAGCCACCGCGAAAATGAC ATCAAAAACGCCATTAACCTGATGTTCTGGGGAATATAA mRNA stabilization sequence (SEQ ID NO:16) ATTCGTCAGTAGGGTTGTAAAGGTTTTTCTTTTCCTGAGAAAACAACCTTTTG TTTTCTCAGGTTTTGCTTTTTGGCCTTTCCCTAGCTTTtAAAAAAAAAAAGCAA AAGACGCTGGTGGCTGGCACTCCTGGTTTCCAGGACGGGGTTCAAGTCCCTG CGGTGTCTTTGCTT gRNA scaffold sequence (SEQ ID NO:17) TAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAA AAGTGGCACCGAGTCGGTGC P2A peptide sequence (SEQ ID NO:18) gcaacaaacttctcactactcaaacaagcaggtgacgtggaggagaatcccgggcct sgRNA sequence for AAV1 (SEQ ID NO:19) gggaccaccttatattccca Mammalian EF1a core promoter (SEQ ID NO:20) Gggcagagcgcacatcgcccacagtccccgagaagttggggggaggggtcggcaattgatccggtgcctagagaaggtgg cgcggggtaaactgggaaagtgatgtcgtgtactggctccgcctttttcccgagggtgggggagaaccgtatataagtgcagta gtcgccgtgaacgttctttttcgcaacgggtttgccgccagaacacaggaccggtactag Left (5’) Recombination Arm for the AAV1 locus (SEQ ID NO: 21) TTCTGGGGCCTGTGCCATCTCTCGTTTCTTAGGATGGCCTTCTCCGACGGATG TCTCCCTTGCGTCCCGCCTCCCCTTCTTGTAGGCCTGCATCATCACCGTTTTTC TGGACAACCCCAAAGTACCCCGTCTCCCTGGCTTTAGCCACCTCTCCATCCTC TTGCTTTCTTTGCCTGGACACCCCGTTCTCCTGTGGATTCGGGTCACCTCTCAC TCCTTTCATTTGGGCAGCTCCCCTACCCCCCTTACCTCTCTAGTCTGTGCTAGC TCTTCCAGCCCCCTGTCATGGCATCTTCCAGGGGTCCGAGAGCTCAGCTAGTC TTCTTCCTCCAACCCGGGCCCCTATGTCCACTTCAGGACAGCATGTTTGCTGC CTCCAGGGATCCTGTGTCCCCGAGCTGGGACCACCTTATATTC Right (3’) Recombination Arm for the AAV1 locus (SEQ ID NO:22) CCAGGGCCGGTTAATGTGGCTCTGGTTCTGGGTACTTTTATCTGTCCCCTCCA CCCCACAGTGGGGCCACTAGGGACAGGATTGGTGACAGAAAAGCCCCATCCT TAGGCCTCCTCCTTCCTAGTCTCCTGATATTGGGTCTAACCCCCACCTCCTGTT AGGCAGATTCCTTATCTGGTGACACACCCCCATTTCCTGGAGCCATCTCTCTC CTTGCCAGAACCTCTAAGGTTTGCTTACGATGGAGCCAGAGAGGATCCTGGG AGGGAGAGCTTGGCAGGGGGTGGGAGGGAAGGGGGGGATGCGTGACCTGCC CGGTTC The disclosures of each and every patent, patent application, and publication cited herein are hereby incorporated herein by reference in their entirety. While this invention has been disclosed with reference to specific embodiments, it is apparent that other embodiments and variations of this invention may be devised by others skilled in the art without departing from the true spirit and scope of the invention. The appended claims are intended to be construed to include all such embodiments and equivalent variations.

Claims

CLAIMS What is claimed is:

1. A homology directed repair (HDR) template vector (ONE-HDR template vector) comprising a nucleic acid molecule, wherein the nucleic acid molecule comprises one or more nucleotide sequences encoding a bacterial negative selection marker, a nucleotide sequence comprising an insertion cassette, wherein the insertion cassette comprises a nucleic acid sequence to be inserted into the genome of a cell, a nucleotide sequence encoding a guide RNA (gRNA) scaffold sequence, and a nucleotide sequence encoding a Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR)-associated (cas) endonuclease operably linked to a mammalian promoter sequence.

2. The ONE-HDR template vector of claim 1, wherein the insertion cassette comprises one or more nucleotide sequences selected from the group consisting of a nucleotide sequence encoding a eukaryotic cell selection marker sequence, a nucleotide sequence encoding protein purification tag, a nucleotide sequence encoding a reporter marker sequence, an exogenous gene sequence, a promoter sequence, a nucleotide sequence encoding a P2A linker sequence, a termination sequence, a nucleotide sequence encoding a messenger RNA (mRNA) stabilization sequence, or a combination thereof.

3. The ONE-HDR template vector of claim 2, wherein the protein purification tag is selected from the group consisting of chitin binding protein (CBP), maltose binding protein (MBP), glutathione-S-transferase (GST), poly(His), biotin / streptavidin, V5-tag, Myc-tag, HA-tag, NE-tag, His-tag, Flag tag, Halo-tag, Snap- tag, Fc-tag, Nus-tag, BCCP, Thioredoxin, SnooprTag, SpyTag, Isopeptag, SBP-tag, S- tag, AviTag, Calmodulin.

4. The ONE-HDR template vector of claim 2, wherein the reporter marker is selected from the group consisting of chloramphenicol-acetyl transferase (CAT), β-galactosyltransferase, horseradish peroxidase, luciferase, NanoLuc®, alkaline phosphatase, and a fluorescent protein.

5. The ONE-HDR template vector of claim 4, wherein the fluorescent protein is selected from the group consisting of Green Fluorescent Protein (GFP), Red Fluorescent Protein (RFP), mCherry, mRuby3, mtagBFP2 and mClover3.

6. The ONE-HDR template vector of claim 2, wherein the eukaryotic cell selection marker sequence is selected from the group consisting of a Zeocin™ resistance marker, a neomycin resistance marker, a puromycin resistance marker, a blasticidin resistance marker and a hygromycin resistance marker.

7. The ONE-HDR template vector of claim 1, wherein the one or more bacterial negative selection markers comprises the ccdb gene.

8. The ONE-HDR template vector of claim 1 comprising two nucleic acid sequences encoding bacterial negative selection markers flanking the insertion cassette.

9. The ONE-HDR template vector of claim 1 wherein the CRISPR- Cas endonuclease comprises CRISPR-Cas9 endonuclease.

10. The ONE-HDR template vector of claim 9 comprising a nucleic acid sequence selected from the group consisting of SEQ ID NO:1, SEQ ID NO:2 and SEQ ID NO:

3.

11. A HDR targeting vector (ONE-HDR targeting vector) comprising a nucleic acid molecule, wherein the nucleic acid molecule comprises one or more recombination arms, wherein the one or more recombination arms comprises a nucleotide sequence having homology to a target nucleotide sequence, and wherein the one or more recombination arms comprises a left recombination arm and a right recombination arm, a nucleotide sequence comprising an insertion cassette, wherein the insertion cassette comprises a nucleic acid sequence to be inserted into the genome of a cell, a nucleotide sequence comprising a guide RNA scaffold sequence, and a nucleotide sequence encoding a CRISPR-Cas endonuclease operably linked to a mammalian promoter.

12. The ONE-HDR targeting vector of claim 11, wherein the insertion cassette comprises one or more nucleotide sequences selected from the group consisting of a nucleotide sequence encoding a eukaryotic cell selection marker sequence, a nucleotide sequence encoding protein purification tag, a nucleotide sequence encoding areporter marker sequence, an exogenous gene sequence, a promoter sequence, a nucleotide sequence encoding a P2A linker sequence, a termination sequence, a nucleotide sequence encoding a messenger RNA (mRNA) stabilization sequence, or a combination thereof.

13. The ONE-HDR targeting vector of claim 12, wherein the protein purification tag is selected from the group consisting of chitin binding protein (CBP), maltose binding protein (MBP), glutathione-S-transferase (GST), poly(His), biotin / streptavidin, V5-tag, Myc-tag, HA-tag, NE-tag, His-tag, Flag tag, Halo-tag, Snap- tag, Fc-tag, Nus-tag, BCCP, Thioredoxin, SnooprTag, SpyTag, Isopeptag, SBP-tag, S- tag, AviTag, Calmodulin.

14. The ONE-HDR targeting vector of claim 12, wherein the reporter marker is selected from the group consisting of chloramphenicol-acetyl transferase (CAT), β-galactosyltransferase, horseradish peroxidase, luciferase, NanoLuc®, alkaline phosphatase, and a fluorescent protein.

15. The ONE-HDR targeting vector of claim 14, wherein the fluorescent protein is selected from the group consisting of Green Fluorescent Protein (GFP), Red Fluorescent Protein (RFP), mCherry, mRuby3, mtagBFP2 and mClover3.

16. The ONE-HDR targeting vector of claim 12, wherein the eukaryotic cell selection marker sequence is selected from the group consisting of a Zeocin™ resistance marker, a neomycin resistance marker, a puromycin resistance marker, a blasticidin resistance marker and a hygromycin resistance marker.

17. The ONE-HDR targeting vector of claim 11, wherein the right recombination arm further comprises at least one single guide RNA (sgRNA) sequence, operably linked to a promoter.

18. The ONE-HDR targeting vector of claim 17, wherein the promoter comprises a transfer RNA (tRNA) promoter.

19. The ONE-HDR targeting vector of claim 11, wherein the one or more recombination arms comprise a nucleic acid sequence selected from the group consisting of SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, and SEQ ID NO:8.

20. The ONE-HDR targeting vector of claim 11, comprising a nucleic acid sequence selected from the group consisting of SEQ ID NO: 12 and SEQ ID NO:

13.

21. The ONE-HDR targeting vector of claim 11 wherein the CRISPR- Cas endonuclease comprises CRISPR-Cas9 endonuclease.

22. A method of generating a genetically modified cell, comprising: contacting a cell containing an endogenous chromosomal target DNA sequence with at least one ONE-HDR targeting vector of claim 11, such that the CRISPR-Cas endonuclease cleaves double stranded DNA of the target sequence, wherein the target sequence in the genome of the target cell, is a site which is at least partially complementary to the sgRNA, such that homologous recombination between the one or more recombination arms of the ONE-HDR targeting vector and the endogenous chromosomal target DNA sequence occurs and promotes integration of the insertion cassette of the ONE-HDR targeting vector into the genome of the cell.

23. The method of claim 22, wherein said contacting comprises transfecting the cell with the ONE-HDR targeting vector.

24. The method of claim 22, wherein the cell is contacted with two or more ONE-HDR targeting vectors of claim 11.

25. The method of claim 22, wherein the cell is from a human.

26. The method of claim 22, wherein the cell is from a mouse.

27. The method of claim 22, wherein the target sequence is in the proximity of an actively transcribed gene.

28. The method of claim 22, wherein the target sequence is in the proximity of a silent gene.

29. A genetically modified cell made according to the method of claim 22.

30. The genetically modified cell of claim 29, wherein the cell is a knock-out cell.

31. The genetically modified cell of claim 29, wherein the cell is a knock-in cell.

32. The genetically modified cell of claim 29, wherein the cell is a mouse cell.

33. The genetically modified cell of claim 29, wherein the cell is a human cell.

34. A method of generating a genetically modified animal in which a desired nucleic acid has been introduced, comprising: obtaining a primary cell comprising an endogenous chromosomal target DNA sequence into which it is desired to introduce said nucleic acid; contacting the cell with a ONE-HDR targeting vector of claim 11, such that the CRISPR-Cas endonuclease cleaves double stranded DNA of the target sequence, wherein the target sequence in the genome of the target cell, is a site which is at least partially complementary to the sgRNA, such that homologous recombination between the one or more recombination arms of the ONE-HDR targeting vector and the endogenous chromosomal target DNA sequence occurs and promotes integration of the insertion cassette of the ONE-HDR targeting vector into the genome of the cell; and generating an animal from said primary cell in which homologous recombination has occurred.

35. The method of claim 34, wherein the animal is selected from the group consisting of a mammal, a marsupial, an avian, an amphibian and a fish.

36. The method of claim 34, wherein the insertion cassette comprises a nucleotide sequence selected from the group consisting of a nucleotide sequence which disrupts a gene after homologous recombination, a nucleotide sequence which replaces a gene after homologous recombination, a nucleotide sequence which introduces a gene after homologous recombination, and a nucleotide sequence which introduces a regulatory site after homologous recombination.

37. A genetically modified animal made according to the method of claim 34.

38. The method of claim 34, wherein the target sequence is in the proximity of an actively transcribed gene.

39. The method of claim 34, wherein the target sequence is in the proximity of a silent gene.

Images