Polynucleotides encoding gasdermin and uses thereof

Polynucleotides encoding gasdermin polypeptides provide a novel approach to harness programmed cell death mechanisms for targeted cell killing in diseases, addressing the limitations of existing therapeutic strategies.

WO2025117968A1PCT designated stage expired Publication Date: 2025-06-05THE GENERAL HOSPITAL CORP
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
PCT/US2024/058120
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-12-01
Filing Date
2024-12-02
Publication Date
2025-06-05

AI Technical Summary

Technical Problem

Current therapeutic strategies lack effective methods to harness programmed cell death mechanisms, such as apoptosis, ferroptosis, necroptosis, and pyroptosis, for targeted cell killing in diseases like cancer and immune disorders.

Method used

Development of polynucleotides encoding gasdermin (GSDM) polypeptides, including variants and fragments with high sequence identity, which can be expressed to form pores in cellular membranes, mediating cell death upon oligomerization.

Benefits of technology

The expression of GSDM polypeptides from encoded polynucleotides leads to efficient cell killing by disrupting osmotic potential, offering promising therapeutic strategies for diseases involving abnormal cell growth or immune dysregulation.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000056_0001
    Figure IMGF000056_0001
  • Figure IMGF000006_0001
    Figure IMGF000006_0001
  • Figure IMGF000007_0001
    Figure IMGF000007_0001
Patent Text Reader

Abstract

The present invention features polynucleotides (e.g., RNA, e.g., mRNA) encoding gasdermin (GSDM) polypeptides or pore forming fragments thereof and methods for activating endogenous gasdermin. These polynucleotides can be used to kill a cell by expressing polypeptides that form membranous pores and disrupt osmotic potential, thereby leading to cell swelling and lysis with or without target cell membrane sensitization.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] POLYNUCLEOTIDES ENCODING GASDERMIN AND USES THEREOF

[0002] SEQUENCE LISTING

[0003] This application contains a Sequence Listing which has been filed electronically in Extensible Markup Language (XML) format and is hereby incorporated by reference in its entirety. Said XML copy, created on November 26, 2024, is named 51802-002W02_Sequence_Listing_11_26_24.XML and is 59,141 bytes in size.

[0004] BACKGROUND OF THE INVENTION

[0005] Cells often die during homeostasis or from disease due to a variety of factors and for a wide variety of biological reasons. In many instances, cells undergo apoptosis, ferroptosis, necroptosis, or pyroptosis, which are generally categorized as programmed (apoptosis, necroptosis, ferroptosis, and pyroptosis) cell death or unprogrammed (necrosis) cell death. Harvesting these biological mechanisms can lead to promising therapeutic strategies for improved treatment modes, such as killing cells.

[0006] SUMMARY OF THE INVENTION

[0007] In one aspect, the invention features a polynucleotide (e.g., a modified polynucleotide) encoding a gasdermin (GSDM) polypeptide.

[0008] In some embodiments, the GSDM is GSDMA, GSDMB, GSDMC, GSDMD, GSDME (DFNA5), or DFNB59, a biologically active pore forming fragment thereof, or a variant thereof having at least 65% (e.g., at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%) sequence identity thereto.

[0009] In some embodiments, the GSDM includes an amino acid sequence having at least 65% (e.g., at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%) sequence identity to any one of SEQ ID NOs: 1-16 or a fragment thereof.

[0010] In some embodiments, the polynucleotide includes a nucleotide sequence having at least 65% (e.g., at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%) sequence identity to any one of SEQ ID NOs: 17-32 or a fragment thereof.

[0011] In some embodiments, the GSDM fragment is an N-terminal GSDM fragment.

[0012] In some embodiments, the N-terminal GSDM fragment includes an amino acid sequence having at least 65% (e.g., at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%) sequence identity to any one of SEQ ID NOs: 1 , 3, 5, 7, 9, 11 , 13, or 15.

[0013] In some embodiments, the polynucleotide includes a nucleotide sequence having at least 65% (e.g., at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%) sequence identity to any one of SEQ ID NOs: 17, 19, 21 , 23, 25, 27, 29, or 31 .

[0014] In some embodiments, the polynucleotide encodes a plurality of GSDMs.

[0015] In some embodiments, each GSDM is separated by a cleavage site or an internal ribosomal entry site (IRES). In some embodiments, the cleavage site is a 2A cleavage site.

[0016] In some embodiments, each GSDM is independently, GSDMA, GSDMB, GSDMC, GSDMD, GSDME (DFNA5), or DFNB59, a biologically active pore forming fragment thereof, or a variant thereof having at least 65% (e.g., at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%) sequence identity thereto.

[0017] In some embodiments, the polynucleotide is an RNA. In some embodiments, the RNA is a messenger RNA (mRNA). In some embodiments, the RNA further includes a 5' UTR, 3' UTR, a poly(A) tail, and / or a 5' cap.

[0018] In some embodiments, the polynucleotide is a DNA.

[0019] In some embodiments, the polynucleotide includes at least one synthetic modification . In some embodiments, the at least one synthetic modification is a 5’ cap analog. In some embodiments, the 5’ cap analog is an m7GpppG, anti-reverse cap analog (ARCA), two-headed cap, S cap, or 2S cap.

[0020] In some embodiments, the at least one synthetic modification is a tail modification. In some embodiments, the tail modification is a ribose-modified adenosine, 8-azaadenosine, cordycepin, or a fluorescent modification.

[0021] In some embodiments, the at least one synthetic modification is a modified nucleobase. In some embodiments, the modified nucleobase is N1-methylpsuedouridine (m1qj), 2-thiouridine (S2U), 5- methylcytidine (m5C), N6-methyladenosine (m6A), 2’-O-methyluridine (Um), 2’-O-methylcytidine (Cm), 2’-O-methyladenosine (Am), 2’-O-methylguanosine (Gm), 5’-methoxyuridine, 5-methylcytosine, 5- hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyladenine, 6- methylguanine, 2-propyladenine, 2-propylguanine, 2-thiouracil, 2-thiothymine, 2-thiocytosine, 5- halouracil, 5-halocytosine, 5-propynyluracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6- azothymine, 5-uracil (pseudouracil), 4-thiouracil, 8-haloadenine, 8-aminoadenine, 8-thioladenine, 8- thioalkyladenine, 8-hydroxyladenine, 8-haloguanine, 8-aminoguanine, 8-thiolguanine, 8- thioalkylguanine, 8-hydroxylguanine, 5-bromouracil, 5-trifluoromethyluracil, 5-bromocytosine, 5- trifluoromethylcytosine, 7-methylguanine, 7-methyladenine, 2-fluoroadenine, 8-azaguanine, 8- azaadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, or 3-deazaadenine.

[0022] In some embodiments, the at least one synthetic modification is a modified sugar. In some embodiments, the modified sugar is a 2’-Ome or 2’-O-fluoro ribose modification. The modified sugar may be a bicyclic sugar, a 2’-O-methoxyethyl (2MOE) modified sugar, a 2’-O-methoxy (2-OMe) modified sugar, a 2’-methoxy modified sugar, a 2’-O-alkyl modified sugar, a constrained ethyl (cEt) modified sugar, a locked sugar, and an unlocked sugar.

[0023] In another aspect, featured is a vector that includes or encodes a polynucleotide as described herein, e.g., of any of the above embodiments. In some embodiments, the vector is a viral vector (e.g., an RNA viral vector or a DNA viral vector). In some embodiments, the RNA viral vector is a replicon RNA or self-amplifying RNA. In some embodiments, the DNA vector is a replication-deficient adenoviral vector selected from the group consisting of human adenovirus, rhesus adenovirus, simian adenovirus and gorilla adenovirus viral vectors.

[0024] In another aspect, featured is a cell that includes the polynucleotide or vector as described herein, e.g., of any of the above embodiments, In another aspect, featured is a pharmaceutical composition that includes a polynucleotide, vector, or cell as described herein, e.g., of any of the above embodiments, and a pharmaceutically acceptable carrier.

[0025] In some embodiments, the pharmaceutical composition further includes a cholesterol depleting agent. In some embodiments, the cholesterol depleting agent includes a methyl cyclodextrin, a Niemann-Pick C1 (NPC1) inhibitor, a statin, a squalene epoxidase inhibitor, an oxysterol, or a 7-Dehydrocholesterol reductase (DHCR7) inhibitor. In some embodiments, the methyl cyclodextrin is methyl-p-cyclodextrin (MCD). In some embodiments, the statin is fatostatin. In some embodiments, the squalene epoxidase inhibitor is NB598. In some embodiments, the DHCR7 inhibitor is AY9944. In some embodiments, the oxysterol is 25-hydroxycholesterol or 24-S-hydroxycholesterol.

[0026] In some embodiments, the pharmaceutical composition further includes a lipid. In some embodiments, the lipid is a phospholipid or a PEGylated lipid. In some embodiments, the lipid is a cationic lipid. In some embodiments, the lipid is an anionic or neutral lipid. In some embodiments, the lipid is a sterol. In some embodiments, the sterol is cholesterol or a derivative thereof. In some embodiments, the pharmaceutical composition includes a mixture of lipids.

[0027] In some embodiments, the composition includes a nanoparticle (e.g., lipid nanoparticle (LNP)) that includes the polynucleotide and the lipid. In some embodiments, the nanoparticle includes a plurality of the polynucleotides and a plurality of the lipids. In some embodiments, the pharmaceutical composition includes a plurality of the nanoparticles.

[0028] In some embodiments, at least 90% of the nanoparticles in the composition have a diameter from about 10 nm to about 500 nm (e.g., 10 nm to 250 nm, e.g., 10 nm, 20 nm, 30 nm, 40 nm, 50 nm, 60 nm, 70 nm, 80 nm, 90 nm, 100 nm, 150 nm, 200 nm, 250 nm, 300 nm, 350 nm, 400 nm, 450 nm, or 500 nm) as measured by dynamic light scattering (DLS).

[0029] In another aspect, the invention features a method of killing a cell. The method includes contacting the cell with the pharmaceutical composition of any of the above embodiments. The gasdermin polypeptide is expressed from the cell and then oligomerizes to form a pore, thereby killing the cell, e.g., upon disruption of the osmotic potential of the cell. The contacting may be performed in vivo (e.g., in a subject).

[0030] In some embodiments, the method further includes contacting the cell with an agent that depletes cholesterol from the cell. In some embodiments, the agent includes a methyl cyclodextrin, an NPC1 inhibitor, a statin, a squalene epoxidase inhibitor, an oxysterol, or a DHCR7 inhibitor. In some embodiments, the methyl cyclodextrin is MCD. In some embodiments, the statin is fatostatin. In some embodiments, the squalene epoxidase inhibitor is NB598. In some embodiments, the DHCR7 inhibitor is AY9944. In some embodiments, the oxysterol is 25-hydroxycholesterol or 24-S-hydroxycholesterol.

[0031] In some embodiments, the method includes contacting the cell with the agent prior to the polynucleotide, vector, or cell. In some embodiments, the method includes contacting the cell with the agent after the polynucleotide, vector, or cell.

[0032] In some embodiments, the cell is a macrophage.

[0033] In some embodiments, the method treats a disease or disorder in a subject. In some embodiments, the disease or disorder is an immune disorder. In some embodiments, the immune disorder is systemic lupus erythematosus (SLE), rheumatic arthritis (RA), systemic sclerosis (SSc), and type 1 diabetes (T1 D).

[0034] In some embodiments, the disease or disorder is cancer. In some embodiments, the cancer is melanoma, ocular melanoma, breast cancer, bladder cancer, head and neck cancer, glioma, or prostate cancer.

[0035] In some embodiments, the cell is a tumor cell. In some embodiments, the tumor cell is an immune cell in the tumor. In some embodiments, the polypeptide oligomerizes to form a pore in the immune cell of the tumor, thereby causing pyroptosis of the immune cell that releases one or more proinflammatory cytokines. In some embodiments, the one or more proinflammatory cytokines activates and recruits one or more tumor infiltrating immune cells to kill a different cell in the tumor. The method may further include administering an immune checkpoint inhibitor, such as an anti-PD-1 immunotherapy.

[0036] In some embodiments, the pharmaceutical composition is administered intravenously or subcutaneously.

[0037] Also featured herein is a kit that includes a polynucleotide as described herein, e.g., of any of the above embodiments, a cell or vector containing the same, or a pharmaceutical composition containing the same, and an agent that depletes cholesterol, e.g., as described herein. The kit may further include an immune checkpoint inhibitor, such as an anti-PD-1 immunotherapy

[0038] Also featured herein is a combination therapy that includes a polynucleotide as described herein, e.g., of any of the above embodiments, a cell or vector containing the same, or a pharmaceutical composition containing the same, and an agent that depletes cholesterol, e.g., as described herein. The combination therapy may further include an immune checkpoint inhibitor, such as an anti-PD-1 immunotherapy.

[0039] Also featured herein method of killing a cell. The method includes contacting the cell an agent that depletes cholesterol and an activator of an endogenous gasdermin polypeptide, wherein the polypeptide oligomerizes to form a pore, thereby killing the cell.

[0040] In some embodiments, the agent includes a methyl cyclodextrin, an NPC1 inhibitor, a statin, a squalene epoxidase inhibitor, an oxysterol, or a DHCR7 inhibitor. In some embodiments, the methyl cyclodextrin is MCD. In some embodiments, the statin is fatostatin. In some embodiments, the squalene epoxidase inhibitor is NB598. In some embodiments, the DHCR7 inhibitor is AY9944. In some embodiments, the oxysterol is 25-hydroxycholesterol or 24-S-hydroxycholesterol.

[0041] In some embodiments, the method includes contacting the cell with the agent prior to the activator. In some embodiments, the method includes contacting the cell with the agent after the activator.

[0042] In some embodiments, the cell is a macrophage.

[0043] In some embodiments, the method treats a disease or disorder in a subject.

[0044] In some embodiments, the disease or disorder is an immune disorder. In some embodiments, the immune disorder is systemic lupus erythematosus (SLE), rheumatic arthritis (RA), systemic sclerosis (SSc), and type 1 diabetes (T1 D). In some embodiments, the disease or disorder is cancer. In some embodiments, the cancer is melanoma, ocular melanoma, breast cancer, bladder cancer, head and neck cancer, glioma, or prostate cancer.

[0045] In some embodiments, the cell is a tumor cell. In some embodiments, the tumor cell is an immune cell in the tumor. In some embodiments, the polypeptide oligomerizes to form a pore in the immune cell of the tumor, thereby causing pyroptosis of the immune cell that releases one or more proinflammatory cytokines. In some embodiments, the one or more proinflammatory cytokines activates and recruits one or more tumor infiltrating immune cells to kill a different cell in the tumor. The method may further include administering an immune checkpoint inhibitor, such as an anti-PD-1 immunotherapy.

[0046] In some embodiments, the endogenous gasdermin is GSDMA, GSDMB, GSDMC, GSDMD, GSDME (DFNA5), or DFNB59.

[0047] In some embodiments, the gasdermin activator includes radiation, a chemotherapeutic agent, or a protease.

[0048] In some embodiments, the protease is a caspase. In some embodiments, the caspase is caspase-1 , caspase-3, caspase-4, caspase-5, caspase-7, or caspase-8. In some embodiments, the chemotherapeutic agent is doxorubicin, etoposide, cisplatin, topotecan, mitoxantrone, actinomycin-D, or talabostat.

[0049] In another aspect, featured is a kit that includes an agent that depletes cholesterol and an activator of an endogenous gasdermin polypeptide. In some embodiments, the kit further includes an immune checkpoint inhibitor.

[0050] Definitions

[0051] As used herein, the term “about” refers to a value that is 10% above or below the value being described.

[0052] As used herein, the terms "conservative mutation," "conservative substitution," "conservative amino acid substitution," and the like refer to a substitution of one or more amino acids for one or more different amino acids that exhibit similar physicochemical properties, such as polarity, electrostatic charge, and steric volume. These properties are summarized for each of the twenty naturally occurring amino acids in Table 1 below.

[0053] Table 1. Representative physicochemical properties of naturally occurring amino acids

[0054] From this table it is appreciated that the conservative amino acid families include (i) G, A, V, L and I; (ii) D and E; (iii) C, S and T; (iv) H, K and R; (v) N and Q; and (vi) F, Y and W. A conservative mutation or substitution is therefore one that substitutes one amino acid for a member of the same amino acid family (e.g., a substitution of Ser for Thr or Lys for Arg).

[0055] As used herein, the term “cholesterol depleting agent” refers to an agent, such as a small molecule, nucleic acid, or polypeptide, that causes a reduction of cholesterol in a target cell, e.g., in the lipid membrane. For example, the cholesterol depleting agent may be a methyl cyclodextrin, an NPC1 inhibitor, a statin, a squalene epoxidase inhibitor, an oxysterol, or a DHCR7 inhibitor. As used herein, the term “fragment” is meant a portion of a polypeptide or nucleic acid molecule that contains, preferably, at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more of the entire length of the reference nucleic acid molecule or polypeptide. A fragment may contain, e.g., 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 350, 400, 450, 500, or more amino acid residues, up to the entire length of the polypeptide.

[0056] As used herein, a “gasdermin” or “GSDM” corresponds to pore forming protein from the gasdermin family. Gasdermins typically insert into a lipid bilayer and induce high order oligomerization within the membrane, forming extensive pores with approximately 16 subunits. These pores can disrupt osmotic potential, thereby leading to cell swelling and lysis, the morphological hallmarks of pyroptosis. A gasdermin may be from any naturally occurring or synthetic gasdermin (e.g., GSDMA, GSDMB, GSDMC, GSDMD, GSDME (DFNA5) and DFNB59 (Pejvakin)) or a variant or biologically active fragment having at least 65%, e.g., at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99%, or 100% sequence identity to any naturally occurring or synthetic gasdermin. Gasdermins also include nonhuman gasdermins, such as mouse (e.g., GSDMA3) or other mammalian gasdermins. A gasdermin includes full length gasdermin as well as fragments thereof, e.g., having at least 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 350, 400, 450, 500, or more amino acids. Exemplary gasdermins are shown in Table 2. Gasdermins also encompass fragments thereof as well as polypeptides having at least 65%, e.g., at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99%, or 100% sequence identity thereto.

[0057] As used herein, the terms “percent (%) identity” or “percent sequence identity” refers to the percentage of amino acid residues of a candidate sequence, e.g., a gasdermin, that are identical to the amino acid residues of a reference sequence, e.g., a naturally occurring gasdermin, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent identity (i.e., gaps can be introduced in one or both of the candidate and reference sequences for optimal alignment and non-homologous sequences can be disregarded for comparison purposes). Alignment for purposes of determining percent identity can be achieved in various ways that are within the skill in the art, for instance, using publicly available computer software such as BLAST, ALIGN, or Megalign (DNASTAR) software. Those skilled in the art can determine appropriate parameters for measuring alignment, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared. In some embodiments, the percent amino acid sequence identity of a given candidate sequence to, with, or against a given reference sequence (which can alternatively be phrased as a given candidate sequence that has or includes a certain percent amino acid sequence identity to, with, or against a given reference sequence) is calculated as follows:

[0058] 100 x (fraction of A / B) where A is the number of amino acid residues scored as identical in the alignment of the candidate sequence and the reference sequence, and where B is the total number of amino acid residues in the reference sequence. In some embodiments where the length of the candidate sequence does not equal to the length of the reference sequence, the percent amino acid sequence identity of the candidate sequence to the reference sequence would not equal to the percent amino acid sequence identity of the reference sequence to the candidate sequence.

[0059] As used herein, “messenger RNA” or “mRNA” is any RNA that encodes a (at least one) protein (e.g., a polypeptide as described herein) and can be translated to produce the encoded protein in vitro, in vivo, in situ, or ex vivo. The skilled artisan will appreciate that, except where otherwise noted, nucleic acid sequences set forth in the instant application may recite "T"s in a representative DNA sequence but where the sequence represents RNA (e.g., mRNA), the "T"s would be substituted for "U"s. Thus, any of the DNAs disclosed and identified by a particular sequence identification number herein also disclose the corresponding RNA (e.g., mRNA) sequence complementary to the DNA, where each "T" of the DNA sequence is substituted with "U."

[0060] As used herein, an “open reading frame” or “ORF” is a continuous stretch of DNA or RNA beginning with a start codon (e.g., methionine (ATG or AUG)) and ending with a stop codon (e.g., TAA, TAG or TGA, or UAA, UAG or UGA). An ORF typically encodes a protein. It will be understood that the sequences disclosed herein may further include additional elements, e.g., 5' and 3' UTRs, but that those elements, unlike the ORF, need not necessarily be present in an RNA polynucleotide disclosed herein.

[0061] As used herein, the term “pharmaceutically acceptable carrier” refers to an excipient or diluent in a pharmaceutical composition. The pharmaceutically acceptable carrier is compatible with the other ingredients of the formulation and not deleterious to the recipient. The pharmaceutically acceptable carrier may provide pharmaceutical stability to the pore forming polypeptide or may impart another beneficial characteristic (e.g., sustained release characteristics). The nature of the carrier differs with the mode of administration. For example, for intravenous administration, an aqueous solution carrier is generally used; for oral administration, a solid carrier is preferred.

[0062] As used herein, the term “pharmaceutical composition” refers to a medicinal or pharmaceutical formulation that contains an active ingredient at a pharmaceutically acceptable purity as well as one or more excipients and diluents to allow the active ingredient suitable for the method of administration. The pharmaceutical composition includes pharmaceutically acceptable components that are compatible with, for example, a polypeptide. The pharmaceutical composition may be in aqueous form, for example, for intravenous or subcutaneous administration or in tablet or capsule form, for example, for oral administration.

[0063] As used herein, “polynucleotides” or “nucleic acids” refer to a polymer of nucleotides (nucleotide monomers). Thus, nucleic acids are also referred to as polynucleotides. Nucleic acids may be or may include, for example, deoxyribonucleic acids (DNAs), ribonucleic acids (RNAs), threose nucleic acids (TNAs), glycol nucleic acids (GNAs), peptide nucleic acids (PNAs), locked nucleic acids (LNAs, including LNA having a beta-D-ribo configuration, alpha-LNA having an alpha-L- ribo configuration (a diastereomer of LNA), 2'-amino-LNA having a 2'-amino functionalization, and 2'- amino-alpha-LNA having a 2'-amino functionalization), ethylene nucleic acids, cyclohexenyl nucleic acids and / or chimeras and / or combinations thereof.

[0064] As used herein, the term “subject” refers to an animal, such as a mammal, e.g., a human.

[0065] The term “targeting moiety,” as used herein, represents a moiety (e.g., a small molecule, e.g., a carbohydrate) that specifically binds or reactively associates or complexes with a receptor or other receptive moiety associated with a given target cell population (e.g., macrophage). Thus, a targeting moiety may be used to target a lipid-based structure (e.g., liposome, lipid nanoparticle, or micelle) described herein to, e.g., a macrophage. As used herein, the term “therapeutically effective amount” refers to an amount, e.g., a pharmaceutical dose, effective in inducing a desired biological effect in a subject or patient or in treating a patient having a condition or disorder described herein. It is also to be understood herein that a “therapeutically effective amount” may be interpreted as an amount giving a desired therapeutic effect, either taken in one dose or in any dosage or route, taken alone or in combination with other therapeutic agents.

[0066] As used herein, the terms “treatment” or “treating” refer to reducing or ameliorating a disorder (e.g., influenza) and / or one or more symptoms associated therewith. It will be appreciated that, although not precluded, treating a disorder or condition does not require that the disorder or symptoms associated therewith be completely eliminated. Reducing or decreasing the side effects of a disease or condition or the risk or progression of the disease or condition may be relative to a subject who did not receive treatment, e.g., a control, a baseline, or a known control level or measurement. The reduction or decrease may be, e.g., by about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 97%, 99%, or about 100% relative to the subject who did not receive treatment or the control, baseline, or known control level or measurement. Various assays or efficacy metrics for a given disorder or disease are described in more detail below.

[0067] BRIEF DESCRIPTION OF THE DRAWINGS

[0068] FIG. 1A is an immunoblot showing the expression level of Rabgefl endosome adaptor protein in wild type (WT) and Rabgefl sgRNA targeted (sg1 and sg2) murine immortalized bone marrow derived macrophages after mock electroporation (WT) and electroporation with Rabgefl targeting sgRNA making a gene knock out (Rabgefl KO). These macrophages express Cas9 from S. pyogenes for ease of gene editing. These macrophages were engineered to express the doxycycline responsive Tet3G transactivator protein. These macrophages were engineered with a TRE3G promoter that is doxycycline and Tet3G dependent upstream of the caspase cleavage product, N terminal fragment (NT) that represents the pore forming and active domain murine gasdermin D (NT-mGSDMD) with an I105N hypomorph mutation as an inducible transgene. There is a mtagBFP fusion tag on the NT- GSDMD to allow expression level and subcellular localization quantification.

[0069] FIG. 1B is a graph showing the plasma membrane perforation after induction with doxycycline (Dox) of NT-mGSDMD or lack of induction of NT-mGSDMD without doxycycline in WT macrophages. Moreover, this subfigure demonstrates that Rabgefl KO macrophages (sg1 and sg2) were protected from plasma membrane permeability after induction with doxycycline of NT-mGSDMD as measured by single cell frequency of propidium iodide positivity through live cell fluorescent imaging.

[0070] FIG. 1C is a graph showing plasma membrane rupture and cell lysis that is characteristic of myeloid cell pyroptosis as measured by LDH enzyme release into culture supernatants proceeds normally in doxycycline treated and NT-mGSDMD expressing WT macrophage but not in doxycycline treated and NT-mGSDMD expressing Rabgefl KO (sg1 and sg2) macrophages. Control WT and Rabgefl KO (sg1 and sg2) macrophages not treated with doxycycline that do not express NT- mGSDMD did not display membrane rupture and cell lysis as seen by a lack of LDH enzyme release into culture supernatants.

[0071] FIG. 1 D is a graph demonstrating cellular viability in doxycycline treated and NT-mGSDMD expressing WT macrophage and Rabgefl KO (sg1 and sg2) macrophages by quantifying cellular ATP levels with a luminescence based assay.

[0072] FIG. 2A is a graph showing cholesterol concentration extracted and quantified using an Amplex red assay from WT and Rabgefl KO (sg1 and sg2) macrophages with or without acute plasma membrane cholesterol depletion with methyl-p-cyclodextrin (MOD). Specifically, Rabgefl KO macrophages (sg1 and sg2) demonstrate elevated cellular free cholesterol content compared to WT macrophages. Treatment of cells with MOD results in acute depletion of cellular cholesterol content in both WT and Rabgefl KO (sg1 and sg2) cells, and cholesterol levels in Rabgefl KO macrophages treated with MOD was similar to untreated WT macrophages.

[0073] FIG. 2B is a graph showing the mean fluorescent intensity of a GFP based biosensor for plasma membrane cholesterol assayed by flow cytometry. This biosensor consists of recombinant protein of a mutated and truncated bacterial cholesterol binding toxin Perfringolysin O (PFO*) covalently linked to the fluorescent protein GFP with the SpyCatcher and Spy Tag system. Specifically, Rabgefl KO macrophages (sg1 and sg2) demonstrate elevated plasma membrane cholesterol staining based on PFO*-GFP compared to WT macrophages. Treatment of cells with MCD results in acute depletion of plasma membrane cholesterol content in both WT and Rabgefl KO (sg1 and sg2) cells.

[0074] FIG. 2C is a graph showing the plasma membrane perforation after induction with doxycycline of NT-mGSDMD or lack of induction of NT-mGSDMD without doxycycline in macrophages as measured by single cell frequency of propidium iodide positivity through live cell fluorescent imaging. WT macrophages demonstrate robust membrane permeability after induction of NT-mGSDMD with doxycycline with limited PI staining without induction. Moreover, this figure demonstrates that Rabgefl KO (sg1 and sg2) macrophages were protected from plasma membrane permeability after induction with doxycycline of NT-mGSDMD. Rabgefl KO macrophages that are resistant to doxycycline and NT-mGSDMD induced membrane permeability when depleted of their elevated cholesterol with MCD rescue membrane permeability as seen by restoration of propidium iodide positivity.

[0075] FIG. 2D is a graph showing plasma membrane rupture and cell lysis that is characteristic of myeloid cell pyroptosis as measured by LDH enzyme release into culture supernatants. WT macrophages demonstrate robust pyroptotic cellular lysis after induction of NT-mGSDMD with doxycycline with limited LDH release without induction. Moreover, this figure demonstrates that Rabgefl KO (sg1 and sg2) macrophages were protected from plasma rupture after induction with doxycycline of NT-mGSDMD. Rabgefl KO macrophages that are resistant to doxycycline and NT- mGSDMD induced cellular lysis when depleted of their elevated cholesterol with MCD rescue pyroptotic membrane rupture as seen by restoration of LDH release.

[0076] FIG. 3A is a graph showing the mean fluorescent intensity of a PFO*-GFP based biosensor for plasma membrane cholesterol assayed by flow cytometry. Treatment of WT and Rabgefl KO (sg2) macrophages with the cholesterol biosynthesis inhibitor fatostatin diminishes plasma membrane cholesterol levels.

[0077] FIG. 3B is a graph showing the plasma membrane perforation after induction with doxycycline of NT-mGSDMD or lack of induction of NT-mGSDMD without doxycycline in macrophages as measured by single cell frequency of propidium iodide positivity through live cell fluorescent imaging. WT macrophages demonstrate robust membrane permeability after induction of NT-mGSDMD with doxycycline that is increased by fatostatin treatment with limited PI staining without NT-mGSDMD induction. Moreover, this figure demonstrates that Rabgefl KO (sg2) macrophages were protected from plasma membrane permeability after induction with doxycycline of NT-mGSDMD, whereas treatment of Rabgefl KO (sg2) macrophages with doxycycline and treated with fatostatin rescue membrane permeability as seen by restoration of propidium iodide positivity.

[0078] FIG. 3C is a graph showing plasma membrane rupture and cell lysis that is characteristic of myeloid cell pyroptosis as measured by LDH enzyme release into culture supernatants. WT macrophages demonstrate robust cellular lysis with doxycycline NT-mGSDMD expression that is increased by fatostatin treatment with limited LDH release without NT-mGSDMD induction. Moreover, this figure demonstrates that Rabgefl KO (sg2) macrophages were protected from plasma membrane rupture after induction with doxycycline of NT-mGSDMD, whereas treatment of Rabgefl KO (sg2) macrophages with doxycycline and treated with fatostatin rescue cellular lysis as seen by restoration of LDH release.

[0079] FIG. 3D is a graph showing the mean fluorescent intensity of a PFO*-GFP based biosensor for plasma membrane cholesterol assayed by flow cytometry. Treatment of WT and Rabgefl KO (sg2) macrophages with the cholesterol biosynthesis inhibitor NB598 diminishes plasma membrane cholesterol levels.

[0080] FIG. 3E is a graph showing the plasma membrane perforation after induction with doxycycline of NT-mGSDMD or lack of induction of NT-mGSDMD without doxycycline in macrophages as measured by single cell frequency of propidium iodide positivity through live cell fluorescent imaging. WT macrophages demonstrate robust membrane permeability after induction of NT-mGSDMD with doxycycline that is increased by NB598 treatment with limited PI staining without NT-mGSDMD induction. Moreover, this figure demonstrates that Rabgefl KO (sg2) macrophages were protected from plasma membrane permeability after induction with doxycycline of NT-mGSDMD, whereas treatment of Rabgefl KO (sg2) macrophages with doxycycline and treated with NB598 rescue membrane permeability as seen by restoration of propidium iodide positivity.

[0081] FIG. 3F is a graph showing plasma membrane rupture and cell lysis that is characteristic of myeloid cell pyroptosis as measured by LDH enzyme release into culture supernatants. WT macrophages demonstrate robust cellular lysis with doxycycline NT-mGSDMD expression that is increased by NB598 treatment with limited LDH release without NT-mGSDMD induction. Moreover, this figure demonstrates that Rabgefl KO (sg2) macrophages were protected from plasma membrane rupture after induction with doxycycline of NT-mGSDMD, whereas treatment of Rabgefl KO (sg2) macrophages with doxycycline and treated with NB598 rescue cellular lysis as seen by restoration of LDH release. FIG. 3G is a graph showing the mean fluorescent intensity of a PFO*-GFP based biosensor for plasma membrane cholesterol assayed by flow cytometry. Treatment of WT and Rabgefl KO (sg2) macrophages with the cholesterol biosynthesis inhibitor AY9944 diminishes plasma membrane cholesterol levels.

[0082] FIG. 3H is a graph showing the plasma membrane perforation after induction with doxycycline of NT-mGSDMD or lack of induction of NT-mGSDMD without doxycycline in macrophages as measured by single cell frequency of propidium iodide positivity through live cell fluorescent imaging. WT macrophages demonstrate robust membrane permeability after induction of NT-mGSDMD with doxycycline that is increased by AY9944 treatment with limited PI staining without NT-mGSDMD induction. Moreover, this figure demonstrates that Rabgefl KO (sg2) macrophages were protected from plasma membrane permeability after induction with doxycycline of NT-mGSDMD, whereas treatment of Rabgefl KO (sg2) macrophages with doxycycline and treated with AY9944 rescue membrane permeability as seen by restoration of propidium iodide positivity.

[0083] FIG. 31 is a graph showing plasma membrane rupture and cell lysis that is characteristic of myeloid cell pyroptosis as measured by LDH enzyme release into culture supernatants. WT macrophages demonstrate robust cellular lysis with doxycycline NT-mGSDMD expression that is increased by AY9944 treatment with limited LDH release without NT-mGSDMD induction. Moreover, this figure demonstrates that Rabgefl KO (sg2) macrophages were protected from plasma membrane rupture after induction with doxycycline of NT-mGSDMD, whereas treatment of Rabgefl KO (sg2) macrophages with doxycycline and treated with AY9944 rescue cellular lysis as seen by restoration of LDH release.

[0084] FIG. 4A is a graph showing the mean fluorescent intensity of a PFO*-GFP based biosensor for plasma membrane cholesterol assayed by flow cytometry. Treatment of WT and Rabgefl KO (sg2) macrophages with endogenous oxysterol 19HC does not diminish plasma membrane cholesterol levels. Treatment of WT and Rabgefl KO (sg2) macrophages with endogenous oxysterol 25HC diminishes plasma membrane cholesterol levels.

[0085] FIG. 4B is a graph showing the plasma membrane perforation after induction with doxycycline of NT-mGSDMD or lack of induction of NT-mGSDMD without doxycycline in macrophages as measured by single cell frequency of propidium iodide positivity through live cell fluorescent imaging. WT macrophages demonstrate robust membrane permeability after induction of NT-mGSDMD with doxycycline that is not increased by 19HC treatment and is increased by 25HC treatment with limited PI staining without NT-mGSDMD induction. Moreover, this figure demonstrates that Rabgefl KO (sg2) macrophages were protected from plasma membrane permeability after induction with doxycycline of NT-mGSDMD. Treatment of Rabgefl KO (sg2) macrophages with doxycycline and treated with 19HC does not rescue membrane permeability, whereas treatment with 25HC does rescue pore formation as seen by restoration of propidium iodide positivity.

[0086] FIG. 4C is a graph showing plasma membrane rupture and cell lysis that is characteristic of myeloid cell pyroptosis as measured by LDH enzyme release into culture supernatants. WT macrophages demonstrate robust cellular lysis with doxycycline NT-mGSDMD expression that is not increased by 19HC treatment and is increased by 25HC treatment with limited LDH release without NT-mGSDMD induction. Moreover, this figure demonstrates that Rabgefl KO (sg2) macrophages were protected from plasma membrane rupture after induction with doxycycline of NT-mGSDMD. Treatment of Rabgefl KO (sg2) macrophages with doxycycline and treated with 19HC does not rescue cellular lysis and treatment with 25HC does rescue cellular lysis as seen by restoration of LDH release.

[0087] FIGS. 5A and 5B are graphs showing that modified mRNA complexed with lipid that encode full length (inactive) gasdermin variants consisting of human GSDMB (FL-hGSDMB), human GSMDC (FL-hGSDMC), human GSDMD (FL-hGSDMD), human GSDME (FL-hGSDME), and mouse GSDMA3 (FL-mGSDMA3) did not demonstrate induction of membrane permeability in murine macrophages (iBMDM) and murine cancer cells (B16-F10 melanoma cells). These figures also demonstrated that modified mRNA that encode the N terminal active pore forming domain of human GSDMB (NT- hGSDMB), human GSMDC (NT-hGSDMC), human GSDMD (NT-hGSDMD), human GSDME (NT- hGSDME), and mouse GSDMA3 (NT-mGSDMA3) result in increased membrane permeability in murine macrophages (iBMDM) and murine cancer cells (B16F10 melanoma cells). Lipid nanoparticles alone (Mock) did not demonstrate membrane permeability in murine macrophages (iBMDM) and murine cancer cells (B16F10 melanoma cells).

[0088] FIG. 6A is a graph showing cholesterol concentration extracted and quantified using an Amplex red assay from murine B16F10 melanoma cancer cells with or without acute plasma membrane cholesterol depletion by MCD. Specifically, B16F10 melanoma cancer cells treated with acute MCD demonstrate diminished free cholesterol levels.

[0089] FIG. 6B is a graph showing the plasma membrane perforation of B16F10 melanoma cancer cells after dose curve mRNA transfections encoding gasdermin variants of inactive full length human GSDMA (FL-GSDMA) and pore forming N terminal domain (NT-GSDMA) as measured by single cell frequency of propidium iodide positivity through live cell fluorescent imaging. NT-GSDMA and FL- GSDMA do not demonstrate appreciable membrane permeability in B16F10 melanoma cancer cells over a range of mRNA doses. NT-GSDMA transfections followed by acute plasma membrane cholesterol depletion with MCD result in increased membrane permeability across all mRNA doses that largely does not occur for FL-GSDMA transfected cells treated with MCD.

[0090] FIG. 6C is a graph showing the plasma membrane perforation of B16F10 melanoma cancer cells after dose curve mRNA transfections encoding gasdermin variants of inactive full length human GSDMB (FL-GSDMB) and pore forming N terminal domain (NT-GSDMB) as measured by single cell frequency of propidium iodide positivity through live cell fluorescent imaging. NT-GSDMB transfected into B16F10 melanoma cancer cells demonstrate membrane permeability that is mRNA dose dependent. FL-GSDMB does not demonstrate appreciable membrane permeability in B16F10 melanoma cancer cells over a range of mRNA doses. NT-GSDMB transfections followed by acute plasma membrane cholesterol depletion with MCD result in increased membrane permeability across all mRNA doses that largely does not occur for FL-GSDMB transfected cells treated with MCD.

[0091] FIG. 6D is a graph showing the plasma membrane perforation of B16F10 melanoma cancer cells after dose curve mRNA transfections encoding gasdermin variants of inactive full length human GSDMC (FL-GSDMC) and pore forming N terminal domain (NT-GSDMC) as measured by single cell frequency of propidium iodide positivity through live cell fluorescent imaging. NT-GSDMC transfected into B16F10 melanoma cancer cells demonstrate membrane permeability that is mRNA dose dependent. FL-GSDMC does not demonstrate appreciable membrane permeability in B16F10 melanoma cancer cells over a range of mRNA doses. NT-GSDMC transfections followed by acute plasma membrane cholesterol depletion with MCD result in increased membrane permeability across all mRNA doses that largely does not occur for FL-GSDMC transfected cells treated with MCD.

[0092] FIG. 6E is a graph showing the plasma membrane perforation of B16F10 melanoma cancer cells after dose curve mRNA transfections encoding gasdermin variants of inactive full length human GSDMD (FL-GSDMD) and pore forming N terminal domain (NT-GSDMD) as measured by single cell frequency of propidium iodide positivity through live cell fluorescent imaging. NT-GSDMD transfected into B16F10 melanoma cancer cells demonstrate membrane permeability that is mRNA dose dependent. FL-GSDMD does not demonstrate appreciable membrane permeability in B16F10 melanoma cancer cells over a range of mRNA doses. NT-GSDMD transfections followed by acute plasma membrane cholesterol depletion with MCD result in increased membrane permeability across all mRNA doses that largely does not occur for FL-GSDMD transfected cells treated with MCD except at the highest dose of FL-GSDMD mRNA.

[0093] FIG. 6F is a graph showing the plasma membrane perforation of B16F10 melanoma cancer cells after dose curve mRNA transfections encoding gasdermin variants of inactive full length human GSDME (FL-GSDME) and pore forming N terminal domain (NT-GSDME) as measured by single cell frequency of propidium iodide positivity through live cell fluorescent imaging. NT-GSDME transfected into B16F10 melanoma cancer cells demonstrate membrane permeability that is mRNA dose dependent. FL-GSDME does not demonstrate appreciable membrane permeability in B16F10 melanoma cancer cells over a range of mRNA doses. NT-GSDME transfections followed by acute plasma membrane cholesterol depletion with MCD result in increased membrane permeability across all mRNA doses that largely does not occur for FL-GSDME transfected cells treated with MCD.

[0094] FIG. 7A is a graph showing cholesterol concentration extracted and quantified using an Amplex red assay from murine LLC1 Lewis lung carcinoma cancer cells with or without acute plasma membrane cholesterol depletion by MCD. Specifically, LLC1 lung cancer cells treated with acute MCD demonstrate diminished free cholesterol levels.

[0095] FIG. 7B is a graph showing the plasma membrane perforation of LLC1 lung cancer cells after dose curve mRNA transfections encoding gasdermin variants of inactive full length human GSDMA (FL-GSDMA) and pore forming N terminal domain (NT-GSDMA) as measured by single cell frequency of propidium iodide positivity through live cell fluorescent imaging. NT-GSDMA transfected into LLC1 lung cancer cells demonstrate membrane permeability that is mRNA dose dependent. FL-GSDMA does not demonstrate appreciable membrane permeability in LLC1 lung cancer cells over a range of mRNA doses. NT-GSDMA transfections followed by acute plasma membrane cholesterol depletion with MCD result in increased membrane permeability across all mRNA doses that largely does not occur for FL-GSDMA transfected cells treated with MCD.

[0096] FIG. 7C is a graph showing the plasma membrane perforation of LLC1 lung cancer cells after dose curve mRNA transfections encoding gasdermin variants of inactive full length human GSDMB (FL-GSDMB) and pore forming N terminal domain (NT-GSDMB) as measured by single cell frequency of propidium iodide positivity through live cell fluorescent imaging. NT-GSDMB transfected into LLC1 lung cancer cells demonstrate membrane permeability that is mRNA dose dependent. FL-GSDMB does not demonstrate appreciable membrane permeability in LLC1 lung cancer cells over a range of mRNA doses. NT-GSDMB transfections followed by acute plasma membrane cholesterol depletion with MCD result in increased membrane permeability across all mRNA doses that largely does not occur for FL-GSDMB transfected cells treated with MCD.

[0097] FIG. 7D is a graph showing the plasma membrane perforation of LLC1 lung cancer cells after dose curve mRNA transfections encoding gasdermin variants of inactive full length human GSDMC (FL-GSDMC) and pore forming N terminal domain (NT-GSDMC) as measured by single cell frequency of propidium iodide positivity through live cell fluorescent imaging. NT-GSDMC transfected into LLC1 lung cancer cells demonstrate membrane permeability that is mRNA dose dependent. FL-GSDMC does not demonstrate appreciable membrane permeability in LLC1 lung cancer cells over a range of mRNA doses. NT-GSDMC transfections followed by acute plasma membrane cholesterol depletion with MCD result in increased membrane permeability across all mRNA doses that largely does not occur for FL-GSDMC transfected cells treated with MCD.

[0098] FIG. 7E is a graph showing the plasma membrane perforation of LLC1 lung cancer cells after dose curve mRNA transfections encoding gasdermin variants of inactive full length human GSDMD (FL-GSDMD) and pore forming N terminal domain (NT-GSDMD) as measured by single cell frequency of propidium iodide positivity through live cell fluorescent imaging. NT-GSDMD transfected into LLC1 lung cancer cells demonstrate membrane permeability that is mRNA dose dependent. FL-GSDMD does not demonstrate appreciable membrane permeability in LLC1 lung cancer cells over a range of mRNA doses. NT-GSDMD transfections followed by acute plasma membrane cholesterol depletion with MCD result in increased membrane permeability across all mRNA doses that largely does not occur for FL-GSDMD transfected cells treated with MCD except at the highest dose of FL-GSDMD mRNA.

[0099] FIG. 7F is a graph showing the plasma membrane perforation of LLC1 lung cancer cells after dose curve mRNA transfections encoding gasdermin variants of inactive full length human GSDME (FL-GSDME) and pore forming N terminal domain (NT-GSDME) as measured by single cell frequency of propidium iodide positivity through live cell fluorescent imaging. NT-GSDME and FL-GSDME does not demonstrate appreciable membrane permeability in LLC1 lung cancer cells over a range of mRNA doses. NT-GSDME transfections followed by acute plasma membrane cholesterol depletion with MCD result in increased membrane permeability across all mRNA doses that largely does not occur for FL- GSDME transfected cells treated with MCD.

[0100] FIG. 8A is a graph showing a time course of plasma membrane perforation of B16F10 melanoma cancer cells after doxycycline induction of NT-GSDME-mNeonGreen in engineered cancer cells. Treatment of engineered B16F10 melanoma cancer cells with doxycycline to induce NT- GSDME-mNeonGreen for 9 hours leads to limited membrane permeability similar to uninduced engineered cancer cells. Acute depletion of plasma membrane cholesterol with MCD in the last hour of doxycycline induction of NT-GSDME-mNeonGreen leads to substantial functional pore formation as seen by single cell PI staining frequency.

[0101] FIG. 8B is a graph showing a time course of plasma membrane perforation of B16F10 melanoma cancer cells after doxycycline induction of NT-GSDME-mNeonGreen in engineered cancer cells. Treatment of engineered B16F10 melanoma cancer cells with doxycycline to induce NT- GSDME-mNeonGreen for 9 hours leads to limited membrane permeability similar to uninduced engineered cancer cells. Treatment with cholesterol biosynthesis inhibitor AY9944 during doxycycline induction of NT-GSDME-mNeonGreen leads to substantial functional pore formation as seen by single cell PI staining frequency.

[0102] FIG. 8C is a graph showing a time course of plasma membrane perforation of B16F10 melanoma cancer cells after doxycycline induction of NT-GSDME-mNeonGreen in engineered cancer cells. Treatment of engineered B16F10 melanoma cancer cells with doxycycline to induce NT- GSDME-mNeonGreen for 9 hours leads to limited membrane permeability similar to uninduced engineered cancer cells. Treatment with endogenous, bioactive oxysterol 25-HC during doxycycline induction of NT-GSDME-mNeonGreen leads to substantial functional pore formation as seen by single cell PI staining frequency.

[0103] DETAILED DESCRIPTION

[0104] Gasdermins are pore forming polypeptides that typically insert into a lipid bilayer and induce high order oligomerization within the membrane, forming extensive pores with approximately 16 subunits. These pores can disrupt osmotic potential of a cell, thereby leading to cell swelling and lysis, the morphological hallmarks of pyroptosis.

[0105] The present invention features active forms of the pore-forming gasdermin protein family and fragments thereof that oligomerize into pores in cellular membranes to mediate IL-1 cytokine release and lytic cell death. The gasdermins may be encoded by a polynucleotide, such as a modified translation competent mRNA, and delivered to target cells, e.g., via electroporation or lipid-based particles, such as liposomes or lipid nanoparticles. Such delivery can target diverse cell types to directly kill these cells via the protein products encoded by these synthetic mRNAs. The gasdermines may also be endogenously expressed, e.g., in an inactive form, and activated by an exogenous agent to produce the pore forming active fragment. Moreover, using these mRNAs and other synthetic genetic models of gasdermin pore domain mediated pyroptosis, new metabolic regulation pathways of several gasdermin pore forming domains have been identified whereby cholesterol content within a cellular membrane is inversely related to functional pore formation. Thus, the depletion of cholesterol from cellular membranes e.g., via extraction, inhibition of transport, and inhibition of biosynthesis, can increase cellular vulnerability to gasdermin mediated pore formation. Consequently, polynucleotides encoding active gasdermins can be optionally combined with cholesterol depleting agents to cause cell rupture, which can be used to treat a variety of diseases and disorders.

[0106] The compositions and methods described herein may also be used to sensitize a tumor cell to an immunotherapy. For example, in some embodiments, the methods described herein are used to kill a tumor cell, e.g., that is non-responsive to an immunotherapy. The polypeptide can oligomerize to form a pore in an immune cell of the tumor, thereby causing pyroptosis of the immune cell that releases one or more proinflammatory cytokines. These proinflammatory cytokines can then activate and recruit one or more tumor infiltrating immune cells to kill a different cell in the tumor, e.g., thereby sensitizing the tumor to an immunotherapy. These methods cause pyroptosis triggering polynucleotides that turn non-immune responsive cold tumors into hot immune-response tumors to promote an antitumor immune response.

[0107] The present invention also features compositions and methods for activating endogenous gasdermins to produce the active forms of the pore-forming gasdermin within a cell. An activator of gasdermin is an agent that causes the inactive full length gasdermin to be converted into the active N- terminal pore forming fragment. By activating an endogenous gasdermin, the gasdermin oligomerizes into pores in cellular membranes to mediate IL-1 cytokine release and lytic cell death. Moreover, the depletion of cholesterol in combination with activation of endogenous gasdermin can increase cellular vulnerability to gasdermin mediated pore formation. Consequently, an activator of gasdermin can be optionally combined with cholesterol depleting agents to cause cell rupture, which can be used to treat a variety of diseases and disorders.

[0108] Gasdermins

[0109] A gasdermin may be from any naturally occurring or synthetic gasdermin (e.g., GSDMA, GSDMB, GSDMC, GSDMD, GSDME (DFNA5) and DFNB59 (Pejvakin)) or a variant or biologically active fragment having at least 65%, e.g., at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99%, or 100% sequence identity to any naturally occurring or synthetic gasdermin. A gasdermin includes full length gasdermin as well as fragments thereof, e.g., having at least 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 350, 400, 450, 500, or more amino acids. Gasdermins also encompass fragments thereof as well as polypeptides having at least 65%, e.g., at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99%, or 100% sequence identity thereto. Exemplary gasdermins are shown in Table 2.

[0110] Table 2. Exemplary Gasdermin Sequences

[0111]

[0112] In some embodiments, the GSDM is GSDMA, GSDMB, GSDMC, GSDMD, GSDME (DFNA5), or DFNB59, a biologically active pore forming fragment thereof, or a variant thereof having at least 65% (e.g., at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%) sequence identity thereto.

[0113] In some embodiments, the GSDM includes an amino acid sequence having at least 65% (e.g., at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%) sequence identity to any one of SEQ ID NOs: 1-16 or a fragment thereof.

[0114] In some embodiments, the GSDM fragment is an N-terminal GSDM fragment. In some embodiments, the N-terminal GSDM fragment includes an amino acid sequence having at least 65% (e.g., at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%) sequence identity to any one of SEQ ID NOs: 1 , 3, 5, 7, 9, 11 , 13, or 15.

[0115] In some embodiments, the GSDM includes an amino acid sequence having at least 65% (e.g., at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%) sequence identity to SEQ ID NO: 1.

[0116] In some embodiments, the GSDM includes an amino acid sequence having at least 65% (e.g., at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%) sequence identity to SEQ ID NO: 2.

[0117] In some embodiments, the GSDM includes an amino acid sequence having at least 65% (e.g., at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%) sequence identity to SEQ ID NO: 3.

[0118] In some embodiments, the GSDM includes an amino acid sequence having at least 65% (e.g., at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%) sequence identity to SEQ ID NO: 4.

[0119] In some embodiments, the GSDM includes an amino acid sequence having at least 65% (e.g., at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%) sequence identity to SEQ ID NO: 5.

[0120] In some embodiments, the GSDM includes an amino acid sequence having at least 65% (e.g., at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%) sequence identity to SEQ ID NO: 6.

[0121] In some embodiments, the GSDM includes an amino acid sequence having at least 65% (e.g., at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%) sequence identity to SEQ ID NO: 7. In some embodiments, the GSDM includes an amino acid sequence having at least 65% (e.g., at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%) sequence identity to SEQ ID NO: 8.

[0122] In some embodiments, the GSDM includes an amino acid sequence having at least 65% (e.g., at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%) sequence identity to SEQ ID NO: 9.

[0123] In some embodiments, the GSDM includes an amino acid sequence having at least 65% (e.g., at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%) sequence identity to SEQ ID NO: 10.

[0124] In some embodiments, the GSDM includes an amino acid sequence having at least 65% (e.g., at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%) sequence identity to SEQ ID NO: 11.

[0125] In some embodiments, the GSDM includes an amino acid sequence having at least 65% (e.g., at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%) sequence identity to SEQ ID NO: 12.

[0126] In some embodiments, the GSDM includes an amino acid sequence having at least 65% (e.g., at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%) sequence identity to SEQ ID NO: 13.

[0127] In some embodiments, the GSDM includes an amino acid sequence having at least 65% (e.g., at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%) sequence identity to SEQ ID NO: 14.

[0128] In some embodiments, the GSDM includes an amino acid sequence having at least 65% (e.g., at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%) sequence identity to SEQ ID NO: 15.

[0129] In some embodiments, the GSDM includes an amino acid sequence having at least 65% (e.g., at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%) sequence identity to SEQ ID NO: 16.

[0130] The polynucleotides described herein may encode two or more GSDMs. For example, the polynucleotide may encode 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, or more gasdermins. In some embodiments, the polynucleotide encodes a plurality of GSDMs. In some embodiments, each GSDM is separated by a cleavage site or an internal ribosomal entry site (IRES). In some embodiments, the cleavage site is a 2A cleavage site.

[0131] In some embodiments, each gasdermin independently has at least 65% (e.g., at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity to any one of SEQ ID NOs: 1-16 (see Table 2).

[0132] In some embodiments, each GSDM is independently, GSDMA, GSDMB, GSDMC, GSDMD, GSDME (DFNA5), or DFNB59, a biologically active pore forming fragment thereof, or a variant thereof having at least 65% (e.g., at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%) sequence identity thereto.

[0133] Polynucleotides

[0134] The invention features polynucleotides encoding a gasdermin polypeptide as described herein. The polynucleotide may be an RNA, such as a messenger RNA (mRNA) or circular RNA, encoding the polypeptide. In some embodiments, the RNA (e.g., mRNA) includes an open reading frame (ORF) encoding the polypeptide. In some embodiments, the mRNA further includes a 5' UTR, 3' UTR, a poly(A) tail, and / or a 5' cap analog. In some embodiments, the mRNA includes a chemical modification. In some embodiments, the mRNA is chemically modified with N1-methylpsuedouridine (m1qj). In some embodiments, each U in the sequence is a 1 N1-methylpsuedouridine (m1qj).

[0135] In some embodiments, the polynucleotide may be a DNA (e.g., circular DNA or a linear DNA). In some embodiments, the polynucleotide includes a nucleotide sequence having at least 65% (e.g., at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%) sequence identity to any one of SEQ ID NOs: 17-32 or a fragment thereof (see, e.g., Table 3). Exemplary polynucleotide sequences encoding gasdermins are shown in Table 3.

[0136] In some embodiments, the polynucleotide includes a nucleotide sequence having at least 65% (e.g., at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%) sequence identity to any one of SEQ ID NOs: 17, 19, 21 , 23, 25, 27, 29, or 31.

[0137] In some embodiments, the polynucleotide includes a nucleotide sequence having at least 65% (e.g., at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%) sequence identity to SEQ ID NO: 17.

[0138] In some embodiments, the polynucleotide includes a nucleotide sequence having at least 65% (e.g., at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%) sequence identity to SEQ ID NO: 18.

[0139] In some embodiments, the polynucleotide includes a nucleotide sequence having at least 65% (e.g., at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%) sequence identity to SEQ ID NO: 19.

[0140] In some embodiments, the polynucleotide includes a nucleotide sequence having at least 65% (e.g., at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%) sequence identity to SEQ ID NO: 20.

[0141] In some embodiments, the polynucleotide includes a nucleotide sequence having at least 65% (e.g., at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%) sequence identity to SEQ ID NO: 21.

[0142] In some embodiments, the polynucleotide includes a nucleotide sequence having at least 65% (e.g., at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%) sequence identity to SEQ ID NO: 22.

[0143] In some embodiments, the polynucleotide includes a nucleotide sequence having at least 65% (e.g., at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%) sequence identity to SEQ ID NO: 23.

[0144] In some embodiments, the polynucleotide includes a nucleotide sequence having at least 65% (e.g., at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%) sequence identity to SEQ ID NO: 24.

[0145] In some embodiments, the polynucleotide includes a nucleotide sequence having at least 65% (e.g., at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%) sequence identity to SEQ ID NO: 25.

[0146] In some embodiments, the polynucleotide includes a nucleotide sequence having at least 65% (e.g., at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%) sequence identity to SEQ ID NO: 26.

[0147] In some embodiments, the polynucleotide includes a nucleotide sequence having at least 65% (e.g., at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%) sequence identity to SEQ ID NO: 27. In some embodiments, the polynucleotide includes a nucleotide sequence having at least 65% (e.g., at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%) sequence identity to SEQ ID NO: 28.

[0148] In some embodiments, the polynucleotide includes a nucleotide sequence having at least 65% (e.g., at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%) sequence identity to SEQ ID NO: 29.

[0149] In some embodiments, the polynucleotide includes a nucleotide sequence having at least 65% (e.g., at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%) sequence identity to SEQ ID NO: 30.

[0150] In some embodiments, the polynucleotide includes a nucleotide sequence having at least 65% (e.g., at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%) sequence identity to SEQ ID NO: 31.

[0151] In some embodiments, the polynucleotide includes a nucleotide sequence having at least 65% (e.g., at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%) sequence identity to SEQ ID NO: 32.

[0152] One of skill in the art would recognize that the polynucleotide sequences described herein encompass both DNA and RNA sequences. Thus, a DNA sequence containing “T” also encompasses an RNA sequence containing a corresponding “U” at the same position. Accordingly, SEQ ID NOs: 17- 32 also include RNA sequences that include the same corresponding sequence but with U instead of T. Accordingly, the present disclosure includes an RNA (e.g., an mRNA) that includes a sequence having at least 65% (e.g., at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity to any one of SEQ ID NOs: 17-32.

[0153] Table 3. Gasdermin Polynucleotide Sequences

[0154]

[0155]

[0156]

[0157]

[0158]

[0159]

[0160]

[0161]

[0162]

[0163]

[0164]

[0165]

[0166]

[0167] In some embodiments, the polynucleotide is an RNA. In some embodiments, the RNA is a messenger RNA (mRNA). In some embodiments, the mRNA further includes a 5' UTR, 3' UTR, a poly(A) tail, and / or a 5' cap.

[0168] In some embodiments, the polynucleotide (e.g., mRNA) includes at least one synthetic modification. Suitable mRNA modifications are described, e.g., in Gao et al. Acta Biomater. 1 ; 131 :1- 15, 2021 , which is hereby incorporated by reference in its entirety.

[0169] In some embodiments, the at least one synthetic modification is a 5’ cap analog. In some embodiments, the 5’ cap analog is an m7GpppG, anti-reverse cap analog (ARCA), two-headed cap, S cap, or 2S cap. In some embodiments, the at least one synthetic modification is a tail modification. In some embodiments, the tail modification is a ribose-modified adenosine, 8-azaadenosine, cordycepin, or a fluorescent modification.

[0170] In some embodiments, the at least one synthetic modification is a modified nucleobase. In some embodiments, the modified nucleobase is N1-methylpsuedouridine (m1qj), 2-thiouridine (S2U), 5- methylcytidine (m5C), N6-methyladenosine (m6A), 2’-O-methyluridine (Um), 2’-O-methylcytidine (Cm), 2’-O-methyladenosine (Am), 2’-O-methylguanosine (Gm), 5’-methoxyuridine, 5-methylcytosine, 5- hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyladenine, 6- methylguanine, 2-propyladenine, 2-propylguanine, 2-thiouracil, 2-thiothymine, 2-thiocytosine, 5- halouracil, 5-halocytosine, 5-propynyluracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6- azothymine, 5-uracil (pseudouracil), 4-thiouracil, 8-haloadenine, 8-aminoadenine, 8-thioladenine, 8- thioalkyladenine, 8-hydroxyladenine, 8-haloguanine, 8-aminoguanine, 8-thiolguanine, 8- thioalkylguanine, 8-hydroxylguanine, 5-bromouracil, 5-trifluoromethyluracil, 5-bromocytosine, 5- trifluoromethylcytosine, 7-methylguanine, 7-methyladenine, 2-fluoroadenine, 8-azaguanine, 8- azaadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, or 3-deazaadenine.

[0171] In some embodiments, the at least one synthetic modification is a modified sugar. In some embodiments, the modified sugar is a 2’-0me or 2’-O-fluoro ribose modification. The modified sugar may be a bicyclic sugar, a 2’-O-methoxyethyl (2MOE) modified sugar, a 2’-O-methoxy (2-OMe) modified sugar, a 2’-methoxy modified sugar, a 2’-O-alkyl modified sugar, a constrained ethyl (cEt) modified sugar, a locked sugar, and an unlocked sugar.

[0172] In some embodiments, the mRNA has a plurality of synthetic modifications, e.g., one or more cap, tail, nucleobase, and ribose modifications.

[0173] Vectors and Cells

[0174] In another aspect, featured is a vector (e.g., an RNA or DNA vector) that includes a polynucleotide as described herein. Also featured is a cell that includes the vector or polynulceotide. In some embodiments, the vector is a viral vector (e.g., an RNA viral vector, such as a replicon RNA or self-amplifying RNA, or a DNA vector, such as a replication-deficient adenoviral vector selected from the group consisting of human adenovirus, rhesus adenovirus, simian adenovirus and gorilla adenovirus viral vectors).

[0175] Viral vectors

[0176] Also featured are viral vectors encoding the polypeptide that are suitable for administration to a subject, e.g., as a delivery vehicle or as a gene therapy.

[0177] Viral genomes provide a rich source of vectors that can be used for the efficient delivery of exogenous genes into a mammalian cell. Viral genomes are particularly useful vectors for gene delivery as the polynucleotides contained within such genomes are typically incorporated into the nuclear genome of a mammalian cell by generalized or specialized transduction. These processes occur as part of the natural viral replication cycle, and do not require added proteins or reagents in order to induce gene integration. Examples of viral vectors are a retrovirus (e.g., Retroviridae family viral vector), adenovirus (e.g., Ad5, Ad26, Ad34, Ad35, and Ad48), parvovirus, coronavirus, negative strand RNA viruses such as orthomyxovirus (e.g., influenza virus), rhabdovirus (e.g., rabies and vesicular stomatitis virus), paramyxovirus (e.g. measles and Sendai), positive strand RNA viruses, such as picornavirus and alphavirus, and double stranded DNA viruses including adenovirus, herpesvirus (e.g., Herpes Simplex virus types 1 and 2, Epstein-Barr virus, cytomegalovirus), and poxvirus (e.g., vaccinia, modified vaccinia Ankara (MVA), fowlpox and canarypox). Other viruses include Norwalk virus, togavirus, flavivirus, reoviruses, papovavirus, hepadnavirus, human papilloma virus, human foamy virus, and hepatitis virus, for example. Examples of retroviruses are avian leukosis-sarcoma, avian C-type viruses, mammalian C-type, B-type viruses, D-type viruses, oncoretroviruses, HTLV-BLV group, lentivirus, alpharetrovirus, gammaretrovirus, spumavirus (Coffin, J. M., Retroviridae: The viruses and their replication, Virology, Third Edition (Lippincott-Raven, Philadelphia, (1996))). Other examples are murine leukemia viruses, murine sarcoma viruses, mouse mammary tumor virus, bovine leukemia virus, feline leukemia virus, feline sarcoma virus, avian leukemia virus, human T-cell leukemia virus, baboon endogenous virus, Gibbon ape leukemia virus, Mason Pfizer monkey virus, simian immunodeficiency virus, simian sarcoma virus, Rous sarcoma virus and lentiviruses. Other examples of vectors are described, for example, in McVey et al., (US 5,801 ,030), the teachings of which are incorporated herein by reference.

[0178] Retroviral vectors

[0179] The delivery vector used in the methods and compositions described herein may be a retroviral vector. One type of retroviral vector that may be used in the methods and compositions described herein is a lentiviral vector. Lentiviral vectors (LVs), a subset of retroviruses, transduce a wide range of dividing and non-dividing cell types with high efficiency, conferring stable, long-term expression of the transgene encoding the polypeptide or RNA. An overview of optimization strategies for packaging and transducing LVs is provided in Delenda, The Journal of Gene Medicine 6: S125 (2004), the disclosure of which is incorporated herein by reference.

[0180] The use of lentivirus-based gene transfer techniques relies on the in vitro production of recombinant lentiviral particles carrying a highly deleted viral genome in which the agent of interest is accommodated. In particular, the recombinant lentivirus are recovered through the in trans coexpression in a permissive cell line of (1) the packaging constructs, i.e., a vector expressing the Gag-Pol precursors together with Rev (alternatively expressed in trans); (2) a vector expressing an envelope receptor, generally of an heterologous nature; and (3) the transfer vector, consisting in the viral cDNA deprived of all open reading frames, but maintaining the sequences required for replication, encapsidation, and expression, in which the sequences to be expressed are inserted. A LV used in the methods and compositions described herein may include one or more of a 5'-Long terminal repeat (LTR), HIV signal sequence, HIV Psi signal 5'-splice site (SD), delta-GAG element, Rev Responsive Element (RRE), 3'-splice site (SA), elongation factor (EF) 1 -alpha promoter and 3'-self inactivating LTR (SIN-LTR). The lentiviral vector optionally includes a central polypurine tract (cPPT) and a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE), as described in US 6,136,597, the disclosure of which is incorporated herein by reference as it pertains to WPRE. The lentiviral vector may further include a pHR' backbone, which may include for example as provided below.

[0181] The Lentigen LV described in Lu et al., Journal of Gene Medicine 6:963 (2004) may be used to express the DNA molecules and / or transduce cells. A LV used in the methods and compositions described herein may a 5'-Long terminal repeat (LTR), HIV signal sequence, HIV Psi signal 5'-splice site (SD), delta-GAG element, Rev Responsive Element (RRE), 3'-splice site (SA), elongation factor (EF) 1 -alpha promoter and 3'-self inactivating L TR (SIN-LTR). It will be readily apparent to one skilled in the art that optionally one or more of these regions is substituted with another region performing a similar function.

[0182] Enhancer elements can be used to increase expression of modified DNA molecules or increase the lentiviral integration efficiency. The LV used in the methods and compositions described herein may include a nef sequence. The LV used in the methods and compositions described herein may include a cPPT sequence which enhances vector integration. The cPPT acts as a second origin of the (+)-strand DNA synthesis and introduces a partial strand overlap in the middle of its native HIV genome. The introduction of the cPPT sequence in the transfer vector backbone strongly increased the nuclear transport and the total amount of genome integrated into the DNA of target cells. The LV used in the methods and compositions described herein may include a Woodchuck Posttranscriptional Regulatory Element (WPRE). The WPRE acts at the transcriptional level, by promoting nuclear export of transcripts and / or by increasing the efficiency of polyadenylation of the nascent transcript, thus increasing the total amount of mRNA in the cells. The addition of the WPRE to LV results in a substantial improvement in the level of expression from several different promoters, both in vitro and in vivo. The LV used in the methods and compositions described herein may include both a cPPT sequence and WPRE sequence. The vector may also include an IRES sequence that permits the expression of multiple polypeptides from a single promoter.

[0183] In addition to IRES sequences, other elements which permit expression of multiple polypeptides are useful. The vector used in the methods and compositions described herein may include multiple promoters that permit expression more than one polypeptide. The vector used in the methods and compositions described herein may include a protein cleavage site that allows expression of more than one polypeptide. Examples of protein cleavage sites that allow expression of more than one polypeptide are described in Klump et al., Gene Ther.; 8:811 (2001), Osborn et al., Molecular Therapy 12:569 (2005), Szymczak and Vignali, Expert Opin Biol Ther. 5:627 (2005), and Szymczak et al., Nat Biotechnol. 22:589 (2004), the disclosures of which are incorporated herein by reference as they pertain to protein cleavage sites that allow expression of more than one polypeptide. It will be readily apparent to one skilled in the art that other elements that permit expression of multiple polypeptides identified in the future are useful and may be utilized in the vectors suitable for use with the compositions and methods described herein.

[0184] The viral vectors (e.g., retroviral vectors, e.g., lentiviral vectors) may include a promoter operably coupled to the transgene encoding the polypeptide or the polynucleotide encoding the RNA to control expression. The promoter may be a ubiquitous promoter. Alternatively, the promoter may be a tissue specific promoter. Cholesterol Depleting Agents

[0185] In some embodiments, the compositions and methods described herein include a cholesterol depleting agent, e.g., to sensitize a cell to gasdermin pore formation. The depletion of cholesterol from cellular membranes may be performed by extraction, inhibition of transport, and / or inhibition of biosynthesis, e.g., to increase cellular vulnerability to gasdermin mediated pore formation. In some embodiments, the cholesterol depleting agent includes a methyl cyclodextrin, a Niemann-Pick C1 (NPC1) inhibitor, a statin, a squalene epoxidase inhibitor, an oxysterol, or a 7-Dehydrocholesterol reductase (DHCR7) inhibitor. In some embodiments, the methyl cyclodextrin is methyl-p-cyclodextrin (MCD). In some embodiments, the statin is fatostatin. In some embodiments, the squalene epoxidase inhibitor is NB598. In some embodiments, the DHCR7 inhibitor is AY9944. In some embodiments, the oxysterol is 25-hydroxycholesterol or 24-S-hydroxycholesterol.

[0186] Featured herein is a kit or combination therapy (e.g., a composition or plurality of compositions) that includes a polynucleotide as described herein, a cell or vector containing the same, or a pharmaceutical composition containing the same, and an agent that depletes cholesterol, e.g., as described above. The cholesterol depleting agent may be formulated together with the polynucleotide, vector, or cell, e.g., in the same pharmaceutical composition. Alternatively, the cholesterol depleting agent may be formulated separately from the polynucleotide, vector, or cell, e.g., in a separate pharmaceutical composition.

[0187] Activators of Gasdermin

[0188] The methods described herein include administering or contacting a cell with an activator of endogenous gasdermin. Gasdermins are often endogenously expressed in a cell in an inactive full- length form. An activator of gasdermin is an agent that causes the inactive full length gasdermin to be converted into the active N-terminal pore forming fragment. The activation of endogenous gasdermin or delivery of an exogenous gasdermin can each cause pore formation in a target cell. In some embodiments, the endogenous gasdermin is GSDMA, GSDMB, GSDMC, GSDMD, GSDME (DFNA5), or DFNB59.

[0189] In some embodiments, the gasdermin activator includes radiation, a chemotherapeutic agent, or a protease. In some embodiments, the protease is a caspase. In some embodiments, the caspase is caspase-1 , caspase-3, caspase-4, caspase-5, caspase-7, or caspase-8. In some embodiments, the chemotherapeutic agent is doxorubicin, etoposide, cisplatin, topotecan, mitoxantrone, actinomycin-D, or talabostat. The method may further include administering an immune checkpoint inhibitor, such as an anti-PD-1 immunotherapy.

[0190] Immune Checkpoint Inhibitor Therapies

[0191] The compositions and methods described herein may employ an immune checkpoint inhibitor therapy, e.g., optionally in combination with a gasdermin and / or a cholesterol depleting agent. In some embodiments, the immune checkpoint inhibitor is an anti-PD1 antibody or a PD1 inhibitor. For example, the anti-PD1 antibody or PD1 inhibitor may be pembrolizumab, nivolumab, cemiplimab, dostarlimab, retifanlimab, toripalimab, vopratelimab, spartalizumab, camrelizumab, sintilimab, tislelizumab, INCMGA00012, AMP-224, AMP-514, or acrixolimab.

[0192] In some embodiments, the immune checkpoint inhibitor is an anti-PD-L1 antibody or a PD-L1 inhibitor. For example, the anti-PDL-1 antibody or PDL-1 inhibitor may be atezolizumab, avelumab, durvalumab, KN035, Cosibelimab, AUNP12, CA-170, or BMS-986189.

[0193] Other immune checkpoint inhibitor therapies are known in the art (see, e.g., Liu et al. Frontiers pharmacol. 12: 731798, 2021 , which is hereby incorporated by reference).

[0194] Pharmaceutical Compositions

[0195] The polynucleotides, cholesterol depleting agents, activators of gasdermin, and / or immune checkpoint inhibitors described herein can be formulated as pharmaceutical compositions for administration to human subjects in a biologically compatible form suitable for administration in vivo.

[0196] The compositions described herein may be administered to a subject (e.g., a human) in a variety of forms depending on the selected route of administration, as will be understood by those skilled in the art. The compositions described herein may be administered, for example, by any route that allows the composition (e.g., the polynucleotide) to reach the target cells. The composition may be administered, for example, by oral, parenteral, intrathecal, intracerebroventricular, intraparenchymal, buccal, sublingual, nasal, rectal, patch, pump, or transdermal administration and the pharmaceutical compositions formulated accordingly. Parenteral administration includes intravenous, intraperitoneal, subcutaneous, intramuscular, transepithelial, nasal, intrapulmonary, intrathecal, intracerebroventricular, intraparenchymal, rectal, and topical modes of administration. In one embodiment, the composition is administered via aero Parenteral administration may be by continuous infusion over a selected period of time. In some preferred embodiments, the compositions described herein are administered via inhalation.

[0197] Certain compositions described herein may be administered, e.g., by inhalation. Inhalation may be oral inhalation or nasal inhalation. An inhalable composition described herein may be provided as a liquid dosage form or dry powder dosage form. A dry powder composition may be, e.g., administered by inhalation as is or after reconstitution in a vehicle (e.g., saline (e.g., isotonic saline), phosphate-buffered saline, or water).

[0198] A composition described herein may be orally administered, for example, with an inert diluent or with an assimilable edible carrier, or it may be enclosed in hard- or soft-shell gelatin capsules, or it may be compressed into tablets, or it may be incorporated directly with the food of the diet. For oral therapeutic administration, a composition described herein may be incorporated with an excipient and used in the form of ingestible tablets, buccal tablets, troches, capsules, elixirs, suspensions, syrups, and wafers. A composition described herein may also be administered parenterally. Solutions of a composition described herein can be prepared in water suitably mixed with a surfactant, such as hydroxypropylcellulose. Dispersions can also be prepared in glycerol, liquid polyethylene glycols, DMSO, and mixtures thereof with or without alcohol, and in oils. Under ordinary conditions of storage and use, these preparations may contain a preservative to prevent the growth of microorganisms. Conventional procedures and ingredients for the selection and preparation of suitable formulations are described, for example, in Remington’s Pharmaceutical Sciences (2012, 22nd ed.) and in The United States Pharmacopeia: The National Formulary (USP 41 NF 36), published in 2018. The pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In all cases the form must be sterile and must be fluid to the extent that may be easily administered via syringe. Compositions suitable for buccal or sublingual administration include tablets, lozenges, and pastilles, where the active ingredient is formulated with a carrier, such as sugar, acacia, tragacanth, gelatin, and glycerin. Compositions for rectal administration are conveniently in the form of suppositories containing a conventional suppository base, such as cocoa butter.

[0199] The composition described herein may be administered to an animal, e.g., a human, alone or in combination with pharmaceutically acceptable carriers, as noted herein, the proportion of which is determined by the solubility and chemical nature of the composition, chosen route of administration, and standard pharmaceutical practice.

[0200] In general, the dosage of a pharmaceutical composition or the active agent in a pharmaceutical composition may be in the range of from about 1 pg to about 10 g (e.g., 1 pg-10 pg, e.g., 2 pg, 3 pg, 4 pg, 5 pg, 6 pg, 7 pg, 8 pg, 9 pg, 10 pg, e.g., 10 pg-100 pg, e.g., 20 pg, 30 pg, 40 pg, 50 pg, 60 pg, 70 pg, 80 pg, 90 pg, 100 pg, e.g., 100 pg-1 ng, e.g., 200 pg, 300 pg, 400 pg, 500 pg, 600 pg, 700 pg, 800 pg, 900 pg, 1 ng, e.g., 1 ng-10 ng, e.g, 2 ng, 3 ng, 4 ng, 5 ng, 6 ng, 7 ng, 8 ng, 9 ng, 10 ng, e.g., 10 ng - 100 ng, e.g., 20 ng, 30 ng, 40 ng, 50 ng, 60 ng, 70 ng, 80 ng, 90 ng, 100 ng, e.g., 100 ng-1 pg, e.g., 200 ng, 300 ng, 400 ng, 500 ng, 600 ng, 700 ng, 800 ng, 900 ng, 1 pg, e.g., 1- 10 pg, e.g., 1 pg, 2 pg, 3 pg, 4 pg, 5 pg, 6 pg, 7 pg, 8 pg, 9 pg, 10 pg, e.g., 10 pg-100 pg, e.g., 20 pg, 30 pg, 40 pg, 50 pg, 60 pg, 70 pg, 80 pg, 90 pg, 100 pg, e.g., 100 pg - 1 mg, e.g., 200 pg, 300 pg, 400 pg, 500 pg, 600 pg, 700 pg, 800 pg, 900 pg, 1 mg, e.g., 1 mg-10 mg, e.g., 2 mg, 3 mg, 4 mg, 5 mg, 6 mg, 7 mg, 8 mg, 9 mg, 10 mg, e.g., 10 mg - 100 mg, e.g., 20 mg, 30 mg, 40 mg, 50 mg, 60 mg, 70 mg, 80 mg, 90 mg, 100 mg, e.g., 100 mg-1 g, e.g., 200 mg, 300 mg, 400 mg, 500 mg, 600 mg, 700 mg, 800 mg, 900 mg, 1 g, e.g., 1 g-10 g, e.g., 2 g, 3 g, 4 g, 5 g, 6 g, 7 g, 8 g, 9 g, 10 g).

[0201] The pharmaceutical composition may also be administered as in a unit dose form or as a dose per mass or weight of the patient from about 0.01 mg / kg to about 100 mg / kg (e.g., 0.01 -0.1 mg / kg, e.g., 0.02 0.03 mg / kg, 0.04 mg / kg, 0.05 mg / kg, 0.06 mg / kg, 0.07 mg / kg, 0.08 mg / kg, 0.09 mg / kg, 0.1 mg / kg, e.g., 0.1-1 mg / kg, e.g., 0.2 mg / kg, 0.3 mg / kg, 0.4 mg / kg, 0.5 mg / kg, 0.6 mg / kg, 0.7 mg / kg, 0.8 mg / kg, 0.9 mg / kg, 1 mg / kg, e.g., 1-10 mg / kg, e.g., 1 mg / kg, 2 mg / kg, 3 mg / kg, 4 mg / kg, 5 mg / kg, 6 mg / kg, 7 mg / kg, 8 mg / kg, 9 mg / kg, 10 mg / kg, e.g., 10-100 mg / kg, e.g., 20 mg / kg, 30 mg / kg, 40 mg / kg, 50 mg / kg, 60 mg / kg, 70 mg / kg, 80 mg / kg, 90 mg / kg, 100 mg / kg). The dose may also be administered as a dose per mass or weight of the patient per unit day (e.g., 0.1 -10 mg / kg / day).

[0202] The dosage of the compositions (e.g., a composition including a polynucleotide) described herein, can vary depending on many factors, such as the pharmacodynamic properties of the polynucleotide, the mode of administration, the age, health, and weight of the recipient, the nature and extent of the symptoms, the frequency of the treatment, and the type of concurrent treatment, if any, and the clearance rate of the composition in the animal to be treated. The compositions described herein may be administered initially in a suitable dosage that may be adjusted as required, depending on the clinical response. In some embodiments, the dosage of a composition (e.g., a composition including a polynucleotide) is a prophylactically or a therapeutically effective amount. Furthermore, it is understood that all dosages may be continuously given or divided into dosages given per a given time frame. The composition can be administered, for example, every hour, day, week, month, or year. In some embodiments, the composition may be administered continuously or systemically.

[0203] The pharmaceutical compositions described herein (e.g., containing a polynucleotide) may be provided in a kit that includes the pharmaceutical composition (e.g., in a container) and instructions for use thereof. The kit may contain one or more containers, in which each container contains a different composition of the invention (e.g., one container with a polynucleotide and one container with a cholesterol depleting agent). The instructions enclosed with the kit may be used to instruct a user to perform a method as described herein. The kit may include a polynucleotide as described herein and an agent that depletes cholesterol. The kit may include an activator of an endogenous gasdermin and an agent that depletes cholesterol. The kit may further include an immune checkpoint inhibitor, such as an anti-PD-1 immunotherapy.

[0204] Lipids

[0205] The compositions described herein may include one or more lipids useful for formulating a polynucleotide for delivery. Lipid-based structures include a defined complex of lipids held together by noncovalent bonds, such as hydrogen bonds, Van der Waals forces, electrostatic interactions, hydrophobic effect, and Pi-Pi interactions. Lipid-based structures may include large complexes of molecules that form sphere-, rod-, or sheet-like structures. Lipid-based structures include, for example, micelles, liposomes, and lipid nanoparticles (LNPs). Lipid-based structures may have a predetermined size. The size of the structure may vary based on the components (e.g., polynucleotide) packed within the structure.

[0206] The Z-average mean particle diameter of the lipid-based structure may vary from, e.g., about 10 nm to about 1000 nm (e.g., from about 10 nm to about 500 nm, or from about 10 nm to about 250 nm). When the structure is an LNP or micelle, the Z-average mean particle diameter may be from about 75 nm to about 250 nm. When the lipid-based structure is a vesicle (e.g., a liposome), the Z- average mean particle diameter may be from about 250 nm to about 750 nm. Non-limiting examples of the Z-average mean particle diameters include, e.g., from about 75 nm to about 100 nm, e.g., from 75 nm to about 85 nm, e.g., about 80 nm, e.g., from about 80 nm to about 140 nm, from about 90 nm to about 130 nm, or from about 110 nm to about 130 nm, e.g., about 120 nm, e.g., from about 200 nm to about 300 nm, e.g., from about 250 nm to about 300 nm, from about 260 nm to about 290 nm, from about 260 nm to about 280 nm, from about 265 nm to about 275 nm, e.g., about 270 nm, e.g., from about 300 nm to about 400 nm, from about 400 nm to about 600 nm, e.g., from about 450 nm to about 550 nm, from about 475 nm to about 525 nm, from about 480 nm to about 520 nm, from about 490 nm to about 510 nm, from about 495 nm to about 505 nm, e.g., about 500 nm, e.g., about 10 nm, about 15 nm, about 20 nm about 25 nm, about 30 nm about 35 nm, about 40 nm, about 45 nm, about 50 nm, about 55 nm, about 60 nm, about 65 nm, about 70 nm, about 75 nm, about 80 nm, about 85 nm, about 90 nm, about 95 nm, about 100 nm, about 105 nm, about 110 nm, about 115 nm, about 120 nm, about 125 nm, about 130 nm, about 135 nm, about 140 nm, about 145 nm, about 150 nm, about 155 nm, about 160 nm, about 165 nm, about 170 nm, about 175 nm, about 180 nm, about 185 nm, about 190 nm, about 195 nm, about 200 nm, about 205 nm, about 210 nm, about 215 nm, about 220 nm, about 225 nm, about 230 nm, about 235 nm, about 240 nm, about 245 nm, about 250 nm, about 255 nm, about 260 nm, about 265 nm, about 270 nm, about 275 nm, about 280 nm, about 285 nm, about 290 nm, about 295 nm, about 300 nm, about 305 nm, about 310 nm, about 315 nm, about 320 nm, about 325 nm, about 330 nm, about 335 nm, about 340 nm, about 345 nm, about 350 nm, about 355 nm, about 360 nm, about 365 nm, about 370 nm, about 375 nm, about 380 nm, about 385 nm, about 390 nm, about 395 nm, about 400 nm, about 405 nm, about 410 nm, about 415 nm, about 420 nm, about 425 nm, about 430 nm, about 435 nm, about 440 nm, about 445 nm, about 450 nm, about 455 nm, about 460 nm, about 465 nm, about 470 nm, about 475 nm, about 480 nm, about 485 nm, about 490 nm, about 495 nm, about 500 nm, about 505 nm, about 510 nm, about 515 nm, about 520 nm, about 525 nm, about 530 nm, about 535 nm, about 540 nm, about 545 nm, about 550 nm, about 555 nm, about 560 nm, about 565 nm, about 570 nm, about 575 nm, about 580 nm, about 585 nm, about 590 nm, about 595 nm, about 600 nm, about 605 nm, about 610 nm, about 615 nm, about 620 nm, about 625 nm, about 630 nm, about 635 nm, about 640 nm, about 645 nm, about 650 nm, about 655 nm, about 660 nm, about 665 nm, about 670 nm, about 675 nm, about 680 nm, about 685 nm, about 690 nm, about 695 nm, about 700 nm, about 705 nm, about 710 nm, about 715 nm, about 720 nm, about 725 nm, about 730 nm, about 735 nm, about 740 nm, about 745 nm, about 750 nm, about 755 nm, about 760 nm, about 765 nm, about 770 nm, about 780 nm, about 785 nm, about 780 nm, about 785 nm, about 790 nm, about 795 nm, about 800 nm, about 805 nm, about 810 nm, about 815 nm, about 820 nm, about 825 nm, about 830 nm, about 835 nm, about 840 nm, about 845 nm, about 850 nm, about 855 nm about 860 nm, about 865 nm, about 870 nm, about 875 nm, about 880 nm, about 885 nm, about 890 nm, about 895 nm, about 900 nm, about 905 nm, about 910 nm, about 915 nm, about 920 nm, about 925 nm, about 930 nm, about 935 nm, about 940 nm, about 945 nm, about 950 nm, about 955 nm, about 960 nm, about 965 nm, about 970 nm, about 975 nm, about 980 nm, about 985 nm, about 990 nm, or about 1 ,000 nm.

[0207] In particular embodiments, the structure (e.g., LNP) has a Z-average mean particle diameter from about 10 nm to about 500 nm (e.g., from about 10 nm to about 250 nm, e.g., about 10 nm, 20 nm, 30 nm, 40 nm, 50 nm, 60 nm, 70 nm, 80 nm, 90 nm, 100 nm, 110 nm, 120 nm, 130 nm, 140 nm, 150 nm, 160 nm, 170 nm, 180 nm, 190 nm, 200 nm, 250 nm, 300 nm, 350 nm, 400 nm, 450 nm, or 500 nm) as measured by dynamic light scattering (DLS). In some embodiments, the composition contains lipid nanoparticles and at least 90% (e.g., at least 95%, at least 97%, at least 99%, or substantially all) of the nanoparticles in the composition have a diameter from about 10 nm to about 500 nm (e.g., from about 10 nm to about 250 nm, e.g., about 10 nm, 20 nm, 30 nm, 40 nm, 50 nm, 60 nm, 70 nm, 80 nm, 90 nm, 100 nm, 110 nm, 120 nm, 130 nm, 140 nm, 150 nm, 160 nm, 170 nm, 180 nm, 190 nm, 200 nm, 250 nm, 300 nm, 350 nm, 400 nm, 450 nm, or 500 nm) as measured by dynamic light scattering (DLS). The mean particle diameter may be measured by zeta potential, dynamic light scattering (DLS), electrophoretic light scattering (ELS), static light scattering (SLS), molecular weight, electrophoretic mobility, size exclusion chromatography (SEC), field flow fractionation, or other methods known in the art. In some embodiments, the mean particle diameter is measured by DLS. One of skill in the art would appreciate that a population of structures (e.g., liposomes, LNPs, or micelles) may have a range of Z-average mean particle diameters within the population. Thus, the population may be polydisperse. The population may have a polydispersity index of 0.3 or less (e.g., 0.05 to 0.3). The polydispersity index can be determined using DLS (see, e.g., ISO 22412:2017).

[0208] The Lipid-based structures may include an endosomal escape moiety. Lipid-based structures including an endosomal escape moiety may provide for an improved cytosolic delivery of the cargo (e.g., a therapeutic agent) included in the structure. Endosomal escape moieties are known in the art. Preferably, an endosomal escape moiety is an ionizable lipid. The ionizable lipids may also serve as structure-layer forming lipids. Non-limiting examples of ionizable lipids include those described in, e.g., WO 2019 / 067875; WO 2018 / 191750; and US 9,999,671 , which are herein incorporated by reference in their entirety. Other endosomal escape moieties include, for example, fusogenic lipids (e.g., dioleoylphosphatidyl-ethanolamine (DOPE)); and polymers such as polyethylenimine (PEI); poly(beta-amino ester)s; polypeptides, such as polyarginines (e.g., octaarginine) and polylysines (e.g., octalysine); proton sponges, viral capsids, and peptide transduction domains as described herein. For example, fusogenic peptides can be derived from the M2 protein of influenza A viruses; peptide analogs of the influenza virus hemagglutinin; the HEF protein of the influenza C virus; the transmembrane glycoprotein of filovi ruses; the transmembrane glycoprotein of the rabies virus; the transmembrane glycoprotein (G) of the vesicular stomatitis virus; the fusion protein of the Sendai virus; the transmembrane glycoprotein of the Semliki forest virus; the fusion protein of the human respiratory syncytial virus (RSV); the fusion protein of the measles virus; the fusion protein of the Newcastle disease virus; the fusion protein of the visna virus; the fusion protein of murine leukemia virus; the fusion protein of the HTL virus; and the fusion protein of the simian immunodeficiency virus (SIV). Other moieties that can be employed to facilitate endosomal escape are described in Dominska et al., Journal of Cell Science, 123(8): 1183-1189, 2010. Specific examples of endosomal escape moieties including moieties suitable for inclusion in, or conjugation to, to the lipid-based structures disclosed herein are provided, e.g., in WO 2015 / 188197; the disclosure of these endosomal escape moieties is incorporated by reference herein.

[0209] In some embodiments, the lipid-based structures include a lipid that is a phospholipid.

[0210] In some embodiments, the lipid is a cationic lipid. In some embodiments, the cationic lipid is 4-(dimethylamino)-butanoic acid, (10Z,13Z)-1-(9Z,12Z)-9,12-octadecadien-1-yl-10,13-nonadecadien- 1-yl ester (DLin-MC3-DMA), 1 ,2-dioleoyl-3-dimethylammonium-propane (DODAP), 1 ,2-dioleyloxy-3- dimethylaminopropane (DODMA), N,N-dimethyl-2,2-di-(9Z,12Z)-9,12-octadecadien-1-yl-1 ,3- dioxolane-4-ethanamine (DLin-KC2-DMA), 4-(dimethylamino)-butanoic acid, (10Z,13Z)-1-(9Z,12Z)- 9,12-octadecadien-1-yl-10,13-nonadecadien-1-yl ester (DLin-MC3-DMA), OF-02, 3,6-bis({4-[bis(2- hydroxydodecyl)amino]butyl})piperazine-2, 5-dione (CKK-E12), 1 ,1 ‘-((2-(4-(2-((2-(bis(2- hydroxydodecyl)amino)ethyl) (2-hydroxydodecyl)amino)ethyl)piperazin-1- yl)ethyl)azanediyl)bis(dodecan-2-ol) (C12-200), or 2-(dioctylamino)ethyl nonyl hydrogen phosphate (9A1 P9). OF-02 is described, e.g., in Fenton, et al. Advanced Mater. 28: 2939-2943, 2016, which is herein incorporated by reference in its entirety.

[0211] In some embodiments, the lipid is a PEGylated lipid. In some embodiments, the PEGylated lipid is 1 ,2-Dimyristoyl-sn-glycero-3-methoxypolyethylene glycol (DMG-PEG). For example, the DMP- PEG may be DMG-PEG 2000.

[0212] In some embodiments, the lipid is an anionic or neutral lipid. In some embodiments, the lipid is an anionic lipid. In some embodiments, the lipid is a neutral lipid. In some embodiments, the neutral lipid is 1 ,2-Dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE).

[0213] In some embodiments, the lipid is a sterol. The sterol may be, for example, cholesterol or a derivative thereof.

[0214] Lipid Nanoparticles

[0215] In some embodiments, the polynucleotide is formulated as a lipid nanoparticle (LNP). For example, in some embodiments, an mRNA encoding the polypeptide is formulated as an LNP for administration to a subject. In some embodiments, the mRNA includes a chemical modification. In some embodiments, the mRNA is chemically modified with N1-methylpsuedouridine (m1qj). In some embodiments, each U in the sequence is a N1-methylpsuedouridine (m1qj).

[0216] LNPs are extremely useful for systemic applications, as they exhibit extended circulation lifetimes following intravenous (i.v.) injection and accumulate at distal sites (e.g., sites physically separated from the administration site). The LNPs may have a mean diameter of about 10 nm to about 500 nm, 10 nm to about 250 nm, 50 nm to about 200 nm, such as about 50 nm to about 15 nm, about 60 nm to about 130 nm, about 70 nm to about 110 nm, or about 70 nm to about 90 nm, and are substantially nontoxic. The diameter may be measured, e.g., by dynamic light scattering (DLS) or another comparable method.

[0217] In one embodiment, the lipid to drug ratio (mass / mass ratio) (e.g., lipid to polynucleotide ratio) will be in the range of from about 1 :1 to about 50:1 , from about 1 :1 to about 25:1 , from about 3:1 to about 15:1 , from about 4:1 to about 10:1 , from about 5:1 to about 9:1 , or about 6:1 to about 9:1 . Ranges intermediate to the above recited ranges are also contemplated to be part of the invention. Non-limiting examples of cationic lipids include N,N-dioleyl-N,N-dimethylammonium chloride (DODAC), N,N-distearyl-N,N-dimethylammonium bromide (DDAB), N-(l-(2,3-dioleoyloxy)propyl)- N,N,N-trimethylammonium chloride (DOTAP), N-(l-(2,3-dioleyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTMA), N,N-dimethyl-2,3-dioleyloxy)propylamine (DODMA), 1 ,2-DiLinoleyloxy-N,N- dimethylaminopropane (DLinDMA), 1 ,2-Dilinolenyloxy-N,N-dimethylaminopropane (DLenDMA), 1 ,2- Dilinoleylcarbamoyloxy-3-dimethylaminopropane (DLin-C-DAP), 1 ,2-Dilinoleyoxy-3- (dimethylamino)acetoxypropane (DLin-DAC), 1 ,2-Dilinoleyoxy-3-morpholinopropane (DLin-MA), 1 ,2- Dilinoleoyl-3-dimethylaminopropane (DLinDAP), 1 ,2-Dilinoleylthio-3-dimethylaminopropane (DLin-S- DMA), 1-Linoleoyl-2-linoleyloxy-3-dimethylaminopropane (DLin-2-DMAP), 1 ,2-Dilinoleyloxy-3- trimethylaminopropane chloride salt (DLin-TMA.CI), 1 ,2-Dilinoleoyl-3-trimethylaminopropane chloride salt (DLin-TAP.CI), 1 ,2-Dilinoleyloxy-3-(N-methylpiperazino)propane (DLin-MPZ), or 3-(N,N- Dilinoleylamino)-1 ,2-propanediol (DLinAP), 3-(N,N-Dioleylamino)-1 ,2-propanedio (DOAP), 1 ,2- Dilinoleyloxo-3-(2-N,N-dimethylamino)ethoxypropane (DLin-EG-DMA), 1 ,2-Dilinolenyloxy-N,N- dimethylaminopropane (DLinDMA), 2,2-Dilinoleyl-4-dimethylaminomethyl-[1 ,3]-dioxolane (DLin-K- DMA) or analogs thereof, (3aR,5s,6aS)-N,N-dimethyl-2,2-di((9Z,12Z)-octadeca-9,12- dienyetetrahydro- 3aH-cyclopenta[d][1 ,3]dioxol-5-amine (ALN100), (6Z,9Z,28Z,31Z)-heptatriaconta- 6,9,28,31 -tetraen-19-yl4-(dimethylamino)butanoate (MC3), 1 ,1'-(2-(4-(2-((2-(bis(2- hydroxydodecyl)amino)ethyl)(2-hydroxydodecyl)amino)ethyl)piperazin-1-yeethylazanediyedidodecan- 2-ol (Tech G1), or a mixture thereof. The cationic lipid can include, for example, from about 20 mol % to about 50 mol % or about 40 mol % of the total lipid present in the particle.

[0218] The ionizable / non-cationic lipid can be an anionic lipid or a neutral lipid including, but not limited to, distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), dioleoyl-phosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoylphosphatidylethanolamine (POPE), dioleoyl-phosphatidylethanolamine 4-(N-maleimidomethyl)-cyclohexane-1 -carboxylate (DOPE-mal), dipalmitoyl phosphatidyl ethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), distearoyl- phosphatidyl-ethanolamine (DSPE), 16-O-monomethyl PE, 16-O-dimethyl PE, 18-1 -trans PE, 1- stearoyl-2-oleoyl-phosphatidyethanolamine (SOPE), cholesterol, 1 ,2-dioleoyl-sn-glycero-3-phospho-L- serine (sodium salt, DOPS), or a mixture thereof. The non-cationic lipid can be, for example, from about 5 mol % to about 90 mol %, about 10 mol %, or about 60 mol % if cholesterol is included, of the total lipid present in the particle.

[0219] The conjugated lipid that inhibits aggregation of particles can be, for example, a polyethyleneglycol (PEG)-lipid including, without limitation, a PEG-diacylglycerol (DAG), a PEG- dialkyloxypropyl (DAA), a PEG-phospholipid, a PEG-ceramide (Cer), or a mixture thereof. The PEG- DAA conjugate can be, for example, a PEG-dilauryloxypropyl (C12), a PEG-dimyristyloxypropyl (C14), a PEG-dipalmityloxypropyl (Cie), or a PEG-distearyloxypropyl (Cis). The conjugated lipid that prevents aggregation of particles can be, for example, from 0 mol % to about 20 mol % or about 2 mol % of the total lipid present in the particle.

[0220] In some embodiments, the LNP further includes cholesterol at, e.g., about 10 mol % to about 60 mol % or about 50 mol % of the total lipid present in the particle.

[0221] Liposomes

[0222] Liposomes are useful for the transfer and delivery of polynucleotides. Because the liposomal membrane is structurally similar to biological membranes, when liposomes are applied to a tissue, the liposomal bilayer fuses with bilayer of the cellular membranes. As the merging of the liposome and cell progresses, the internal aqueous contents that include the polynucleotide are delivered into the cell where the polynucleotide can be targeted to the nucleus. The composition of the liposome is usually a combination of phospholipids, usually in combination with steroids, such as cholesterol. Other phospholipids or other lipids may also be used. The physical characteristics of liposomes depend on pH, ionic strength, and the presence of divalent cations. Preferably, a liposome described herein includes a phospholipid, more preferably, a glycerophospholipid, e.g., a phosphatidylserine. A phosphatidylserine is a glycerol molecule having two hydroxyl groups substituted with fatty acid ester moieties and one hydroxyl group substituted with a phosphodiester moiety that is covalently bonded to serine side chain. A typical structure of a phosphatidylserine is RO-CH2-CH(OR)-CH2-OP(O)(OH)-OCH2CH(COOH)NH2, or a salt thereof, where each R is independently a fatty acid acyl. Additionally, or alternatively, a liposome described herein may include, e.g., a lysophospholipid, e.g., a lysophosphatidylserine. A lysophosphatidylserine is a phosphatidylserine missing one of its two fatty acid ester moieties. A typical structure of a lysophosphatidylserine is RO-CH2-CH(OR)-CH2-OP(O)(OH)-OCH2CH(COOH)NH2, or a salt thereof, where one R is a fatty acid acyl, and the other R is H. Thus, in certain preferred embodiments, a liposome described herein includes RO-CH2-CH(OR)-CH2-OP(O)(OH)-OCH2CH(COOH)NH2, or a salt thereof, where each R is H or a fatty acid acyl, provided that at least one R is a fatty acid acyl.

[0223] One major type of liposomal composition includes phospholipids other than naturally derived phosphatidylcholine. Neutral liposome compositions, for example, can be formed from dimyristoyl phosphatidylcholine (DMPC) or dipalmitoyl phosphatidylcholine (DPPC). Cationic liposomes possess the advantage of being able to fuse to the cell membrane. Non-limiting examples of cationic lipids include N,N-dioleyl-N,N-dimethylammonium chloride (DODAC), N,N-distearyl-N,N-dimethylammonium bromide (DDAB), N-(l-(2,3-dioleoyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTAP), N-(l- (2,3-dioleyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTMA), N,N-dimethyl-2,3- dioleyloxy)propylamine (DODMA), 1 ,2-DiLinoleyloxy-N,N-dimethylaminopropane (DLinDMA), 1 ,2- Dilinolenyloxy-N,N-dimethylaminopropane (DLenDMA), 1 ,2-Dilinoleylcarbamoyloxy-3- dimethylaminopropane (DLin-C-DAP), 1 ,2-Dilinoleyoxy-3-(dimethylamino)acetoxypropane (DLin- DAC), 1 ,2-Dilinoleyoxy-3-morpholinopropane (DLin-MA), 1 ,2-Dilinoleoyl-3-dimethylaminopropane (DLinDAP), 1 ,2-Dilinoleylthio-3-dimethylaminopropane (DLin-S-DMA), 1-Linoleoyl-2-linoleyloxy-3- dimethylaminopropane (DLin-2-DMAP), 1 ,2-Dilinoleyloxy-3-trimethylaminopropane chloride salt (DLin- TMA.CI), 1 ,2-Dilinoleoyl-3-trimethylaminopropane chloride salt (DLin-TAP.CI), 1 ,2-Dilinoleyloxy-3-(N- methylpiperazino)propane (DLin-MPZ), or 3-(N,N-Dilinoleylamino)-1 ,2-propanediol (DLinAP), 3-(N,N- Dioleylamino)-1 ,2-propanedio (DOAP), 1 ,2-Dilinoleyloxo-3-(2-N,N-dimethylamino)ethoxypropane (DLin-EG-DMA), 1 ,2-Dilinolenyloxy-N,N-dimethylaminopropane (DLinDMA), 2,2-Dilinoleyl-4- dimethylaminomethyl-[1 ,3]-dioxolane (DLin-K-DMA) or analogs thereof, (3aR,5s,6aS)-N,N-dimethyl- 2,2-di((9Z,12Z)-octadeca-9,12-dienyetetrahydro- 3aH-cyclopenta[d][1 ,3]dioxol-5-amine (ALN100), (6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31 -tetraen-19-yl4-(dimethylamino)butanoate (MC3), 1 ,1 '-(2-(4- (2-((2-(bis(2-hydroxydodecyl)amino)ethyl)(2-hydroxydodecyl)amino)ethyl)piperazin-1- yeethylazanediyedidodecan-2-ol (Tech G1), or a mixture thereof. The cationic lipid can include, for example, from about 20 mol % to about 50 mol % or about 40 mol % of the total lipid present in the particle.

[0224] Non-cationic liposomes, although not able to fuse as efficiently with the plasma membrane, may also be used for delivery. Anionic liposome compositions generally are formed from dimyristoyl phosphatidylglycerol, while anionic fusogenic liposomes are formed primarily from dioleoyl phosphatidylethanolamine (DOPE). The ionizable / non-cationic lipid can be an anionic lipid or a neutral lipid including, but not limited to, distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), dioleoyl-phosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoylphosphatidylethanolamine (POPE), dioleoyl-phosphatidylethanolamine 4-(N-maleimidomethyl)-cyclohexane-1 -carboxylate (DOPE-mal), dipalmitoyl phosphatidyl ethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), distearoyl- phosphatidyl-ethanolamine (DSPE), 16-O-monomethyl PE, 16-O-dimethyl PE, 18-1 -trans PE, 1- stearoyl-2-oleoyl-phosphatidyethanolamine (SOPE), cholesterol, 1 ,2-dioleoyl-sn-glycero-3-phospho-L- serine (sodium salt, DOPS), or a mixture thereof. The non-cationic lipid can be, for example, from about 5 mol % to about 90 mol %, about 10 mol %, or about 58 mol % if cholesterol is included, of the total lipid present in the particle. In some embodiments, an ionizable / non-cationic lipid can be a combination of lipids described above, e.g., a combination of lipids including DOPC, DOPS, Choi, and DOPE.

[0225] The conjugated lipid that inhibits aggregation of liposomal particles can be, for example, a polyethyleneglycol (PEG)-lipid including, without limitation, a PEG-diacylglycerol (DAG), a PEG-dialkyloxypropyl (DAA), a PEG-phospholipid, a PEG-ceramide (Cer), or a mixture thereof. The PEG-DAA conjugate can be, for example, a PEG-dilauryloxypropyl (C12), a PEG-dimyristyloxypropyl (C14), a PEG-dipalmityloxypropyl (Cie), or a PEG-distearyloxypropyl (Cis). The conjugated lipid that prevents aggregation of particles can be, for example, from 0 mol % to about 20 mol % or about 2 mol % of the total lipid present in the particle. In some embodiments, the liposome composition further includes cholesterol at, e.g., about 10 mol % to about 60 mol % or about 50 mol % of the total lipid present in the particle.

[0226] Another type of liposomal composition is formed from phosphatidylcholine (PC) such as, for example, soybean PC, and egg PC. Another type is formed from mixtures of phospholipid and / or phosphatidylcholine and / or cholesterol. Examples of other methods to introduce liposomes into cells in vitro and in vivo include U.S. Pat. No. 5,283,185; U.S. Pat. No. 5,171 ,678; WO 94 / 00569; WO 93 / 24640; WO 91 / 16024; Feigner, (1994) J. Biol. Chem. 269:2550; Nabel, (1993) Proc. Natl. Acad. Sci. 90:11307; Nabel, (1992) Human Gene Ther. 3:649; Gershon, (1993) Biochem. 32:7143; and Strauss, (1992) EMBO J. 11 :417.

[0227] The targeting of liposomes is also possible based on, for example, organ-specificity, cell-specificity, and organelle-specificity and is known in the art. In the case of a liposomal targeted delivery system, lipid groups can be incorporated into the lipid bilayer of the liposome in order to maintain the targeting ligand in stable association with the liposomal bilayer. Various linking groups can be used for joining the lipid chains to the targeting ligand. Additional methods are known in the art and are described, for example in U.S. Pub. No. 20060058255, the linking groups of which are herein incorporated by reference.

[0228] Cleavable linking groups are susceptible to cleavage agents, e.g., pH, redox potential, or the presence of degradative molecules. Generally, cleavage agents are more prevalent or found at higher levels or activities inside cells than in serum or blood. Examples of such degradative agents include: redox agents which are selective for particular substrates or which have no substrate specificity, including, e.g., oxidative or reductive enzymes or reductive agents such as mercaptans, present in cells, that can degrade a redox cleavable linking group by reduction; esterases; endosomes or agents that can create an acidic environment, e.g., those that result in a pH of five or lower; enzymes that can hydrolyze or degrade an acid cleavable linking group by acting as a general acid; peptidases (which can be substrate specific); and phosphatases.

[0229] A cleavable linkage group, such as a disulfide bond can be susceptible to pH. The pH of human serum is 7.4, while the average intracellular pH is slightly lower, ranging from about 7.1 -7.3. Endosomes have a more acidic pH, in the range of 5.5-6.0, and lysosomes have an even more acidic pH at around 5.0. Some linkers will have a cleavable linking group that is cleaved at a preferred pH, thereby releasing a cationic lipid from the ligand inside the cell, or into the desired compartment of the cell.

[0230] A linker can include a cleavable linking group that is cleavable by a particular enzyme. The type of cleavable linking group incorporated into a linker can depend on the cell to be targeted. In general, the suitability of a candidate cleavable linking group can be evaluated by testing the ability of a degradative agent (or condition) to cleave the candidate linking group. It will also be desirable to also test the candidate cleavable linking group for the ability to resist cleavage in the blood or when in contact with other non-target tissues. Thus, one can determine the relative susceptibility to cleavage between a first and a second condition, where the first is selected to be indicative of cleavage in a target cell and the second is selected to be indicative of cleavage in other tissues or biological fluids, e.g., blood or serum. The evaluations can be carried out in cell free systems, in cells, in cell culture, in organ or tissue culture, or in whole animals. It can be useful to make initial evaluations in cell-free or culture conditions and to confirm by further evaluations in whole animals. In preferred embodiments, useful candidate linkers are cleaved at least about 2, 4, 10, 20, 30, 40, 50, 60, 70, 80, 90, or about 100 times faster in the cell (or under in vitro conditions selected to mimic intracellular conditions) as compared to blood or serum (or under in vitro conditions selected to mimic extracellular conditions). Micelles

[0231] Micelles are a particular type of molecular assembly in which amphipathic molecules are arranged in a spherical structure such that all the hydrophobic portions of the molecules are directed inward, leaving the hydrophilic portions in contact with the surrounding aqueous phase. Micelles may be made of lipids. The micelle phase is caused by the packing behavior of single-tail lipids in a bilayer. The difficulty filling all the volume of the interior of a bilayer, while accommodating the area per head group forced on the molecule by the hydration of the lipid head group, leads to the formation of the micelle. This type of micelle is known as a normal-phase micelle (oil-in-water micelle). Inverse micelles have the head groups at the center with the tails extending out (water-in-oil micelle).

[0232] Micelles are approximately spherical in shape. Other phases, including shapes such as ellipsoids, cylinders, and bilayers, are also possible. The shape and size of a micelle are a function of the molecular geometry of its surfactant molecules and solution conditions such as surfactant concentration, temperature, pH, and ionic strength. The process of forming micelles is known as micellization and forms part of the phase behavior of many lipids according to their polymorphism. Targeting Moieties

[0233] A lipid structure described herein (e.g., liposome, lipid nanoparticle, or micelle) may include a targeting moiety. A targeting moiety may be used to direct the lipid structure to a particular cell-type (e.g., a macrophage). Certain lipids (e.g., phosphatidyl serine) may be used in the lipid structure (e.g., a vesicle) both as a layer-forming lipid and as a targeting moiety. The targeting moiety may be, e.g., an antibody or an antigen-binding fragment or an engineered derivative thereof (e.g., Fcab or a fusion protein (e.g., scFv)). The targeting moiety may be, e.g., a polypeptide. Alternatively, the targeting moiety may be, e.g., a small molecule (e.g., mannose or folate) or a cluster of small molecules (e.g., a cluster of mannoses). A targeting moiety may be associated with a lipid structure covalently or non- covalently.

[0234] Small Molecules

[0235] The targeting moiety may be a small molecule capable of complexing a receptor expressed on the surface of the targeted cell. Non-limiting examples of small molecules that may be used as targeting moieties in the lipid structures described herein are phosphatidylserine, lysophosphatidylserine folate, mannose, and mannose clusters.

[0236] In some embodiments, the targeting moiety is phosphatidylserine or lysophosphatidylserine. In some embodiments, the targeting moiety is phosphatidylserine. Phosphatidylserine and / or lysophosphatidylserine may be present as a lipid structure layer-forming lipid that is non-covalently bonded to the rest of the lipid structure.

[0237] Folate may be used as a targeting moiety. In the lipid structures described herein, folate may be of the following structure:

[0238] Mannose or a mannose cluster can be used to target the lipid structure described herein to macrophages. Mannose clusters are known in the art.

[0239] Folate, mannose, and mannose clusters may be covalently linked to the structure. Conjugation techniques for linking folate, mannose, and mannose clusters are known in the art, for example, as described in US 2014 / 0045919, US 9,725,479, US 8,758,810, US 8,450,467, US 6,525,031 , US 6,335,434, and US 5,759,572.

[0240] Antigen-Binding Moieties

[0241] An antigen-binding moiety in the lipid structure described herein can be an antibody or an antigen-binding fragment thereof, e.g., F(ab)2 or Fab, or an engineered derivative thereof, e.g., Fcab or a fusion protein, e.g., scFv. A human or chimeric, e.g., humanized, antibody can be used as an antibody in the lipid structure described herein. The antigen-binding moiety targets APCs having the surface antigen that is recognized by the antigen-binding moiety. Dendritic cells may be targeted by anti-DEC205, anti-CD304, anti-CD303, anti-CD40, anti-CD74, anti-BDCA2, or anti-CD123 antibodies or antigen-binding fragments thereof or engineered derivatives thereof. Macrophages can be targeted by anti-CD163, anti-CD40, anti-CD74, anti-CD206, or anti-CD123 antibodies or antigen-binding fragments thereof or engineered derivatives thereof.

[0242] Non-limiting examples of anti-CD38 antibodies are daratumumab, SAR650984, MOR202, or any one of antibodies Ab79, Ab19, Ab43, Ab72, and Ab110 disclosed in WO 2012 / 092616, the disclosure of these antibodies is incorporated herein by reference. A non-limiting example of an anti- CD79b antibody is huMA79b v28 disclosed in WO 2014 / 011521 . A non-limiting example of an anti- CD22 antibody is 10F4 disclosed in US 2014 / 0127197. A non-limiting example of an anti-CD20 antibody is rituximab. A non-limiting example of an anti-DEC205 antibody is provided in US 2010 / 0098704, the antibodies of which are incorporated herein by reference. Non-limiting examples of anti-CD40 antibodies are lucatumumab and dacetuzumab. A non-limiting example of an anti-CD304 antibody is vesencumab.

[0243] Conjugation techniques for linking antigen-binding moieties are known in the art, for example, as described in Ansell et al., Methods Mol. Med., 25:51-68, 2000; US 2002 / 0025313; US 6,379,699; and US 5,059,421.

[0244] Polypeptides

[0245] The targeting moiety can be a polypeptide having an affinity for cells (e.g., having an affinity for a cell type, e.g., a macrophage). Non-limiting examples of polypeptides are RGD peptide, rabies virus glycoprotein (RVG), and DC3 peptide. Alternatively, the polypeptide may be a TLR2 agonist, e.g., MALP-2 lipoprotein, MALP-404 lipoprotein, OspA, a porin, LcrV, Hsp60, glycoprotein gH / gL, or glycoprotein gB.

[0246] Conjugation techniques for linking peptides are known in the art, for example, as described in Ansell et al., Methods Mol. Med, 25:51-68, 2000; US 2002 / 0025313; US 6,379,699; and US 5,059,421.

[0247] Pathogen associated molecular patterns (PAMPs)

[0248] The targeting moiety may be a PAMP. PAMPs are known in the art, e.g., a CpG ODN. CpG ODNs are generally divided into three classes: class A, class B, and class C. Class A CpG ODNs typically contain poly-G tails with phosphorothioate backbones at the 3’- and 5’-termini and a central palindromic sequence including a phosphate backbone. Class A CpG ODNs typically contain CpG within the central palindromic sequence. Class B CpG ODNs typically include fully phosphorothioated backbone, and the sequence at the 5’ end of class B CpG ODNs is often critical for TLR9 activation. Class C CpG ODNs include a fully phosphorothioated backbone with a 3’-end sequence enabling formation of a duplex. A PAMP may be covalently linked to a lipid structure using techniques and methods known in the art. Methods of Use

[0249] The compositions described herein can be used to kill a cell, e.g., cause a cell to rupture, e.g., via pyroptosis. The method includes contacting a cell with the pharmaceutical composition as described herein, e.g., containing a polynucleotide encoding a gasdermin. The gasdermin polypeptide is expressed from the cell and then oligomerizes to form a pore, thereby killing the cell, e.g., upon disruption of the osmotic potential ofthe cell. The contacting may be performed in vivo (e.g., in a subject).

[0250] In some embodiments, the method further includes contacting the cell with an agent that depletes cholesterol from the cell. In some embodiments, the agent includes a methyl cyclodextrin, an NPC1 inhibitor, a statin, a squalene epoxidase inhibitor, or a DHCR7 inhibitor. In some embodiments, the methyl cyclodextrin is MCD. In some embodiments, the statin is fatostatin.

[0251] In some embodiments, the method includes contacting the cell with the agent prior to the polynucleotide, vector, or cell. In some embodiments, the method includes contacting the cell with the agent after the polynucleotide, vector, or cell.

[0252] In some embodiments, the cell is a macrophage.

[0253] In some embodiments, the method treats a disease or disorder in a subject.

[0254] In some embodiments, the disease or disorder is an immune disorder. In some embodiments, the immune disorder is systemic lupus erythematosus (SLE), rheumatic arthritis (RA), systemic sclerosis (SSc), and type 1 diabetes (T1 D).

[0255] In some embodiments, the disease or disorder is cancer. In some embodiments, the cancer is melanoma, ocular melanoma, breast cancer, bladder cancer, head and neck cancer, glioma, or prostate cancer.

[0256] In some embodiments, the method is used to sensitize a tumor cell to an immunotherapy. For example, in some embodiments, the methods described herein are used to kill a tumor cell, e.g., that is non-responsive to an immunotherapy. In some embodiments, the tumor cell is an immune cell in the tumor. In some embodiments, the polypeptide oligomerizes to form a pore in the immune cell of the tumor, thereby causing pyroptosis of the immune cell that releases one or more proinflammatory cytokines. In some embodiments, the one or more proinflammatory cytokines activates and recruits one or more tumor infiltrating immune cells to kill a different cell in the tumor, e.g., thereby sensitizing the tumor to an immunotherapy. The method may further include administering an immune checkpoint inhibitor, such as an anti-PD-1 immunotherapy.

[0257] In some embodiments, the methods described herein are used to activate an endogenous gasdermin, e.g., with an activator of gasdermin (e.g., radiation, a chemotherapeutic agent, or a protease). An activator of gasdermin is an agent that causes the inactive full length gasdermin to be converted into the active N-terminal pore forming fragment. The activation of endogenous gasdermin or delivery of an exogenous gasdermin can each cause pore formation in a target cell. In some embodiments, the endogenous gasdermin is GSDMA, GSDMB, GSDMC, GSDMD, GSDME (DFNA5), or DFNB59.

[0258] In some embodiments, the gasdermin activator includes radiation, a chemotherapeutic agent, or a protease. In some embodiments, the protease is a caspase. In some embodiments, the caspase is caspase-1 , caspase-3, caspase-4, caspase-5, caspase-7, or caspase-8. For example, in some embodiments, caspase-1 , caspase-4, or caspase-5 is used to activate GSDMD. In some embodiments, caspase-3 or caspase-7 is used to activate GSDME. In some embodiments, caspase- 8 is used to activate GSDMC or GSDMD, or indirectly activate GSDME via caspase-3 and / or caspase-7. In some embodiments, the chemotherapeutic agent is doxorubicin, etoposide, cisplatin, topotecan, mitoxantrone, actinomycin-D, or talabostat. The method may further include administering an immune checkpoint inhibitor, such as an anti-PD-1 immunotherapy.

[0259] EXAMPLES

[0260] The following examples are put forth so as to provide those of ordinary skill in the art with a description of how the compositions and methods described herein may be used, made, and evaluated, and are intended to be purely exemplary of the invention and are not intended to limit the scope of what the inventors regard as their invention.

[0261] Example 1 :

[0262] Materials and Methods:

[0263] Reagents List:

[0264] • Q5® Site-Directed Mutagenesis Kit (NEB #E0554)

[0265] • QIAquick PCR Purification Kit (Qiagen #28106)

[0266] • NEBuilder HiFi DNA Assembly Master Mix (NEB #E2621 L)

[0267] • RNaseZap (Thermo #AM9788)

[0268] • HiScribe T7 mRNA Kit with CleanCap Reagent AG (NEB #E2080S)

[0269] • Modified NTP 5’-methoxy-UTP (Trilink #N-1093-1)

[0270] • Modified NTP 5’-methyl-CTP (Trilink #N-1014-1)

[0271] • Monarch RNA Cleanup Kit (50ug) (NEB #T2040L)or Monarch RNA Cleanup Kit (500ug)(NEB #T2050L)

[0272] • Poly(A) tailing of RNA using E. coli Poly (A) Polymerase Kit (NEB #M0276)

[0273] • RNase inhibitor (Thermo #AM2696)

[0274] • Lipofectamine MessengerMAX (Invitrogen, #LMRNA015)

[0275] • Amplex Red Cholesterol Assay kit (Invitrogen, A12216)

[0276] • CyQUANT LDH Cytotoxicity Assay (Thermo #C20301)

[0277] • Propidium Iodide Solution (Sigma #P4864-10ML)

[0278] • Methyl-p-cyclodextrin (Sigma #C4555-5G)

[0279] • CellTiter-Glo® Luminescent Cell Viability Assay (Promega, #G7571)

[0280] • Fatostatin (Cayman, #13562)

[0281] • NB598 (Cayman, #14912)

[0282] • AY9944 (Cayman, #14611)

[0283] • 25-hydroxy Cholesterol (Cayman, #11097) 19-hydroxy Cholesterol (Cayman, #15209)

[0284] DNA template backbone elements and gasdermin insert sequences:

[0285] Linearized plasmid DNA has shown best yield in comparison to PCR product DNA templates for in vitro transcription (IVT) for the present applications. However, linearized plasmid, PCR products, and synthetic DNA oligos can be used for IVT as long as they contain a double stranded T7 promoter sequence (5' TAATACGACTCACTATA 3') (SEQ ID NO: 33) followed by an AG initiation sequence change for compatibility with the mRNA cap analog known as CleanCap AG, located upstream of the transcribed sequence.

[0286] (5' TAATACGACTCACTATAGN 3') (SEQ ID NO: 34): T7 original promoter

[0287] (5' TAATACGACTCACTATAAG 3') (SEQ ID NO: 35): T7 promoter for use with CleanCap AG Q5 Site-Directed Mutagenesis Kit (NEB #E0554) to create site-specific mutations in the vector backbone.

[0288] The initial plasmid backbone was based on elements contained within pcDNA3.1 (+) with added elements for efficient mRNA production and mRNA translation of IVT transcripts. This vector contained a T7 phage RNA polymerase promoter sequence upstream of the multiple cloning site for insertion of genes of interest for use as a DNA template for IVT. Q5 mutagenesis kit was used to change the canonical T7 promoter to a CleanCap AG cap analog T7 promoter. NEB Builder kit was used per manufacture instructions to assemble synthetic DNA fragments encoding for the 5’ untranslated region (UTR) of the alpha globulin gene upstream of the inserts and 3’ UTR from the alpha globulin downstream of the inserts. Sequences of inserts listed below were PCR amplified with the addition of relevant restriction enzyme cutsites for insertion into the plasmid vector (forward primers contained the Nhel cutsite sequence, reverse primers contained the Notl cutsite sequence). For plasmid DNA to serve as a template for mRNA production with IVT it must be linearized downstream of the T7 promoter and downstream of the insert of interest.

[0289] Sequences that correspond to the DNA encoding gasdermin family members were cloned into the plasmid to allow IVT reactions for mRNA production and delivery into mammalian cell models. Full length gasdermins consist of the amino (N) terminal fragments that contain the “gasdermin” or “poreforming domain” linked as one single polypeptide to an autoinhibitory carboxy (C) terminal domain. These full-length proteins are latent when expressed within cells and require a secondary trigger including protease cleavage to release the active pore forming domains to perforate cellular membranes and kill cells. Sequences corresponding to the constitutively active N terminal pore forming domains of gasdermin family members were also cloned into the DNA plasmid. Plasmids and mRNA encoding full length and N terminal fragments of mouse GSDMA3 were generated. Plasmids and mRNA encoding full length and N terminal fragments of human GSDMA, GSDMB, GSDMC, GSDMD, and GSDME family members were generated. These constructs encoded an in frame C terminal Flag epitope tag added to aid in protein detection for family members without good endogenous antibody reagents. The sequence information of the template DNA and amino acid sequence for these inserts is as follows.

[0290] As stated above the vector backbone consists of a T7(AG) promoter sequence, 5’ UTR sequence from alpha globulin gene, kozak sequence, start codon, gene insert sequence, Flag epitope tag, stop codon, 3’ UTR from alpha globulin gene, restriction site for linearization of the plasmid. After IVT reaction and polyA polymerase this will result in an mRNA sequence with the CleanCap AG analog, 5’ UTR, Kozak sequence, start codon, gene insert coding sequence, flag epitope coding sequence, stop codon, 3’ UTR, and variable length polyA tail. Of note for produced RNA species, anywhere an A is specified in the DNA sequence an A ribonucleotide is incorporated, anywhere a G is specified in the DNA sequence a G ribonucleotide is incorporated, anywhere a C is specified in the DNA sequence a modified C ribonucleotide base (from 5-m-CTP) is incorporated, and anywhere a T is specified in the DNA sequences a modified U ribonucleotide base (from 5-mo-UTP) is incorporated.

[0291] T7(AG) promoter:

[0292] TAATACGACTCACTATAAG (SEQ ID NO: 35)

[0293] 5’ UTR:

[0294] ACTCTTCTGGTCCCCACAGACTCAGAGAGAA (SEQ ID NO: 36)

[0295] 3’UTR: CTGCCTTCTGCGGGGCTTGCCTTCTGGCCATGCCCTTCTTCTCTCCCTTGCACCTGTACCTCTTG GTCTTTGAATAAAGCCTGAGTAGGAAG (SEQ ID NO: 37)

[0296] Kozak sequence and start codon: GCCACCATG

[0297] Sequence of Flag epitope tag:

[0298] GACTACAAAGACGATGACGACAAG (SEQ ID NO: 38)

[0299] Stop codon:

[0300] 5’ TAA 3’; or 5’ TAG 3’; or 5’ TGA 3’

[0301] Linearization of DNA template:

[0302] Linearization of the DNA plasmid to make an IVT template was conducted using restriction enzymes. In this application the restriction enzyme Notl was used to digest 10 pg of plasmid according to the manufacturer’s digestion protocol. This recognition sequence was downstream of gene inserts and 3’ UTRs. After linearization, template DNA was purified using QIAquick® PCR Purification Kit (Qiagen #28106). IVT and RNA synthesis protocol:

[0303] RNase contamination is a common contributor to failed transcription reactions. RNase can be introduced by inappropriate handling, so it is crucial to establish an RNase-free environment. All bench space and equipment were cleaned with an RNase cleaning product such as RNaseZap (Thermo #AM9788). This area was a designated workspace and equipment for mRNA production. RNase inhibitor was also spiked into reaction mixtures and cleanup procedures to prevent degradation of produced mRNA. mRNAs containing modified nucleotides (such as 5-m-CTP, Pseudo-UTP, and 5-methoxy- UTP) have been shown to suppress RNA-mediated innate immune activation. The HiScribe T7 mRNA Kit with CleanCap Reagent AG (NEB #E2080S) is formulated to allow for the complete substitution of unlabeled NTPs with a modified version of the NTP. First were thawed the reaction buffer, NTP’s, modified NTP’s, CleanCap Reagent AG, and template DNAto room temperature while keeping enzyme mix on ice. The reaction conditions shown below demonstrate a full substitution of 5’- methoxy-UTP (Trilink #N-1093-1) for UTP and 5’-methyl-CTP (Trilink #N-1014-1) for CTP.

[0304] Reaction was assembled at room temperature in this order:

[0305] Table 4. Reagents

[0306] * Addition of DTT to the reaction is optional but recommended. * To avoid RNase contamination and failed IVT reaction, RNase inhibitor (Thermo #AM2696) was used to optimize IVT reaction and increase mRNA yield (1 pL RNase inhibitor in 20 p _ IVT reaction).

[0307] After mixing and spinning down, the reaction was incubated in a thermocycler at 37°C for 2 hours. Following incubation, 2 pL of DNase I was added, mixed, and incubated in thermocycler for 15 minutes to degrade template DNA. mRNA Purification:

[0308] Synthesized RNA was isolated and cleaned with the Monarch RNA Cleanup Kit (50pg)(NEB #T2040L) or Monarch Cleanup Kit (500pg) (NEB #T2050) per manufacturer recommendations. The mRNA was eluted with RNase inhibitor (~1 pL) spiked water. For constructs containing a templated split poly(A) tail this mRNA is ready for aliquoting, storage at -80 °C, and dilution and use with liposomes and lipid nanoparticles for mammalian cell transfection and expression of gasdermin variants. For templates without a split poly(A) tail added at the plasmid stage, a variable length poly A tail was added using an E. coli polyA polymerase (NEB #M0276) reaction according to manufacturer’s protocol. The polyA tailed mRNA is then reisolated and cleaned again using the Monarch RNA Cleanup Kit (50pg)(NEB #T2040L) or Monarch Cleanup Kit (500pg) (NEB #T2050) per manufacturer recommendations. PolyA tailed mRNA transcripts are now ready for aliquoting, storage at -80 °C, and dilution and use with liposomes and lipid nanoparticles for mammalian cell transfection and expression of gasdermin variants. To avoid repeated freeze and thaw cycles, the mRNA was aliquoted into single use tubes. mRNA transfection:

[0309] 2E5 cells per well were seeded in 24-well plate overnight. These cells were then transfected with 500 ng / well indicated mRNA mixed with Lipofectamine MessengerMAX (Invitrogen, #LMRNA015) at a ratio of 1 :3 per manufacturer’s complexing protocol. 1 hour after transfection, the media was changed to complete DMEM with propidium iodide (PI) at the concentration of 3.3 pg / ml (dilution at 1 :300 from stock) and the plate was placed in an SX5 Incucyte incubated live cell imaging apparatus for scanning every 30 min for 8 hours with images taken in the brig htfield (morphology, cell segmentation channel) and orange / red (PI positivity channel for membrane permeability) channels.

[0310] For methyl-p-cyclodextrin (MCD) treatment condition, after 7 hours the mRNA transfected cancer cells were treated with 7.5 mM methyl-p-cyclodextrin to acutely deplete cell membrane cholesterol.

[0311] Doxycycline (Dox) induction assay of gasdermin D pore forming domain in murine macrophages:

[0312] Engineered immortalized bone marrow derived macrophages were used that express Tet3G doxycycline responsive transactivator protein, and a Tre3G promoter in front of a transgene encoding the N terminal pore forming fragment of murine GSDMD with a hypomorph I105N point mutation and tagged with a C terminal monomer tag blue florescent protein as previously published (Evavold et al, Cell 19:4495-4511 , 2021 ; PMID: 34289345). These macrophages also expressed Cas9 protein and may be considered wild type (no genes knocked out) or knocked out for specific candidate regulators of macrophage and cholesterol biology as described below. 2.5E4 cells per well were seeded in black 96-well plates with optically clear bottoms. On the next day, the cells were treated with doxycycline inducer chemical at the concentration of 1 pg / ml (dilution at 1 :2000 from stock) and PI at the concentration of 3.3 pg / ml (dilution at 1 :300 from stock). The plate was placed in an SX5 Incucyte incubated live cell imaging apparatus for scanning every 30 min for 8 hours with images taken in the brightfield (morphology, cell segmentation channel) and orange / red (PI positivity channel for membrane permeability) channels.

[0313] For MOD treatment condition, following 7 hours of initial imaging, the cells were treated with 10 mM MCD. At the end point, the supernatants or lysed cell controls were collected and processed for an LDH release assay to measure pyroptotic lysis and membrane rupture of perforated cells.

[0314] Doxycycline (Dox) induction assay of gasdermin E pore forming domain in B16F10 melanoma cells:

[0315] Engineered B16F10 melanoma cells were used that express Tet3G doxycycline responsive transactivator protein, and a Tre3G promoter in front of the N terminal pore forming domain of murine GSDME tagged with mNeonGreen. 1 E5 cells per well were seeded in 24-well plate in de-lipidated medium. On the next day, the cells were pre-treated with AY9944 at a concentration of 10 pM or 25HC at a concentration of 10 pM for 1 h. The cells were then treated with doxycycline at a concentration of 1 pg / ml and PI staining at the concentration of 3.3 pg / ml. The plate was placed in an SX5 Incucyte incubated live cell imaging for scanning every 1 hour for 9 hours. For MCD treatment condition, following 8h of initial imaging, the cells were treated with 7.5 mM MCD for 1 hour.

[0316] LDH release assay:

[0317] LDH release was quantified using the CyQuant LDH cytotoxicity assay kit from Thermo Fisher following the manufacturer’s protocol. Briefly, 50 pl / well supernatant was transferred to a 96-well plate containing 50 pl LDH assay buffer and incubate the plate at room temperature for 30 min protected from light. The reaction was stopped with 50 pL of stop solution. The absorbance of the supernatant reaction mixes was measured at 490 nm (signal) and 680 nm (background) on a Tecan Spark plate reader.

[0318] Cellular ATP viability assay:

[0319] Cell viability was determined by the CellTiter-Glo Luminescent Cell Viability Assay (Promega, G7571) according to the manufacturer’s protocol. Briefly, 100 pl CellTiter-Glo Reagent was added to the equal volume of cells in cell culture medium present in 96-well plate. The contents were left to mix for 2 minutes to induce cell lysis and then the plate was incubated at room temperature for an additional 10 minutes to stabilize the luminescent signal. The luminescence from different cell conditions was measured on a Tecan Spark plate reader. Generation of Rabgefl KO macrophage:

[0320] Two complete sgRNA sequences (crRNA targeting sequence and tracrRNA structural sequence) were used for Rabgefl knockout (KO) via CRISPR / Cas9 technology and ordered from IDT. The targeting sequences were sg1 targeting: CACTCGGTCCGTCTCAATGC (SEQ ID NO: 39); sg2 targeting: ACCACCATGTCGGACACTTC (SEQ ID NO: 40). Rabgefl KO macrophage was generated by electroporation of sgRNAs into Dox inducible Cas9-expressing iBMDMs mentioned above using the Neon transfection system (Thermo Fisher). Briefly, 1 .2E6 indicated iBMDMs were collected and resuspended in 120 pl R buffer, mixed with 2 pl of sgRNA (ordered as complete sgRNA from IDT and dissolved at a concentration of 100 mM in sterile water). 100 pl containing 1 E6 cells was electroporated with the condition of 10 ms, 2 pluses and 1400 V. Cells were then dispensed directly to a tube containing 900 pl prewarmed complete DMEM and then transferred into a 6-well plate containing 2 ml prewarmed completed DMEM medium. Following 2 days culturing, the cells were collected and subcloned by diluting to 3 cells / ml medium to obtain single cell colonies of complete knockout of targeted genes. The resulting clone derived cell lines were lysed to test the bulk knockout efficiency by immunoblot.

[0321] Cholesterol quantification:

[0322] Cholesterol concentration was quantified with Amplex Red Cholesterol Assay kit (Invitrogen, A12216) following the manufacturer’s protocol. Briefly, 5E5 cells per well were seeded in 12 well plate. On the next day, the medium was changed to 0% FBS DMEM medium before treating the cells with or without MCD for 1 hour. The cells were washed with PBS for 3 times and 1 E6 counted cells were lysed in 500 pl water for 30 min at 37°C before quantification. The cholesterol-containing samples were diluted with 2X reaction buffer. A volume of 50 pl was used for each reaction. Free cholesterol was measured by incubating 50 pl of the Amplex Red working solution containing 2 U / ml HRP and 2 U / ml cholesterol oxidase with 50 pl of the diluted samples for 30 min at 37°C. The fluorescence was measured in Tecan plate reader using excitation of 560 nm and emission detection at 590 nm.

[0323] Cholesterol staining with PFO-based biosensor:

[0324] Plasma membrane cholesterol was stained with recombinant PFO*-GFP biosensor. Perfringolysin O (PFO) is a bacterial pore forming toxin protein that binds cholesterol and oligomerizes in host plasma membranes. Prior reports have made a truncated and mutated form of PFO (PFO*) that retains binding to plasma membrane cholesterol but does not oligomerize into pores. Recombinant PFO* was produced with a SpyTag fusion. Recombinant GFP was produced with a SpyCatcher fusion. A fusion protein biosensor was produced by covalently attaching PFO* and GFP proteins with the SpyTag and SpyCatcher system.

[0325] 5E5 of the indicated cell type were plated in 12-well plates. After one day, wash the cells with sterile PBS pH 7.4 for 3 times. Based on respective cell types, cells were collected either through incubation with PBS + 4 mM EDTA or incubation with trypsin. Cells were collected, spun at 400 x g for 5 minutes to gently pellet then resuspended in 250 pl of PBS. To this cell suspension, 250 pl of PFO*- GFP diluted in PBS containing 2% of BSA was added in each tube to the final concentration of 10 pg / mL. The cells were stained for 2 hours at 4°C under gentle shaking. After incubation, the sample was washed with cold PBS for 3 times at 4°C spinning cells at 400 x g for 5 minutes between each wash. Next, the cells were treated with paraformaldehyde at concentration of 4% in PBS for 10 min at 4°C and wash with cold PBS for 3 times. Finally, the cells were resuspended in 500 pl of PBS and run the samples on a flow cytometer analyzer to analyze PFO*-GFP fluorescence of single cells by mean fluorescence intensity (MFI) in the GFP channel with FlowJo software.

[0326] Cholesterol biosynthesis inhibitors treatment:

[0327] 2.5E4 WT macrophages or Rabgefl sg2 macrophages were seeded in 96-well plate with complete DMEM that contained de-lipidated FBS. On the next day, the cells were pre-treated with Fatostatin at a concentration of 20 pM, NB598 at a concentration of 2 pM, AY9944 at a concentration of 10 pM, and 19HC or 25HC at a concentration of 10 pM for 1 h. For cells engineered for doxycycline induction, the cells received a final concentration of doxycycline of 1 pg / ml and PI staining at the concentration of 3.3 pg / ml. For mRNA treated cells, cells were treated with mRNA dose curves of carrier mRNA or gasdermin variant encoding mRNA keeping the final mRNA quantity the same but varying the amount of gasdermin variant to provide dose response curves with and without MCD treatment. Cells were stained with PI at a final concentration of 3.3 pg / ml. To read the PI staining by single cell imaging, the plate was placed in an Incucyte for scanning every 30 min for 8 h. At the end time point, collect the supernatant or lysed cell controls for LDH release detection and ATP viability quantification according to manufacturer’s protocols briefly described above.

[0328] Results:

[0329] First, a macrophage system was established to investigate aspects of pyroptosis including N terminal fragment mediated membrane permeability and cellular lysis. This system consists of primary bone marrow derived macrophages from a Cas9 transgenic mouse that were immortalized with J2 retrovirus to allow for cellular engineering and expansion for repeat characterization and creation of new lines of different genotypes with CRISPR / Cas9 engineering. These macrophages also express the Tet3G transactivator protein that, in response to doxycycline treatment, will initiate transcription at a genomic site that contains a corresponding TRE3G promoter sequence. These macrophages were engineered to have a transgene downstream of a TRE3G promoter sequence with the transgene encoding for the caspase-cleavage product and active N terminal fragment pore forming domain of murine gasdermin D (NT-mGSDMD) with an I105N hypomorph mutation that aids in detection of expression and localization (Evavold et al, Cell 19:4495-4511 , 2021 ; PMID: 34289345). Based on prior identification of sgRNA sequences that were bioinformatically identified to increase the likelihood of a macrophage to survive and not become permeable after doxycycline induction of NT-mGSDMD (Evavold et al, Cell 19:4495-4511 , 2021 ; PMID: 34289345), macrophages were generated that lack expression of endosome adaptors that scored well for enrichment in survivorship including Rabgefl . These macrophages were electroporated as a mock wild type condition (WT macrophages) and electroporated with synthetic sgRNAs (sg1 and sg2) that target the Rabgefl gene (Rabgefl KO macrophages). Immunoblot with an antibody against Rabgefl protein demonstrates protein expression ablation of Rabgefl in Rabgefl KO macrophages compared to WT macrophages with loading control immunoblot of the protein beta-Actin being equivalent between these two cell line lysates (FIG. 1A). Live cell imaging and cellular frequency monitoring of propidium iodide positivity (%PI+) demonstrates that doxycycline induction of murine NT-GSDMD causes membrane permeability in WT macrophages but not Rabgefl KO macrophages (FIG. 1 B). No doxycycline control conditions do not demonstrate membrane permeability as expected in either WT or Rabgefl KO macrophages as expected (FIG. 1B). , Release of the cytosolic metabolic enzyme LDH into culture supernatants as a population metric of membrane rupture was used to monitor cellular lysis downstream of membrane perforation. Similar to single cell PI membrane permeability metric, WT macrophages that express NT-GSDMD ( + Dox condition) demonstrate LDH release indicative of membrane lysis whereas Rabgefl KO macrophages that express NT-GSDMD ( + Dox condition) and control no Dox conditions for both WT and Rabgefl KO macrophages do not demonstrate robust LDH release indicative of membrane rupture (FIG. 1C). To monitor cellular viability as a reciprocal measurement to membrane permeability and cellular lysis, ATP levels within cell types and treatment conditions were monitored using a luminescence assay. WT macrophages that express NT-GSDMD ( + Dox condition) have reduced viability compared to Rabgefl KO macrophages that express NT- GSDMD ( + Dox) or no Dox control conditions in WT and Rabgefl KO macrophages (FIG. 1D). This data in summary demonstrates that Rabgefl promotes GSDMD pore activity and pyroptotic cell death, and lacking Rabgefl endosome adaptor provides a survival benefit to cells even when enforced to express a normally toxic pore forming domain of murine GSDMD.

[0330] It was next investigated whether there were metabolic differences between pyroptosissensitive WT macrophages and pyroptosis-resistant Rabgefl KO macrophages and noted that Rabgefl KO macrophages demonstrated drastically increased concentration of cellular free cholesterol (FIG. 2A). Moreover, acute treatment with a cholesterol depleting agent known a methylcyclodextrin (MOD) results in a decrease in free cellular cholesterol in WT and Rabgefl KO macrophages. Notably, the treatment conditions with MOD of Rabgefl KO macrophages restore WT levels of cholesterol to these macrophages (FIG. 2A). Using PFO-based plasma membrane specific cholesterol biosensor, it was demonstrated that Rabgefl KO macrophages display higher plasma membrane cholesterol content compared to WT macrophages (FIG. 2B). Moreover, acute depletion of plasma membrane cholesterol with MOD demonstrates the reagent removes detectable plasma membrane cholesterol in WT and Rabgefl KO macrophages (FIG. 2B). Again, WT macrophages expressing NT-GSDMD ( + Dox) display robust PI staining for membrane permeability and LDH release for cellular lysis that is largely absent in Rabgefl KO macrophages expressing NT-GSDMD ( + Dox) (FIG. 2C and 2D). Pyroptosis-resistant Rabgefl KO macrophages are converted into pyroptosis-sensitive cells after acute MOD treatment after expression of NT-GSDMD ( + Dox) as seen by rescued PI staining and LDH release (FIG. 2C and 2D). Notably, there was no increase in membrane permeability for Rabgefl KO macrophages treated with MOD without expression of NT- mGSDMD (FIG. 2C and 2D). It was next queried whether other cholesterol modulating small molecules would also enhance NT-GSDMD pores and pyroptosis. After plating WT and Rabgefl KO macrophages in complete media using delipidated fetal bovine serum (FBS) hereafter referred to as delipidated media, cells were pretreated with the small molecule Fatostatin that inhibits the transcriptional activity of the master regulator of cholesterol uptake and biosynthesis enzyme expression SREBP2. WT and Rabgefl KO macrophages treated with Fatostatin display diminished plasma membrane cholesterol levels assayed by PFO*-GFP staining (FIG. 3A). Moreover, WT macrophages treated with Fatostatin and expressing NT-GSDMD ( + Dox) display increased membrane permeability by PI staining (FIG. 3B) and cellular lysis by LDH release (FIG. 3C). Furthermore, pyroptosis resistant Rabgefl KO macrophages treated with Fatostatin and expressing NT-GSDMD ( + Dox) rescue membrane permeability (FIG. 3B) and cellular lysis (FIG. 3C) to WT macrophage levels. Fatostatin treatment alone did not affect baseline (no Dox) membrane permeability (FIG. 3B) and cellular lysis (FIG. 3C). Fatostatin hits a master transcription factor that controls many aspects of cholesterol metabolism that may also affect other pathways, thus it was sought to target commitment steps in cholesterol biosynthesis that are rate limiting enzymes. WT and Rabgefl KO macrophages were plated in delipidated media, and cells were pretreated with the squalene epoxidase (SOLE) inhibitor NB598. WT and Rabgefl KO macrophages treated with NB598 display diminished plasma membrane cholesterol levels assayed by PFO*-GFP staining (FIG. 3D). Moreover, WT macrophages treated with NB598 and expressing NT-GSDMD ( + Dox) display increased membrane permeability by PI staining (FIG. 3E) and cellular lysis by LDH release (FIG. 3F). Furthermore, pyroptosis resistant Rabgefl KO macrophages treated with NB598 and expressing NT-GSDMD ( + Dox) rescue membrane permeability (FIG. 3E) and cellular lysis (FIG. 3F) to WT macrophage levels. NB598 treatment alone did not affect baseline (no Dox) membrane permeability (FIG. 3E) and cellular lysis (FIG. 3F). WT and Rabgefl KO macrophages were plated in delipidated media, and cells were pretreated with the 7- dehydrocholesterol reductase (DHCR7) inhibitor AY9944. WT and Rabgefl KO macrophages treated with AY9944 display diminished plasma membrane cholesterol levels assayed by PFO*-GFP staining (FIG. 3G). Moreover, WT macrophages treated with AY9944 and expressing NT-GSDMD ( + Dox) display increased membrane permeability by PI staining (FIG. 3H) and cellular lysis by LDH release (FIG. 31). Furthermore, pyroptosis resistant Rabgefl KO macrophages treated with AY9944 and expressing NT-GSDMD ( + Dox) rescue membrane permeability (FIG. 3H) and cellular lysis (FIG. 31) to WT macrophage levels. AY9944 treatment alone did not affect baseline (no Dox) membrane permeability (FIG. 3H) and cellular lysis (FIG. 31). Finally, macrophages plated in delipidated media were treated with endogenous cholesterol modulating compounds known as oxysterols. The oxysterol 25-hydroxysterol (25HC) is known to reduce plasma membrane cholesterol whereas a related oxysterol 19HC is not suggested to reduce plasma membrane cholesterol. WT and Rabgefl KO macrophages treated with 25HC display diminished plasma membrane cholesterol levels assayed by PFO*-GFP staining (FIG. 4A). WT and Rabgefl KO macrophages treated with 19HC have increased plasma membrane cholesterol levels assayed by PFO*-GFP staining (FIG. 4A). Moreover, WT macrophages treated with 25HC and expressing NT-GSDMD ( + Dox) display increased membrane permeability by PI staining (FIG. 4B) and cellular lysis by LDH release (FIG. 4C). Furthermore, pyroptosis resistant Rabgefl KO macrophages treated with 25HC and expressing NT-GSDMD ( + Dox) rescue membrane permeability (FIG. 4B) and cellular lysis (FIG. 4C) to WT macrophage levels. 25HC treatment alone did not affect baseline (no Dox) membrane permeability (FIG. 4B) and cellular lysis (FIG. 4C). 19HC treatment did not increase membrane permeability (FIG. 4B) or cellular lysis (FIG. 4C) in any condition consistent with the observation that 19HC does not decrease plasma membrane cholesterol staining (FIG. 4A).

[0331] It was next sought to create a platform for expression of human and mouse gasdermin variants in many cell types with robust and efficient expression. To this end, optimized modified mRNA IVT conditions were generated to produce mRNA that encode the full length gasdermin coding sequence for human GSDMB (FL-GSDMB), human GSMDC (FL-GSDMC), human GSDMD (FL- GSDMD), human GSDME (FL-GSDME), and mouse GSDMA3 (FL-GSDMA3) and the N terminal constitutively active pore forming domains of human GSDMB (NT-GSDMB), human GSMDC (NT- GSDMC), human GSDMD (NT-GSDMD), human GSDME (NT-GSDME), and mouse GSDMA3 (NT- GSDMA3). When mRNA was complexed with lipid to make a liposomal lipid nanoparticle mRNA vehicle, murine macrophages (iBMDMs) and cancer cells (B16F10 melanoma) express certain genes of interest (FIGS. 5A and 5B). Transfection of FL variants that are inactive or mock lipid nanoparticles do not induce membrane permeability on their own as expected in either iBMDM or B16F10 assayed by PI staining (FIGS. 5A and 5B). Transfection of NT constitutively active gasdermin variants induced membrane permeability to varying degrees in either iBMDM or B16F10 assayed by PI staining (FIGS. 5A and 5B) establishing a new way to introduce constitutively active lytic cell death executioners into target cells via lipid complexed with modified mRNAs.

[0332] It was next considered whether the inverse relationship between pyroptotic pore formation by a gasdermin and cellular cholesterol content first established with the murine pore forming domain of GSDMD (NT-mGSDMD in FIGS. 1A-4C) held to other gasdermin pore forming domains from mouse and human origin that are expressed via synthetic modified mRNAs. B16F10 melanoma cancer cells were treated by transfection with lipid alone, FL inactive variants of gasdermins, and NT constitutively active variants of gasdermins with acute exposure to the cholesterol depleting agent MCD that reduced free cholesterol levels (FIG. 6A). MCD treatment of B16F10 increased membrane permeability assayed by PI staining in cells transfected with mRNA encoding NT active gasdermin variants but not FL inactive gasdermin variants or mock transfected (FIG. 6A- 6F). Similar to the doxycycline inducible murine NT-GSDMD macrophage datasets, MCD treatment of B16F10 leads to an increase in membrane permeability across a range of doses of mRNA encoding human NT- GSDMD with limited increases in membrane permeability for inactive human FL-GSDMD (FIGS. 6A and 6E). This trend of cholesterol depletion by MCD sensitizing B16F10 melanoma cancer cells to the active pore forming domains of gasdermins also continues for human NT-GSDMB and NT-GSDMC with limited enhancement of membrane permeability for the inactive human FL-GSDMB and FL- GSDMC (FIGS. 6A, 6C, and 6D). The enhancement of gasdermin pore activity by MCD cholesterol depletion is most apparent in B16F10 melanoma cancer cells treated with active human NT-GSDMA and NT-GSDME that have limited plasma membrane pore activity by PI staining across a range of mRNA doses that are dramatically increased by MCD treatment with limited enhancement of PI staining for cells transfected with inactive human FL-GSDMA and FL-GSDME (FIGS. 6A, 6B, and 6F). The analysis was expanded to the murine Lewis lung carcinoma cell line LLC1. LLC1 lung carcinoma cancer cells were treated by transfection with lipid alone, FL inactive variants of gasdermins, and NT constitutively active variants of gasdermins with acute exposure to the cholesterol depleting agent MCD that reduced free cholesterol levels (FIG. 7A). MCD treatment of LLC1 increased membrane permeability assayed by PI staining in cells transfected with mRNA encoding NT active gasdermin variants but not FL inactive gasdermin variants or mock transfected (FIG. 7A, 7B, 7C, 7D, 7E, and 7F). Similar to the doxycycline inducible murine NT-GSDMD macrophage datasets, MCD treatment of LLC1 leads to an increase in membrane permeability across a range of doses of mRNA encoding human NT-GSDMD with limited increases in membrane permeability for inactive human FL-GSDMD (FIGS. 7A and 7E). This trend of cholesterol depletion by MCD sensitizing LLC1 lung carcinoma cancer cells to the active pore forming domains of gasdermins also continues for human NT-GSDMB and NT-GSDMC with limited enhancement of membrane permeability for the inactive human FL- GSDMB and FL-GSDMC (FIGS. 7A, 7C, and 7D). The enhancement of gasdermin pore activity by MCD cholesterol depletion is most apparent in LLC1 lung carcinoma cancer cells treated with active human NT-GSDMA and NT-GSDME that have limited plasma membrane pore activity by PI staining across a range of mRNA doses that are dramatically increased by MCD treatment with limited enhancement of PI staining for cells transfected with inactive human FL-GSDMA and FL-GSDME (FIGS. 7A, 7B, and 7F).

[0333] Engineered B16F10 melanoma cells were constructed similarly to the doxycycline inducible NT-GSDMD murine macrophages to be able to doxycycline induce production of the pore forming fragment of murine GSDME (NT-GSDME). In brief, these B16F10 were transduced with retroviruses to express the Tet3G transactivator protein. These melanoma cells were also transduced with retrovirus with a TRE3G promotor sequence upstream of the pore forming fragment of murine GSDME (NT-GSDME) fused to a C terminal mNeonGreen fluorescent protein tag that aids in detection of expression and localization. Upon doxycycline treatment, these B16F10 melanoma cancer cells induce expression of NT-GSDME-mNeonGreen expression. Acute treatment cholesterol depletion with MCD for 1 hour after 8 hours of NT-GSDME expression ( + Dox) leads to increased plasma membrane permeability assayed by PI staining that does not occur in MCD treated cells not expressing NT-GSDME ( no Dox) (FIG. 8A). Pretreatment of engineered B16F10 melanoma cancer cells with the DHCR7 inhibitor AY9944 leads to increased membrane permeability kinetics and magnitude by PI staining when NT-GSDME is expressed ( + Dox) but not when NT-GSDME is not expressed (no Dox) (FIG. 8B). Pretreatment of engineered B16F10 melanoma cancer cells with the cholesterol depleting oxysterol 25HC leads to increased membrane permeability kinetics and magnitude by PI staining when NT-GSDME is expressed ( + Dox) but not when NT-GSDME is not expressed (no Dox) (FIG. 8C). All together these data suggest in various immune and cancer cell types that cholesterol depletion or enhancement modulates the pore forming activity of a variety of human and mouse gasdermin pore forming fragments. ORDERED EMBODIMENTS A

[0334] 1 . A polynucleotide encoding a gasdermin (GSDM) polypeptide.

[0335] 2. The polynucleotide of embodiment 1 , wherein the GSDM is GSDMA, GSDMB, GSDMC, GSDMD, GSDME (DFNA5), or DFNB59, a biologically active pore forming fragment thereof, or a variant thereof having at least 65% sequence identity thereto.

[0336] 3. The polynucleotide of embodiment 2, wherein the GSDM comprises an amino acid sequence having at least 65% sequence identity to any one SEQ ID NOs: 1 -16 or a fragment thereof.

[0337] 4. The polynucleotide of embodiment 3, wherein the polynucleotide comprises a nucleotide sequence having at least 65% sequence identity to any one of SEQ ID NOs: 17-32 or a fragment thereof.

[0338] 5. The polynucleotide of any one of embodiments 1-4, wherein the GSDM fragment is an N- terminal GSDM fragment.

[0339] 6. The polynucleotide of embodiment 5, wherein the N-terminal GSDM fragment comprises an amino acid sequence having at least 65% sequence identity to any one of SEQ ID NOs: 1 , 3, 5, 7, 9, 11 , 13, or 15.

[0340] 7. The polynucleotide of embodiment 6, wherein the polynucleotide comprises a nucleotide sequence having at least 65% sequence identity to any one of SEQ ID NOs: 17, 19, 21 , 23, 25, 27, 29, or 31.

[0341] 8. The polynucleotide of any one of embodiments 1 -7, wherein the polynucleotide encodes a plurality of GSDMs.

[0342] 9. The polynucleotide of embodiment 8, wherein each GSDM is separated by a cleavage site or an internal ribosomal entry site (IRES).

[0343] 10. The polynucleotide of embodiment 9, wherein the cleavage site is a 2A cleavage site.

[0344] 11. The polynucleotide of any one of embodiments 8-10, wherein each GSDM is independently, GSDMA, GSDMB, GSDMC, GSDMD, GSDME (DFNA5), or DFNB59, a biologically active pore forming fragment thereof, or a variant thereof having at least 65% sequence identity thereto.

[0345] 12. The polynucleotide of any one of embodiments 1 -11 , wherein the polynucleotide is an RNA.

[0346] 13. The polynucleotide of embodiment 12, wherein the RNA is a messenger RNA (mRNA).

[0347] 14. The polynucleotide of embodiment 13, wherein the mRNA further includes a 5' UTR, 3' UTR, a poly(A) tail, and / or a 5' cap.

[0348] 15. The polynucleotide of any one of embodiments 1-14, wherein the polynucleotide is a DNA.

[0349] 16. The polynucleotide of any one of embodiments 1 -15, wherein the polynucleotide comprises at least one synthetic modification.

[0350] 17. The polynucleotide of embodiment 16, wherein the at least one synthetic modification is a 5’ cap analog.

[0351] 18. The polynucleotide of embodiment 17, wherein the 5’ cap analog is an m7GpppG, antireverse cap analog (ARCA), two-headed cap, S cap, or 2S cap. 19. The polynucleotide of embodiment 16, wherein the at least one synthetic modification is a tail modification.

[0352] 20. The polynucleotide of embodiment 19, wherein the tail modification is a ribose-modified adenosine, 8-azaadenosine, cordycepin, or a fluorescent modification

[0353] 21. The polynucleotide of embodiment 16, wherein the at least one synthetic modification is a modified nucleobase.

[0354] 22. The polynucleotide of embodiment 21 , wherein the modified nucleobase is N1- methylpseudouridine (m1qj), 2-thiouridine (S2U), 5-methylcytidine (m5C), N6-methyladenosine (m6A), 2’-O-methyluridine (Um), 2’-O-methylcytidine (Cm), 2’-O-methyladenosine (Am), 2’-O- methylguanosine (Gm), , 5’-methoxyuridine, 5-methylcytosine, 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyladenine, 6-methylguanine, 2-propyladenine, 2- propylguanine, 2-thiouracil, 2-thiothymine, 2-thiocytosine, 5-halouracil, 5-halocytosine, 5- propynyluracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-uracil (pseudouracil), 4-thiouracil, 8-haloadenine, 8-aminoadenine, 8-thioladenine, 8-thioalkyladenine, 8-hydroxyladenine, 8-haloguanine, 8-aminoguanine, 8-thiolguanine, 8-thioalkylguanine, 8-hydroxylguanine, 5- bromouracil, 5-trifluoromethyluracil, 5-bromocytosine, 5-trifluoromethylcytosine, 7-methylguanine, 7- methyladenine, 2-fluoroadenine, 8-azaguanine, 8-azaadenine, 7-deazaguanine, 7-deazaadenine, 3- deazaguanine, or 3-deazaadenine.

[0355] 23. The polynucleotide of 16, wherein the at least one synthetic modification is a modified sugar.

[0356] 24. The polynucleotide of embodiment 23, wherein the modified sugar is a 2’-0me or 2’-O- fluoro ribose modification.

[0357] 25. A vector comprising or encoding the polynucleotide of any one of embodiments 1 -15.

[0358] 26. The vector of embodiment 25, wherein the vector is a viral vector.

[0359] 27. The vector of embodiment 26, wherein the viral vector is an RNA viral vector.

[0360] 28. The vector of embodiment 27, wherein the RNA viral vector is a replicon RNA or selfamplifying RNA.

[0361] 29. The vector of embodiment 26, wherein the viral vector is a DNA viral vector.

[0362] 30. The vector of embodiment 29, where in the DNA vector is a replication-deficient adenoviral vector selected from the group consisting of human adenovirus, rhesus adenovirus, simian adenovirus and gorilla adenovirus viral vectors.

[0363] 31 . A cell comprising the polynucleotide of any one of embodiments 1 -15 or the vector of any one of embodiments 25-30.

[0364] 32. A pharmaceutical composition comprising the polynucleotide of any one of embodiments 1 -24, the vector of any one of embodiments 25-30, or the cell of embodiment 31 , and a pharmaceutically acceptable carrier.

[0365] 33. The pharmaceutical composition of embodiment 32, further comprising a cholesterol depleting agent. 34. The pharmaceutical composition of embodiment 33, wherein the cholesterol depleting agent comprises a methyl cyclodextrin, a Niemann-Pick C1 (NPC1) inhibitor, a statin, a squalene epoxidase inhibitor, an oxysterol, or a 7-Dehydrocholesterol reductase (DHCR7) inhibitor.

[0366] 35. The pharmaceutical composition of embodiment 34, wherein the methyl cyclodextrin is methyl-p-cyclodextrin (MCD).

[0367] 36. The pharmaceutical composition of embodiment 34, wherein the statin is fatostatin.

[0368] 37. The pharmaceutical composition of embodiment 34, wherein the squalene epoxidase inhibitor is NB598.

[0369] 38. The pharmaceutical composition of embodiment 34, wherein the DHCR7 inhibitor is AY9944.

[0370] 39. The pharmaceutical composition of embodiment 34, wherein the oxysterol is 25- hydroxycholesterol or 24-S-hydroxycholesterol.

[0371] 40. The pharmaceutical composition any one of embodiments 32-39, wherein the pharmaceutical composition further comprises a lipid.

[0372] 41. The pharmaceutical composition of embodiment 40, wherein the lipid is a phospholipid or a PEGylated lipid.

[0373] 42. The pharmaceutical composition of embodiment 40, wherein the lipid is a cationic lipid.

[0374] 43. The pharmaceutical composition of embodiment 40, wherein the lipid is an anionic or neutral lipid.

[0375] 44. The pharmaceutical composition of embodiment 40, wherein the lipid is a sterol.

[0376] 45. The pharmaceutical composition of embodiment 44, wherein the sterol is cholesterol or a derivative thereof.

[0377] 46. The pharmaceutical composition of any one of embodiments 40-45, wherein the pharmaceutical composition comprises a mixture of lipids.

[0378] 47. The pharmaceutical composition of any one of embodiments 40-46, wherein the composition comprises a nanoparticle comprising the polynucleotide and the lipid.

[0379] 48. The pharmaceutical composition of embodiment 47, wherein the nanoparticle comprises a plurality of the polynucleotides and a plurality of the lipids.

[0380] 49. The pharmaceutical composition of embodiment 47 or 48, wherein the pharmaceutical composition comprises a plurality of the nanoparticles.

[0381] 50. The pharmaceutical composition of embodiment 49, wherein at least 90% of the nanoparticles in the composition have a diameter from about 10 nm to about 500 nm as measured by dynamic light scattering (DLS).

[0382] 51 . The pharmaceutical composition of embodiment 50, wherein at least 90% of the nanoparticles in the composition have a diameter from about 10 nm to about 250 nm as measured by DLS.

[0383] 52. A method of killing a cell, the method comprising contacting the cell with the pharmaceutical composition of any one of embodiments 32-51 , wherein the polypeptide oligomerizes to form a pore, thereby killing the cell. 53. The method of embodiment 52, further comprising contacting the cell with an agent that depletes cholesterol from the cell.

[0384] 54. The method of embodiment 53, wherein the agent comprises a methyl cyclodextrin, an NPC1 inhibitor, a statin, a squalene epoxidase inhibitor, an oxysterol, or a DHCR7 inhibitor.

[0385] 55. The method of embodiment 54, wherein the methyl cyclodextrin is MCD.

[0386] 56. The method of embodiment 54, wherein the statin is fatostatin.

[0387] 57. The method of embodiment 54, wherein the squalene epoxidase inhibitor is NB598.

[0388] 58. The method of embodiment 54, wherein the DHCR7 inhibitor is AY9944.

[0389] 59. The method of embodiment 54, wherein the oxysterol is 25-hydroxycholesterol or 24-S- hydroxycholesterol.

[0390] 60. The method of any one of embodiments 53-59, wherein the method comprises contacting the cell with the agent prior to the polynucleotide, vector, or cell.

[0391] 61. The method of any one of embodiments 52-60, wherein the cell is a macrophage.

[0392] 62. The method of any one of embodiments 52-61 , wherein the method treats a disease or disorder.

[0393] 63. The method of embodiment 62, wherein the disease or disorder is an immune disorder.

[0394] 64. The method of embodiment 63, wherein the immune disorder is systemic lupus erythematosus (SLE), rheumatic arthritis (RA), systemic sclerosis (SSc), and type 1 diabetes (T1 D).

[0395] 65. The method of embodiment 62, wherein the disease or disorder is cancer.

[0396] 66. The method of embodiment 65, wherein the cancer is melanoma, ocular melanoma, breast cancer, bladder cancer, head and neck cancer, glioma, or prostate cancer.

[0397] 67. The method of embodiment 65 or 66, wherein the cell is a tumor cell.

[0398] 68. The method of embodiment 67, wherein the tumor cell is an immune cell in the tumor.

[0399] 69. The method of embodiment 68, wherein the polypeptide oligomerizes to form a pore in the immune cell of the tumor, thereby causing pyroptosis of the immune cell that releases one or more proinflammatory cytokines.

[0400] 70. The method of embodiment 69, wherein the one or more proinflammatory cytokines activates and recruits one or more tumor infiltrating immune cells to kill a different cell in the tumor.

[0401] 71. The method of any one of embodiments 65-70, further comprising administering an immune checkpoint inhibitor.

[0402] 72. The method of embodiment 71 , wherein the immune checkpoint inhibitor is an anti-PD-1 immunotherapy.

[0403] 73. The method of any one of embodiments 52-72, wherein the pharmaceutical composition is administered intravenously or subcutaneously.

[0404] ORDERED EMBODIMENTS B

[0405] 1 . A method of killing a cell, the method comprising contacting the cell with a polynucleotide encoding a gasdermin (GSDM) polypeptide and an agent that depletes cholesterol , wherein the polypeptide oligomerizes to form a pore, thereby killing the cell. 2. The method of embodiment 1 , wherein the agent comprises a methyl cyclodextrin, an NPC1 inhibitor, a statin, a squalene epoxidase inhibitor, an oxysterol, or a DHCR7 inhibitor.

[0406] 3. The method of embodiment 2, wherein the methyl cyclodextrin is MCD.

[0407] 4. The method of embodiment 2, wherein the statin is fatostatin.

[0408] 5. The method of embodiment 2, wherein the squalene epoxidase inhibitor is NB598.

[0409] 6. The method of embodiment 2, wherein the DHCR7 inhibitor is AY9944.

[0410] 7. The method of embodiment 2, wherein the oxysterol is 25-hydroxycholesterol or 24-S- hydroxycholesterol.

[0411] 8. The method of any one of embodiments 1 -7, wherein the method comprises contacting the cell with the agent prior to the polynucleotide.

[0412] 9. The method of any one of embodiments 1 -8, wherein the cell is a macrophage.

[0413] 10. The method of any one of embodiments 1 -9, wherein the method treats a disease or disorder.

[0414] 11 . The method of embodiment 10, wherein the disease or disorder is an immune disorder.

[0415] 12. The method of embodiment 11 , wherein the immune disorder is systemic lupus erythematosus (SLE), rheumatic arthritis (RA), systemic sclerosis (SSc), and type 1 diabetes (T1 D).

[0416] 13. The method of embodiment 10, wherein the disease or disorder is cancer.

[0417] 14. The method of embodiment 13, wherein the cancer is melanoma, ocular melanoma, breast cancer, bladder cancer, head and neck cancer, glioma, or prostate cancer.

[0418] 15. The method of embodiment 13 or 14, wherein the cell is a tumor cell.

[0419] 16. The method of embodiment 15, wherein the tumor cell is an immune cell in the tumor.

[0420] 17. The method of embodiment 16, wherein the polypeptide oligomerizes to form a pore in the immune cell of the tumor, thereby causing pyroptosis of the immune cell that releases one or more proinflammatory cytokines.

[0421] 18. The method of embodiment 17, wherein the one or more proinflammatory cytokines activates and recruits one or more tumor infiltrating immune cells to kill a different cell in the tumor.

[0422] 19. The method of any one of embodiments 1 -18, further comprising administering an immune checkpoint inhibitor.

[0423] 20. The method of embodiment 19, wherein the immune checkpoint inhibitor is an anti-PD-1 immunotherapy.

[0424] 21. The method of any one of embodiments 1-20, wherein the polynucleotide and / or the agent that depletes cholesterol is administered intravenously or subcutaneously.

[0425] 22. The method of any one of embodiments 1 -21 , wherein the GSDM is GSDMA, GSDMB, GSDMC, GSDMD, GSDME (DFNA5), or DFNB59, a biologically active pore forming fragment thereof, or a variant thereof having at least 65% sequence identity thereto.

[0426] 23. The method of embodiment 22, wherein the GSDM comprises an amino acid sequence having at least 65% sequence identity to any one SEQ ID NOs: 1 -16 or a fragment thereof.

[0427] 24. The method of embodiment 23, wherein the polynucleotide comprises a nucleotide sequence having at least 65% sequence identity to any one of SEQ ID NOs: 17-32 or a fragment thereof. 25. The method of any one of embodiments 1-24, wherein the GSDM fragment is an N- terminal GSDM fragment.

[0428] 26. The method of embodiment 25, wherein the N-terminal GSDM fragment comprises an amino acid sequence having at least 65% sequence identity to any one of SEQ ID NOs: 1 , 3, 5, 7, 9, 11 , 13, or 15.

[0429] 27. The method of embodiment 26, wherein the polynucleotide comprises a nucleotide sequence having at least 65% sequence identity to any one of SEQ ID NOs: 17, 19, 21 , 23, 25, 27, 29, or 31.

[0430] 28. The method of any one of embodiments 1 -27, wherein the polynucleotide encodes a plurality of GSDMs.

[0431] 29. The method of embodiment 28, wherein each GSDM is separated by a cleavage site or an internal ribosomal entry site (IRES).

[0432] 30. The method of embodiment 29, wherein the cleavage site is a 2A cleavage site.

[0433] 31. The method of any one of embodiments 28-30, wherein each GSDM is independently, GSDMA, GSDMB, GSDMC, GSDMD, GSDME (DFNA5), or DFNB59, a biologically active pore forming fragment thereof, or a variant thereof having at least 65% sequence identity thereto.

[0434] 32. The method of any one of embodiments 1 -31 , wherein the polynucleotide is an RNA.

[0435] 33. The method of embodiment 32, wherein the RNA is a messenger RNA (mRNA).

[0436] 34. The method of embodiment 33, wherein the mRNA further includes a 5' UTR, 3' UTR, a poly(A) tail, and / or a 5' cap.

[0437] 35. The method of any one of embodiments 1 -31 , wherein the polynucleotide is a DNA.

[0438] 36. The method of any one of embodiments 1 -35, wherein the polynucleotide comprises at least one synthetic modification.

[0439] 37. The method of embodiment 36, wherein the at least one synthetic modification is a 5’ cap analog.

[0440] 38. The method of embodiment 37, wherein the 5’ cap analog is an m7GpppG, anti-reverse cap analog (ARCA), two-headed cap, S cap, or 2S cap.

[0441] 39. The method of embodiment 36, wherein the at least one synthetic modification is a tail modification.

[0442] 40. The method of embodiment 39, wherein the tail modification is a ribose-modified adenosine, 8-azaadenosine, cordycepin, or a fluorescent modification

[0443] 41. The method of embodiment 36, wherein the at least one synthetic modification is a modified nucleobase.

[0444] 42. The method of embodiment 41 , wherein the modified nucleobase is N1- methylpseudouridine (m1qj), 2-thiouridine (S2U), 5-methylcytidine (m5C), N6-methyladenosine (m6A), 2’-O-methyluridine (Um), 2’-O-methylcytidine (Cm), 2’-O-methyladenosine (Am), 2’-O- methylguanosine (Gm), , 5’-methoxyuridine, 5-methylcytosine, 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyladenine, 6-methylguanine, 2-propyladenine, 2- propylguanine, 2-thiouracil, 2-thiothymine, 2-thiocytosine, 5-halouracil, 5-halocytosine, 5- propynyluracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-uracil (pseudouracil), 4-thiouracil, 8-haloadenine, 8-aminoadenine, 8-thioladenine, 8-thioalkyladenine, 8-hydroxyladenine, 8-haloguanine, 8-aminoguanine, 8-thiolguanine, 8-thioalkylguanine, 8-hydroxylguanine, 5- bromouracil, 5-trifluoromethyluracil, 5-bromocytosine, 5-trifluoromethylcytosine, 7-methylguanine, 7- methyladenine, 2-fluoroadenine, 8-azaguanine, 8-azaadenine, 7-deazaguanine, 7-deazaadenine, 3- deazaguanine, or 3-deazaadenine.

[0445] 43. The method of 36, wherein the at least one synthetic modification is a modified sugar.

[0446] 44. The method of embodiment 43, wherein the modified sugar is a 2’-0me or 2’-O-fluoro ribose modification.

[0447] 45. The method of any one of embodiments 1 -43, wherein a vector comprises the polynucleotide.

[0448] 46. The method of embodiment 45, wherein the vector is a viral vector.

[0449] 47. The method of embodiment 46, wherein the viral vector is an RNA viral vector.

[0450] 48. The method of embodiment 47, wherein the RNA viral vector is a replicon RNA or selfamplifying RNA.

[0451] 49. The method of embodiment 48, wherein the viral vector is a DNA viral vector.

[0452] 50. The method of embodiment 49, where in the DNA vector is a replication-deficient adenoviral vector selected from the group consisting of human adenovirus, rhesus adenovirus, simian adenovirus and gorilla adenovirus viral vectors.

[0453] 51. The method of any one of embodiments 1-43, wherein a cell comprises the polynucleotide.

[0454] 52. The method of any one of embodiments 1-51 , wherein the polynucleotide and / or the agent that depletes cholesterol is formulated as a pharmaceutical composition comprising a pharmaceutically acceptable carrier.

[0455] 53. The method of embodiment 52, wherein the pharmaceutical composition further comprises a lipid.

[0456] 54. The method of embodiment 53, wherein the lipid is a phospholipid or a PEGylated lipid.

[0457] 55. The method of embodiment 53, wherein the lipid is a cationic lipid.

[0458] 56. The method of embodiment 53, wherein the lipid is an anionic or neutral lipid.

[0459] 57. The method of embodiment 53, wherein the lipid is a sterol.

[0460] 58. The method of embodiment 57, wherein the sterol is cholesterol or a derivative thereof.

[0461] 59. The method of any one of embodiments 53-58, wherein the pharmaceutical composition comprises a mixture of lipids.

[0462] 60. The method of any one of embodiments 53-59, wherein the pharmaceutical composition comprises a nanoparticle comprising the polynucleotide and the lipid.

[0463] 61. The method of embodiment 60, wherein the nanoparticle comprises a plurality of the polynucleotides and a plurality of the lipids.

[0464] 62. The method of embodiment 60 or 61 , wherein the pharmaceutical composition comprises a plurality of the nanoparticles. 63. The method of embodiment 62, wherein at least 90% of the nanoparticles in the composition have a diameter from about 10 nm to about 500 nm as measured by dynamic light scattering (DLS).

[0465] 64. The method of embodiment 63, wherein at least 90% of the nanoparticles in the composition have a diameter from about 10 nm to about 250 nm as measured by DLS.

[0466] 65. A kit comprising a polynucleotide encoding a GSDM polypeptide and an agent that depletes cholesterol.

[0467] 66. The kit of embodiment 65, wherein the GSDM is GSDMA, GSDMB, GSDMC, GSDMD, GSDME (DFNA5), or DFNB59, a biologically active pore forming fragment thereof, or a variant thereof having at least 65% sequence identity thereto.

[0468] 67. The kit of embodiment 66, wherein the GSDM comprises an amino acid sequence having at least 65% sequence identity to any one SEQ ID NOs: 1-16 or a fragment thereof.

[0469] 68. The kit of embodiment 67, wherein the polynucleotide comprises a nucleotide sequence having at least 65% sequence identity to any one of SEQ ID NOs: 17-32 or a fragment thereof.

[0470] 69. The kit of any one of embodiments 65-68, wherein the GSDM fragment is an N-terminal GSDM fragment.

[0471] 70. The kit of embodiment 69, wherein the N-terminal GSDM fragment comprises an amino acid sequence having at least 65% sequence identity to any one of SEQ ID NOs: 1 , 3, 5, 7, 9, 11 , 13, or 15.

[0472] 71 . The kit of embodiment 70, wherein the polynucleotide comprises a nucleotide sequence having at least 65% sequence identity to any one of SEQ ID NOs: 17, 19, 21 , 23, 25, 27, 29, or 31 .

[0473] 72. The kit of any one of embodiments 65-71 , wherein the polynucleotide encodes a plurality of GSDMs.

[0474] 73. The kit of embodiment 72, wherein each GSDM is separated by a cleavage site or an internal ribosomal entry site (IRES).

[0475] 74. The kit of embodiment 73, wherein the cleavage site is a 2A cleavage site.

[0476] 75. The kit of any one of embodiments 72-74, wherein each GSDM is independently, GSDMA, GSDMB, GSDMC, GSDMD, GSDME (DFNA5), or DFNB59, a biologically active pore forming fragment thereof, or a variant thereof having at least 65% sequence identity thereto.

[0477] 76. The kit of any one of embodiments 65-75, wherein the polynucleotide is an RNA.

[0478] 77. The kit of embodiment 76, wherein the RNA is a messenger RNA (mRNA).

[0479] 78. The kit of embodiment 77, wherein the mRNA further includes a 5' UTR, 3' UTR, a poly(A) tail, and / or a 5' cap.

[0480] 79. The kit of any one of embodiments 65-75, wherein the polynucleotide is a DNA.

[0481] 80. The kit of any one of embodiments 65-79, wherein the polynucleotide comprises at least one synthetic modification.

[0482] 81 . The kit of embodiment 80, wherein the at least one synthetic modification is a 5’ cap analog.

[0483] 82. The kit of embodiment 81 , wherein the 5’ cap analog is an m7GpppG, anti-reverse cap analog (ARCA), two-headed cap, S cap, or 2S cap. 83. The kit of embodiment 80, wherein the at least one synthetic modification is a tail modification.

[0484] 84. The kit of embodiment 83, wherein the tail modification is a ribose-modified adenosine, 8- azaadenosine, cordycepin, or a fluorescent modification

[0485] 85. The kit of embodiment 80, wherein the at least one synthetic modification is a modified nucleobase.

[0486] 86. The kit of embodiment 85, wherein the modified nucleobase is N1-methylpseudouridine (m1qj), 2-thiouridine (S2U), 5-methylcytidine (m5C), N6-methyladenosine (m6A), 2’-O-methyluridine (Um), 2’-O-methylcytidine (Cm), 2’-O-methyladenosine (Am), 2’-O-methylguanosine (Gm), , 5’- methoxyuridine, 5-methylcytosine, 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2- aminoadenine, 6-methyladenine, 6-methylguanine, 2-propyladenine, 2-propylguanine, 2-thiouracil, 2- thiothymine, 2-thiocytosine, 5-halouracil, 5-halocytosine, 5-propynyluracil, 5-propynylcytosine, 6- azouracil, 6-azocytosine, 6-azothymine, 5-uracil (pseudouracil), 4-thiouracil, 8-haloadenine, 8- aminoadenine, 8-thioladenine, 8-thioalkyladenine, 8-hydroxyladenine, 8-haloguanine, 8- aminoguanine, 8-thiolguanine, 8-thioalkylguanine, 8-hydroxylguanine, 5-bromouracil, 5- trifluoromethyluracil, 5-bromocytosine, 5-trifluoromethylcytosine, 7-methylguanine, 7-methyladenine,

[0487] 2-fluoroadenine, 8-azaguanine, 8-azaadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, or

[0488] 3-deazaadenine.

[0489] 87. The kit of 80, wherein the at least one synthetic modification is a modified sugar.

[0490] 88. The kit of embodiment 87, wherein the modified sugar is a 2’-0me or 2’-O-fluoro ribose modification.

[0491] 89. The kit of any one of embodiments 65-88, wherein a vector comprises the polynucleotide.

[0492] 90. The kit of embodiment 89, wherein the vector is a viral vector.

[0493] 91 . The kit of embodiment 90, wherein the viral vector is an RNA viral vector.

[0494] 92. The kit of embodiment 91 , wherein the RNA viral vector is a replicon RNA or selfamplifying RNA.

[0495] 93. The kit of embodiment 90, wherein the viral vector is a DNA viral vector.

[0496] 94. The kit of embodiment 93, where in the DNA vector is a replication-deficient adenoviral vector selected from the group consisting of human adenovirus, rhesus adenovirus, simian adenovirus and gorilla adenovirus viral vectors.

[0497] 95. The kit of any one of embodiments 65-94, wherein a cell comprises the polynucleotide.

[0498] 96. The kit of any one of embodiments 65-95, wherein the cholesterol depleting agent comprises a methyl cyclodextrin, a Niemann-Pick C1 (NPC1) inhibitor, a statin, a squalene epoxidase inhibitor, an oxysterol, or a 7-Dehydrocholesterol reductase (DHCR7) inhibitor.

[0499] 97. The kit of embodiment 96, wherein the methyl cyclodextrin is methyl-p-cyclodextrin (MCD).

[0500] 98. The kit of embodiment 96, wherein the statin is fatostatin.

[0501] 99. The kit of embodiment 96, wherein the squalene epoxidase inhibitor is NB598. 100. The kit of embodiment 96, wherein the DHCR7 inhibitor is AY9944.

[0502] 101 . The kit of embodiment 96, wherein the oxysterol is 25-hydroxycholesterol or 24-S- hydroxycholesterol.

[0503] 102. The kit of any one of embodiments 65-101 , wherein the polynucleotide and / or the agent that depletes cholesterol is formulated as a pharmaceutical composition comprising a pharmaceutically acceptable carrier.

[0504] 103. The kit of embodiment 102, wherein the pharmaceutical composition further comprises a lipid.

[0505] 104. The kit of embodiment 103, wherein the lipid is a phospholipid or a PEGylated lipid.

[0506] 105. The kit of embodiment 103, wherein the lipid is a cationic lipid.

[0507] 106. The kit of embodiment 103, wherein the lipid is an anionic or neutral lipid.

[0508] 107. The kit of embodiment 103, wherein the lipid is a sterol.

[0509] 108. The kit of embodiment 107, wherein the sterol is cholesterol or a derivative thereof.

[0510] 109. The kit of any one of embodiments 103-108, wherein the pharmaceutical composition comprises a mixture of lipids.

[0511] 110. The kit of any one of embodiments 103-109, wherein the composition comprises a nanoparticle comprising the polynucleotide and the lipid.

[0512] 111. The kit of embodiment 110, wherein the nanoparticle comprises a plurality of the polynucleotides and a plurality of the lipids.

[0513] 112. The kit of embodiment 110 or 111 , wherein the pharmaceutical composition comprises a plurality of the nanoparticles.

[0514] 113. The kit of embodiment 112, wherein at least 90% of the nanoparticles in the composition have a diameter from about 10 nm to about 500 nm as measured by dynamic light scattering (DLS).

[0515] 114. The kit of embodiment 113, wherein at least 90% of the nanoparticles in the composition have a diameter from about 10 nm to about 250 nm as measured by DLS.

[0516] 115. A method of killing a cell, the method comprising contacting the cell an agent that depletes cholesterol and an activator of an endogenous gasdermin polypeptide, wherein the polypeptide oligomerizes to form a pore, thereby killing the cell.

[0517] 116. The method of embodiment 115, wherein the agent comprises a methyl cyclodextrin, an NPC1 inhibitor, a statin, a squalene epoxidase inhibitor, an oxysterol, or a DHCR7 inhibitor.

[0518] 117. The method of embodiment 116, wherein the methyl cyclodextrin is MCD.

[0519] 118. The method of embodiment 116, wherein the statin is fatostatin.

[0520] 119. The method of embodiment 116, wherein the squalene epoxidase inhibitor is NB598.

[0521] 120. The method of embodiment 116, wherein the DHCR7 inhibitor is AY9944.

[0522] 121 . The method of embodiment 116, wherein the oxysterol is 25-hydroxycholesterol or 24-S- hydroxycholesterol.

[0523] 122. The method of any one of embodiments 115-121 , wherein the method comprises contacting the cell with the agent prior to the activator.

[0524] 123. The method of any one of embodiments 115-122, wherein the cell is a macrophage. 124. The method of any one of embodiments 115-123, wherein the method treats a disease or disorder.

[0525] 125. The method of embodiment 124, wherein the disease or disorder is an immune disorder.

[0526] 126. The method of embodiment 125, wherein the immune disorder is systemic lupus erythematosus (SLE), rheumatic arthritis (RA), systemic sclerosis (SSc), and type 1 diabetes (T1 D).

[0527] 127. The method of embodiment 124, wherein the disease or disorder is cancer.

[0528] 128. The method of embodiment 127, wherein the cancer is melanoma, ocular melanoma, breast cancer, bladder cancer, head and neck cancer, glioma, or prostate cancer.

[0529] 129. The method of embodiment 127 or 128, wherein the cell is a tumor cell.

[0530] 130. The method of embodiment 129, wherein the tumor cell is an immune cell in the tumor.

[0531] 131. The method of embodiment 130, wherein the polypeptide oligomerizes to form a pore in the immune cell of the tumor, thereby causing pyroptosis of the immune cell that releases one or more proinflammatory cytokines.

[0532] 132. The method of embodiment 131 , wherein the one or more proinflammatory cytokines activates and recruits one or more tumor infiltrating immune cells to kill a different cell in the tumor.

[0533] 133. The method of any one of embodiments 115-132, further comprising administering an immune checkpoint inhibitor.

[0534] 134. The method of embodiment 133, wherein the immune checkpoint inhibitor is an anti-PD- 1 immunotherapy.

[0535] 135. The method of any one of embodiments 115-134, wherein the activator and / or the agent that depletes cholesterol is administered intravenously or subcutaneously.

[0536] 136. The method of any one of embodiments 115-135, wherein the endogenous gasdermin is GSDMA, GSDMB, GSDMC, GSDMD, GSDME (DFNA5), or DFNB59.

[0537] 137. The method of any one of embodiments 115-136, wherein the gasdermin activator comprises radiation, a chemotherapeutic agent, or a protease.

[0538] 138. The method of embodiment 137, wherein the protease is a caspase.

[0539] 139. The method of embodiment 138, wherein the caspase is caspase-1 , caspase-3, caspase-4, caspase-5, caspase-7, or caspase-8.

[0540] 140. The method of embodiment 137, wherein the chemotherapeutic agent is doxorubicin, etoposide, cisplatin, topotecan, mitoxantrone, actinomycin-D, or talabostat.

[0541] 141 . A kit comprising an agent that depletes cholesterol and an activator of an endogenous gasdermin polypeptide.

[0542] 142. The kit of embodiment 141 , further comprising an immune checkpoint inhibitor.

[0543] OTHER EMBODIMENTS

[0544] While the invention has been described in connection with specific embodiments thereof, it will be understood that it is capable of further modifications and this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the invention that come within known or customary practice within the art to which the invention pertains and may be applied to the essential features hereinbefore set forth and follows in the scope of the claims.

[0545] Other embodiments are within the claims.

Claims

CLAIMS1 . A method of killing a cell, the method comprising contacting the cell with a polynucleotide encoding a gasdermin (GSDM) polypeptide and an agent that depletes cholesterol , wherein the polypeptide oligomerizes to form a pore, thereby killing the cell.

2. The method of claim 1 , wherein the agent comprises a methyl cyclodextrin, an NPC1 inhibitor, a statin, a squalene epoxidase inhibitor, an oxysterol, or a DHCR7 inhibitor.

3. The method of claim 2, wherein the methyl cyclodextrin is MCD.

4. The method of claim 2, wherein the statin is fatostatin.

5. The method of claim 2, wherein the squalene epoxidase inhibitor is NB598.

6. The method of claim 2, wherein the DHCR7 inhibitor is AY9944.

7. The method of claim 2, wherein the oxysterol is 25-hydroxycholesterol or 24-S-hydroxycholesterol.

8. The method of claim 1 , wherein the method comprises contacting the cell with the agent prior to the polynucleotide.

9. The method of claim 1 , wherein the cell is a macrophage.

10. The method of claim 1 , wherein the method treats a disease or disorder.11 . The method of claim 10, wherein the disease or disorder is an immune disorder.

12. The method of claim 11 , wherein the immune disorder is systemic lupus erythematosus (SLE), rheumatic arthritis (RA), systemic sclerosis (SSc), and type 1 diabetes (T1 D).

13. The method of claim 10, wherein the disease or disorder is cancer.

14. The method of claim 13, wherein the cancer is melanoma, ocular melanoma, breast cancer, bladder cancer, head and neck cancer, glioma, or prostate cancer.

15. The method of claim 13, wherein the cell is a tumor cell.

16. The method of claim 15, wherein the tumor cell is an immune cell in the tumor.

17. The method of claim 16, wherein the polypeptide oligomerizes to form a pore in the immune cell of the tumor, thereby causing pyroptosis of the immune cell that releases one or more proinflammatory cytokines.

18. The method of claim 17, wherein the one or more proinflammatory cytokines activates and recruits one or more tumor infiltrating immune cells to kill a different cell in the tumor.

19. The method of claim 1 , further comprising administering an immune checkpoint inhibitor.

20. The method of claim 19, wherein the immune checkpoint inhibitor is an anti-PD-1 immunotherapy.21 . The method of claim 1 , wherein the polynucleotide and / or the agent that depletes cholesterol is administered intravenously or subcutaneously.

22. The method of claim 1 , wherein the GSDM is GSDMA, GSDMB, GSDMC, GSDMD, GSDME (DFNA5), or DFNB59, a biologically active pore forming fragment thereof, or a variant thereof having at least 65% sequence identity thereto.

23. The method of claim 22, wherein the GSDM comprises an amino acid sequence having at least 65% sequence identity to any one SEQ ID NOs: 1-16 or a fragment thereof.

24. The method of claim 23, wherein the polynucleotide comprises a nucleotide sequence having at least 65% sequence identity to any one of SEQ ID NOs: 17-32 or a fragment thereof.

25. The method of claim 1 , wherein the GSDM fragment is an N-terminal GSDM fragment.

26. The method of claim 25, wherein the N-terminal GSDM fragment comprises an amino acid sequence having at least 65% sequence identity to any one of SEQ ID NOs: 1 , 3, 5, 7, 9, 11 , 13, or 15.

27. The method of claim 26, wherein the polynucleotide comprises a nucleotide sequence having at least 65% sequence identity to any one of SEQ ID NOs: 17, 19, 21 , 23, 25, 27, 29, or 31.

28. The method of claim 1 , wherein the polynucleotide encodes a plurality of GSDMs.

29. The method of claim 28, wherein each GSDM is separated by a cleavage site or an internal ribosomal entry site (IRES).

30. The method of claim 29, wherein the cleavage site is a 2A cleavage site.

31. The method of claim 28, wherein each GSDM is independently, GSDMA, GSDMB, GSDMC, GSDMD, GSDME (DFNA5), or DFNB59, a biologically active pore forming fragment thereof, or a variant thereof having at least 65% sequence identity thereto.

32. The method of claim 1 , wherein the polynucleotide is an RNA.

33. The method of claim 32, wherein the RNA is a messenger RNA (mRNA).

34. The method of claim 33, wherein the mRNA further includes a 5' UTR, 3' UTR, a poly(A) tail, and / or a 5' cap.

35. The method of claim 1 , wherein the polynucleotide is a DNA.

36. The method of claim 1 , wherein the polynucleotide comprises at least one synthetic modification.

37. The method of claim 36, wherein the at least one synthetic modification is a 5’ cap analog.

38. The method of claim 37, wherein the 5’ cap analog is an m7GpppG, anti-reverse cap analog (ARCA), two-headed cap, S cap, or 2S cap.

39. The method of claim 36, wherein the at least one synthetic modification is a tail modification.

40. The method of claim 39, wherein the tail modification is a ribose-modified adenosine, 8- azaadenosine, cordycepin, or a fluorescent modification41. The method of claim 36, wherein the at least one synthetic modification is a modified nucleobase.

42. The method of claim 41 , wherein the modified nucleobase is N1-methylpseudouridine (m1qj), 2- thiouridine (S2U), 5-methylcytidine (m5C), N6-methyladenosine (m6A), 2’-O-methyluridine (Um), 2’-O- methylcytidine (Cm), 2’-O-methyladenosine (Am), 2’-O-methylguanosine (Gm), , 5’-methoxyuridine, 5- methylcytosine, 5-hydroxy methyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6- methyladenine, 6-methylguanine, 2-propyladenine, 2-propylguanine, 2-thiouracil, 2-thiothymine, 2- thiocytosine, 5-halouracil, 5-halocytosine, 5-propynyluracil, 5-propynylcytosine, 6-azouracil, 6- azocytosine, 6-azothymine, 5-uracil (pseudouracil), 4-thiouracil, 8-haloadenine, 8-aminoadenine, 8- thioladenine, 8-thioalkyladenine, 8-hydroxyladenine, 8-haloguanine, 8-aminoguanine, 8-thiolguanine, 8-thioalkylguanine, 8-hydroxylguanine, 5-bromouracil, 5-trifluoromethyluracil, 5-bromocytosine, 5- trifluoromethylcytosine, 7-methylguanine, 7-methyladenine, 2-fluoroadenine, 8-azaguanine, 8- azaadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, or 3-deazaadenine.

43. The method of 36, wherein the at least one synthetic modification is a modified sugar.

44. The method of claim 43, wherein the modified sugar is a 2’-0me or 2’-O-fluoro ribose modification.

45. The method of claim 1 , wherein a vector comprises the polynucleotide.

46. The method of claim 45, wherein the vector is a viral vector.

47. The method of claim 46, wherein the viral vector is an RNA viral vector.

48. The method of claim 47, wherein the RNA viral vector is a replicon RNA or self-amplifying RNA.

49. The method of claim 48, wherein the viral vector is a DNA viral vector.

50. The method of claim 49, where in the DNA vector is a replication-deficient adenoviral vector selected from the group consisting of human adenovirus, rhesus adenovirus, simian adenovirus and gorilla adenovirus viral vectors.51 . The method of claim 1 , wherein a cell comprises the polynucleotide.

52. The method of claim 1 , wherein the polynucleotide and / or the agent that depletes cholesterol is formulated as a pharmaceutical composition comprising a pharmaceutically acceptable carrier.

53. The method of claim 52, wherein the pharmaceutical composition further comprises a lipid.

54. The method of claim 53, wherein the lipid is a phospholipid or a PEGylated lipid.

55. The method of claim 53, wherein the lipid is a cationic lipid.

56. The method of claim 53, wherein the lipid is an anionic or neutral lipid.

57. The method of claim 53, wherein the lipid is a sterol.

58. The method of claim 57, wherein the sterol is cholesterol or a derivative thereof.

59. The method of claim 53, wherein the pharmaceutical composition comprises a mixture of lipids.

60. The method of claim 53, wherein the pharmaceutical composition comprises a nanoparticle comprising the polynucleotide and the lipid.

61. The method of claim 60, wherein the nanoparticle comprises a plurality of the polynucleotides and a plurality of the lipids.

62. The method of claim 60, wherein the pharmaceutical composition comprises a plurality of the nanoparticles.

63. The method of claim 62, wherein at least 90% of the nanoparticles in the composition have a diameter from about 10 nm to about 500 nm as measured by dynamic light scattering (DLS).

64. The method of claim 63, wherein at least 90% of the nanoparticles in the composition have a diameter from about 10 nm to about 250 nm as measured by DLS.

65. A kit comprising a polynucleotide encoding a GSDM polypeptide and an agent that depletes cholesterol.

66. The kit of claim 65, wherein the GSDM is GSDMA, GSDMB, GSDMC, GSDMD, GSDME (DFNA5), or DFNB59, a biologically active pore forming fragment thereof, or a variant thereof having at least 65% sequence identity thereto.

67. The kit of claim 66, wherein the GSDM comprises an amino acid sequence having at least 65% sequence identity to any one SEQ ID NOs: 1 -16 or a fragment thereof.

68. The kit of claim 67, wherein the polynucleotide comprises a nucleotide sequence having at least 65% sequence identity to any one of SEQ ID NOs: 17-32 or a fragment thereof.

69. The kit of claim 65, wherein the GSDM fragment is an N-terminal GSDM fragment.

70. The kit of claim 69, wherein the N-terminal GSDM fragment comprises an amino acid sequence having at least 65% sequence identity to any one of SEQ ID NOs: 1 , 3, 5, 7, 9, 11 , 13, or 15.

71. The kit of claim 70, wherein the polynucleotide comprises a nucleotide sequence having at least 65% sequence identity to any one of SEQ ID NOs: 17, 19, 21 , 23, 25, 27, 29, or 31 .

72. The kit of claim 65, wherein the polynucleotide encodes a plurality of GSDMs.

73. The kit of claim 72, wherein each GSDM is separated by a cleavage site or an internal ribosomal entry site (IRES).

74. The kit of claim 73, wherein the cleavage site is a 2A cleavage site.

75. The kit of claim 72, wherein each GSDM is independently, GSDMA, GSDMB, GSDMC, GSDMD, GSDME (DFNA5), or DFNB59, a biologically active pore forming fragment thereof, or a variant thereof having at least 65% sequence identity thereto.

76. The kit of claim 65, wherein the polynucleotide is an RNA.

77. The kit of claim 76, wherein the RNA is a messenger RNA (mRNA).

78. The kit of claim 77, wherein the mRNA further includes a 5' UTR, 3' UTR, a poly(A) tail, and / or a 5' cap.

79. The kit of claim 65, wherein the polynucleotide is a DNA.

80. The kit of claim 65, wherein the polynucleotide comprises at least one synthetic modification.81 . The kit of claim 80, wherein the at least one synthetic modification is a 5’ cap analog.

82. The kit of claim 81 , wherein the 5’ cap analog is an m7GpppG, anti-reverse cap analog (ARCA), two-headed cap, S cap, or 2S cap.

83. The kit of claim 80, wherein the at least one synthetic modification is a tail modification.

84. The kit of claim 83, wherein the tail modification is a ribose-modified adenosine, 8-azaadenosine, cordycepin, or a fluorescent modification85. The kit of claim 80, wherein the at least one synthetic modification is a modified nucleobase.

86. The kit of claim 85, wherein the modified nucleobase is N1-methylpseudouridine (m1qj), 2- thiouridine (S2U), 5-methylcytidine (m5C), N6-methyladenosine (m6A), 2’-O-methyluridine (Um), 2’-O- methylcytidine (Cm), 2’-O-methyladenosine (Am), 2’-O-methylguanosine (Gm), , 5’-methoxyuridine, 5- methylcytosine, 5-hydroxy methyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6- methyladenine, 6-methylguanine, 2-propyladenine, 2-propylguanine, 2-thiouracil, 2-thiothymine, 2- thiocytosine, 5-halouracil, 5-halocytosine, 5-propynyluracil, 5-propynylcytosine, 6-azouracil, 6- azocytosine, 6-azothymine, 5-uracil (pseudouracil), 4-thiouracil, 8-haloadenine, 8-aminoadenine, 8- thioladenine, 8-thioalkyladenine, 8-hydroxyladenine, 8-haloguanine, 8-aminoguanine, 8-thiolguanine, 8-thioalkylguanine, 8-hydroxylguanine, 5-bromouracil, 5-trifluoromethyluracil, 5-bromocytosine, 5- trifluoromethylcytosine, 7-methylguanine, 7-methyladenine, 2-fluoroadenine, 8-azaguanine, 8- azaadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, or 3-deazaadenine.

87. The kit of 80, wherein the at least one synthetic modification is a modified sugar.

88. The kit of claim 87, wherein the modified sugar is a 2’-0me or 2’-O-fluoro ribose modification.

89. The kit of claim 65, wherein a vector comprises the polynucleotide.

90. The kit of claim 89, wherein the vector is a viral vector.91 . The kit of claim 90, wherein the viral vector is an RNA viral vector.

92. The kit of claim 91 , wherein the RNA viral vector is a replicon RNA or self-amplifying RNA.

93. The kit of claim 90, wherein the viral vector is a DNA viral vector.

94. The kit of claim 93, where in the DNA vector is a replication-deficient adenoviral vector selected from the group consisting of human adenovirus, rhesus adenovirus, simian adenovirus and gorilla adenovirus viral vectors.

95. The kit of claim 65, wherein a cell comprises the polynucleotide.

96. The kit of claim 65, wherein the cholesterol depleting agent comprises a methyl cyclodextrin, a Niemann-Pick C1 (NPC1) inhibitor, a statin, a squalene epoxidase inhibitor, an oxysterol, or a 7- Dehydrocholesterol reductase (DHCR7) inhibitor.

97. The kit of claim 96, wherein the methyl cyclodextrin is methyl-p-cyclodextrin (MCD).

98. The kit of claim 96, wherein the statin is fatostatin.

99. The kit of claim 96, wherein the squalene epoxidase inhibitor is NB598.

100. The kit of claim 96, wherein the DHCR7 inhibitor is AY9944.101 . The kit of claim 96, wherein the oxysterol is 25-hydroxycholesterol or 24-S-hydroxycholesterol.

102. The kit of claim 65, wherein the polynucleotide and / or the agent that depletes cholesterol is formulated as a pharmaceutical composition comprising a pharmaceutically acceptable carrier.

103. The kit of claim 102, wherein the pharmaceutical composition further comprises a lipid.

104. The kit of claim 103, wherein the lipid is a phospholipid or a PEGylated lipid.

105. The kit of claim 103, wherein the lipid is a cationic lipid.

106. The kit of claim 103, wherein the lipid is an anionic or neutral lipid.

107. The kit of claim 103, wherein the lipid is a sterol.

108. The kit of claim 107, wherein the sterol is cholesterol or a derivative thereof.

109. The kit of claim 103, wherein the pharmaceutical composition comprises a mixture of lipids.

110. The kit of claim 103, wherein the composition comprises a nanoparticle comprising the polynucleotide and the lipid.

111. The kit of claim 110, wherein the nanoparticle comprises a plurality of the polynucleotides and a plurality of the lipids.

112. The kit of claim 110, wherein the pharmaceutical composition comprises a plurality of the nanoparticles.

113. The kit of claim 112, wherein at least 90% of the nanoparticles in the composition have a diameter from about 10 nm to about 500 nm as measured by dynamic light scattering (DLS).

114. The kit of claim 113, wherein at least 90% of the nanoparticles in the composition have a diameter from about 10 nm to about 250 nm as measured by DLS.

115. A method of killing a cell, the method comprising contacting the cell an agent that depletes cholesterol and an activator of an endogenous gasdermin polypeptide, wherein the polypeptide oligomerizes to form a pore, thereby killing the cell.

116. The method of claim 115, wherein the agent comprises a methyl cyclodextrin, an NPC1 inhibitor, a statin, a squalene epoxidase inhibitor, an oxysterol, or a DHCR7 inhibitor.

117. The method of claim 116, wherein the methyl cyclodextrin is MCD.

118. The method of claim 116, wherein the statin is fatostatin.

119. The method of claim 116, wherein the squalene epoxidase inhibitor is NB598.

120. The method of claim 116, wherein the DHCR7 inhibitor is AY9944.

121. The method of claim 116, wherein the oxysterol is 25-hydroxycholesterol or 24-S- hydroxycholesterol.

122. The method of claim 115, wherein the method comprises contacting the cell with the agent prior to the activator.

123. The method of claim 115, wherein the cell is a macrophage.

124. The method of claim 115, wherein the method treats a disease or disorder.

125. The method of claim 124, wherein the disease or disorder is an immune disorder.

126. The method of claim 125, wherein the immune disorder is systemic lupus erythematosus (SLE), rheumatic arthritis (RA), systemic sclerosis (SSc), and type 1 diabetes (T1 D).

127. The method of claim 124, wherein the disease or disorder is cancer.

128. The method of claim 127, wherein the cancer is melanoma, ocular melanoma, breast cancer, bladder cancer, head and neck cancer, glioma, or prostate cancer.

129. The method of claim 127 or 128, wherein the cell is a tumor cell.

130. The method of claim 129, wherein the tumor cell is an immune cell in the tumor.131 . The method of claim 130, wherein the polypeptide oligomerizes to form a pore in the immune cell of the tumor, thereby causing pyroptosis of the immune cell that releases one or more proinflammatory cytokines.

132. The method of claim 131 , wherein the one or more proinflammatory cytokines activates and recruits one or more tumor infiltrating immune cells to kill a different cell in the tumor.

133. The method of claim 115, further comprising administering an immune checkpoint inhibitor.

134. The method of claim 133, wherein the immune checkpoint inhibitor is an anti-PD-1 immunotherapy.

135. The method of claim 115, wherein the activator and / or the agent that depletes cholesterol is administered intravenously or subcutaneously.

136. The method of claim 115, wherein the endogenous gasdermin is GSDMA, GSDMB, GSDMC, GSDMD, GSDME (DFNA5), or DFNB59.

137. The method of claim 115, wherein the gasdermin activator comprises radiation, a chemotherapeutic agent, or a protease.

138. The method of claim 137, wherein the protease is a caspase.

139. The method of claim 138, wherein the caspase is caspase-1 , caspase-3, caspase-4, caspase-5, caspase-7, or caspase-8.

140. The method of claim 137, wherein the chemotherapeutic agent is doxorubicin, etoposide, cisplatin, topotecan, mitoxantrone, actinomycin-D, or talabostat.141 . A kit comprising an agent that depletes cholesterol and an activator of an endogenous gasdermin polypeptide.

142. The kit of claim 141 , further comprising an immune checkpoint inhibitor.

Citation Information

Patent Citations

  • Methods for regulating potency of pluripotent stem cells and applications thereof

    US20220090023A1

  • RNA Replicon for Versatile and Efficient Gene Expression

    US20230265454A1

  • Prevention and / or treatment of hearing loss or impairment

    WO2016131981A1