Helper plasmid for high-yield recombinant adeno-associated virus, and use

Abstract

Provided are a helper plasmid for a high-yield recombinant adeno-associated virus (AAV), and a use. The provided helper plasmid comprises a backbone plasmid and a recombinant sequence; the recombinant sequence comprises Rep and Cap protein coding sequences, E2A, E4 and VARNA sequences, and at least one promoter sequence; and the promoter sequence is located downstream of the Rep and Cap protein coding sequences. When cells are transfected with the helper plasmid, the AAV yield of single cells can be significantly increased. The helper plasmid can be applied to large-scale AAV production.

Description

A high-yield recombinant adeno-associated virus helper plasmid and its application Technical Field

[0001] The present invention relates to the technical field of genetic engineering, and in particular to a helper plasmid for high-yield recombinant adeno-associated virus and its application. Background Art

[0002] In recent years, rAAV-based gene therapy has garnered widespread attention due to its advantages such as low pathogenicity and low immunogenicity, making it a highly favored gene therapy delivery vector. rAAV-based vectors can target dividing and non-dividing cells, including the retina, liver, heart, muscle, and central nervous system (CNS), to achieve long-term expression of therapeutic genes. To date, over 200 clinical trials have been conducted for the treatment of various diseases, such as hemophilia, Parkinson's disease, wet age-related macular degeneration, mucopolysaccharidosis (MPS), and Batten disease. Despite the success of rAAV-based gene therapy in clinical trials, high manufacturing costs remain a bottleneck in the gene therapy field due to low yields and high dose requirements for certain disease indications, limiting patient access to these promising products. This, in turn, intensifies the demand for reducing AAV production costs and establishing flexible and GMP-compliant AAV production systems.

[0003] Transient transfection of human embryonic kidney (HEK) 293 cells with plasmids is a common strategy for producing adeno-associated virus (AAV) vectors, offering key advantages such as short production cycles, ease of operation, and flexibility. The three-plasmid transfection method is currently the most commonly used method for producing recombinant adeno-associated virus (rAAV). This method co-transfects HEK293 cells with three plasmids: an AAV genome plasmid containing a target gene (GOI) expression cassette flanked by inverted terminal repeats (ITRs); a packaging plasmid providing the AAV Rep and Cap protein coding sequences; and a helper plasmid containing the adenoviral E2A, E4, and VA RNA genes.

[0004] In 1998, Grimm et al. reported combining the packaging plasmid and helper plasmid from the three-plasmid construct into a single plasmid, combining the AAV rep / cap and Ad helper genes in a single helper plasmid, pDG. However, AAV production using this helper plasmid resulted in low titers of approximately 1E+07 IU / mL. Recently, modifications to this prototype backbone replaced the ampicillin gene with a kanamycin resistance gene, generating another helper plasmid, called pQT, that is more compliant with GMP production standards. By replacing the three-plasmid construct with a dual-plasmid for AAV production, the transfection procedure is simplified and the number of components required for AAV production is reduced, lowering the cost of plasmid production and thus significantly saving costs in the GMP production of rAAV.

[0005] Summary of the Invention

[0006] The purpose of the present invention is to overcome the shortcomings of the prior art and provide a helper plasmid for high-yield recombinant adeno-associated virus and its application.

[0007] To achieve the above object, the technical solution adopted by the present invention is as follows:

[0008] In a first aspect, the present invention provides a helper plasmid for high-yield recombinant adeno-associated virus, comprising a backbone plasmid and a recombinant sequence; the recombinant sequence comprises:

[0009] Rep, Cap protein coding sequences, E2A, E4, VA RNA sequences and at least one promoter sequence;

[0010] The promoter sequence is located downstream of the Rep and Cap protein coding sequences.

[0011] After the helper plasmid of the present invention is transfected into cells, compared with the pRCHelper helper vector driven by a single promoter, the helper plasmid with the promoter placed downstream of the Rep and Cap protein coding sequences can increase the AAV yield by about 4.2-11.2 times, which can significantly improve the AAV yield of single cells.

[0012] As a preferred embodiment of the helper plasmid described in the present invention, the recombinant sequence further includes at least one DA' sequence.

[0013] As a preferred embodiment of the helper plasmid of the present invention, the DA' sequence is located downstream of the Rep and Cap protein coding sequences.

[0014] As a preferred embodiment of the helper plasmid of the present invention, the recombinant sequence includes any one of the following in order from 5' to 3' direction:

[0015] i. the Rep and Cap protein coding sequences, the E2A, E4, and VA RNA sequences, and the promoter sequence;

[0016] ii. the Rep and Cap protein coding sequences, the E2A, E4, and VA RNA sequences, the DA' sequence, and the promoter sequence;

[0017] iii. the E2A, E4, VA RNA sequences, the Rep and Cap protein coding sequences, the DA' sequence, and the promoter sequence;

[0018] iv. the Rep and Cap protein coding sequences, the promoter sequence, and the E2A, E4, and VA RNA sequences;

[0019] v, the Rep and Cap protein coding sequences, the DA' sequence, the promoter sequence, and the E2A, E4, and VA RNA sequences;

[0020] vi, the Rep and Cap protein coding sequences, the promoter sequence, the E2A, E4, and VA RNA sequences, and the DA' sequence;

[0021] vii. the Rep and Cap protein coding sequences, the DA' sequence, the E2A, E4, and VA RNA sequences, and the promoter sequence;

[0022] viii. the Rep and Cap protein coding sequences, the DA' sequence, the E2A, E4, and VA RNA sequences, the DA' sequence, and the promoter sequence;

[0023] ix, the Rep and Cap protein coding sequences, the DA' sequence, the promoter sequence, the E2A, E4, and VA RNA sequences, the DA' sequence, and the promoter sequence.

[0024] As a preferred embodiment of the helper plasmid of the present invention, the promoter is the P5 promoter, and its nucleotide sequence is shown in SEQ ID NO: 2.

[0025] As a preferred embodiment of the helper plasmid of the present invention, the DA' sequence is shown as SEQ ID NO:3.

[0026] As a preferred embodiment of the helper plasmid described in the present invention, the Rep is derived from adeno-associated virus type 2, and its nucleotide sequence is shown in SEQ ID NO: 4; the Cap is derived from adeno-associated virus type 9, and its nucleotide sequence is shown in SEQ ID NO: 5.

[0027] As a preferred embodiment of the helper plasmid described in the present invention, the E2A, E4, and VA RNA are derived from adenovirus; preferably, the nucleotide sequence of the E2A is shown in SEQ ID NO: 6, the nucleotide sequence of the E4 is shown in SEQ ID NO: 7, and the nucleotide sequence of the VA RNA is shown in SEQ ID NO: 8.

[0028] In a second aspect, the present invention provides a plasmid set for high-yield recombinant adeno-associated virus, comprising the above-mentioned helper plasmid and AAV plasmid.

[0029] Preferably, the AAV plasmid is an AAV plasmid expressing a fluorescent protein driven by a CAG promoter. Further preferably, the AAV plasmid is a pAAV.CAG.EGFP vector.

[0030] In a third aspect, the present invention provides a high-yield recombinant adeno-associated virus production system obtained by transforming host cells with the above-mentioned plasmid group.

[0031] Preferably, the host cell is HeLa, HEK293 or insect Sf9 cell.

[0032] In a fourth aspect, the present invention provides a method for producing high-yield recombinant adeno-associated virus using the above-mentioned production system.

[0033] In a fifth aspect, the present invention applies the aforementioned auxiliary plasmid, the aforementioned plasmid group, and the aforementioned production system in AAV production.

[0034] Compared with the prior art, the present invention has the following beneficial effects:

[0035] The helper plasmid provided by the present invention has the effect of increasing the yield of rAAV virus. The plasmid includes a backbone plasmid and a recombinant sequence; the recombinant sequence includes: Rep, Cap protein coding sequences, E2A, E4, VA RNA sequences and at least one promoter sequence; the promoter sequence is located downstream of the Rep and Cap protein coding sequences. After the helper plasmid of the present invention is transfected into cells, compared with the pRCHelper helper vector driven by a single promoter, the helper plasmid in which the promoter is placed downstream of the Rep and Cap protein coding sequences can increase AAV production by about 4.2-11.2 times, which can significantly improve the AAV yield of single cells. It can be applied to large-scale AAV production. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] FIG1 is a schematic diagram of the structural elements of the plasmid backbone in Example 1.

[0037] FIG2 is a schematic diagram of the experimental design for studying the functions of P5 and DA′ in the embodiment;

[0038] FIG3 is a comparison of the viral titers of the lysates of each group of plasmids tested in the examples with those of the control vector;

[0039] FIG4 is a statistical graph showing the titer of AAV produced by two plasmids and three plasmids. DETAILED DESCRIPTION

[0040] To better illustrate the purpose, technical solutions and advantages of the present invention, the present invention will be further described below in conjunction with specific embodiments. Those skilled in the art should understand that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0041] Unless otherwise specified, the experimental methods used in the examples are conventional methods; the materials, reagents, etc. used are all available from commercial sources unless otherwise specified.

[0042] Example 1: Construction of helper plasmid pRCHelper

[0043] By designing combinations containing various DA', P5 promoter, Rep, Cap, E2A, E4, and VA RNA placement positions, different candidate helper plasmids were constructed based on the backbone vector using conventional molecular cloning methods (Figure 1 and Table 1), and the toxin titers of each helper vector in the dual-plasmid transfection system were then compared in parallel.

[0044] Table 1 Plasmid AJ information

[0045] Among them, the plasmid backbone sequence (as shown in Figure 1) is shown in SEQ ID NO: 1; the P5 promoter sequence is shown in SEQ ID NO: 2; the DA' sequence is shown in SEQ ID NO: 3; Rep is from adeno-associated virus type 2, and its sequence is shown in SEQ ID NO: 4; Cap is from adeno-associated virus type 9, and its sequence is shown in SEQ ID NO: 5; E2A, E4, and VA RNA are from adenovirus, the E2A sequence is shown in SEQ ID NO: 6, the E4 sequence is shown in SEQ ID NO: 7, and the VA RNA sequence is shown in SEQ ID NO: 8.

[0046] The construction process of helper plasmids A to J in Figure 2 is as follows:

[0047] (1) Using the plasmid containing the RepCap gene as a template, the RepCap gene sequence, DA' sequence, P5 sequence, and the E2A / E4 / VA RNA gene sequence were amplified respectively.

[0048] The PCR reaction system is shown in Table 2:

[0049] Table 2 PCR reaction system

[0050] The primer sequences used for plasmid A are as follows:

[0051] Forward primer 1: ATGGCTGCCGATGGTTATC;

[0052] Reverse primer 1: acgtaatccgtagatgtacctgg;

[0053] Forward primer 2: aggtacatctacggattacgtAAGCCGAATTCTGCAGATATCC;

[0054] Reverse primer 2: gtgacctctaatacaggacctAGCTCCCCCGATACCGTC;

[0055] Forward primer 3: aggtcctgtattagaggtcacg;

[0056] Reverse primer 3: ACCATCGGCAGCCATacctgatttaaatcatttattgttcaaagatg.

[0057] The primer sequences used for plasmid B are as follows:

[0058] Forward primer 1: aggtacatctacggattacgtTGCAGGACTAGAGGTCCTG;

[0059] Reverse primer 1: AGCTCCCCCGATACCGTC;

[0060] Forward primer 2: CGATCGAGTCGACGGTATC;

[0061] Reverse primer 2: acgtaatccgtagatgtacctgg.

[0062] The primer sequences used for plasmid C are as follows:

[0063] Forward primer 1: CCCCCTCGATCGAGGATGCCGGGGTTTTACGAGAT;

[0064] Reverse primer 1: CCTCCCACCAGATCACCATC;

[0065] Forward primer 2: aggtacatctacggattacgtACCTGCAAGGAACCCCTAGT;

[0066] Reverse primer 2: gagttgggtaccggatccGTTCAACTGAAACGAATCAACCG;

[0067] Forward primer 3: ggatccggtacccaactcca;

[0068] Reverse primer 3: acgtaatccgtagatgtacctgg.

[0069] The primer sequences used for plasmid D are as follows:

[0070] Forward primer 1: aggtacatctacggattacgtCGATCGAGGTCGACGGTATC;

[0071] Reverse primer 1: gagttgggtaccggatccAAAACCCTGGCGTTACCCAA;

[0072] Forward primer 2: ggatccggtacccaactcca;

[0073] Reverse primer 2: acgtaatccgtagatgtacctgg.

[0074] The primer sequences used for plasmid E are as follows:

[0075] Forward Primer 1:

[0076] CGAAGGGCGAATTCGTTTGCAGGACTAGAGGTCCTGTATTAG;

[0077] Reverse primer 1: gggtaaataatcacccgagagt;

[0078] Forward primer 2: aggtacatctacggattacgtTTCCAGTCGGGAAACCTGTC;

[0079] Reverse primer 2: gagttgggtaccggatccACTTTATGCTTCCGGCTCGT;

[0080] Forward primer 3: ggatccggtacccaactcca;

[0081] Reverse primer 3: acgtaatccgtagatgtacctgg.

[0082] The primer sequences used for plasmid F are as follows:

[0083] Forward primer 1: aggtacatctacggattacgtTTCCAGTCGGGAAACCTGTC;

[0084] Reverse primer 1: gagttgggtaccggatccACTTTATGCTTCCGGCTCGT;

[0085] Forward primer 2: ggatccggtacccaactcca;

[0086] Reverse primer 2: acgtaatccgtagatgtacctgg.

[0087] The primer sequences used for plasmid G are as follows:

[0088] Forward primer 1: ggatccggtacccaactcca;

[0089] Reverse primer 1: GTCCTGCAGCCTCAGTGA;

[0090] Forward primer 2: ACTGAGGCTGCAGGACGTGGAGCTCCAGCTTTTGTT;

[0091] Reverse primer 2: GTTCAACTGAAACGAATCAACCG;

[0092] Forward primer 3:

[0093] CGGTTGATTCGTTTCAGTTGAACTGCAGGACTAGAGGTCCTG;

[0094] Reverse primer 3: gagttgggtaccggatccGGATATCTGCAGAATTCGGCTT.

[0095] The primer sequences used for plasmid H are as follows:

[0096] Forward primer 1: aggtacatctacggattacgtGCAGGACTAGAGGTCCTGTATTAG;

[0097] Reverse primer 1: gagttgggtaccggatccGCCTCAGTGAGCGAGC;

[0098] Forward primer 2: ggatccggtacccaactcca;

[0099] Reverse primer 2: acgtaatccgtagatgtacctgg.

[0100] The primer sequences used for plasmid 1 are as follows:

[0101] Forward primer 1: CGGTTGATTCGTTTCAGTTGAAC;

[0102] Reverse primer 1: gagttgggtaccggatccGCCTCAGTGAGCGAGC;

[0103] Forward primer 2: ggatccggtacccaactcca;

[0104] Reverse primer 2: GTTCAACTGAAACGAATCAACCG.

[0105] The primer sequences used for plasmid J are as follows:

[0106] Forward primer 1: CGGTTGATTCGTTTCAGTTGAAC;

[0107] Reverse primer 1: tggagttgggtaccggatccCTGCAGAATTCGGCTTGG;

[0108] Forward primer 2: ggatccggtacccaactcca;

[0109] Reverse primer 2: GTTCAACTGAAACGAATCAACCG.

[0110] PCR reaction conditions are shown in Table 3:

[0111] Table 3 PCR reaction conditions

[0112] (2) Detect the PCR amplified bands by agarose gel electrophoresis and recover the target fragments using a gel recovery kit.

[0113] (3) Use seamless cloning kit for multi-fragment ligation.

[0114] The seamless cloning reaction system is shown in Table 4:

[0115] Table 4 Reaction system

[0116] The reaction conditions were 50°C for 1 h.

[0117] The reaction product was transformed into Escherichia coli and spread on a kanamycin-resistant plate. The next day, clones were picked for colony PCR identification. Positive clones were sent to Guangzhou GeneWeichi Company for sequencing to select the correct plasmid required.

[0118] Example 2: Production of AAV by dual-plasmid transfection

[0119] (1) Plating 293T cells (293T, derived from -3216TM) were transfected into 6-well plates at approximately 3E+05 cells / well, using high-glucose DMEM medium containing 10% newborn calf serum and 1% penicillin / streptomycin, and cultured in a 37°C, 5% CO2 cell culture incubator for approximately 48 h. The cell density at the time of transfection was approximately 60-70%.

[0120] (2) The pRCHelper auxiliary vector AJ constructed in Example 1 and the AAV plasmid pAAV.CAG.EGFP vector of fluorescent protein driven by the CAG promoter were added to 0.5 mL of DMEM at 1 μg and 0.5 μg respectively, and then 3 μL of PEI (1 μg / μL) was added and vortexed. After standing at room temperature for 10 minutes, the mixture was added to 1.5 mL of transfection medium and vortexed.

[0121] The pRC plasmid, pHelper plasmid and CAG promoter-driven fluorescent protein AAV plasmid pAAV.CAG.EGFP vector of the three-plasmid control group were added to 0.5 mL DMEM at a ratio of 0.5 μg: 0.5 μg: 0.5 μg, and then 3 μL of PEI (1 μg / μL) was added and vortexed. After standing at room temperature for 10 minutes, the mixture was added to 1.5 mL of transfection medium and vortexed.

[0122] The culture medium in the 6-well plate was aspirated, and a transfection mixed medium was added, and the cells were returned to the 37° C. cell culture incubator (5% CO 2 concentration) for culture.

[0123] (3) After 72 hours of culture, 15 μL of cell lysis buffer was added, and the cells and supernatant were collected into a 2 mL centrifuge tube. The cells were shaken at 250 rpm at 37°C for 1 hour, and the supernatant was obtained as the crude AAV extract after centrifugation at 10,000 g for 10 minutes.

[0124] Example 3: Determination of AAV titer

[0125] The titer of AVV produced by double-plasmid transfection in each group of Example 2 was determined as follows:

[0126] Primers FWD ITR (5'-GGAACCCCTAGTGATGGAGTT) and REV (5'-CGGCCTCAGTGAGCGA) were used to specifically detect the sequences of ITRs of all types of AAV vectors.

[0127] (1) DNase I digested sample

[0128] The components of the reaction system are shown in Table 5:

[0129] Table 5 Reaction system

[0130] Take 5 μL of sample and dilute it 20-fold. Take the corresponding number of PCR tubes and aliquot 18 μL of digestion solution into each tube. Add 2 μL of diluted sample and 2 μL of plasmid standard (containing 4E+08 AAV copies (Genome Copies, GC) for preparing the standard curve, equivalent to a 10-fold dilution, and incubate at 37°C for 30 minutes. After digestion, take 5 μL of sample and add it to 95 μL of water. Serially dilute twice for a total of 80,000-fold dilution. RefAAV (plasmid standard) is diluted a total of 4,000-fold.

[0131] (2)SYBR Green qPCR

[0132] Standard Preparation: Prepare a plasmid standard containing 2E+08 AAV copies / μL and make six serial dilutions using 8 μL + 72 μL water. The first dilution is 2E+08 GC / μL, which is set in the software to 8E+14 GC / mL to reflect the sample dilution gradient. The subsequent dilutions are 8E+13 GC / mL, 8E+12 GC / mL, 8E+11 GC / mL, 8E+10 GC / mL, and 8E+09 GC / mL.

[0133] The components of the reaction system are shown in Table 6:

[0134] Table 6 Reaction system

[0135] Prepare three replicate wells for each sample and prepare a mixture of corresponding volume, aliquot 18 μL into each well, and then add 2 μL of sample into each well.

[0136] (3)SYBR Green qPCR conditions

[0137] Pre-denaturation: 95℃ for 10min

[0138] Cycle: 40 cycles: 95℃15sec; 60℃1min.

[0139] All titer test results were converted to multiples of the control vector P5+RC+Helper as shown in the figure 3 The results showed that compared with the pRCHelper helper vector "P5+RC+Helper" driven by the P5 promoter alone, the "RC+Helper+P5" helper vector, which placed the P5 promoter behind the RC+Helper, increased AAV yield by approximately 4.2-fold. Furthermore, the "RC+Helper+DA'+P5" and "RC+DA'+Helper+P5" helper vectors, which added the DA' sequence, increased AAV yield by approximately 11.2-fold and 5.2-fold, respectively. The "Helper+RC+DA'+P5" helper vector, which altered the positions of the RC and Helper sequences, increased AAV yield by approximately 8-fold. The "RC+P5+Helper" helper vector, which placed the P5 promoter between the RC and Helper sequences, increased AAV yield by approximately 3.5-fold. Furthermore, the "RC+DA'+P5+Helper" and "RC+P5+Helper+DA'" helper vectors, which added the DA' sequence, increased yield by approximately 7.8-fold and 6.9-fold, respectively. The helper vectors "RC+DA'+Helper+DA'+P5" and "RC+DA'+P5+Helper+DA'+P5" with two additional DA' sequences increased the yield by approximately 9.8-fold and 11-fold, respectively. The above results indicate that the helper plasmids constructed in Example 1 of the present invention have the effect of increasing rAAV virus yield.

[0140] The optimal version of the "RC+Helper+DA'+P5" auxiliary vector constructed above and the preferred example "RC+DA'+P5" packaging vector in CN115197967A were used to produce AAV with two plasmids and three plasmids, respectively. The titer results were converted into a multiple relationship with the three-plasmid group as the control, as shown in Figure 4. The results showed that compared with the "RC+DA'+P5" packaging vector of the three-plasmid group, the rAAV virus yield of the "RC+Helper+DA'+P5" auxiliary vector of the two-plasmid group was higher. That is, the titer of AAV produced by the double plasmid of the present invention can reach or even be better than the titer of AAV produced by the three-plasmid group. A specific serotype (Rep2Cap9) auxiliary plasmid is used in the embodiment. It should be understood by those skilled in the art that the present invention is not limited to this specific serotype, but can be implemented using other serotype auxiliary plasmids that are currently known and may continue to be discovered in the future.

[0141] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that the technical solutions of the present invention may be modified or replaced by equivalents without departing from the essence and scope of the technical solutions of the present invention.

Claims

1. A helper plasmid for high-yield recombinant adeno-associated virus, characterized in that: It includes a backbone plasmid and a recombinant sequence; the recombinant sequence includes: Rep, Cap protein coding sequences, E2A, E4, VA RNA sequences and at least one promoter sequence; The promoter sequence is located downstream of the Rep and Cap protein coding sequences.

2. The helper plasmid according to claim 1, characterized in that The recombinant sequence also includes at least one DA' sequence.

3. The helper plasmid according to claim 2, characterized in that The DA' sequence is located downstream of the Rep and Cap protein coding sequences.

4. The helper plasmid according to claim 2, characterized in that The recombinant sequence includes any combination of the following sequences in order from 5' to 3' direction: i, the Rep and Cap protein coding sequences, the E2A, E4, and VA RNA sequences, and the promoter sequence; ii, the Rep and Cap protein coding sequences, the E2A, E4, and VA RNA sequences, the DA' sequence, and the promoter sequence; iii. the E2A, E4, VA RNA sequences, the Rep, Cap protein coding sequences, the DA' sequence, and the promoter sequence; iv. the Rep and Cap protein coding sequences, the promoter sequence, and the E2A, E4, and VA RNA sequences; v, the Rep and Cap protein coding sequences, the DA' sequence, the promoter sequence, and the E2A, E4, and VA RNA sequences; vi, the Rep and Cap protein coding sequences, the promoter sequence, the E2A, E4, VA RNA sequences, and the DA' sequence; vii. the Rep and Cap protein coding sequences, the DA' sequence, the E2A, E4, and VA RNA sequences, and the promoter sequence; viii. the Rep and Cap protein coding sequences, the DA' sequence, the E2A, E4, and VA RNA sequences, the DA' sequence, and the promoter sequence; ix, the Rep and Cap protein coding sequences, the DA' sequence, the promoter sequence, the E2A, E4, VA RNA sequences, the DA' sequence, and the promoter sequence.

5. The helper plasmid according to any one of claims 1 to 4, characterized in that The promoter is the P5 promoter.

6. The helper plasmid according to claim 5, characterized in that The nucleotide sequence of the P5 promoter is shown in SEQ ID NO:

2.

7. The helper plasmid according to any one of claims 1 to 4, characterized in that The Rep is derived from adeno-associated virus type 2, and the Cap is derived from adeno-associated virus type 9.

8. The helper plasmid according to claim 7, characterized in that The nucleotide sequence of Rep is shown in SEQ ID NO:

4.

9. The helper plasmid according to claim 7, characterized in that The nucleotide sequence of the Cap is shown in SEQ ID NO:

5.

10. The helper plasmid according to any one of claims 1 to 4, characterized in that The E2A, E4, and VA RNAs are derived from adenovirus.

11. The helper plasmid according to claim 10, characterized in that The nucleotide sequence of the E2A is shown in SEQ ID NO: 6, the nucleotide sequence of the E4 is shown in SEQ ID NO: 7, and the nucleotide sequence of the VA RNA is shown in SEQ ID NO:

8.

12. A plasmid set for high-yield recombinant adeno-associated virus, characterized in that: It comprises the auxiliary plasmid and AAV plasmid described in any one of claims 1-11.

13. A high-yield recombinant adeno-associated virus production system, characterized in that: Obtained by transforming a host cell with the plasmid set described in claim 12.

14. A method for producing high-yield recombinant adeno-associated virus, characterized in that: Produced using the production system described in claim 13.

15. Use of the auxiliary plasmids described in claims 1-11, the plasmid group described in claim 12, and the production system described in claim 13 in AAV production.

Images