Ultrahigh-density probe capture-based spatial transcriptomics chip, preparation method therefor, and use thereof
By modifying ultra-high density poly T and TSO probe clusters on solid substrates, combined with bridge amplification technology, the complexity and resolution limitations of existing spatial transcriptome technology are solved, and efficient and low-cost high-throughput gene detection is achieved.
Patent Information
- Application Number
- PCT/CN2025/074260
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-02-01
- Filing Date
- 2025-01-23
- Publication Date
- 2025-08-07
AI Technical Summary
The existing spatial transcriptome technology has problems such as complex experiments, high cost and low throughput, and the resolution of the technology based on high-throughput sequencing is limited by DNA probe spacing.
Ultra-high density poly T probes and TSO probe clusters are modified on solid substrates, mRNA is captured and spatial position information is obtained through bridge amplification technology, and high-throughput sequencing is performed in combination with Sanger sequencing and other methods.
It has achieved simplification of experimental procedures, reduced costs, and improved gene detection efficiency and resolution, and can detect gene expression levels and spatial locations at high throughput.
Smart Images

Figure PCTCN2025074260-FTAPPB-I100001 
Figure 00000016_0000 
Figure 00000016_0001
Abstract
Description
Ultra-high-density probe-captured spatial transcriptome chip and its preparation method and application
[0001] The present invention claims priority to Chinese patent application No. 2024101445792, filed with the Patent Office of China on February 1, 2024, entitled “Spatial transcriptome chip with ultra-high density probe capture, preparation method and application thereof”, the entire contents of which are incorporated herein by reference. Technical Field
[0002] The present invention belongs to the field of biotechnology and relates to spatial omics, in particular to a spatial transcriptomics chip captured by ultra-high density probes and a preparation method and application thereof. Background Art
[0003] Spatial transcriptomics is a technology used to study gene expression in tissues and cells. Unlike traditional transcriptomics methods, spatial transcriptomics can not only measure the expression level of genes, but also determine the specific location of these genes in the tissue. This technology allows researchers to map gene expression within the spatial range of the tissue, thereby understanding the location of different cell types in the tissue and their gene expression patterns at specific spatial locations. By combining spatial information with gene expression data, researchers can have a more comprehensive understanding of the interactions between cells, the structure and function of tissues. Spatial transcriptomics has a wide range of applications in biomedical research, especially in fields such as cancer research and tissue development. It provides a powerful tool for studying complex tissue structures and cell interactions, helping to gain a deeper understanding of the spatial level of biological processes.
[0004] Currently, the technologies for spatial transcriptome research on the market can be divided into two main categories: one is based on imaging, including in situ sequencing (ISS) and in situ hybridization (ISS). ISS includes FISSEQ (Fluorescent In Situ Hybridization followed by Sequencing) and STARmap (spatially-resolved transcript amplicon readout mapping). Its principle is to obtain the corresponding genetic information by in situ imaging and sequencing of mRNA in cells. ISH technology includes SMFISH (Single Molecule Fluorescent In Situ Hybridization) and MERFISH (Multiplexed Error-Robust Fluorescence in situ Hybridization). Its principle is to hybridize corresponding fluorescent probes to mRNA molecules in cells and then obtain the corresponding genetic information by imaging under a microscope. The advantages of imaging-based technologies are high detection efficiency and resolution, but they are often more complex experiments, high cost, low throughput, and difficult to perform large-scale data analysis. The other is based on high-throughput sequencing, and representative technologies include 10X Visium, HDST, Slide-seq, etc., whose principle is to modify DNA probes with known barcode information on a solid matrix, use these probes to capture and reverse transcribe the RNA in the tissue cells that need to be studied, and then perform the second-generation sequencing library construction step, and sequence on the machine to obtain the corresponding gene information; the advantages of sequencing-based technology are simple operation and high throughput, but due to the gaps between the modified DNA probes, there are certain limitations on resolution.
[0005] Imaging-based spatial transcriptomics techniques often have complex experimental processes, high costs, and low throughput, making large-scale data analysis difficult. High-throughput sequencing-based spatial transcriptomics techniques have relatively low gene detection efficiency and limited resolution due to the spacing between modified DNA probes. For example, as shown in Figure 1, the modified DNA probe region is 55 μm in size, and the center regions of two clusters of DNA probes are separated by 100 μm, resulting in a 45 μm gap between the two clusters, which limits resolution. Summary of the Invention
[0006] Based on this, the purpose of the present invention is to provide a spatial transcriptomics chip with ultra-high density probe capture and a preparation method and application thereof.
[0007] The first aspect of the present invention provides a method for preparing a spatial transcriptomics chip for ultra-high-density probe capture, comprising the following steps:
[0008] S1. Two primers are modified on a solid substrate, wherein the two primers are a poly T primer for generating a poly T probe and a bridge amplification primer;
[0009] S2. Loading the synthesized library onto the surface of the solid substrate and performing bridge amplification with the bridge amplification primer to generate DNA chains on the solid substrate; the library is composed of, from 5' to 3', amplification primer 1, adapter 1, barcode, barcode sequencing primer, and amplification primer 2, wherein amplification primer 1 has the same base composition as one of the bridge amplification primers, and amplification primer 2 has a base that is at least 50% complementary to another of the bridge amplification primers;
[0010] S3. Sequencing the barcode to obtain corresponding base information and sequencing to obtain spatial position information;
[0011] S4. By using a template switching primer with a TSO sequence and a unique molecular marker UMI, a TSO sequence and a unique molecular marker UMI are added to the DNA chain to generate a TSO probe cluster with a TSO sequence and a unique molecular marker UMI on a solid substrate;
[0012] The chip is obtained by extending the poly T primer or connecting the poly T probe cluster.
[0013] In some embodiments, the poly T primer or the bridge amplification primer is modified with a chemical group. The modified chemical group can be used to cleave the chemical structure during sequencing to obtain a free cDNA strand. The chemical group can be a diol modification (-diol), deoxyuridine (dU), deoxyguanosine (8-Oxo-2'-deoxyguanosine), etc.
[0014] In some embodiments, the amplification primer 2 is at least 60%, or at least 70%, or at least 80%, or at least 90% complementary to a modified bridge amplification primer on the solid substrate, and most preferably is completely complementary.
[0015] In some embodiments, at least one flow channel is provided on the solid substrate, and preferably, two or more flow channels are provided.
[0016] In some embodiments, the number of consecutive T bases in the poly T is 10-50, further 10-40, or 10-35, or 15-35, or 20-35, or 20-30.
[0017] In some embodiments, the sequencing in step S3 is performed by Sanger sequencing, NGS sequencing, nanopore sequencing, etc., preferably NGS sequencing, single-end sequencing, preferably SE50 sequencing.
[0018] In some embodiments, the molar ratio of the polyT primer modified on the solid substrate to the bridge amplification primer is 1-10:1, preferably 2-8:1, and more preferably 4-6:1.
[0019] The second aspect of the present invention is to provide a spatial transcriptomics chip captured by ultra-high density probes obtained by any of the above preparation methods.
[0020] The spatial transcriptomics chip of the present invention includes a solid substrate on which a poly T probe cluster and a TSO probe cluster are fixed. The TSO probe is formed by amplifying a DNA chain generated by a bridge amplification primer fixed on the solid substrate and a library, and then extending or connecting with a primer for a template-converted TSO sequence and a unique molecular marker UMI.
[0021] A third aspect of the present invention is to provide the application of the spatial transcriptomics chip captured by ultra-high-density probes in high-throughput sequencing. For example, it can be used to detect gene expression in a sample and obtain corresponding spatial location information.
[0022] A fourth aspect of the present invention is to provide a method for detecting nucleic acid molecules in a sample, comprising the following steps:
[0023] S1) obtaining any of the above-mentioned ultra-high-density probe-captured spatial transcriptomics chips;
[0024] S2) Permeabilizing the tissue to be captured in the sample to be tested to release mRNA from the tissue onto the chip surface, hybridizing with a poly T probe on the chip surface, reverse-transcribing to obtain cDNA with a TSO complementary sequence, and performing bridge amplification between the cDNA and the TSO probe to obtain cDNA immobilized on a solid matrix and carrying a barcode with spatial location information and a unique molecular marker (UMI);
[0025] S3) obtaining free cDNA;
[0026] S4) PCR amplification, library construction, and next-generation sequencing are performed to obtain nucleic acid results of the sample.
[0027] In some embodiments, the tissue to be captured may be at least one of nucleic acid molecules from any organism such as viruses, bacteria, cells, etc., or an independent nucleic acid molecule.
[0028] In some specific embodiments, the nucleic acid molecule is an RNA fragment, and further, mRNA. Since mRNA generally has a poly A tail, the poly T probe can achieve specific binding to the mRNA through the base T in the poly T probe.
[0029] In some embodiments, the sample is a tissue slice; it can be derived from animal cells or plant cells, or a tissue sample formed by viruses or bacteria. The tissue sample can be living tissue, living tissue cultured in vitro, or a single cell. It is understood that the tissue can also be an organoid formed from one or more tissues or cells.
[0030] In some embodiments, free cDNA can be obtained by breaking the chemical groups in the primers fixed to the solid matrix and recovering them to obtain free cDNA chains.
[0031] In some embodiments, free cDNA can be obtained by using the amplification primer at the 3' end of the cDNA or the complementary sequence of adapter 1 to hybridize with the cDNA chain to synthesize a second chain, then denaturing the second chain and recovering the free cDNA chain.
[0032] The present invention increases probe density and thus improves gene detection efficiency and resolution by modifying the entire solid substrate with DNA probe clusters, including poly T probe clusters and probe clusters carrying TSO information. The poly T probe captures mRNA and reverse transcribes it to generate cDNA, which is then hybridized with the TSO probe via a TSO complementary sequence and then bridge amplified, allowing the cDNA to acquire spatial position information and unique molecular markers. By designing a sequence to achieve bridge amplification, DNA chains that originally lacked spatial position information and unique molecular markers acquire the corresponding information, thereby achieving a simple experimental process, low cost, and high-throughput spatial transcriptomics technology that can simultaneously detect gene expression levels and obtain their spatial position information. BRIEF DESCRIPTION OF THE DRAWINGS
[0033] Figure 1 is a schematic diagram of the modified DNA probe regions in the 10X visium spatial transcriptome.
[0034] FIG2 is a schematic diagram of the structures of two primers modified on a solid substrate.
[0035] FIG3 is a schematic diagram of the structure of the library.
[0036] FIG4 is a schematic diagram of the process of obtaining spatial position information by sequencing during chip production.
[0037] FIG5 is a schematic diagram of the structure of probes generated on a chip.
[0038] FIG6 is a schematic diagram of the RNA capture process during sample detection.
[0039] FIG7 is a schematic diagram of obtaining free cDNA during sample detection.
[0040] FIG8 is a schematic diagram of the results of detecting polyT and TSO probes after the ultra-high-density probe capture chip is manufactured, wherein A: modified TSO probe, B: modified polyT primer.
[0041] Figure 9 is a schematic diagram of the results obtained by analyzing tissue transcriptomes captured using microarrays. A: The median number of genes captured in the mouse brain tissue sections used was 11,404; B: The median number of genes captured in the mouse brain tissue samples from the 10X genomics official website at the same resolution was 4,426. DETAILED DESCRIPTION
[0042] To facilitate understanding of the present invention, the present invention will be described more fully below. The present invention can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the understanding of the present disclosure more thorough and comprehensive.
[0043] Experimental procedures in the following examples, where specific conditions are not specified, generally followed conventional conditions, such as those in Molecular Cloning: A Laboratory Manual (4th edition, edited by Green and Sambrook, published in 2013), or according to manufacturer recommendations. All commonly used chemical reagents used in the examples were commercially available.
[0044] Unless otherwise defined, all technical and scientific terms used herein have the same meanings as commonly understood by those skilled in the art to which this invention pertains. The terms used in this specification are for the purpose of describing specific embodiments only and are not intended to limit the invention. The term "and / or" as used herein includes any and all combinations of one or more of the associated listed items.
[0045] Definitions To facilitate understanding of this technology, certain terms and phrases are defined below.
[0046] The "solid phase carrier" or "solid matrix" or "substrate" all refer to the same product, which refers to any insoluble substrate or matrix to which nucleotide molecules can be attached, such as latex beads, dextran beads, polystyrene surfaces, polypropylene surfaces, polyacrylamide gels, gold surfaces, glass surfaces and silicon wafers. The solid phase carrier can be a flat glass surface. The solid phase carrier can include a flow channel, which can be at least one, or two or more. The solid phase carrier can also be installed inside a circulation pool to allow various reagent solutions to interact. This solid phase carrier constitutes the substrate of the chip.
[0047] The term "barcode" refers to any unique, non-naturally occurring nucleic acid sequence that can identify the origin of a nucleic acid fragment. The barcode sequence provides high-quality, individual reads of the barcode associated with, for example, DNA, RNA, cDNA, cells, or nuclei, enabling the sequencing of multiple species together.
[0048] Any suitable sequence can be used as the "barcode" of the present invention. A suitable sequence means that the spatial barcode domain does not interfere with (i.e., inhibit or distort) the interaction between the RNA of the tissue sample and the capture domain of the "barcode". For example, the design of the "barcode" should make the nucleic acid molecules in the tissue sample not specifically or substantially hybridize with the "barcode" or its complementary portion. The "barcode" can be composed of 5-30 nucleotides, and can further be 10 to 25 nucleotides, 10 to 20 nucleotides, for example, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 nucleotides.
[0049] TSO: Template switch oligo, is an oligonucleotide that is added to the 5' end of the non-template strand by reverse transcriptase during reverse transcription for downstream cDNA amplification. It is used to introduce a specific sequence tag during reverse transcription.
[0050] The principle of complementary base pairing is the phenomenon in which the bases of nucleotide residues form hydrogen bonds according to a specific correspondence. 1 For example, adenine (A) pairs with thymine (T), guanine (G) pairs with cytosine (C), and in RNA, thymine is replaced by uracil (U), and adenine pairs with uracil. Herein, the bases of the amplification primer 2 in the library can be complementary to at least 50%, or 60%, or 70%, or 80%, or 90% of the bases of a modified bridge amplification primer on the solid substrate. Perfect complementary pairing is most preferred. If the number of bases occupied is not specifically specified, perfect complementary pairing (100%) is generally assumed.
[0051] Bridge amplification is mainly used in fields such as DNA library construction and genome sequencing. The basic process of bridge PCR amplification includes the following:
[0052] First amplification: Using the single-stranded DNA adsorbed on the flow cell (chip) as a template, dNTPs and DNA polymerase are added to generate complementary chains.
[0053] Melting: Add NaOH solution to melt the DNA, wash away the unfixed template chain, and leave the single chain fixed on the flow cell.
[0054] Bridge formation: Add a neutral solution to allow the other end of the newly generated single strand to complementarily pair with another primer (P7') on the flow cell to form a bridge structure.
[0055] Second amplification: Using the bridge-shaped single strand as a template, add dNTP and DNA polymerase to extend from the P7' primer to the P5' primer to generate double-stranded DNA.
[0056] Repeat the cycle: Repeat the above steps continuously for about 30 rounds of amplification-denaturation cycles to eventually form a monoclonal DNA cluster of 1000 copies.
[0057] Some embodiments of the present invention relate to a method for preparing a spatial transcriptome chip for ultra-high-density probe capture and a detection method using the chip, comprising the following steps:
[0058] S1. Primer modification: Primers are modified on a solid substrate. (See Figure 2 ) The primers are mainly divided into two categories: one type of bridge amplification primer (two sequences, i.e., two sequences of different compositions) is used for bridge amplification of sequencing libraries, and the other type of primer is used to generate poly T probes for mRNA capture. This type of primer can be a DNA primer directly containing a poly T sequence, or a fixed sequence primer. Poly T probes are generated by ligation or extension during subsequent processing, and are named poly T primers. The molar ratio of the poly T primer modified on the solid substrate to the bridge amplification primer is 1-10:1.
[0059] S2. Library synthesis. The sequence of the synthetic library mainly includes the following features: the 5' end sequence (amplification primer 1) has the same base composition as a bridge amplification primer modified on the solid substrate, and the 3' end sequence (amplification primer 2) matches another bridge amplification primer modified on the solid substrate. The matching refers to complementary pairing, such as 50%, 60%, 70%, 80%, 90% or more base complementary pairing, or complete complementary pairing. As long as it can amplify the target sequence as a primer, preferably more than 90% complementary pairing or complete complementary pairing, bridge amplification is performed after the library is loaded onto the solid substrate surface; the library has the following composition: from 5' to 3', it is: amplification primer 1, adapter 1, barcode, barcode sequencing primer, amplification primer 2, see Figure 3. The adapter 1 region is used for subsequent sequencing, the barcode sequencing primer region is used to sequence the barcode region, and the barcode region (Spatial Barcode) is used to obtain spatial position information in spatial transcriptome data.
[0060] S3. Sequencing to Obtain Spatial Position Information: The barcode region is sequenced to obtain the corresponding base information, thereby extracting the position information of this region on the solid substrate. First, the library synthesized in the second step is loaded onto the solid substrate surface, followed by bridge amplification. During this process, the synthesized library will continuously hybridize and extend with the modified bridge amplification primers on the solid substrate. After amplification, the barcode sequencing primer region is used as a primer to sequence the barcode to obtain spatial position information (see Figure 4).
[0061] S4. Probe Generation: After sequencing is complete, the amplified DNA chain is tagged with a template-switching oligo (TSO) sequence and a unique molecular identifier (UMI) sequence at the 3' end through DNA ligation or DNA hybridization extension, ultimately generating a complete TSO probe with the TSO sequence and UMI. The poly T sequence is then extended or ligated to the poly T-generating primer to generate a poly T probe. The poly T probe is used to capture mRNA molecules in cells for reverse transcription to obtain cDNA. The TSO sequence is used for template switching with the subsequent reverse transcribed cDNA product, and the UMI sequence counts the number of captured gene copies. See Figure 5.
[0062] S5. RNA Capture: The tissue to be captured is attached to the solid substrate on which the probes have been generated. Permeabilization allows the mRNA to be released from the cells onto the chip surface. The mRNA, through its poly A tail, hybridizes with the probe bearing the poly T sequence on the solid substrate surface. This is then reverse transcribed to obtain the cDNA portion. Because the reverse transcription process adds a TSO complementary sequence to the 3' end of the cDNA, the 3' end of the cDNA will form a complementary pair with the probe containing the TSO sequence on the solid substrate after reverse transcription is complete. Bridge amplification then occurs, allowing the TSO sequence probe to extend the captured cDNA portion, forming a bridge-like structure. The cDNA reverse-transcribed from the poly T probe originally lacks the barcode information for spatial location and the unique molecular marker for gene copy number count. However, through bridge amplification, the cDNA acquires the corresponding label information. See Figure 6.
[0063] In order to facilitate the capture of the target substance by the probe, the target substance in the sample is released by permeabilization. The method for permeabilizing the sample can be chemical treatment, heat treatment, ultrasonic treatment, enzyme treatment, hypotonic treatment, etc., so as to release the target substance from the sample.
[0064] S6. cDNA chain acquisition, library construction, and next-generation sequencing: After the above reaction steps, the cDNA chain is immobilized on the solid matrix. To obtain the cDNA chain for subsequent library construction steps, the following methods can be used, but are not limited to: During the first primer modification process, a relevant chemical structure is introduced at the 5' end of the modified primer (polyT primer or bridge amplification primer), and the chemical structure is cleaved to obtain a free cDNA chain (see Figure 7A). Alternatively, the amplification primer at the 3' end of the cDNA or the complementary sequence of adapter 1 can be used to hybridize with the cDNA chain to synthesize a second chain (see Figure 7B). The second chain is then denatured and recovered to obtain the free cDNA chain. After the cDNA chain is recovered, the library is constructed as usual and sequenced on the sequencing machine.
[0065] The present invention is further described in detail below with reference to specific embodiments.
[0066] Example 1
[0067] The method for manufacturing the ultra-high-density capture chip of this embodiment includes the following steps:
[0068] S1. Transcriptome capture chips can be fabricated using sequencing chip substrates as a base. The following sequence primers were synthesized at Sangon Biotechnology Co., Ltd. After obtaining the primers, dilute them to 100 μM in TE buffer according to the volume indicated on the centrifuge tube. Then, dissolve 20 μL of the primers in 180 μL of PBS. The final primer concentration in this example is 10 μM, but a range of 1-10 μM is practical. The 5' end of SEQ ID NO: 1 is modified with a DBCO (dibenzocyclooctyne) group.
[0069] The poly T primer used to generate the poly T probe is SEQ ID NO: 1:
[0070] 5'DBCO-AATGATACGGCGACCACCGAGATCTACACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN, wherein V refers to a nucleotide selected from the bases A, C, and G, and N refers to a nucleotide selected from the bases A, T, C, and G.
[0071] Subsequently, a sequencing chip substrate (with bridge amplification primers fixed thereto) was removed from the Salus Pro sequencing reagent set (SRM-SE50). The sequencing chip substrate had two flow channels (flow tanks). 100 μL of the above-mentioned primer solution was added to each flow channel, which was sealed and placed in a 37°C-55°C oven for reaction for 12-16 hours. After the reaction was completed, the bridge amplification primer and the poly T primer were modified on the chip substrate; a solid phase carrier (chip) modified with the two primers (bridge amplification primer and poly T primer) was obtained, wherein the molar fixed amount ratio of the poly T primer to the bridge amplification primer was 5:1.
[0072] Bridge amplification primers (primer 1 and primer 2 use the same amount):
[0073] Primer 1: CAAGCAGAAGACGGCATACGAGAT (SEQ ID NO: 6);
[0074] Primer 2: AATGATACGGCGACCACCGAGATCTACAC (SEQ ID NO: 7).
[0075] S2. The following library sequence (SEQ ID NO: 2) was synthesized at GenScript. The library structure is as follows (the 5' and 3' end sequences match the modified bridge amplification primers on the solid substrate). From the 5' end to the 3' end, the sequence is: Amplification Primer 1 (underlined region), Adapter 1 (lowercase region), barcode (N sequence), barcode sequencing primer (italicized portion), and Amplification Primer 2 (dashed underlined region). After obtaining the library, it was diluted to a concentration of 4 pM to 8 pM. In this example, 4 pM was used for the experiment. The library was then loaded onto the chip surface and the chip was sequenced using SE50 sequencing on a Salus Pro sequencer according to the instructions of the Salus Pro Sequencing Reagent Set (SRM-SE50) to obtain the barcode information.
[0076] SEQ ID NO: 2:
[0077] S3. After sequencing is complete, add 100 μL of denaturing reagent to the chip and place it in an oven at 55°C for 10 minutes. Then, wash the chip with 200 μL of wash buffer. Synthesize the following sequence primers at Sangon Biotechnology (template switching primers, i.e., TSO probe generation primers SEQ ID NO: 3, and detection primers SEQ ID NO: 4). After obtaining the primers, dilute them to 100 μM with TE buffer according to the volume marked on the centrifuge tube. Take 2 μL of the SEQ ID NO: 3 primer solution and mix it with 198 μL of 3X SSC, then add it to the above chip and react at 37°C for 30 minutes. Prepare the phi29 (NEB) reaction solution: 10 μL of 10X phi29 DNA polymerase reaction buffer, 5 μL of phi29 DNA polymerase, 5 μL of dNTP mix, and 80 μL of ddH2O. Add it to the above chip after the previous reaction is completed, and then react in an oven at 30°C for 30 minutes. A spatial transcriptomics chip was obtained by generating ultra-high-density probe capture of TSO probes and poly T probes with TSO sequences and unique molecular markers (UMIs) on a solid matrix.
[0078] After the reaction is complete, the TSO sequence probe has been generated, and its generation status is tested. 100 μL of denaturing reagent is added to the chip, and the reaction is carried out in an oven at 55°C for 10 minutes. The chip is then washed with 200 μL of wash buffer. 2 μL of the SEQ ID NO: 4 primer solution is mixed with 198 μL of 3X SSC and added to the chip for a reaction at 37°C for 30 minutes. After completion, the chip is scanned and photographed on a Salus Pro sequencer. If many bright spots are observed in the photo, the TSO sequence probe has been successfully generated, as shown in Figure 8A.
[0079] Template-switching primers with TSO sequences (underlined) and unique molecular identifiers (UMI) sequences (italicized), i.e., TSO probe generation primers:
[0080] SEQ ID NO: 3:5'TCTGCTGAGTCTGCTGAGTCGAGAACGTCTCNNNNNNNNNNAATGATACGGCGACCACCGAGATCTACAC.
[0081] SEQ ID NO: 4: 5'cy5-TCTGCTGAGTCTGCTGAGTCGAGAACGTCTC.
[0082] The results are shown in Figure 8 : The polyT primers modified in step S1 were also tested. Successful primer modification revealed a fluorescent signal across the entire chip (Figure 8B). Figure 8B demonstrates that all regions of the chip have been modified with polyT primers, ready for subsequent mRNA capture. For example, the 10X Visium technology shown in Figure 1 shows that the chip is modified with polyT capture probes only within the circular region, with distinct gaps between them. This demonstrates that the probe density of the chip produced using this invention is significantly higher than that of other technologies.
[0083] Example 2: Ultra-high density capture chip captures tissue mRNA
[0084] 1. Referring to the Salus spatial transcriptome reagent instructions, tissue patching, tissue permeabilization, reverse transcription reaction, and tissue digestion were completed in sequence on the ultra-high density capture chip prepared by the preparation method in Example 1. At this time, the polyT probe has captured mRNA and reverse transcribed cDNA and added the TSO complementary sequence. Subsequently, 100 μL of denaturing reagent was added to the tissue reaction area, and the reaction was carried out in an oven at 45°C for 10 minutes to convert the cDNA chain into a single-stranded state; after denaturation, the tissue reaction area was washed with 100 μL of 0.1XSSC solution, and 100 μL of amplification reagent (Salus) was added and the reaction was carried out in an oven at 45°C for 10 minutes for bridge amplification. The cDNA with the TSO complementary sequence will hybridize with the TSO probe and begin to extend; after completion, the above denaturation, washing, and amplification steps were repeated 3 times.
[0085] 2. The following primers were synthesized at Sangon Biotechnology Co., Ltd. After obtaining the primers, they were diluted to 100 μM with TE buffer according to the volume marked on the centrifuge tube. The phi29 (NEB) reaction system was prepared, with 10 μL 10X phi29 DNA polymerase reaction buffer, 5 μL phi29 DNA polymerase, 5 μL dNTP mix, 5 μL SEQ ID NO: 5 primer, and 70 μL ddH2O. These were added to the tissue reaction area to synthesize the second-strand cDNA. The reaction was carried out in an oven at 30°C for 1-2 hours. Subsequently, the instructions for the Salus spatial transcriptome reagent were used for subsequent cDNA second-strand recovery to obtain free cDNA chains, PCR amplification, library construction, and next-generation sequencing.
[0086] Amplification primer: SEQ ID NO: 5: 5'AATGATACGGCGACCACCGAGATCTACAC.
[0087] The tissue slices used in this example are mouse brain tissue slices.
[0088] The sequencing data were aligned using the Salus spatial transcriptome analysis process. The results are shown in Figure 9A. The median number of genes captured in the mouse brain tissue slices used in this example was 11,404. Using the mouse brain tissue example data on the 10X genomics official website as a reference (Figure 9B), the median number of genes captured at the same resolution was 4,426. Therefore, the spatial transcriptome method based on ultra-high-density probe capture described in the present invention can significantly increase the amount of gene capture.
[0089] The above-described embodiments merely illustrate several implementations of the present invention, and while their descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the patent. It should be noted that a person skilled in the art would be able to make numerous variations and improvements without departing from the spirit of the present invention, all of which fall within the scope of protection of the present invention. Therefore, the scope of protection of the patent for this invention shall be determined by the appended claims.
Claims
1. A method for preparing a spatial transcriptomics chip for ultra-high density probe capture, characterized in that: The following steps are involved: S1. Two primers are modified on a solid substrate, wherein the two primers are a poly T primer and a bridge amplification primer for generating a poly T probe; S2. loading the synthesized library onto the surface of the solid substrate, performing bridge amplification with the bridge amplification primer, and generating a DNA chain on the solid substrate; The library is composed of, from 5' to 3', amplification primer 1, adapter 1, barcode, barcode sequencing primer, and amplification primer 2; the base composition of amplification primer 1 is the same as that of one of the bridge amplification primers, and amplification primer 2 has bases that are at least 50% complementary to the other of the bridge amplification primers; S3. Sequencing the barcode to obtain corresponding base information and sequencing to obtain spatial position information; S4. By using a template switching primer with a TSO sequence and a unique molecular marker UMI, a TSO sequence and a unique molecular marker UMI are added to the 3' end of the DNA chain to generate a TSO probe cluster with a TSO sequence and a unique molecular marker UMI on a solid substrate; The chip is obtained by extending or connecting the poly T primer to a poly T probe cluster.
2. The preparation method according to claim 1, wherein The poly T primer or the bridge amplification primer is modified with a chemical group; the chemical group is preferably dibenzocyclooctyne, sulfhydryl, or amino.
3. The preparation method according to claim 1, wherein The solid substrate is provided with at least one flow channel, preferably, two or more flow channels.
4. The preparation method according to claim 1, wherein The number of consecutive T bases in the poly T primer is 10 to 50.
5. The preparation method according to claim 4, characterized in that: The number of consecutive T bases in the poly T primer is 15 to 30.
6. The preparation method according to claim 1, wherein The sequencing in step S3 is NGS sequencing, preferably SE50 sequencing.
7. The preparation method according to any one of claims 1 to 6, characterized in that: The molar ratio of the polyT primer modified on the solid matrix to the bridge amplification primer is 1-10:
1.
8. The preparation method according to claim 7, characterized in that: The molar ratio of the polyT primer modified on the solid matrix to the bridge amplification primer is 2-8:
1.
9. A spatial transcriptomics chip captured by ultra-high-density probes obtained according to the preparation method of any one of claims 1 to 8.
10. Use of the spatial transcriptomics chip captured by ultra-high-density probes according to claim 9 in high-throughput sequencing.
11. A method for detecting nucleic acid molecules in a sample, characterized in that: The following steps are involved: S1) obtaining a spatial transcriptomics chip captured by ultra-high-density probes according to any one of claims 1 to 8; S2) Permeabilizing the tissue to be captured in the test sample to release mRNA from the tissue onto the chip surface, hybridizing with the poly T probe on the surface of the spatial transcriptomics chip, reversely transcribing to obtain cDNA with a TSO complementary sequence, and performing bridge amplification on the cDNA with the TSO probe on the surface of the spatial transcriptomics chip to obtain cDNA fixed on a solid matrix and carrying a barcode with spatial location information and unique molecular marker (UMI) information; S3) obtaining free cDNA; S4) PCR amplification, library construction, and next-generation sequencing are performed to obtain nucleic acid results of the sample.
12. The detection method according to claim 11, characterized in that: The sample to be tested is a tissue section.
13. The detection method according to claim 11, wherein: The method for obtaining free cDNA comprises: breaking the chemical groups in the modified primers on the solid matrix of the chip, and recovering them to obtain free cDNA chains.
14. The detection method according to claim 11, wherein: The method for obtaining free cDNA includes: hybridizing the amplification primer or the complementary sequence of adapter 1 at the 3' end of the cDNA with the cDNA chain to synthesize a second chain, denaturing the second chain, and recovering the free cDNA chain.
Citation Information
Patent Citations
Array for detecting spatial information of nucleic acid and detection method
CN114207105A
Spatial nucleic acid detection using oligonucleotide microarrays
CN116685697A
Space transcriptome chip, construction method of cDNA library and transcriptome sequencing analysis method
CN117210943A
Chip for space transcriptomics sequencing, preparation method thereof and space transcriptomics sequencing method
CN117385477A
Generating capture probes for spatial analysis
US20230129552A1