Novel promoter variant of bacillus and method for producing protein using same

A modified Bacillus subtilis aprE promoter with specific nucleotide substitutions increases transcriptional activity, addressing the limitations of existing promoters to enhance protein production efficiency in Bacillus microorganisms.

WO2025211726A1PCT designated stage Publication Date: 2025-10-09CJ CHEILJEDANG CORP

Patent Information

Application Number
PCT/KR2025/004291
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-04-01
Filing Date
2025-04-01
Publication Date
2025-10-09

AI Technical Summary

Technical Problem

Existing protein production systems in Bacillus microorganisms are limited by the strength of the promoter, which affects the transcription and production efficiency of target proteins, necessitating the development of a stronger promoter variant for enhanced protein expression.

Method used

A novel Bacillus subtilis aprE promoter variant with specific substitutions at the -35 and -10 sites and a spacer site, including TTGACA, TATAAT, and TGN at the 3' end of the spacer, to increase transcriptional activity and protein production.

Benefits of technology

The promoter variant significantly enhances protein expression levels, allowing for improved isolation and purification of target proteins, and can be used in recombinant cells to produce biologically active substances like enzymes and amino acids.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure KR2025004291_09102025_PF_FP_ABST
    Figure KR2025004291_09102025_PF_FP_ABST
Patent Text Reader

Abstract

The present application relates to a novel Bacillus promoter variant and a protein production method using same. When the novel Bacillus promoter variant of the present application is used, the expression of a target protein can be significantly increased in a host cell, and thus the novel Bacillus promoter variant can be effectively used in the production of biotechnologically, medically, and industrially useful proteins through the mass production of proteins and target proteins such as polypeptide drugs.
Need to check novelty before this filing date? Find Prior Art

Description

Novel Bacillus promoter variant and protein production method using the same

[0001] Cross-citation with related application(s)

[0002] This application claims the benefit of priority from Republic of Korea Patent Application No. 10-2024-0044220, dated April 1, 2024, the entire contents of which are incorporated herein by reference.

[0003] Numerous papers and patents are referenced and cited throughout this application. The disclosures of these cited papers and patents are incorporated herein by reference in their entirety, providing a clearer understanding of the state of the art and the content of this application.

[0004] The present application relates to a novel Bacillus promoter variant and a protein production method using the same.

[0005]

[0006] Bacillus is a valuable industrial microorganism suitable as a host for traditional fermented foods and the production of food and pharmaceutical proteins. Bacillus's advantages as a protein production host include its generally regarded as safe (GRAS) status, which makes it harmless to humans. Its ability to secrete intracellular proteins is superior to that of other microorganisms, and its lack of endotoxin production. Furthermore, Bacillus possesses a long history of accumulated biological research, along with well-established genome information, genetic manipulation methods, and materials, facilitating the development of hosts for mass-production and production of proteins. Industrial enzymes produced using Bacillus as a host account for more than half of the global market, and various Bacillus strains and expression systems are actively being developed to enhance the productivity of these enzymes.

[0007] The most crucial step for increasing protein production in microorganisms is transcription of the target protein gene, and the level of protein production varies depending on the strength of the promoter. The promoter is located upstream of the structural gene, and transcription, which creates mRNA, is initiated when RNA polymerase binds to the promoter region. Promoter strength is a critical factor in determining the amount of mRNA produced by RNA polymerase. The efficiency with which RNA polymerase binds to the promoter, leading to rapid and stable transcription initiation, determines the amount of protein produced within the cell. In other words, a strong promoter increases the expression ratio of the target protein among the total protein produced by the host cell and facilitates the isolation and purification of the target protein. Therefore, securing a promoter with strong activity is essential for developing an efficient protein production system.

[0008]

[0009] One aspect of the present application provides a promoter mutant comprising a Bacillus subtilis aprE promoter wherein the -35 site is substituted with TTGACA, the -10 site is substituted with TATAAT, and a spacer site is present between the -35 site and the -10 site, wherein the length of the spacer site is 19 bp or 17 bp, the TAT at the 3' end of the spacer site is substituted with TGN, and wherein N is randomly selected from A, T, G, or C.

[0010] Another aspect of the present application provides an expression cassette comprising the above-described promoter variant and a gene of interest.

[0011] Another aspect of the present application provides a vector comprising the above-described promoter variant; or the above-described expression cassette comprising the promoter variant and a gene of interest.

[0012] Another aspect of the present application provides a microorganism comprising at least one member selected from the group consisting of the promoter variant, an expression cassette comprising the promoter variant and a target gene, and a vector comprising the expression cassette. The microorganism may have the ability to produce a target product.

[0013] Another aspect of the present application provides a method for producing a target product, comprising the step of culturing the above-described microorganism in a medium.

[0014] Another aspect of the present application provides a composition for producing a target product comprising the microorganism, a medium containing the microorganism, or a combination thereof.

[0015] Another aspect of the present application provides a use of the above-described microorganism for producing a desired product.

[0016]

[0017] This is specifically explained as follows. Meanwhile, each description and embodiment disclosed in this specification can also be applied to each other description and embodiment. In other words, all combinations of the various elements disclosed in this specification fall within the scope of this application. Furthermore, the scope of this application is not limited by the specific descriptions described below.

[0018]

[0019] According to one aspect of the present application, the present application provides a promoter mutant comprising a Bacillus subtilis aprE promoter in which the -35 site is substituted with TTGACA, the -10 site is substituted with TATAAT, a spacer site is present between the -35 site and the -10 site, the length of the spacer site is 19 bp or 17 bp, TAT at the 3' end of the spacer site is substituted with TGN, and N is A, T, G, or C.

[0020]

[0021] The "Bacillus subtilis" described in this application is a Gram-positive, rod-shaped bacterium, also known as Bacillus subtilis. Bacillus subtilis is generally non-pathogenic and is widely used in various industrial fields, including enzyme and antibiotic production, and probiotics for animal feed.

[0022] In the present specification, examples of Bacillus subtilis include Bacillus subtilis subspecies B. subtilissubsp.subtilis, B. subtilissubsp.spizizenii, B. subtilissubsp.inaquosorum, etc., but the origin of the promoter variant of the present application is not limited by the above examples.

[0023] As used herein, the term "promoter" refers to a nucleic acid sequence upstream (in the 5' direction) of a coding region that contains a binding site for RNA polymerase and has the activity of initiating transcription of a target sequence downstream (in the 3' direction) into mRNA. In prokaryotes, a promoter is usually defined as the binding site immediately adjacent to the transcription start site (TSS) where RNA polymerase binds. As used herein, a promoter may be derived entirely from a native gene, may be composed of different elements derived from different promoters found in nature, or may include a synthetic nucleic acid segment.

[0024] Promoters in prokaryotes typically contain two short nucleotide sequences, located approximately 10 and 35 bp upstream from the transcription start site, which are crucial for promoter activity. The nucleotide sequence located approximately 10 bp upstream is called the pribnow box or -10 element (-10 region), and is essential for the initiation of transcription in prokaryotes. Meanwhile, the nucleotide sequence located approximately 35 bp upstream is called the -35 element (-35 region), and it plays a role in enabling active transcription. The exact locations of the -10 element and -35 region can vary across species and can be regulated by complex interactions with various factors involved in transcriptional regulation.

[0025] As used herein, the term "spacer region" refers to the region between the -35 and -10 regions described above. In prokaryotic promoters, the spacer region typically has a length of 17 to 19 bp. The spacer region affects the binding of RNA polymerase, and the efficiency of transcription can be affected depending on the length and sequence of the spacer region. The length and sequence of the spacer region vary depending on the specific promoter and organism.

[0026] In this specification, the term “aprE” refers to a gene encoding subtilisin, a serine alkaline protease of Bacillus subtilis. The promoter of aprE (PaprE) is regulated by sigma factor A (σ A , sig A) is known to be regulated by RNA polymerase. The subtilisin is also known as subtilisin E, or AprE.

[0027] In this specification, the term “consensus sequence” means that a specific nucleotide appears with a high frequency at a specific position in all or part of the sequence of the -35 site, -10 site, or spacer site in the promoter of a prokaryotic organism. In other words, the consensus sequence is theoretically a representative nucleotide sequence, and refers to the sequence that occurs most frequently in the corresponding site among various sequences that occur in nature. In particular, the consensus sequence of the promoter of aprE (PaprE) is the σ of RNA polymerase. A Considering the characteristics that depend on it, it can be used interchangeably with the “sigA consensus sequence”.

[0028] In one embodiment of the present application, the promoter variant of the present application may regulate (e.g., increase or decrease) the expression of a target gene operably linked thereto, the production and / or activity of a target protein encoded by the target gene, and / or the production and / or activity of a biologically active substance involved in the production of the target protein, in comparison with a conventional promoter or a cell-endogenous promoter in a cell.

[0029] As demonstrated in the examples described below, when the -35 site of PaprE is replaced with the conserved sequence TTGACA, and / or when the -10 site is replaced with the conserved sequence TATAAT, the transcriptional activity of PaprE increases, resulting in an increase in the expression level of the target protein.

[0030] In one embodiment of the present application, when TAT at the 3' end of the spacer region described above is replaced with TGN, N may be arbitrarily selected from A, T, G or C, and may be, for example, T, A or G, but is not limited thereto.

[0031] As demonstrated in the examples described below, when TAT at the 3' end of the spacer region described above is replaced with TGN, the nucleotide corresponding to N can affect the transcriptional activity of PaprE.

[0032] In one embodiment of the present application, the -35 site described above may be located 37 bp upstream or 35 bp upstream of the aprE transcription start site (TSS), but is not limited thereto.

[0033] The above aprE transcription start site (TSS) refers to the transcription start site of wild-type aprE. Specifically, the -35 site may be a nucleotide sequence having a length of 6 bp in the 5'-to-3'-end direction, calculated from a position 37 bp or 35 bp above the aprE transcription start site, but is not limited thereto.

[0034] In one example, the -35 site may be, but is not limited to, a nucleotide sequence having a length of 6 bp in the 5'-to-3'-end direction starting from the 114th position from the 5'-to-3'-end of the wild-type PaprE of SEQ ID NO: 21, or a nucleotide sequence having a length of 6 bp in the 5'-to-3'-end direction starting from the 116th position.

[0035] In one embodiment of the present application, the -10 site described above may be located 12 bp upstream of the aprE transcription start site, but is not limited thereto. Specifically, the -10 site may be a nucleotide sequence having a length of 6 bp in the 5'- to 3'-terminal direction, counting from a position 12 bp upstream of the aprE transcription start site, but is not limited thereto.

[0036] In one example, the -10 site may be a nucleotide sequence having a length of 6 bp in the 5'-to-3'-end direction starting from the 139th position from the 5'-end of the wild-type PaprE of SEQ ID NO: 21, but is not limited thereto.

[0037] As demonstrated in the examples described below, the position of the -35 site of PaprE can affect the transcriptional activity of PaprE.

[0038] In one embodiment of the present application, the -35 site of the above-described promoter variant is located 37 bp upstream of the aprE transcription start site, and the above-described spacer site may be a 19 bp long sequence existing between the -35 site and the -10 site, but is not limited thereto.

[0039] In one embodiment of the present application, the -35 site of the above-described promoter variant is located 35 bp upstream of the aprE transcription start site, and the above-described spacer site may be a 17 bp long sequence existing between the -35 site and the -10 site, but is not limited thereto.

[0040] In one embodiment of the present application, the -35 site of the above-described promoter variant is located 37 bp upstream of the aprE transcription start site, and the above-described spacer site may be a 19 bp-long sequence existing between the -35 site and the -10 site, in which the AA sequence at the 5' end (more specifically, nucleotides corresponding to 30 bp upstream and 31 bp upstream of the wild-type aprE transcription start site) is deleted, but is not limited thereto. By deleting the AA sequence at the 5' end of the 19 bp-long sequence, the spacer site may be formed to have a length of 17 bp.

[0041] As demonstrated in the examples described below, the length of the spacer region of PaprE can affect the transcriptional activity of PaprE.

[0042] As used herein, “transcriptional activity of a promoter” refers to a qualitative or quantitative estimate of the ability of a promoter to stimulate transcription of a downstream target sequence. Methods for measuring the transcriptional activity of a promoter are often based on the expression of a reporter gene (e.g., green fluorescent protein; GFP), wherein the promoter sequence of interest is positioned upstream and operably linked to the reporter gene (e.g., GFP). For example, the transcriptional activity of a promoter can be measured by operably linking the promoter sequence of interest (or multiple variants thereof (e.g., including one or more mutations, deletions, or substitutions)) upstream of the reporter gene (e.g., GFP) and detecting or measuring changes in the reporter gene. Furthermore, the transcriptional activity of a promoter can be assessed by introducing a cassette for expressing a target protein into a suitable host cell (e.g., a Bacillus spp.) and expressing the same.

[0043] In this specification, the "target sequence" may be a "target gene" that is the target of expression. In one example, the target gene may be a gene encoding a target protein. The target protein may be a protein (e.g., an enzyme) involved in the production of the target product.

[0044] In one embodiment, the target protein may be, but is not limited to, a serine protease.

[0045] The term "target product" in this specification refers to a biologically active substance whose production is ultimately to be produced or whose production is to be controlled (increased or decreased) using a promoter variant provided herein, an expression cassette containing the same, an expression vector, and / or a recombinant cell (microorganism), and may refer to, for example, the target protein itself encoded by the target gene, and / or all biologically active substances produced with the participation of the target protein. The above biologically active substance means all substances produced or derived from an organism (e.g., a cell) or having a predetermined function in a living body or in a cell, for example, amino acids, amino acid derivatives, nucleic acids (nucleic acid, adenine, thymine, guanine, cytosine, uracil, etc.), nucleic acid derivatives, vitamins (vitamins A (retinol), B (B1 (thiamine), B2 (riboflavin), B3 (niacin), B5 (pantothenic acid), B6 ​​(pyridoxine), B7, B9 (folic acid), B12 (cobalamin), etc.), C (ascorbic acid), D (calciferol), E (tocopherol), K (phylloquinone), etc.), vitamin derivatives, proteins (proteins other than the target proteins, for example, hormones, growth factors, cytokines, immunoglobulins (antibodies), antigen proteins, receptors, ligands, functional fragments thereof (fragments having the target function), fusion proteins in which two or more are fused, etc.), sugars (e.g., monosaccharides) (glyceraldehyde, dihydroxyacetone, erythrose, threose, erythrulose, arabinose, lyxose, ribose, xylose, ribulose, xylulose, deoxyribose, allose, altrose, galactose, glucose, gulose, idose, mannose, talose, fructose, psicose, sorbose, tagatose, fucose, fuculose, rhamnose, mannoheptulose, sedoheptulose, etc.), disaccharides (cellobiose, isomaltose, isomaltulose, lactose, lactulose, maltose, sucrose, trehalose, turanose, etc.), polysaccharides, etc.), sugar derivatives (sugar alcohols, galactosamine, glucosamine, sialic acid,N-acetylglucosamine, sulfoquinobose, ascorbic acid, mannitol, glucuronic acid, etc.), fatty acids (myristoleic acid, palitoleic acid, sapienic acid, oleic acid, elaidic acid, vaccenic acid, linoleic acid, linolelaidic acid, arachidonic acid, eicosapentaenoic acid (EPA), erucic acid, docosahexaenoic acid (DHA), etc.), fatty acid derivatives, organic acids (lactic acid, citric acid, oxalic acid, uric acid, butyric acid, stearic acid, propionic acid, etc.), metabolites thereof (polyhydroxyalkanoates (PHAs), etc.), precursors thereof, derivatives that maintain their biological activity, etc., but are not limited thereto.

[0046] In one example, when the target protein is involved in the production of the target product, (1) the target protein may be at least one selected from the group consisting of proteins involved in at least one process or step of the intracellular production pathway (e.g., biosynthesis, metabolism, bioconversion, etc.), intracellular transport, and / or extracellular excretion pathway of the target product, such as synthetase, decomposition enzyme, phosphorylation enzyme, carboxylase (e.g., pyruvate carboxylase, etc.), reductase, oxidase, decarboxylase, dehydrogenase, dehydratase, transferase (e.g., transferase, epimerase, etc.), intermediate, transport protein, membrane protein (channel, etc.), but is not limited thereto.

[0047] (2) The above target gene may be a gene encoding the target protein described in (1) above.

[0048] Among the above target products, the amino acids may be proteinogenic amino acids or non-proteinogenic amino acids.

[0049] The above protein-forming amino acids may be at least one selected from the group consisting of arginine, histidine, lysine, aspartic acid, glutamic acid, serine, threonine, asparagine, glutamine, cysteine, glycine, proline, selenocysteine, pyrrolysine, alanine, valine, isoleucine, leucine, methionine, phenylalanine, tyrosine, and tryptophan, and may also be intermediates thereof.

[0050] The above protein-forming amino acid may be at least one selected from the group consisting of L-amino acids, for example, L-arginine, L-histidine, L-lysine, L-aspartic acid, L-glutamic acid, L-serine, L-threonine, L-asparagine, L-glutamine, L-tyrosine, L-alanine, L-isoleucine, L-leucine, L-valine, L-phenylalanine, L-methionine, L-tryptophan, L-glycine, L-proline and L-cysteine, or an intermediate thereof, and specifically may be L-lysine, L-threonine, L-isoleucine, L-leucine, L-valine, L-arginine, or L-glutamic acid, but is not limited thereto. The intermediate may be, for example, O-acetyl homoserine, which is an intermediate of L-methionine, but is not limited thereto.

[0051] The above non-proteinogenic amino acids are beta-alanine, gamma-aminobutyric acid (GABA), 5-aminolevulinic acid (δ-Aminolevulinic acid), p-aminobenzoic acid (4-Aminobenzoic acid), α-aminoisobutyric acid, dehydroalanine, cystathionine, lanthionine, djenkolic acid, diaminopimelic acid, norvaline, norleucine, alloisoleucine, tert-Leucine, α-amino-n-heptanoic acid, pipecolic acid, alpha, It may be at least one selected from the group consisting of, but is not limited to, α,β-diaminopropionic acid, α,γ-diaminobutyric acid, ornithine, allothreonine, homocysteine, homoserine (or isothreonine), O-acetyl homoserine, etc.

[0052] The above amino acid may be a D-amino acid or an L-amino acid.

[0053] In one embodiment of the present application, the promoter variant may include a nucleotide sequence selected from the group consisting of the nucleotide sequences of SEQ ID NO: 22 to SEQ ID NO: 28 shown in Table 1 below, for example, a nucleotide sequence selected from the group consisting of the nucleotide sequences of SEQ ID NO: 23, SEQ ID NO: 26, and SEQ ID NO: 28, but is not limited thereto.

[0054]

[0055] The nucleotide sequence of the promoter variant of the present application can be modified by conventionally known mutagenesis methods, such as directed evolution and site-directed mutagenesis. That is, the promoter variant has a biological activity identical to or corresponding to any one nucleotide sequence selected from the group consisting of the nucleotide sequences of SEQ ID NO: 22 to SEQ ID NO: 28, and has an activity of at least 60%, at least 65%, at least 70%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 90.5%, at least 91%, at least 91.5%, at least 92%, at least 92.5%, at least 93%, at least 93.5%, It may comprise or consist of a nucleotide sequence having a homology or identity of at least 94%, at least 94.5%, at least 95%, at least 95.5%, at least 96%, at least 96.5%, at least 97%, at least 97.5%, at least 98%, at least 98.5%, at least 99%, at least 99.5% or at least 99.9% (the upper limit may be 100% or less than 100%).In addition, if it is a polynucleotide having a biological activity substantially identical to or corresponding to any one of the nucleotide sequences selected from the group consisting of the nucleotide sequences of SEQ ID NO: 22 to SEQ ID NO: 28 and having homology or identity with any one of the nucleotide sequences selected from the group consisting of the nucleotide sequences of SEQ ID NO: 22 to SEQ ID NO: 28, a polynucleotide having a nucleotide sequence in which a part of the sequence is deleted, modified, substituted or added in any one of the nucleotide sequences selected from the group consisting of the nucleotide sequences of SEQ ID NO: 22 to SEQ ID NO: 28 may also be included within the scope of the promoter variant of the present application.

[0056] In one embodiment, the wild-type PaprE of the above sequence number 21 may represent, but is not limited to, a sequence immediately upstream from the transcription start site of the wild-type aprE.

[0057] As used herein, the term 'homology' or 'identity' refers to the degree of identity with a given nucleic acid sequence or amino acid sequence, and may be expressed as a percentage (%). For example, homology may be determined by aligning sequence information and directly aligning parameters such as score, identity, and similarity between two polynucleotide molecules or two polypeptide molecules using a readily available computer program. The computer program may be BLAST (NCBI), CLC Main Workbench (CLC bio), MegAlignTM (DNASTAR Inc), etc.

[0058] In one specific embodiment, a promoter variant comprising a specific nucleotide sequence provided herein may be interpreted as including a polynucleotide fragment comprising not only the specific nucleotide sequence or a nucleotide acid sequence substantially equivalent thereto, but also a nucleotide sequence complementary to the specific nucleotide sequence. Specifically, the polynucleotide having the complementarity can be hybridized at a Tm value that can be appropriately adjusted by one skilled in the art depending on the purpose, for example, a Tm value of 55°C, 60°C, 63°C, or 65°C, and analyzed under the conditions described below: such conditions are specifically described in known literature. For example, conditions in which polynucleotides having a high complementarity of 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 98% or more, 99.5% or more, or 99.9% or more hybridize with each other, and polynucleotides having a lower complementarity do not hybridize with each other, or washing conditions of conventional Southern hybridization: 60°C, 1x SSC (saline-sodium citrate buffer), and 0.1% (w / v) SDS (Sodium Dodecyl Sulfate); 60°C, 0.1x SSC, and 0.1% SDS; Or, conditions such as washing once, specifically two to three times, at a salt concentration and temperature equivalent to 68°C, 0.1x SSC, and 0.1% SDS, etc., can be listed, but are not limited thereto. Hybridization requires that two nucleotides have complementary sequences, but mismatches between bases may be allowed depending on the stringency of hybridization. The term "complementary" can be used to describe the relationship between nucleotide bases that can hybridize with each other. For example, in the case of DNA, adenosine is complementary to thymine and cytosine is complementary to guanine.The appropriate stringency for hybridizing polynucleotides depends on the length and degree of complementarity of the polynucleotides, and is well known in the art (see Sambrook et al., supra, 9.50-9.51, 11.7-11.8).

[0059] According to one specific example, the promoter variant may comprise any one nucleotide sequence selected from the group consisting of the nucleotide sequences of SEQ ID NO: 22 to SEQ ID NO: 28, or may consist of or consist essentially of any one nucleotide sequence selected from the group consisting of the nucleotide sequences of SEQ ID NO: 22 to SEQ ID NO: 28.

[0060]

[0061] In one embodiment of the present application, the promoter variant may be isolated. As used herein, “isolated” or “purified” means that a biomolecule (e.g., a polypeptide or polynucleotide) is altered from its natural state by being separated from some or all of the naturally occurring components with which it is associated in nature. Such isolation or purification can be achieved by any separation technique recognized in the art, such as ion exchange chromatography, affinity chromatography, hydrophobic separation, dialysis, protease treatment, ammonium sulfate precipitation or other protein salt precipitation, centrifugation, size exclusion chromatography, filtration, microfiltration, gel electrophoresis, or gradient separation to remove undesirable whole cells, cell debris, impurities, foreign proteins, or enzymes from the final composition. It is further possible to add components to the purified or isolated biomolecule composition that provide additional benefits, such as activators, anti-inhibitors, desirable ions, compounds for controlling pH, or other enzymes or chemicals.

[0062]

[0063] According to another aspect of the present application, the present application provides an expression cassette comprising a promoter variant of the present application and a gene of interest.

[0064] The above target gene may be a gene encoding a target protein, and the target protein may be a protein (e.g., an enzyme) involved in the production of the target product.

[0065] The above target product may be at least one selected from the group consisting of amino acids, amino acid derivatives, nucleic acids, nucleic acid derivatives, vitamins, vitamin derivatives, sugars, sugar derivatives, fatty acids, fatty acid derivatives, proteins, and other metabolites.

[0066] As used herein, the term “expression cassette” may mean a structure that is the smallest unit of nucleic acid fragment capable of being expressed in a host cell and includes at least a target gene and an expression control sequence (e.g., a promoter).

[0067] The above promoter variant may be included in the 5' end or 3' end region of the target gene.

[0068] The above promoter variant may be operably linked to the target gene.

[0069] The above promoter variant, target gene, target protein and target product are as described above.

[0070]

[0071] According to another aspect of the present application, a vector comprising the above-described promoter variant or the above-described expression cassette is provided.

[0072] As used herein, the term “vector” refers to a genetic construct that is an expression vector capable of expressing a target protein in a suitable host cell (microorganism), and includes essential regulatory elements operably linked to express a gene insert (expression cassette). The expression vector of the present application is not particularly limited as long as it can replicate in the host cell (microorganism), and may be selected from all commonly used vectors. Examples of commonly used vectors include plasmids, cosmids, viruses, bacteriophages, etc., in a natural or recombinant state. For example, as the vector, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A, etc. can be used as a phage vector or a cosmid vector, and as a plasmid vector, pBR series, pUC series, pBluescriptII series, pGEM series, pTZ series, pCL series, and pET series, etc. can be used. Specifically, examples include, but are not limited to, pDG1730, pDZ, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, and pCC1BAC vectors.

[0073] As used herein, the term "regulatory element" refers to an untranslated nucleic acid sequence that aids in or influences the transcription, translation, or expression of a nucleic acid sequence encoding a protein. The expression vector of the present application essentially includes a promoter variant of the present application as a regulatory element, and may include expression regulatory sequences capable of influencing protein expression, such as an initiation codon, a stop codon, a polyadenylation signal, an enhancer, a signal sequence for membrane targeting or secretion, etc.

[0074] In one embodiment of the present application, the vector described above may additionally include a gene encoding a target protein downstream of the promoter variant sequence described above, and the gene encoding the target protein may be operatively linked to the promoter variant described above.

[0075] As used herein, "operably linked" means that the promoter variant described above is functionally linked to a nucleotide sequence of a gene encoding a target protein so as to initiate and / or mediate transcription of the gene encoding the target protein. Operable linking can be performed using a genetic recombination technique known in the art, such as a site-specific DNA cleavage and / or ligation technique, and the site-specific DNA cleavage and ligation can be performed using a conventional cleavage enzyme and / or ligation enzyme, but is not limited thereto.

[0076] As used herein, the term “target protein” means any protein whose expression is to be increased using the promoter variant of the present application, and may be homologous or heterologous.

[0077] As used herein, the term “gene” refers to a polynucleotide encoding a specific sequence of amino acids, including all or part of a protein coding sequence, and may include regulatory (non-transcribed) DNA sequences, such as a promoter sequence, which determines the conditions under which the gene is expressed.

[0078] In one embodiment of the present application, the vector comprising the above-described promoter variant may additionally comprise a tag for protein purification. The tag for protein purification is not limited as long as it facilitates the purification of the target protein recovered in the present application, and examples thereof include glutathione S-transferase (Pharmacia, USA), maltose binding protein (NEB, USA), FLAG (IBI, USA), and 6x His (hexahistidine; Quiagen, USA).

[0079] In one embodiment of the present application, the vector comprising the above-described promoter variant may further comprise a selection marker for confirming whether the vector has been integrated into the chromosome of a host cell (microorganism). The selection marker is used to select cells transformed with the vector, i.e., to confirm whether the promoter variant nucleotide sequence of the present application has been inserted, and may be selected from genes that confer a selectable phenotype, such as drug resistance, nutrient requirement, cytotoxic agent resistance, or expression of a surface protein. In an environment treated with a selective agent, only cells expressing the selection marker survive or exhibit other phenotypic traits, thereby enabling selection of transformed cells.

[0080]

[0081] According to another aspect of the present application, the present application provides a host cell or recombinant cell comprising at least one selected from the group consisting of the promoter variant of the present application described above, the promoter variant and a target gene operably linked thereto, the expression cassette, and the vector.

[0082] The description of the promoter variant, target gene, expression cassette, or vector is as described above.

[0083] In this specification, the term "recombinant cell" may refer to a transformant into which the polynucleotide and / or the recombinant vector has been introduced. The term "transformation" refers to changing the genetic characteristics of a host cell (microorganism) by introducing a target nucleic acid (DNA or RNA) into the host cell (microorganism). The transformation method may be performed by selecting a suitable standard technique known in the relevant field depending on the host cell. For example, the transformation may be performed by, but is not limited to, electroporation, lipofection, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, and lithium acetate-DMSO method.

[0084] The above host cell may include, without limitation, any cell capable of (or increasing) expression of a target gene (a gene included in a recombinant vector or a host cell endogenous gene) (operably linked) by the polynucleotide provided in the present application acting as a promoter.

[0085] In one example, the host cell may be a microorganism, a plant cell, or an animal cell.

[0086] The microorganism of the present application may be a microorganism having the ability to produce the target product or having an improved ability to produce the target product.

[0087] The microorganism of the present application may be a microorganism that naturally does not have the ability to produce the target product, or a microorganism that has the ability to produce the target product, but is not limited thereto, by introducing at least one selected from the group consisting of the promoter variant, the expression cassette, and the vector into a microorganism that has the ability to produce the target product, thereby imparting or improving the ability to produce the target product.

[0088] The fact that the above microorganism has an improved ability to produce a target product or has an ability to produce a target product may mean that the microorganism has an improved ability to produce a target product compared to a non-modified microorganism, a cell before recombination, a parent strain, and / or a wild-type strain, or that the microorganism has been granted an ability to produce a target product unlike a non-modified microorganism, a cell before recombination, a parent strain, and / or a wild-type strain that does not have an ability to produce a target product.

[0089] A microorganism into which at least one selected from the group consisting of the promoter variant, the expression cassette, and the vector is introduced may have an improved ability to produce a target product compared to a microorganism before introduction or a microorganism before enhancement, i.e., an unmodified microorganism of the same species. In the present application, the term "unmodified microorganism" does not exclude a microorganism containing a mutation that may occur naturally in a microorganism, and may refer to a wild-type microorganism or a natural microorganism itself, or a microorganism before its traits are changed by genetic mutation due to natural or artificial factors. For example, the unmodified microorganism may refer to a strain into which at least one selected from the group consisting of the promoter variant, the expression cassette, and the vector is not introduced, or before it is introduced. The term "unmodified microorganism" may be used interchangeably with "pre-modified strain," "pre-modified microorganism," "unmutated strain," "unmodified microorganism," or "reference microorganism." The above promoter variant, the above expression cassette and the above vector are as described above.

[0090] In one embodiment of the present application, a microorganism into which at least one selected from the group consisting of the promoter mutant, the expression cassette, and the vector has been introduced may have a newly granted or increased ability to produce a target product compared to a parent strain before mutation, an unmodified microorganism, a parent strain, or a wild-type microorganism, but is not limited thereto.

[0091] As another example, the microorganism with improved target product production ability may have a target product production ability of about 2 times or more, about 10 times or more, about 50 times or more, about 80 times or more, about 95 times or more, about 100 times or more, about 110 times or more, about 120 times or more, about 130 times or more, about 140 times or more, about 150 times or more, about 160 times or more, about 175 times or more, about 200 times or more, about 230 times or more, about 250 times or more, or about 280 times or more (the upper limit is not particularly limited, and may be, for example, about 1,000 times or less), but is not limited thereto.

[0092] The term “about” above includes all ranges including ±0.5, ±0.4, ±0.3, ±0.2, ±0.1, etc., and includes all ranges of values ​​equal to or similar to the value following the term “about,” but is not limited thereto.

[0093]

[0094] In one embodiment of the present application, the host cell of the present application described above may be isolated.

[0095] Any host cell or cell line capable of stably and continuously cloning and expressing the vector of the present application may be used, and examples thereof include, but are not limited to, strains of the genus Bacillus such as Bacillus subtilis and Bacillus thuringiensis, strains of enterobacteria such as Salmonella typhimurium, Serratia marcescens and various Pseudomonas species, and strains of E. coli such as E. coliOrigami2, E. coliJM109, E. coliBL21(DE3), E. coliRR1, E. coliLE392, E. coliB, E. coliX1776, and E. coliW3110.

[0096] In one embodiment of the present application, the host cell described above may be a gram-positive bacterium.

[0097] In one embodiment of the present application, the Gram-positive bacteria described above may be any one Gram-positive bacteria selected from the group consisting of Bacillus subtilis, Bacillus licheniformis, Bacillus megaterium, Bacillus cereus, Bacillus thuringiensis, Bacillus brevis, and bacteria of the genus Lactobacillus or Panibacillus, but is not limited thereto.

[0098] As used herein, "transformation" or "transfection" refers to introducing a gene into a host cell and then allowing it to be expressed. The method of transforming or transfecting a host cell with a vector containing the target gene includes any method for introducing a nucleotide into the cell, and can be performed by selecting an appropriate standard technique known in the art.

[0099] Methods for transporting the vector of the present application into a host cell include the CaCl2 precipitation method, the Hanahan method which increases efficiency by using a reducing substance called dimethyl sulfoxide (DMSO) in the CaCl2 method, electroporation, calcium phosphate precipitation, protoplast fusion, a stirring method using silicon carbide fibers, Agrobacteria-mediated transformation, polyethylene glycol (PEG)-mediated transformation, dextran sulfate, lipofectamine, and desiccation / inhibition-mediated transformation methods, etc. The methods for transforming or transfecting the vector of the present application are not limited to the above examples, and methods commonly used in the art may be used without limitation.

[0100]

[0101] According to another aspect of the present application, the present application provides a composition for producing a target product comprising the microorganism, a medium in which the microorganism is cultured, or a combination thereof.

[0102] The composition may further comprise any suitable excipients commonly used in compositions for producing the desired product, and such excipients may be, for example, but are not limited to, preservatives, wetting agents, dispersing agents, suspending agents, buffering agents, stabilizers, or isotonic agents.

[0103] In another aspect of the present application, the present application provides a use of the above-described microorganism for producing a desired product.

[0104] According to another aspect of the present application, the present application provides a use of the above-described microorganism for the preparation of a composition for producing a desired product.

[0105]

[0106] According to another aspect of the present application, the present application provides a method for producing a target product, comprising the step of culturing the above-described microorganism in a medium.

[0107] The above method may further include a step of recovering the target product from the medium or microorganism according to the above culture.

[0108] The medium in which the above microorganism is cultured may or may not contain the above microorganism.

[0109] The above microorganism may include at least one selected from the group consisting of a polynucleotide provided in the present application, an expression cassette including the polynucleotide and a target gene, and a vector including the expression cassette, as described above.

[0110] As used herein, "cultivation" refers to growing cells under artificially controlled environmental conditions. The method for producing the target product provided herein can be performed by any method appropriately selected from among all methods widely known in the art. For example, the cultivation can be continuously cultured in a batch process, a fed batch process, or a repeated fed batch process, but is not limited thereto. The medium used for the cultivation can be one that satisfies the growth requirements of the target cells in an appropriate manner.

[0111] In this application, "medium" means a material containing nutrients necessary for culturing the microorganism as a main component, and supplies nutrients and growth factors, including water essential for survival and growth. Specifically, the medium and other culture conditions used for culturing the microorganism of this application may be any medium used for culturing general microorganisms without particular limitation, but the microorganism of this application may be cultured under aerobic conditions while controlling temperature, pH, etc. in a general medium containing an appropriate carbon source, nitrogen source, phosphorus source, inorganic compound, amino acid, and / or vitamin.

[0112] The sugar source that can be used for the above culture or included in the medium may include at least one selected from the group consisting of sugars and carbohydrates such as glucose, saccharose, lactose, fructose, maltose, starch, cellulose, etc.; oils and fats such as soybean oil, sunflower oil, castor oil, coconut oil, etc.; fatty acids such as palmitic acid, stearic acid, linoleic acid; alcohols such as glycerol, ethanol, etc.; organic acids such as acetic acid, etc., but is not limited thereto. The nitrogen source that can be used for the above culture or included in the medium may include at least one selected from the group consisting of organic nitrogen sources such as peptone, yeast extract, meat juice, malt extract, corn steep liquor, soybean meal, urea, etc., and inorganic nitrogen sources such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate, ammonium nitrate, etc., but is not limited thereto. The phosphorus that may be used for the above culture or included in the medium may include, but is not limited to, one or more selected from the group consisting of potassium salts of phosphoric acid such as potassium dihydrogen phosphate, dipotassium hydrogen phosphate, and their corresponding sodium salts. In addition, the medium may contain metal salts such as magnesium sulfate or iron sulfate necessary for growth. In addition to the above, the culture or medium may additionally use or include one or more selected from essential growth substances such as amino acids and vitamins. In addition, the medium may contain an appropriate precursor of the desired product as a raw material. The above-mentioned raw materials may be added to the culture in a batch and / or continuous manner in an appropriate manner during the culture process.

[0113] During the culture of the above cells, the pH of the culture can be adjusted by appropriately using basic compounds such as sodium hydroxide, potassium hydroxide, and ammonia, and / or acid compounds such as phosphoric acid or sulfuric acid. In addition, during the culture, an antifoaming agent such as fatty acid polyglycol ester can be used to suppress bubble formation. In addition, oxygen or an oxygen-containing gas (e.g., air) can be injected into the culture to maintain an aerobic state. The temperature of the medium and / or culture can be typically set to 20°C to 45°C, or 25°C to 40°C. The culture time can be continued until the production of the target product reaches the desired amount, and can be, for example, about 10 to about 160 hours, but is not limited thereto.

[0114] The step of isolating or recovering the target substance from the cultured microorganism or culture medium can be performed using a suitable method known in the art depending on the culture method. For example, centrifugation, filtration, extraction, spraying, drying, evaporation, precipitation, crystallization, electrophoresis, differential dissolution (e.g., ammonium sulfate precipitation), and / or chromatography (e.g., ion exchange, affinity, hydrophobicity, and size exclusion) can be used, but is not limited thereto. The culture medium refers to a medium in which recombinant cells are cultured.

[0115] According to one specific example, the step of isolating or recovering the target product may include removing biomass by low-speed centrifugation of the culture and separating the obtained supernatant through ion exchange chromatography.

[0116] The method for producing the above target product may additionally include a process for purifying the target product.

[0117] The recovery of the target product from the culture medium (medium) can be performed using a separation method using conventional means known in the art. Examples of conventional means available for the separation of the target product include centrifugation, filtration, chromatography, and / or crystallization. In one example, the culture medium may be centrifuged at low speed to remove biomass, and the resulting supernatant may be subjected to ion exchange chromatography to separate the target product, but is not limited thereto. The recovery step may additionally include a purification process.

[0118]

[0119] According to another aspect of the present application, the present application provides a use for producing a target product, and / or preparing a target product-producing microorganism, and / or imparting and / or increasing the target product-producing ability of a microorganism, wherein at least one microorganism is selected from the group consisting of a promoter variant of the present application described above; a vector comprising the promoter variant; and a microorganism comprising the promoter variant and / or a vector comprising the promoter variant.

[0120] In the above-described purpose product production, and / or purpose product production microorganism production, and / or purpose product production ability of microorganism, the promoter variant, vector, microorganism, etc. are as described in other aspects described above, and therefore, the common contents are mutually referred to, and the description thereof is omitted to avoid excessive complexity of the present specification.

[0121]

[0122] In another aspect of the present application, the present application provides a composition, method, product, process, or use characterized by one or more elements disclosed in the present application.

[0123]

[0124] Figure 1 is a schematic diagram of the pDG1730_PaprE_protease vector containing the aprE promoter (PaprE) and the protease gene.

[0125] Figure 2 is a diagram showing a part of the sequence of PaprE and a part of the sequence of a promoter variant.

[0126] Figure 3 is a diagram showing specific mutations in a portion of the sequence of PaprE and a portion of the promoter variant.

[0127]

[0128] Hereinafter, the present application will be described in more detail through examples. These examples are intended solely to illustrate the present application more specifically, and it will be apparent to those skilled in the art that the scope of the present application is not limited by these examples, in accordance with the gist of the present application.

[0129]

[0130] Example

[0131]

[0132] (Throughout this specification, "%" used to indicate the concentration of a particular substance is (weight / weight) % for solid / solid, (weight / volume) % for solid / liquid, and (volume / volume) % for liquid / liquid, unless otherwise stated.)

[0133]

[0134] Example 1. Construction of pDG1730_PaprE_protease vector

[0135] The vector to be used to evaluate the transcriptional activity of the promoter was constructed using the following method.

[0136] To evaluate the transcriptional activity of the promoter, a promoter-serine protease expression cassette was inserted into the amyE site on the Bacillus subtilis chromosome using the pDG1730 plasmid (BGSC, Bacillus Genetic Stock Center), and the protease expression level was analyzed. pDG1730 has a sequence homologous to the amyE site of Bacillus subtilis, so when it is introduced into a strain in a linear form using a restriction enzyme, gene insertion into the amyE site of Bacillus subtilis is possible through homologous recombination.

[0137] Specifically, to construct the pDG1730_PaprE_protease vector, pDG1730 was digested with BamH1 to prepare it, and the PaprE fragment was prepared by PCR using the polynucleotide of the sequence of SEQ ID NO: 29 as a template and the primer pairs of SEQ ID NOs: 1 and 2 (Table 2), and the protease coding fragment was prepared by PCR using the polynucleotide of the sequence of SEQ ID NO: 30 as a template and the primer pairs of SEQ ID NOs: 3 and 4. The three fragments prepared in this way were ligated using the In-Fusion HD cloning kit (Clontech) and then transformed into DH5a (E. coli), thereby completing vector cloning for evaluating the transcriptional activity of the promoter (Fig. 1).

[0138]

[0139]

[0140] Example 2. Production of a mutant of the aprE promoter

[0141] Transcriptional activity of the aprE promoter (PaprE) of Bacillus subtilis is regulated by sigma factor A (σ) of RNA polymerase. A) is known to be dependent on PaprE. In order to confirm the structure of PaprE, the DNA sequence of PaprE was closely analyzed considering that the length of the spacer region of the promoter is typically 17 to 19 bp. As a result, i) TCTACT, which is estimated to be located at the -35 region from the upper 37 bp position (hereinafter referred to as the 'upper 37 position') based on the aprE transcription start site (TSS), and TACAAT, which is estimated to be located at the -10 region with a gap of 19 bp (i.e., a spacer region of 19 bp) between the -35 region of the upper 37 position and the lower 37 position, were confirmed, and ii) TACTAA, which is estimated to be located at the -35 region from the upper 35 bp position (hereinafter referred to as the 'upper 35 position') based on the aprE transcription start site, and TACAAT, which is estimated to be located at the -10 region with a gap of 17 bp (i.e., a spacer region of 17 bp) between the -35 region of the upper 35 position and the lower 35 position, were confirmed.

[0142] Based on the analysis results of the above-described promoter sequence, we analyzed whether i) the transcriptional activity of the promoter according to the position of the -35 site where the promoter sequence starts, ii) the transcriptional activity of the promoter according to the optimization of the length of the spacer region to 17 bp by deleting AA at the 5' end of the spacer region, and iii) the transcriptional activity of the promoter according to the mutation of the TAT sequence at the 3' end of the spacer region to TGT changes.

[0143] Specifically, a total of seven mutants were constructed as follows, and are shown in Figures 2 and 3. TTGACA was used as the common sequence at the -35 site, and TATAAT was used as the common sequence at the -10 site. The constructed PaprE mutants are as follows:

[0144] 1) PaprEsigA1 (SEQ ID NO: 22, hereinafter 'PsigA1') in which the -35 site (TCTACT) at the upper 37th position of PaprE is replaced with a consensus sequence (TTGACA), the TAT sequence at the 3'-end of the spacer site (19 bp) is replaced with TGT, and the -10 site (TACAAT) having a 19 bp gap from the -35 site at the upper 37th position is replaced with a consensus sequence (TATAAT);

[0145] 2) PaprEsigA2 (SEQ ID NO: 23, hereinafter 'PsigA2') in which the -35 site (TCTACT) at the upper 37th position of PaprE is replaced with a consensus sequence (TTGACA), the AA sequence at the 5' end of the spacer site (19 bp) is deleted, the TAT sequence at the 3' end of the spacer site (19 bp) is replaced with TGT, and the -10 site (TACAAT) having a gap of 17 bp from the -35 site at the upper 37th position as a result of the deletion of the spacer site (19 bp) is replaced with a consensus sequence (TATAAT);

[0146] 3) PaprEsigA3 (SEQ ID NO: 24, hereinafter 'PsigA3') in which the -35 site (TACTAA) at the upper 35th position of PaprE is replaced with a consensus sequence (TTGACA) and the -10 site (TACAAT) with a gap of 17 bp from the -35 site at the upper 37th position is replaced with a consensus sequence (TATAAT); and

[0147] 4) PaprEsigA4 (SEQ ID NO: 25, hereinafter referred to as 'PsigA4') in which the wild-type -35 site (TACTAA) at the upper 35th position of PaprE is replaced with a consensus sequence (TTGACA), the -10 site (TACAAT) at the upper 37th position with a gap of 17 bp from the -35 site is replaced with a consensus sequence (TATAAT), and the TAT sequence at the 3' end of the spacer site (17 bp) is replaced with TGT;

[0148] 5) PaprEsigA5 (SEQ ID NO: 26, hereinafter 'PsigA5') in which the -35 site (TCTACT) at the upper 37th position of PaprE is replaced with a consensus sequence (TTGACA), the AA sequence at the 5' end of the spacer site (19 bp) is deleted, the TAT sequence at the 3' end of the spacer site (19 bp) is replaced with TGA, and the -10 site (TACAAT) having a gap of 17 bp from the -35 site at the upper 37th position as a result of the deletion of the spacer site (19 bp) is replaced with a consensus sequence (TATAAT);

[0149] 6) PaprEsigA6 (SEQ ID NO: 27, hereinafter 'PsigA6') in which the -35 site (TCTACT) at the upper 37th position of PaprE is replaced with a consensus sequence (TTGACA), the AA sequence at the 5' end of the spacer site (19 bp) is deleted, the TAT sequence at the 3' end of the spacer site (19 bp) is replaced with TGC, and the -10 site (TACAAT) having a gap of 17 bp from the -35 site at the upper 37th position as a result of the deletion of the spacer site (19 bp) is replaced with a consensus sequence (TATAAT);

[0150] 7) PaprEsigA7 (SEQ ID NO: 28, hereinafter 'PsigA7') in which the -35 site (TCTACT) at the upper 37th position of PaprE is replaced with a consensus sequence (TTGACA), the AA sequence at the 5' end of the spacer site (19 bp) is deleted, the TAT sequence at the 3' end of the spacer site (19 bp) is replaced with TGG, and the -10 site (TACAAT) having a gap of 17 bp from the -35 site at the upper 37th position as a result of the deletion of the spacer site (19 bp) is replaced with a consensus sequence (TATAAT).

[0151]

[0152] The above PaprE-based promoter mutants were constructed by inducing partial mutations through site-directed mutagenesis using pDG1730_PaprE_protease as a template DNA. The primers used for inducing partial mutations are shown in Table 3 below.

[0153]

[0154]

[0155] Example 3. Production of protease-expressing strains based on PaprE and PaprE mutants (PaprE*)

[0156] The pDG1730_PaprE(PaprE*)_protease vector constructed in Examples 1 and 2 was digested with speI to prepare linear DNA. The prepared linear DNA was transformed into the Bacillus subtilis LB700 strain, and insertion into the amyE site of the expression cassette was induced through homologous recombination. The strain in which the target gene was inserted was obtained by selecting colonies resistant to spectinomycin. Finally, the insertion of the target gene was confirmed by detecting a band of approximately 1,700 bp through colony PCR using the primers in Table 4 below, and then sequencing.

[0157] Primer name sequence (5'→3') Sequence number Seq_genome_△amyE_Seq_FCAAGTGGCTGCGGTTTATGGTG13seq_sigA_2_RGTACGGGTTTCCACCAATAATTGC14

[0158]

[0159] Example 4. Comparison of transcriptional activity of PaprE and PaprE mutant (PaprE*)

[0160] We evaluated whether PaprE mutants function as promoters and, if so, whether substitution of each component of PaprE or optimization of the spacer region length affects transcriptional activity as follows.

[0161] Among the promoter expression strains produced in Example 3, the wild-type PaprE expression strain, PsigA1 expression strain, PsigA2 expression strain, PsigA3 expression strain, and PsigA4 expression strain were cultured in LB medium at 37°C overnight, and then inoculated at 1% in 25 ml titer medium (10 g / l Glucose, 15 g / l CSL, 20 g / l Yeast extract, 2 g / l MgCl2, 2 g / l NaSO4, 2 g / l (NH4)2SO4, 1.5 g / l K2HPO4), and cultured at 37°C and 200 rpm for 24 hours. The amount of protease expression was measured using Suc-AAPF-pNA Kinetic Assay. After 24 hours of incubation, the culture solution was centrifuged to obtain a supernatant containing the enzyme. 10 μl of the supernatant diluted in buffer solution and 190 μl of 0.5 mM Suc-AAPF-pNA substrate dissolved in buffer solution were mixed and reacted in a 96-well plate at 25°C. The degree of substrate degradation was measured by comparing the degree of color development by measuring the absorbance at 410 nm using a microplate reader (Biotek, Synergy HTX).

[0162] Promoter transcription activity comparison Promoter enzyme activity (unit / ml) Activity Non-wild type PaprE (control) 0.061 PsigA 1 5.99 108 PsigA 2 11.41 206 PsigA 3 5.42 98 PsigA 4 7.42 134

[0163] As shown in Table 5, PsigA1, a mutant in which the -35 site (TCTACT) at the 37th position upstream of PaprE was substituted with a consensus sequence (TTGACA), the TAT sequence at the 3' end of the spacer region (19 bp) was substituted with TGT, and the -10 site (TACAAT) was substituted with a consensus sequence (TATAAT), showed a 108-fold increase in activity compared to the wild-type promoter, and PsigA2, a mutant in which the AA sequence at the 5' end of the spacer region (19 bp) was deleted in addition to the mutations of PsigA1, showed a 206-fold increase in activity compared to the wild-type promoter. Therefore, it was confirmed that substitution of the -35 site, the 3' end of the spacer region, and the -10 site increased the transcriptional activity of the promoter. In addition, when the 5'-terminal AA of the spacer region was deleted to optimize the spacer length from 19 bp (PsigA1) to 17 bp (PsigA2), the activity ratio increased by approximately 91%, indicating that optimization of the spacer region length is an additional factor that increases the transcriptional activity of the promoter. Meanwhile, in the case of PsigA1, where the -35 and -10 sites were designated based on the top 37 positions, the transcriptional activity of the promoter was confirmed to be improved by approximately 11% compared to PsigA3, where the -35 and -10 sites were designated based on the top 35 positions, indicating that the position of the promoter affects the transcriptional activity, and that designating each site based on the top 37 positions is advantageous in increasing the transcription efficiency.

[0164] PsigA3, a mutant in which the -35 site (TACTAA) at the top 35 positions was substituted with a consensus sequence (TTGACA) and the -10 site (TACAAT) at the top 37 positions was substituted with a consensus sequence (TATAAT), showed a 98-fold increase in activity compared to the wild-type promoter. In addition to the mutations in PsigA3, PsigA4, a mutant in which the TAT sequence at the 3' end of the spacer region was substituted with TGT, showed a 134-fold increase in activity compared to the wild-type promoter, indicating that the substitution of the TAT sequence at the 3' end of the spacer region is an additional factor that increases the transcriptional activity of the promoter.

[0165] Thus, it was found that i) the location of the promoter (starting at position 37 or 35 above the aprE transcription start site), ii) whether there is a consensus sequence substitution at the -35 site, iii) whether there is a consensus sequence substitution at the -10 site, and iv) optimization of the spacer region length have a significant impact on the magnitude of the promoter's transcriptional activity. Finally, it was confirmed that the promoter PsigA2, in which the -35 site (TCTACT) at the upper 37th position of Bacillus subtilis PaprE was replaced with a consensus sequence (TTGACA), the AA sequence at the 5' end of the spacer region (19 bp) was deleted, the TAT sequence at the 3' end of the spacer region (19 bp) was replaced with TGT, and the -10 site (TACAAT) with a gap of 17 bp from the -35 site at the upper 37th position as a result of the deletion of the spacer region (19 bp) was replaced with a consensus sequence (TATAAT), showed the most remarkable increase in transcriptional activity, showing a transcriptional activity that was more than 200 times higher than that of the PaprE wild type.

[0166]

[0167]

[0168] Example 5. Comparison of transcriptional activity by substituting the TAT sequence at the 3' end of the spacer region.

[0169] In the above-described Example 4, it was confirmed that the promoter PsigA2, in which the -35 site (TCTACT) at the upper 37th position of Bacillus subtilis PaprE was replaced with a consensus sequence (TTGACA), the AA sequence at the 5' end of the spacer site (19 bp) was deleted, the TAT sequence at the 3' end of the spacer site (19 bp) was replaced with TGT, and the -10 site (TACAAT) having a gap of 17 bp from the -35 site at the upper 37th position as a result of the deletion of the spacer site (19 bp) was replaced with a consensus sequence (TATAAT), showed the most significantly increased transcriptional activity.

[0170] In addition, the transcriptional activities of mutants (PsigA5, PsigA6, and Psig7, respectively) in which i) the -35 site (TCTACT) at the upper 37th position was replaced with a consensus sequence (TTGACA), ii) the AA sequence at the 5' end of the spacer region (19 bp) was deleted, and iii) the -10 site (TACAAT), which has a gap of 17 bp from the -35 site at the upper 37th position as a result of the deletion of the spacer region (19 bp), was replaced with a consensus sequence (TATAAT), but unlike in PsigA2, iv) the TAT sequence at the 3' end of the spacer region (19 bp) was replaced with TGA, TGC, or TGG instead of TGT were additionally compared.

[0171] Promoter transcription activity was measured in the same manner as in Example 4 for the PsigA2 expression strain, PsigA5 expression strain, PsigA6 expression strain, and PsigA7 expression strain among the promoter expression strains produced in Example 3.

[0172] Promoter (TAT substitution sequence) Activity ratio compared to PsigA2 PsigA2 (TGT) 1 PsigA5 (TGA) 1.14 PsigA6 (TGC) 0.44 PsigA7 (TGG) 1.02

[0173] As a result, as shown in Table 6 above, when the TAT sequence at the 3' end of the spacer region (19 bp) was replaced with TGA instead of TGT (PsigA5), transcriptional activity was increased, and when replaced with TGG (PsigA7), transcriptional activity was slightly increased. On the other hand, when the TAT sequence at the 3' end of the spacer region (19 bp) was replaced with TGC (PsigA6), transcriptional activity was confirmed to decrease compared to PsigA2. However, considering that PsigA2 exhibits a transcriptional activity more than 200 times higher than that of the wild type, it was confirmed that PsigA6 still has high activity.

[0174] In this way, when i) the -35 site (TCTACT) at the upper 37th position of Bacillus subtilis PaprE was replaced with a consensus sequence (TTGACA), ii) the AA sequence at the 5' end of the spacer site (19 bp) was deleted, iii) the -10 site (TACAAT) having a gap of 17 bp from the -35 site at the upper 37th position as a result of the deletion of the spacer site (19 bp) was replaced with a consensus sequence (TATAAT), and iv) the TAT sequence at the 3' end of the spacer site (19 bp) was replaced with TGT, TGA, TGG, or TGC, it was confirmed that it had high transcriptional activity, and in particular, when the TAT sequence at the 3' end of the spacer site (19 bp) was replaced with TGT, TGA, or TGG, it was confirmed that it had a more significantly increased transcriptional activity.

Claims

1. A promoter mutant in which the -35 site of the Bacillus subtilis aprE promoter is substituted with TTGACA, the -10 site is substituted with TATAAT, and a spacer site exists between the -35 site and the -10 site, the length of the spacer site is 19 bp or 17 bp, TAT at the 3' end of the spacer site is substituted with TGN, and N is A, T, G, or C.

2. A promoter variant in the first paragraph, wherein the -35 site is located 37 bp upstream or 35 bp upstream of the aprE transcription start site (TSS).

3. A promoter variant in the second paragraph, wherein the -35 site is located 37 bp upstream of the aprE transcription start site.

4. A promoter mutant in the first paragraph, wherein the -35 site is located 37 bp upstream from the aprE transcription start site, and the spacer site is a 19 bp-long sequence existing between the -35 site and the -10 site, in which the AA sequence at the 5' end is deleted.

5. A promoter variant according to claim 1, wherein the promoter variant comprises any one nucleotide sequence selected from the group consisting of nucleotide sequences of SEQ ID NO: 22 to SEQ ID NO:

28.

6. An expression cassette comprising the promoter variant of paragraph 1 and the target gene.

7. The promoter variant of paragraph 1; or A microorganism comprising an expression cassette comprising the above promoter variant and a target gene.

8. A microorganism according to claim 7, wherein the microorganism is a gram-positive bacterium.

9. A microorganism according to claim 8, wherein the Gram-positive bacteria is any one Gram-positive bacteria selected from the group consisting of Bacillus subtilis, Bacillus licheniformis, Bacillus megaterium, Bacillus cereus, Bacillus thuringiensis, Bacillus brevis, and bacteria of the genus Lactobacillus or Panibacillus.

10. A method for producing a target product, comprising a step of culturing the microorganism of clause 7.

11. A method for producing a target product, further comprising a step of recovering the target product from a medium or microorganism according to the culture in accordance with paragraph 10.

Citation Information

Patent Citations

  • Methods for producing hyaluronan in a recombinant hostcell

    KR100879908B1

  • Mutant apre promoter

    KR1020020073497A

  • Bacillus strain for increased protein production

    WO2010144283A1

  • Industrial fermentation process for bacillus using defined medium and trace element feed

    WO2020169564A1

Cited By

  • DNA molecule for expressing alkaline protease, promoter and application

    CN121575012A