Engineered cell capable of highly expressing secretory protein and use thereof
By integrating a polynucleotide encoding a secretory protein into the B2M locus of mesenchymal stem cells and combining it with an exogenous signal peptide, the problem of unsatisfactory expression of exogenous therapeutic factors by mesenchymal stem cells in the existing technology is solved, efficient and stable secretory protein expression is achieved, and the tumor treatment effect is improved.
Patent Information
- Application Number
- PCT/CN2024/113685
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-04-10
- Filing Date
- 2024-08-21
- Publication Date
- 2025-10-16
AI Technical Summary
In the existing technology, mesenchymal stem cells have difficulty in efficiently expressing exogenous therapeutic factors, especially during the site-specific integration process, where genes are difficult to integrate into the cell genome, are not expressed after integration, or are expressed at unsatisfactory levels, resulting in poor results in tumor treatment.
The polynucleotide encoding the secretory protein was site-specifically integrated into the B2M locus through a non-viral method and combined with an exogenous signal peptide to construct engineered cells to achieve high expression of the secretory protein. The CRISPR/Cas system was used for site-specific integration and the expression cassette was optimized to increase the expression level.
The engineered cells have been enabled to efficiently and stably express secretory proteins in tumor treatment, thereby improving the therapeutic effect, reducing the risk of immunogenicity, and ensuring the uniformity and safety of the product.
Smart Images

Figure CN2024113685_16102025_PF_FP_ABST
Abstract
Description
Engineered cell with high expression of secretory protein and application thereof
[0001] Cross-reference to related applications
[0002] The present application claims priority to the prior application with the patent application number 2024104255554, the title of which is "Engineered cell with high expression of secretory protein and application thereof", filed on April 10, 2024 with the State Intellectual Property Office of China. The prior application is incorporated herein by reference in its entirety. TECHNICAL FIELD
[0003] The present application relates to the field of DNA recombination technology, and in particular to an engineered cell with high expression of secretory protein and application thereof. BACKGROUND
[0004] In recent years, cell gene therapy has become one of the research hotspots in the medical industry, and is expected to become an effective treatment strategy for tumors, metabolism, autoimmune diseases and other diseases. Among them, the treatment method based on mesenchymal stem cells has been widely studied.
[0005] Mesenchymal stem / stromal cells (MSCs) are adult multipotent stem cells, which are important members of the stem cell family, have self-renewal ability and multi-directional differentiation potential, and can be differentiated into various tissue cells such as fat, bone, and cartilage in vitro. Mesenchymal stem cells are widely available and can be obtained from bone marrow, umbilical cord blood, and adipose tissue and other adult tissues. At the same time, MSCs have low expression of MHC class I molecules on the surface, and do not express MHC class II molecules and CD86, CD40 and other costimulatory molecules, so MSCs have low immunogenicity, which lays the foundation for their use as a cell preparation that can be applied heterogeneously. Another important feature of MSCs is their tumor homing ability, which allows them to migrate to tumor sites and penetrate tumor stroma and microenvironments. This feature may be related to the presence of receptors on the surface of MSCs that can bind to chemotactic factors in the tumor microenvironment (such as CXCL12 / CXCR4, etc.). Many studies have shown that native MSCs can inhibit tumor cell growth and induce apoptosis in the treatment of liver cancer, leukemia, and Kaposi's sarcoma, but using MSCs alone to fight diseases such as tumors is far from ideal therapeutic effect. Based on the characteristics of mesenchymal stem cells, loading exogenous therapeutic factors into MSCs for disease treatment has become a relatively effective treatment method.
[0006] Secretory proteins are a common type of exogenous therapeutic factors, such as coagulation factors, immune checkpoint inhibitors, TNF-alpha inhibitors, insulin, etc. The most representative target among the immune checkpoints well known to those skilled in the art is programmed death-protein 1 (PD-1). PD-1, also known as CD279, is a type I transmembrane glycoprotein with a molecular weight of about 55 kDa, which is expressed on activated T cells, natural killer cells, B cells, macrophages, dendritic cells and monocytes. The ligands of PD-1 include PD-L1 and PD-L2, of which PD-L1 is the main ligand, and PD-L1 is widely expressed in T cells, dendritic cells, macrophages, vascular endothelial cells and keratinocytes in normal organisms. After PD-1 binds to the ligand, it can inhibit T cell proliferation, activation and cytokine secretion, thereby inhibiting the immune response and effectively maintaining immune stability in normal organisms. However, PD-L1 is also widely expressed in various tumor cells, and tumor cells can use the immune suppression function of PD-1 / PD-L1 to achieve immune escape by binding to PD-1 molecules on the surface of lymphocytes. Therefore, by administering an antibody-based inhibitor to competitively bind to PD-1, thereby blocking the binding of PD-1 to PD-L1 on the surface of tumor cells, the tumor microenvironment can be reversed to relieve the immune suppression state of T cells, dendritic cells, macrophages, NK cells, and restore the endogenous anti-tumor immune response.
[0007] At present, there are few studies on the site-specific integration of genes expressing secretory proteins into mesenchymal stem cells for combination therapy. In addition, there are problems such as difficulty in integrating exogenous genes into the cell genome, no expression after integration, and unsatisfactory expression after integration during the site-specific integration process, thereby making it difficult to apply to actual tumor treatment.
[0008] SUMMARY
[0009] To solve the above problems, the present application provides a safer and more effective engineered cell treatment strategy for diseases, which constructs an engineered cell site-specifically integrated with a polynucleotide encoding a secretory protein by a non-viral method, and combines with an exogenous signal peptide to obtain a therapeutic engineered cell with high expression of secretory proteins. The polynucleotide encoding the secretory protein is preferably site-specifically integrated into the B2M locus.
[0010] In a first aspect of the present application, an engineered cell site-specifically integrated with a nucleic acid encoding a secretory protein is provided.
[0011] In an embodiment of the present application, the engineered cell comprises an engineered mesenchymal stem cell, and / or an engineered IPSC cell and a cell derived therefrom.
[0012] In one embodiment of the application, the engineered mesenchymal stem cell is derived from an adult cell or a stem cell.
[0013] In one preferred embodiment of the application, the engineered mesenchymal stem cell is derived from a pluripotent stem cell, more preferably the pluripotent stem cell is selected from an induced pluripotent stem cell (iPSC).
[0014] In one preferred embodiment of the application, the engineered mesenchymal stem cell is derived from bone marrow, fat, muscle, heart, umbilical cord blood or umbilical cord.
[0015] In one embodiment of the application, the derived cell comprises a CAR-iNK, a dopaminergic neural precursor cell, a CAR-iMac, a cardiomyocyte, an endothelial progenitor cell, an iNK cell, a retinal cell, a neural cell, an osteoblast, a hematopoietic stem cell, a blood cell, a B cell, a fibroblast, a hair cell, a monocyte, a macrophage, a Treg cell, a kidney progenitor cell, a lung epithelial cell, an endothelial cell, a megakaryocyte, a smooth muscle cell, a skeletal muscle cell, a chondrocyte, a bone cell, an adipocyte, a hepatocyte, an islet cell, a keratinocyte, a melanocyte, a dendritic cell.
[0016] In one embodiment of the application, the site of the site-directed integration is located at the B2M locus.
[0017] In one embodiment of the application, the secreted protein comprises a dipeptide, an oligopeptide, a polypeptide or a short protein. The secreted protein is preferably composed of less than 2500 amino acids, preferably less than 2400, 2000, 1500, 1000, 900, 800, 700, 600, 500, 400, 300, 200 amino acids.
[0018] In one embodiment of the application, the secreted protein comprises one or several of an immune checkpoint inhibitor, a TNF-a inhibitor, a GLP-1 receptor agonist, a growth hormone, a coagulation factor, an interleukin, an insulin, an interferon, a tumor necrosis factor, an enzyme, a growth factor.
[0019] In one embodiment of the application, the immune checkpoint is selected from one or more of PD1, PD-L1, CTLA-4, TIGIT, LAG-3, TIM-3, preferably PD1.
[0020] In one preferred embodiment of the application, the immune checkpoint inhibitor is an antibody or an antibody fragment, preferably a full-length antibody or a single-chain antibody.
[0021] In a further preferred embodiment of the application, the immune checkpoint inhibitor is a full-length antibody or a single-chain antibody against PD1. Preferably, the immune checkpoint inhibitor is a single-chain antibody against PD1.
[0022] In one embodiment of the present application, the TNF-a inhibitor is selected from the group consisting of TNF-a receptor or TNF-a antibody, such as etanercept, adalimumab, secukinumab, infliximab, golimumab, pexidartinib.
[0023] In one embodiment of the present application, the interleukin is selected from the group consisting of interleukin family members, such as IL-2, IL-7, IL-10, IL-11, IL-12, IL-15, IL-23 and IL-24.
[0024] In one embodiment of the present application, the tumor necrosis factor family member is selected from the group consisting of, for example, TNF, LTA, LTB, FASLG, TNFSF8, TNFSF9, TNFSF10, TNFSF11, TNFSF12, TNFSF13, TNFSF14, TNFSF15, TNFSF18 and EDA, TRAIL.
[0025] In one embodiment of the present application, the interferon is selected from the group consisting of, for example, interferon a, b, g.
[0026] In one embodiment of the present application, the GLP-1 receptor agonist is a polypeptide GLP-1 receptor agonist selected from the group consisting of, for example, exenatide, albiglutide, dulaglutide, and other polypeptide GLP-1 receptor agonists with or without chemical modification.
[0027] In one embodiment of the present application, the growth hormone is preferably natural or recombinant human growth hormone (rhGH), which is divided into short-acting recombinant human growth hormone or long-acting recombinant human growth hormone.
[0028] In one embodiment of the present application, the coagulation factor is selected from the group consisting of, for example, prothrombin complex, fibrinogen, antifibrinolytic, recombinant factor VIIa, recombinant factor VIII, recombinant factor IX, recombinant factor X.
[0029] In one embodiment of the present application, the growth factor is selected from the group consisting of, for example, epidermal growth factor (EGF), platelet-derived growth factor (PDGF), fibroblast growth factor (FGF), GM-CSF, G-CSF.
[0030] In an embodiment of the present application, the enzyme is selected from the group consisting of lipase, amylase, trypsin, chymotrypsin, lysozyme, urokinase, L-asparaginase, glutaminase, neuraminidase, and the like.
[0031] In an embodiment of the present application, the nucleic acid encoding the secretory protein is not limited to a functional region, and can include at least one of a coding region, a leader sequence, a signal peptide sequence, an exon, an intron, and an expression cassette.
[0032] In an embodiment of the present application, the nucleic acid encoding the secretory protein is an expression cassette encoding the secretory protein.
[0033] In an embodiment of the present application, the expression cassette includes a promoter sequence, a signal peptide sequence, a nucleic acid sequence encoding the secretory protein, which are operably linked. In an embodiment of the present application, the expression cassette includes a promoter sequence, a signal peptide sequence, a nucleic acid sequence encoding the secretory protein, a selection marker or a tag, which are operably linked. In an embodiment of the present application, the expression cassette includes a promoter sequence, a signal peptide sequence, a nucleic acid sequence encoding the secretory protein, a selection marker or a tag, a Poly(A) tail, which are operably linked.
[0034] In an embodiment of the present application, the signal peptide is an exogenous signal peptide. In an embodiment of the present application, the signal peptide is used to direct secretion of the secretory protein.
[0035] In an embodiment of the present application, the signal peptide is a strong secretory signal peptide suitable for the secretory protein, and the strong secretory signal peptide suitable for one secretory protein can be one or a combination of more than one.
[0036] Alternatively, the strong secretory signal peptide is selected from the group consisting of secrecon, Gaussia luciferase (Gluc), Mouse Ig Kappa, Human IgG V, Human IgK VIII, Ig heavy chain signal peptide 7 (H7), Ig kappa light chain signal peptide 1 (L1).
[0037] In an embodiment of the present application, the promoter sequence is located upstream of the nucleic acid sequence, and the promoter controls expression of the secretory protein.
[0038] In an embodiment of the present application, the promoter is selected from the group consisting of a CMV promoter, an EF1α promoter, an SV40 promoter, a CAG promoter, a PGK promoter, or a UBC promoter.
[0039] In one embodiment of the application, the selection marker is selected from, for example, ampicillin resistance (Ampr), chloramphenicol resistance (Camr), kanamycin resistance (Kanr), tetracycline resistance (Tetr), puromycin (Puro), G418, hygromycin beta (Hygr), Zeocin, Blasticidin.
[0040] In one embodiment of the application, the tag is selected from, for example, FLAG, His, GST, HA, c-Myc, HSV, V5, SUMO, eGFP / eCFP / eYFP / mCherry eGFP.
[0041] In one embodiment of the application, the engineered cell further comprises one or several of the following:
[0042] (1) expresses at least one of a chimeric antigen receptor, CD64, CD47, HLA-E or non-cleavable HLA-E, HLA-G or non-cleavable HLA-G;
[0043] (2) one or several MHC-I and / or MHC-II human leukocyte antigens are expressed under regulation; preferably, the MHC-I and / or MHC-II human leukocyte antigens are selected from one or several of HLA-A, HLA-B, HLA-C, HLA-DPA1, HLA-DPB1, HLA-DQA1, HLA-DQB1, HLA-DRA, B2M, TAP1, TAP2, LMP2, LMP7, TNFRSF1A, CD8B, CD8A, CCR7, CXCR6, IL2RA, GZMB, GNLY, CKB, P2RY6, ADCY2, CHRM1, ERAP1, ERAP2, Tapasin, CD74, HLA-DO, HLA-DM, CLIP, Cathepsins, RFX5, RFXAP, RFXANK, CIITA; more preferably, CIITA expression is regulated.
[0044] (3) CD54 and / or CD58 expression is regulated.
[0045] In one embodiment of the application, the regulated expression comprises no expression or reduced expression.
[0046] In one embodiment of the application, the engineered mesenchymal stem cell has a higher amount of secreted protein expression compared to a wild-type mesenchymal stem cell.
[0047] In one embodiment of the application, the engineered mesenchymal stem cell has a higher amount of secreted protein expression compared to a rDNA region site-specifically integrated mesenchymal stem cell.
[0048] In one embodiment of the present application, the engineered mesenchymal stem cell expresses a secreted protein at a rate of greater than 20 ng, preferably greater than 30 ng, preferably greater than 40 ng, preferably greater than 50 ng, preferably greater than 100 ng, preferably greater than 200 ng, preferably greater than 300 ng, preferably greater than 400 ng, preferably greater than 500 ng of secreted protein per 24 hours per one million mesenchymal stem cells.
[0049] In a second aspect of the present application, there is provided a method of producing the engineered cell described above, comprising introducing a nucleic acid encoding a secreted protein into a site of site-specific integration of the cell.
[0050] In one embodiment of the present application, the expression cassette encoding the secreted protein is introduced into the site of site-specific integration of the cell by a Meganuclease, Zinc-finger nuclease (ZFN), Transcription activator-like effector nuclease (TALEN) and / or CRISPER / Cas system; more preferably a CRISPER / Cas system.
[0051] In one embodiment of the present application, the expression cassette encoding the secreted protein is introduced into the site of site-specific integration of the cell by a targeting vector, sgRNA vector and / or nuclease or nuclease expression vector.
[0052] In one embodiment of the present application, the targeting vector comprises a 5' homology arm - expression cassette encoding the secreted protein - 3' homology arm.
[0053] In one embodiment of the present application, the 5' homology arm and 3' homology arm are homologous to sequences in the site of site-specific integration described above. In one embodiment of the present application, the 5' homology arm and 3' homology arm are homologous to sequences in the B2M locus.
[0054] In one embodiment of the present application, the 5' homology arm and 3' homology arm are 2-1000 bp in length, for example 2, 10, 20, 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000 bp in length.
[0055] In one embodiment of the present application, the 5' homology arm and 3' homology arm are homologous to sequences 2-1000 bp upstream and downstream of a PAM sequence in the site of site-specific integration.
[0056] In one embodiment of the present application, the expression cassette encoding the secreted protein is as described above.
[0057] In one embodiment of the present application, the sgRNA is used to bind to a nuclease and direct the nuclease to cleave a target gene fragment by recognising a PAM sequence of the target sequence.
[0058] In an embodiment of the present application, the sgRNA is partially or fully complementary to the target sequence. In an embodiment of the present application, the sgRNA is partially or fully complementary to the target sequence in the B2M locus.
[0059] In an embodiment of the present application, the nuclease comprises a Meganuclease, a Zinc-finger nuclease (ZFNs), a Transcription-activator-like effector nuclease (TALEN), a CRISPER / Cas system, etc., preferably a CRISPER / Cas system.
[0060] In an embodiment of the present application, the nuclease of the CRISPER / Cas system is selected from one or more of Cas12a, Cas12b, Cas13, Casl4, Cas9, CasX, CasY, C2c2, Casl, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, CaslO, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm1, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, and Csf4.
[0061] In an embodiment of the present application, the nuclease is used for PAM sequence-dependent recognition of the site of the site-directed integration and initiates DNA cleavage at a specific site 3bp upstream of the PAM sequence.
[0062] In an embodiment of the present application, the vector is a non-viral vector suitable for expression in mesenchymal stem cells, such as pUC, pET, pGEX, etc.
[0063] In an embodiment of the present application, the method comprises introducing a nucleic acid encoding a secretory protein into iPSCs cells for site-directed integration, followed by directed differentiation to obtain a derivative cell. In an embodiment of the present application, the derivative cell is an engineered mesenchymal stem cell (iMSC).
[0064] In an embodiment of the present application, the site-directed integration comprises double copy integration or single copy integration.
[0065] In an embodiment of the present application, the method of introduction is a non-viral method.
[0066] In an embodiment of the present application, the method of introduction is selected from vector transformation, transfection, heat shock, electroporation, transduction, microinjection.
[0067] In a third aspect, the present invention provides a preparation comprising the above-mentioned engineered cells and pharmaceutically acceptable excipients.
[0068] In one embodiment of the present invention, the excipients include a buffer selected from, for example, acetate, Tris, phosphate, citrate and other organic acids; an antioxidant including ascorbic acid and methionine; a preservative selected from, for example, octadecyldimethylbenzyl ammonium chloride, hexamethonium chloride, benzalkonium chloride, benzalkonium chloride, phenol, butylbenzyl alcohol, alkyl parabens, such as methyl or propyl parabens, catechol, resorcinol, cyclohexanol; a protein selected from, for example, serum albumin, gelatin or immunoglobulin; a hydrophilic polymer selected from, for example, polyethylene glycol. Pyrrolidone; amino acids such as glycine, glutamine, asparagine, histidine, arginine or lysine; monosaccharides, disaccharides and other carbohydrates selected from, for example, glucose, mannose or dextrin; chelating agents selected from, for example, EDTA; sugars selected from, for example, sucrose, mannitol, trehalose or sorbitol; surfactants selected from, for example, polysorbates; metal complexes selected from, for example, zinc protein complexes; non-ionic surfactants selected from, for example, Tween or polyethylene glycol (PEG); liposomes, albumin microspheres, polyesters, micelles, sustained-release matrices, etc.
[0069] In a fourth aspect, the present invention provides a pharmaceutical composition comprising the above-mentioned engineered cells.
[0070] In one embodiment of the present invention, the pharmaceutical composition further comprises other therapeutic agents, and the other therapeutic agents include antipyretics, antiasthmatics, antibiotics, antidepressants, antidiabetics, anti-inflammatory drugs, antitumor drugs, antianxiety drugs, immunomodulators, sedatives and hypnotics, antianginal drugs, antipsychotics, antimanics, antiarthritis drugs, antiarrhythmic drugs, antigout drugs, anticoagulants, thrombolytics, antifibrinolytics, hemorheology drugs, antiplatelet drugs, anticonvulsants, antiparkinsonian drugs, antihistamines, drugs for calcium regulation, antivirals, bronchodilators, hormones, lipid-lowering drugs, proteins, polypeptides, nucleic acids, antiulcer or antireflux drugs, antiemetics, diagnostic agents, and nutritional drugs. Among them, preferably, anti-tumor drugs are included, specifically including but not limited to paclitaxel and its derivatives, docetaxel, camptothecin and its derivatives, etoposide, teniposide, doxorubicin hydrochloride, cyclophosphamide, dactinomycin, bleomycin, daunomycin, doxorubicin, epirubicin, mitomycin, methotrexate, 5-fluorouracil, carboplatin, carmustine, lomustine, cisplatin, vinblastine, vincristine, tamoxifen, sulfamethoxazole, and phenylephrine.
[0071] In one embodiment of the present application, the one or more additional therapeutic agents are administered in combination with the engineered cells. The combination administration includes sequential administration in any order or at any interval, such that the two or more therapeutic agents exert their biological activities at the same time. Preferably, the combination administration produces a synergistic therapeutic effect.
[0072] In a fifth aspect of the present application, the engineered cells, the preparation, and the pharmaceutical composition are used for preparing a medicament for diagnosing, preventing, and treating diseases, including but not limited to cell proliferative diseases such as tumors, melanoma, non-small cell lung cancer, renal cell carcinoma, colorectal cancer, breast cancer, pancreatic cancer, head and neck cancer, and other solid tumors; hematological diseases such as leukemia, anemia, lymphoma, hemophilia, leukopenia, thrombocytopenia, angiogenesis disorders, Kaposi's sarcoma, and the like; autoimmune diseases such as Crohn's disease, ulcerative colitis, allergies, inflammatory bowel disease, arthritis, psoriasis, and respiratory inflammation, asthma, and organ transplant rejection, and the like; metabolic diseases such as diabetes, growth hormone deficiency, childhood growth retardation, and the like; infections including viral, bacterial, fungal, and parasitic infections such as hepatitis B, hepatitis B and C, and the like; digestive system diseases such as indigestion, pancreatic diseases, and the like; skin injuries such as wounds, burns, and the like.
[0073] In one embodiment of the present application, the medicament is administered via intravenous, intramuscular, intraperitoneal, intracerebrospinal, subcutaneous, intraspinal, intrathecal, oral, topical, or inhalation routes.
[0074] In a sixth aspect of the present application, the B2M locus is used for increasing the expression of a secretory protein by mesenchymal stem cells.
[0075] In a seventh aspect of the present application, a method for preparing a secretory protein is provided, which comprises expressing the secretory protein using the engineered cells.
[0076] In one embodiment of the present application, the secretory protein includes an immune checkpoint inhibitor, a TNF-α inhibitor, a GLP-1 receptor agonist, a growth hormone, a coagulation factor, an interleukin, an insulin, an interferon, a tumor necrosis factor, an enzyme, and a growth factor.
[0077] In an eighth aspect of the present application, a method for increasing the expression amount of a secretory protein is provided, which comprises culturing the engineered cells to obtain the secretory protein.
[0078] In one embodiment of the present application, the secretory protein includes an immune checkpoint inhibitor, a TNF-α inhibitor, a GLP-1 receptor agonist, a growth hormone, a coagulation factor, an interleukin, an insulin, an interferon, a tumor necrosis factor, an enzyme, and a growth factor. Beneficial effects
[0079] 1. In the embodiments of the present application, induced pluripotent stem cells (iPSCs) are used as the source of MSCs, a polynucleotide encoding a secretory protein is site-specifically integrated into the B2M locus of the iPSCs by a non-viral method, and the iPSCs are directionally differentiated in vitro and screened to obtain therapeutic iMSCs that can highly secrete the desired secretory protein. Compared with other integration sites, better integration and expression effects are achieved.
[0080] The technical solution in the embodiments of the present application uses a non-viral method, which overcomes the safety hazards of viral vector-mediated gene transfer methods, avoids the immunogenicity of viral vectors and the random integration of exogenous therapeutic genes into the MSCs genome, so as to avoid affecting the expression of exogenous therapeutic genes or the normal function of MSCs. Moreover, the random integration method will cause differences in exogenous therapeutic genes among different therapeutic cells, making it difficult to ensure the consistency of product quality. The exogenous therapeutic gene site-specifically integrated into the MSCs genome is preferably a secretory protein, which can continue to be maintained in the MSCs genome with multiple passages of MSCs cells and achieve long-term stable expression, thereby ensuring the sustained therapeutic effect of MSCs cells and reducing the medication cost of patients.
[0081] 2. In the specific embodiments of the present application, it is found through experiments that the effects of integrating the expression frame of a secretory protein into different gene sites are significantly different. The inventors have found a gene editing site suitable for the expression frame of a secretory protein, i.e., the B2M locus, through experiments.
[0082] In the embodiments of the present application, the expression frame of a secretory protein is site-specifically integrated into the B2M locus of mesenchymal stem cells, which overcomes the problem of being unable to integrate or difficult to achieve high expression after integration when the expression frame of a secretory protein is site-specifically integrated into other sites (such as AAVS1, CCR5, rDNA region, ROSA26, HTRP, H11, TCR, etc.). In particular, in some embodiments of the specific embodiments of the present application, the expression frame of a PD1 antibody is site-specifically integrated into the B2M locus of mesenchymal stem cells, which achieves excellent expression effects.
[0083] The mesenchymal stem cells prepared in some embodiments of the present application highly express coagulation factor F8, and one million mesenchymal stem cells can secrete up to 372.29 ng or more per 24 hours, which is much higher than the secretion amount of 0.59±0.11 ng / (10 6 cells per 24 hours) and 0.68±0.14 ng / (10 6 cells per 24 hours) achieved in the prior art ("Restoration of FVIII Function and Phenotypic Rescue in Hemophilia A Mice by Transplantation of MSCs Derived From F8-Modified iPSCs", Liyan Qiu, et al, Frontiers in Cell and Developmental Biology, Volume 9, 2021.2.11), which also integrates the F8 gene with a deleted B region into the mesenchymal stem cells, but the integration site is the rDNA region.
[0084] 3. In some embodiments of the present application, the scFv of the PD-1 blocking antibody (hereinafter referred to as aPD1-scFv) is integrated into the B2M locus of the iPSCs by a non-viral vector plasmid, and aPD1 scFv-iPSCs stem cells are obtained. Subsequently, through in vitro directed differentiation, aPD1 scFv-iMSCs that can highly secrete aPD1-scFv are obtained for the treatment of various tumors. This scheme combines the dual advantages of iMSCs and PD1 antibodies. iMSCs first migrate to the tumor site, and then stably and persistently secrete PD1 antibodies at high levels, allowing the PD1 antibodies to be secreted at high density in the tumor site, increasing the concentration and effective dose of the antibodies, thereby improving the cellular immunotherapy effect of MSCs and providing a safer, more effective, and more uniform MSCs tumor treatment strategy. BRIEF DESCRIPTION OF DRAWINGS
[0085] FIGS. 1-2 are targeting diagrams for integrating anti-human PD1 scFv into the B2M locus and the rDNA region locus in Example 1.
[0086] FIGS. 3-4 are PCR identification of aPD1 scFv site-specific integration of aPD1 iPSCs.
[0087] FIGS. 5-6 are sequencing diagrams for detecting site-specific integration PCR products.
[0088] FIG. 7 is a morphological diagram of site-specific integration aPD1 iPSCs.
[0089] Figure 8 is a Western Blot detecting the difference in protein expression level of rDNA aPD1 iPSCs and B2M aPD1 iPSCs.
[0090] Figure 9 is a PCR detecting the B2M gene editing.
[0091] Figure 10 is the sequencing result of the PCR product.
[0092] Figure 11 is the morphology of aPD1 iMSCs obtained by differentiation of two strains of aPD1 iPSCs.
[0093] Figure 12 is the flow cytometry result of the surface markers of two strains of aPD1 iMSCs.
[0094] Figure 13 is the identification result of the multi-lineage differentiation potential of two strains of aPD1 iMSCs.
[0095] Figure 14 is a Western Blot detecting the protein expression of aPD1 iMSCs.
[0096] Figure 15 is an ELISA detecting the aPD1 protein level secreted in the supernatant of aPD1 iMSCs.
[0097] Figure 16 is a flow cytometry analysis result of the HLA-ABC protein expression on the cell membrane surface of aPD1 iMSCs.
[0098] Figure 17 is a flow cytometry detecting the binding of aPD1-FLAG secreted by aPD1 iMSCs to human PD1+ 293T cells.
[0099] Figure 18 is a flow cytometry detecting the blocking of human PD-L1 binding to human PD1+ 293T cells by aPD1-FLAG secreted by aPD1 iMSCs.
[0100] Figure 19 is aPD1 iMSCs promoting the killing effect of human PBMC on HCC827 cell line.
[0101] Figure 20 is a graph showing the trend of body weight change of mice after injection of aPD1 iMSCs.
[0102] Figure 21 is a graph showing the trend of subcutaneous tumor volume growth of mice after injection of aPD1 iMSCs.
[0103] Figure 22 is a schematic diagram of the targeting of Gluc-anti-TNF-α scFv and IgG V-anti-TNF-α scFv integrated into the B2M locus in Example 8.
[0104] Figure 23 is an agarose gel showing the PCR identification of anti-TNF-α scFv integrated iPSCs across the downstream homology arm in Example 9.
[0105] Figure 24 is a sequencing result of downstream junction PCR product of anti-TNF-a scFv integrated iPSCs in Example 9.
[0106] Figure 25 is a result of ELISA detection of protein secretion level of anti-TNF-a scFv iPSCs in Example 9.
[0107] Figure 26 is a result of ELISA detection of protein secretion level of anti-TNF-a scFv iMSCs in Example 10.
[0108] Figure 27 is a schematic diagram of targeting to integrate BDDF8-CO expression cassette into B2M locus in Example 11.
[0109] Figure 28 is a result of PCR identification of BDDF8-CO iPSCs with BDDF8-CO expression cassette integrated at the targeted site in Example 11.
[0110] Figure 29 is a sequencing result of PCR product of targeted integration in Example 11.
[0111] Figure 30 is a result of PCR detection of B2M gene editing in Example 11.
[0112] Figure 31 is a sequencing result of PCR product of B2M gene editing in Example 11.
[0113] Figure 32 is a result of ELISA detection of FVIII protein level secreted from BDDF8-CO iMSCs supernatant.
[0114] Figure 33 is a result of automatic coagulation analyzer detection of FVIII protein coagulation activity secreted from BDDF8-CO iMSCs supernatant.
[0115] Figure 34 is a schematic diagram of targeting to integrate GH-HyFc expression cassette into B2M locus in Example 16.
[0116] Figure 35 is a result of PCR identification of GH-HyFc iPSCs with GH-HyFc expression cassette integrated at the targeted site in Example 16.
[0117] Figure 36 is a sequencing result of PCR product of targeted integration in Example 16.
[0118] Figure 37 is a result of PCR detection of B2M gene editing in Example 16.
[0119] Figure 38 is a sequencing result of PCR product of B2M gene editing in Example 16.
[0120] Figure 39 is a result of ELISA detection of GH-HyFc protein level secreted from GH-HyFc iMSCs supernatant.
[0121] Figure 40 is a result of The number of Nb2-11 cells was detected by luminescence cell viability detection kit to verify the function of GH-HyFc protein secreted in the supernatant of GH-HyFc iMSCs.
[0122] Figure 41 is a schematic diagram of targeting integration into the B2M locus in Example 21.
[0123] FIG42 is an agarose gel image of the PCR identification of GLP-1RA integrated iPSCs across upstream homology arms in Example 22.
[0124] FIG43 is an agarose gel image of the PCR identification of GLP-1RA integrated iPSCs across downstream homology arms in Example 22.
[0125] Figure 44 is a diagram showing the sequencing results of PCR detection of B2M gene editing products in Example 22.
[0126] Figure 45 is a graph showing the results of PCR detection of B2M gene editing in Example 22.
[0127] Figure 46 is a diagram showing the sequencing results of PCR detection of B2M gene editing products in Example 22.
[0128] FIG. 47 shows the level of GLP-1RA protein secreted in the supernatant of GLP-1RA iMSCs detected by ELISA in Example 24.
[0129] Definitions and Explanations of Terms
[0130] Unless otherwise indicated, the definitions of groups and terms in this specification and claims, including definitions used as examples, exemplary definitions, preferred definitions, definitions in tables, and definitions of specific compounds in the Examples, may be arbitrarily combined and coupled with one another. The group definitions and compound structures resulting from such combinations and couplings should be understood to be within the scope of this specification and / or claims.
[0131] The term "antibody" is used herein in the broadest sense to refer to a protein that contains an antigen binding site and encompasses natural and artificial antibodies of various structures, including but not limited to monoclonal antibodies, polyclonal antibodies, multispecific antibodies (e.g., bispecific antibodies), single-chain antibodies, whole antibodies, and antibody fragments.
[0132] iPSCs or ipscs (Induced pluripotent stem cells) refer to induced pluripotent stem cells. iMSCs or iMSCs refer to mesenchymal stem cells differentiated from induced pluripotent stem cells.
[0133] aPD1 and anti-PD1 have the same meaning herein, both refer to antibodies targeting PD1 immune checkpoint. aPD1-FLAG refers to a PD1 antibody with FLAG detection tag for facilitating detection of the PD1 antibody.
[0134] Single-chain antibody (scFv): a light chain variable region and a heavy chain variable region of an antibody are connected by a hinge region, which retains the ability to bind antigens.
[0135] Programmed cell death receptor 1 (PD-1): a member of the immunoglobulin superfamily receptor, PD-1 can inhibit the proliferation of immune cells such as T cells and the secretion of cytokines after binding with its ligand PD-L1 / PD-L2. In the tumor microenvironment, the binding of PD-1 and ligand can weaken the function of tumor-specific T cells, leading to the failure of complete elimination of tumors.
[0136] Tumor necrosis factor alpha (TNF-α): a cytokine that plays a core regulatory role in the processes of inflammatory response, apoptosis and immune regulation. On the one hand, it can resist infection and prevent tumor formation. On the other hand, it is closely related to the progression of various diseases, such as malignant tumors, rheumatoid arthritis (RA), psoriatic arthritis, diabetes, etc. In RA, excessive production of TNF-α promotes the development of the disease and joint destruction, so anti-TNF-α drugs are widely used in the treatment of rheumatoid arthritis, thereby reducing inflammatory response, relieving joint symptoms and improving joint destruction. sTNFRII in the specific embodiments of the present application is a tumor necrosis factor receptor, and anti-TNF-α scFv is a single-chain antibody against tumor necrosis factor alpha, both of which can treat diseases caused by excessive TNF-α.
[0137] FVIII refers to coagulation factor VIII, which is a protein encoded by the F8 gene. Coagulation factors are proteins involved in the blood clotting process, including coagulation factors I, II, III, IV, V, VI, VII, VIII, IX, X, XI, XII, etc., among which coagulation factor VIII (i.e., F8 or FVIII) is a common type, and mutations in the F8 gene cause defects in the structure of FVIII molecules or a decrease in the content of FVIII, which cannot play a normal coagulation function. The F8 gene encodes a precursor polypeptide containing 2351 amino acids, which is processed and modified to form a mature F8 protein containing 2332 amino acids. The FVIII structure can be divided into several different functional regions, including three A regions, one B region and two C regions. The A region contains a calcium ion binding site and plays a role in the endogenous coagulation pathway. The B region is highly glycosylated and has little to do with FVIII activity. The deletion of most of the B region does not affect the activity of FVIII. The B domain deletion F8 (BDD-F8) also has certain clinical treatment effects. In the specific embodiments of the present application, the coagulation factor F8 includes but is not limited to full-length F8, B domain deletion F8 or other mutant F8, and optionally can also be an antibody that can achieve the purpose of coagulation.
[0138] B domain deletion F8 (BDD-F8): The complete F8 gene encodes full-length coagulation factor VIII (FVIII), and full-length FVIII has A1, A2, B, A3, C1 and C2 six domains. The B structure is not essential for the coagulation catalytic activity of FVIII. The B domain deletion F8 gene is relatively small and easy to integrate, and also encodes FVIII with coagulation activity.
[0139] Glucagon-like peptide-1 (GLP-1) is a 30 / 31 amino acid-containing peptide hormone released by intestinal L cells after nutrient consumption. Glucagon-like peptide-1 acts on GLP-1 receptor (GLP-1R) to lower blood glucose by enhancing glucose-dependent insulin secretion, inhibiting glucagon secretion and slowing gastric emptying. In general, glucagon-like peptide-1 receptor agonists (GLP-1RAs) can activate GLP-1 receptors to inhibit glucagon secretion, thereby achieving the effects of reducing blood sugar and losing weight. The existing technology uses a viral method to express GLP-1RA in cells, which has high risk and poor cell quality uniformity. In the specific embodiments of the present application, a non-viral method is used to stably express GLP-1RA in cells by site-specific integration of a polynucleotide sequence encoding GLP-1RA at a specific site in the cell genome. Preferably, the above-mentioned cells are mesenchymal stem cells. The GLP-1RA secretion amount of each million mesenchymal stem cells per 24 hours is more than 20 nanograms.
[0140] Human Growth Hormone is a 22kDa peptide hormone secreted by the anterior pituitary of the human body, containing 191 amino acids, with two disulfide bonds and four alpha-helices. Human Growth Hormone directly binds to specific cell surface receptors and indirectly acts through Insulin-like Growth Factor 1 (IGF-1) to promote bone, internal organ and whole body growth.
[0141] GH refers to Growth hormone, which is a polypeptide hormone secreted by the anterior pituitary of the human body, and its main function is to promote growth and cell regeneration. In a specific embodiment of the present application, GH with Hybrid Fc (GH-HyFc): GH has a short half-life, Hybrid Fc is a mixture of part IgD and part IgG4 Fc, and GH with Hybrid Fc has a longer half-life.
[0142] GLP-1RA refers to Glucagon-Like Peptide-1 Receptor Agonists. This class of drugs regulates blood glucose levels for the treatment and research of type 2 diabetes by mimicking the effects of Glucagon-Like Peptide-1 (GLP-1). GLP-1RA drugs are mainly used for the treatment of type 2 diabetes, helping to control blood glucose, and also have weight loss effects. Common GLP-1RA drugs include Liraglutide, Exenatide, Semaglutide, etc. These drugs are usually administered by subcutaneous injection, and due to their good metabolic regulation, they are also used in the treatment of obesity and other metabolic diseases.
[0143] Signal peptide: a short peptide chain of 5-30 amino acids that guides the transfer of a newly synthesized polypeptide chain to the secretory pathway; it is located at the N-terminus of a secreted protein and consists of three parts: the N-terminus is a positively charged basic amino terminal end; the middle is the main functional region, which is a hydrophobic sequence formed by neutral amino acids; the C-terminus is a negatively charged processing region, which is the cleavage site of the signal peptide. The newly synthesized protein is guided into the lumen of the endoplasmic reticulum by the signal peptide, and the signal peptide sequence is removed under the action of signal peptide enzyme, and then the protein continues to be translated, at the same time, folded and modified. The signal peptide in the specific embodiment of the present application is selected from the commonly used signal peptides in the art, but the present inventors have found through research that for different proteins, the secretion level will show different effects when different signal peptides are selected. The signal peptides selected in the specific embodiment of the present application are all strong secretion signal peptides suitable for secretory proteins, and a strong secretion signal peptide suitable for a secretory protein can be one or a combination of multiple, as long as the desired expression amount is achieved. Alternatively, the strong secretion signal peptide is secrecon, Gaussia luciferase (Gluc), Mouse Ig Kappa, Human IgG V, Human IgK VIII, Ig heavy chain signal peptide 7 (H7), Ig kappa light chain signal peptide 1 (L1). In addition, according to the different types of specific proteins, the signal peptide can also be selected from other types of signal peptides known in the art, as long as it can achieve the desired expression amount.
[0144] Endogenous signal peptide: a signal peptide derived from the corresponding gene (protein) itself in the organism.
[0145] Exogenous signal peptide: a signal peptide that is not the signal peptide of the target gene (protein) itself in the organism, but is an artificially added signal peptide in the process of gene expression. The exogenous signal peptide includes any signal peptide that can promote the secretion of a secretory protein from a cell. For example, a signal peptide from an immunoglobulin (such as IgG heavy chain or IgG-Kappa light chain), a cytokine (such as interleukin-2 (IL-2) or CD33), a serum albumin (such as HSA or albumin), Azurocidin preproprotein, luciferase, trypsinogen (such as trypsinogen or trypsinogen), or other signal peptides that can effectively secrete proteins from cells.
[0146] B2M locus: refers to the location of the Beta-2-Microglobulin (b2 microglobulin) gene in the human genome. The B2M locus is located on chromosome 15, which encodes the b2 microglobulin (Beta-2-Microglobulin), a small protein that normally binds to major histocompatibility complex (MHC I) molecules on the surface of most human cells. In one embodiment of the present application, the B2M locus is the coordinates NC_000015.10:44711391-44721145 of the human genome of human reference genome version 38 (GRCh38 / hg38). In one embodiment of the present application, the site for site-directed integration of the B2M locus is NC_000015.10:44711496-44711616, NC_000015.10:44712633-44712758, NC_000015.10:44714254-44714367, NC_000015.10:44716166-44716285, NC_000015.10:44717129-44717251, or NC_000015.10:44718022-44718131.
[0147] Vector: refers to a polynucleotide or other molecule capable of transferring at least one nucleic acid fragment into a cell. A vector can optionally contain components / elements that mediate maintenance of the vector and / or achieve its intended purpose (e.g., an origin of replication, an antibiotic resistance gene, a multiple cloning site, and / or a promoter / enhancer element operably linked to achieve expression of a gene of interest). Vectors include plasmids, bacteriophages, plant or animal viruses.
[0148] Expression cassette: refers to a polynucleotide sequence that includes an operably linked sequence that can be expressed in a particular host. For example, a polynucleotide sequence for expression in a prokaryote includes, but is not limited to, a promoter, an operator, a ribosome binding site, a sequence encoding a gene of interest. A polynucleotide sequence for expression in a eukaryote includes, but is not limited to, a promoter, an enhancer, a termination signal, a sequence encoding a gene of interest, and a polyadenylation signal (as well as other sequences).
[0149] Promoter: a promoter is a region of DNA that generally lies upstream (5' end) of a nucleic acid that enhances transcription of the nucleic acid. A promoter can suitably activate or repress a nucleic acid operably linked thereto. A promoter contains specific sequences that are recognized by transcription factors. Transcription factors bind to the promoter DNA sequence, leading to the recruitment of RNA polymerase, the enzyme that synthesizes RNA from the coding region of the nucleic acid.
[0150] Introduction: refers to the incorporation of a nucleic acid into a cell using any method known in the art, including but not limited to transfection, transformation, and transduction. For example, viral vector transfection; plasmid vector transformation; electroporation (Fromm et al. (1986) Nature 319:791-3); lipofection (Feigner et al. (1987) Proc. Natl. Acad. Sci. USA 84:7413-7); microinjection (Mueller et al. (1978) Cell 15:579-85); Agrobacterium-mediated transfer (Fraley et al. (1983) Proc. Natl. Acad. Sci. USA 80:4803-7); direct DNA uptake; and microprojectile bombardment (Klein et al. (1987) Nature 327:70), among others.
[0151] Operably linked: a first nucleic acid sequence is operably linked with a second nucleic acid sequence when the first nucleic acid sequence is in a functional relationship with the second nucleic acid sequence. For instance, a promoter is operably linked to a coding sequence when the promoter influences the transcription or expression of the coding sequence. Nucleic acid sequences that are operably linked are generally contiguous and, where necessary to join two protein coding regions, in the same reading frame.
[0152] Nucleic acid: refers to a polymeric form of nucleotides (i.e., ribonucleotides, deoxyribonucleotides, and / or modified versions of either type of nucleotide). As used herein, "nucleic acid," "nucleic acid molecule," "polynucleotide," and "nucleotide sequence" are synonymous. A nucleotide sequence or polynucleotide can include double- stranded DNA or single-stranded DNA (i.e., the sense strand of a double-stranded DNA or the antisense strand of a double-stranded DNA) or RNA. Nucleic acids include any topological conformation, including single-stranded, double-stranded, partially duplexed, triplexed, hairpinned, circularized, and padlocked conformations. Nucleic acids can include either or both naturally occurring and modified nucleotides. Modifications include, but are not limited to, labeling, methylation, substitution of one or more naturally occurring nucleotides with an analog, and internucleotide modifications such as methylphosphonates, phosphotriesters, phosphoramidates, and carbamates; such as phosphorothioates and phosphorodithioates. In addition, a fragment of a polynucleotide refers to a portion of a polynucleotide that encodes a polypeptide that provides substantially the same function as the polypeptide encoded by the entire polynucleotide. Examples of mutants of a particular polynucleotide sequence include naturally occurring allelic variants, artificial mutants, and polynucleotide sequences obtained by deletion, substitution, addition and / or insertion of one or more nucleotides in the particular polynucleotide sequence. It is understood that such fragments and / or mutants of a particular polynucleotide sequence encode polypeptides having substantially the same function as the polypeptide encoded by the original particular polynucleotide sequence.
[0153] site-specific integration: refers to the insertion or integration of all or part of a desired sequence (e.g., a target sequence) into a desired site or locus (e.g., a target sequence) in the genome. Methods of site-specific integration are well known to those skilled in the art. For example, calcium phosphate-mediated integration: by combining an exogenous gene with a calcium phosphate carrier (such as CaP04), the exogenous gene is integrated into the cell using an electric shock or ultraviolet light activated method. Transposon-mediated integration: using a transposon (such as Tn7, Tn5) to integrate an exogenous gene into the cell chromosome. CRISPR / Cas9-mediated integration: using the CRISPR / Cas9 system to site-specifically integrate an exogenous gene into the cell chromosome. Direct DNA ligation: using a DNA ligase to directly ligate an exogenous gene to a specific location in the cell chromosome. In some embodiments, site-specific integration is performed using the CRISPR / Cas9 system.
[0154] homology arm: refers to a sequence that is substantially identical or substantially complementary to a sequence at or near a target site (or target sequence) in the genome. In some embodiments, a homology arm is at least about 2, at least about 3, at least about 4, at least about 5, at least about 6, at least about 7, at least about 8, at least about 9, at least about 10, at least about 20, at least about 25, at least about 30, at least about 35, at least about 40, at least about 45, at least about 50, at least about 55, at least about 60, at least about 65, at least about 70, at least about 75, at least about 80, at least about 85, at least about 90, at least about 95, at least about 100, at least about 150, at least about 200, at least about 250, at least about 300, at least about 350, at least about 400, at least about 450, at least about 500, at least about 600, at least about 700, at least about 800, at least about 900, at least about 1000 or more nucleotides. A homology arm can integrate a target sequence into a target site (or target sequence) in the genome via homologous recombination, where the homology arm is substantially identical or substantially complementary to a sequence at or near the target site (or target sequence) in the genome. In some embodiments, a 5' homology arm is homologous to a sequence present in the nucleotide sequence of SEQ ID NO: 1 and a 3' homology arm is homologous to a sequence present in the nucleotide sequence of SEQ ID NO: 2.
[0155] PAM sequence: "Protospacer Adjacent Motif". PAM sequence is located next to the target sequence recognized and cleaved by CRISPR RNA-guided Cas protein (such as Cas9). PAM sequence is usually a short nucleic acid sequence, which is not directly recognized by CRISPR RNA-guided Cas protein, but as an essential auxiliary sequence, it helps Cas protein to determine the binding position on the target sequence. In some embodiments, the PAM sequence is 5'-NGG-3', and the N is A, T, C or G. Preferably, the PAM sequence is TGG.
[0156] Target sequence: is the region for being recognized and inserted with foreign DNA sequence by integrase, is the binding site of integrase, and is usually near the coding region or promoter of gene. The target sequence can be a naturally occurring sequence, or a sequence designed or synthesized by human. In some embodiments, the target sequence is located upstream of the PAM sequence by n bases, and n is a natural number. In some embodiments, n = 1-20 bp.
[0157] "sgRNA", "guide RNA" or "sgRNA of the present application" are used interchangeably, all refer to sgRNA targeting the target sequence in the site-specific integration site. In some embodiments, the sgRNA is sgRNA targeting the target sequence in the B2M gene. In some embodiments, the sgRNA is the nucleotide sequence shown in SEQ ID NO: 3. DETAILED DESCRIPTION
[0158] The technical solutions of the present disclosure will be further described in detail below in combination with specific examples. It should be understood that the following examples are only illustratively described and explained the present disclosure, and should not be interpreted as limiting the scope of protection of the present disclosure. Any technology realized based on the above description of the present disclosure is covered within the scope of the present disclosure.
[0159] Unless otherwise specified, the raw materials and reagents used in the following examples are commercially available or can be prepared by known methods.
[0160] Example 1 Construction of anti-PD1 scFv-carrying targeting vector and nucleofection of iPSCs
[0161] 1. Construction of anti-PD1 scFv-carrying targeting vector
[0162] First, five target loci were selected: AAVS1, B2M, CCR5, CIITA, and rDNA regions, and corresponding anti-PD1 scFv targeting vectors were constructed. CRISPR / Cas9 gene editing tools were used to site-specifically integrate the anti-human PD1 scFv sequence into the AAVS1, B2M, CCR5, or CIITA loci, respectively. TALENickase editing tools were used to site-specifically integrate the anti-human PD1 scFv sequence into the rDNA region. Using the targeting vector for the B2M locus as an example, the main components and the site-specific integration process are shown in Figure 1. The main components of the rDNA region anti-human PD1 scFv targeting vector and the process of combined site-specific integration are shown in Figure 2. A 1531-bp stretch from site 4533 upstream to site 6064 downstream of site 5468 of the human rDNA transcription region served as the homology arm sequence. The upstream homology arm was 935 bp long, and the downstream homology arm was 596 bp long. The screening gene NEO was located between the two homology arms to assist in the selection of site-specific integration clones (see prior art document: IL24 gene targeting in the ribosomal gene region of human iPSCs and its anti-tumor effect on differentiated MSCs, Liu Bo, graduation thesis, Central South University, 2017: 19-25; the TALENickase editing tool used in the specific embodiments of the present invention was constructed with reference to this prior art document). The targeting vector sequence was synthesized by Sangon Biotech (i.e., Sangon Biotech (Shanghai) Co., Ltd.), and the endotoxin-free target plasmid was obtained for subsequent experiments.
[0163] After screening for suitable sgRNAs, approximately 600 bp upstream and downstream of the PAM site were used as upstream and downstream homology arms. The aPD1 scFv was driven by the EF1α promoter and a FLAG tag was added for detection.
[0164] The nucleotide sequence of the sgRNA used in the CRISPR / Cas9 gene editing tool in the specific embodiment of the present invention is as follows:
[0165] AAVS1 sgRNA: GTCCCCTCCACCCCACAGTG (SEQ ID NO: 4)
[0166] B2M sgRNA: GGCCGAGATGTCTCGCTCCG (SEQ ID NO: 3)
[0167] CCR5 sgRNA: GACTATGCTGGCCGCCCAGT (SEQ ID NO: 5)
[0168] CIITA sgRNA: GAGATTGAGCTCTACTCAGG (SEQ ID NO: 6)
[0169] The sgRNAs were ligated to PX330 plasmid (originated from Addgene) to form CRISPR / Cas9 gene editing tool plasmids for each site.
[0170] The homology arm nucleotide sequences of the targeting vectors for different sites in the embodiments of the present application are as follows:
[0171] AAVS1 LHA: (SEQ ID NO: 7)
[0172] AAVS1 RHA: (SEQ ID NO: 8)
[0173] B2M LHA: (SEQ ID NO: 1)
[0174] B2M RHA: (SEQ ID NO: 2)
[0175] CCR5 LHA: (SEQ ID NO: 9)
[0176] CCR5 RHA: (SEQ ID NO: 10)
[0177] CIITA LHA: (SEQ ID NO: 11)
[0178] CIITA RHA: (SEQ ID NO: 12)
[0179] The homology arm nucleotide sequences of the targeting vectors for different sites in the embodiments of the present application are as follows:
[0180] rDNA LHA: (SEQ ID NO: 13)
[0181] rDNA RHA: (SEQ ID NO: 14)
[0182] The amino acid sequence of aPD1 scFv (originated from WO2018 / 020476A1) used in the embodiments of the present application is as follows:
[0183] Heavy chain variable region: (SEQ ID NO: 15)
[0184] Hinge region: (SEQ ID NO: 16)
[0185] Light chain variable region: (SEQ ID NO: 17)
[0186] The nucleotide sequence of aPD1 scFv (derived from WO2018 / 020476A1) used in the embodiments of the present application is as follows:
[0187] Heavy chain variable region: (SEQ ID NO: 18)
[0188] Hinge region: (SEQ ID NO: 19)
[0189] Light chain variable region: (SEQ ID NO: 20)
[0190] In addition, the aPD1 scFv can also adopt the following amino acid sequence (derived from Keytruda monoclonal antibody):
[0191] Heavy chain variable region: (SEQ ID NO: 21)
[0192] Hinge region: (SEQ ID NO: 22)
[0193] Light chain variable region: (SEQ ID NO: 23)
[0194] The nucleotide sequence corresponding to the aPD1 scFv (derived from Keytruda monoclonal antibody) is as follows:
[0195] Heavy chain variable region: (SEQ ID NO: 24)
[0196] Hinge region: (SEQ ID NO: 25)
[0197] Light chain variable region: (SEQ ID NO: 26)
[0198] The amino acid sequence of the FLAG tag is: DYKDDDDK; (SEQ ID NO: 27)
[0199] The nucleotide sequence of the FLAG tag is: GACTACAAGGACGACGACGACAAG. (SEQ ID NO: 28)
[0200] SP is a signal sequence, and the amino acid sequence thereof is: DMRVPAQLLGLLLLWLRGARC; (SEQ ID NO: 29)
[0201] The nucleotide sequence of the SP signal sequence is: (SEQ ID NO: 30)
[0202] 2. Targeting vector nucleo-transferring iPSCs carrying anti-PD1 scFv
[0203] The nucleo-transferring method for AAVS1, B2M, CCR5, CIITA, and rDNA region is as follows:
[0204] (1) The well-conditioned iPSCs to be targeted are inoculated in a 6-well plate coated with Matrigel (Corning), and mTeSR TM Plus culture medium is used for daily medium replacement;
[0205] (2) When the cell confluence is 80%-90%, the targeting is prepared, and 2 hours before the targeting, the cells are replaced with mTeSR TM Plus medium containing 10 μM Y-27632 (Stem Cell), and the cells are placed in an incubator for continued culture;
[0206] (3) After 2 hours of medium replacement, the culture medium is aspirated, 1 mL of DPBS is added for gentle washing, which is repeated twice, and then 1 mL of TrypLE TM Express is added, and the cells are placed in an incubator for 37°C digestion for 3 minutes;
[0207] (4) The digestion solution is aspirated, and the cells are blown into a single cell suspension with the culture medium, which is collected in a 15 mL centrifuge tube. The cell concentration is counted using a hemocytometer, and a suspension containing 1 million cells is taken according to the counted concentration. The cells are centrifuged at 1000 rpm and room temperature for 5 minutes, and are prepared for nucleo-transferring;
[0208] (5) The ThermoFisher Neon nucleo-transferrer and the Neon TM transfection system 100 μL kit (ThermoFisher, #MPK10096) are prepared at the same time. The nucleo-transferring tube is installed in the base, 3 ml of buffer E2 is added, and program 14 is selected for standby;
[0209] (6) 100 uL of buffer R is used to resuspend the centrifuged cells, which are transferred to a sterile EP tube, and the nucleo-transferring plasmid is added. The EP tube is mixed to prepare for standby;
[0210] (7) Take out the reagent kit matched pipette and tip, push the pipette to the bottom, insert the tip tightly, and then suck 100 uL mixed cytoplasmic plasmid suspension;
[0211] (8) Put the pipette + tip into the nucleic acid transfer tube and clamp tightly, and click "start" to perform nucleic acid transfer;
[0212] (9) Take out the pipette + tip, slowly drop the cell suspension into the culture medium, add Y-27632 to the hole plate at a final concentration of 10 μM, gently shake the cells, and place them in the incubator for culture.
[0213] (10) The nucleic acid transferred cells are cultured in mTeSR TM Plus (Stemcell, #05825) with daily medium replacement;
[0214] (11) After the cells normally proliferate, aspirate the culture medium, add 1 mL DPBS and gently rinse, repeat twice, then add 1 mL TrypLE TM Express (Gibco, #12604-021), and place in the incubator at 37°C for 3 minutes;
[0215] (12) Aspirate the digestion solution, blow the cells into a single cell suspension with culture medium, collect into a 15 mL centrifuge tube, count using a hemocytometer, and according to the counted concentration, take an appropriate amount of cell suspension, centrifuge at 1000 rpm at room temperature for 5 min, and take 300 cells for single cell inoculation;
[0216] (13) Inoculate the cells in a 6 cm dish coated with Matrigel in advance, add 3 mL Clone R (Stemcell, #05888) culture medium, gently shake the cells, and place them in the incubator for culture;
[0217] (14) After about 6-8 days of culture, when the single cell clones grow to the size of the 10x field of view under the microscope, use a small tip to cut the clones into small pieces and aspirate them into a 48-well plate coated with Matrigel for culture. When the picked single clones reach 80%-90% confluence, they are subcultured for expansion, and DNA is extracted for single clone site-specific integration identification. The positive clones are expanded for further culture and freezing.
[0218] Example 2 Identification of iPSCs single clone after nucleic acid transfer by PCR
[0219] 1. Cross-upstream and downstream homologous arm PCR identification
[0220] (1) using the extracted iPSCs monoclonal gDNA as a template, respectively using the primer LHA-F / R crossing the upstream homologous arm region, the primer RHA-F / R crossing the downstream homologous arm region, for AAVS1, B2M, CCR5, CIITA, if it is a single clone of site-specific integration, a product with a length of about 1100bp can be amplified by PCR. For rDNA region, if it is a single clone of site-specific integration, a product with a length of about 1600bp can be amplified by PCR.
[0221] The primer nucleotide sequence used in the embodiment of the present application is:
[0222] AAVS1 LHA-F: gccattgtcactttgcgctgc (SEQ ID NO: 31)
[0223] AAVS1 LHA-R: gggaaccacacacggcacttac (SEQ ID NO: 32)
[0224] AAVS1 RHA-F: aagagcctgatcttcagcgcc (SEQ ID NO: 33)
[0225] AAVS1 RHA-R: ggcatgagatggtggacgagg (SEQ ID NO: 34)
[0226] B2M LHA-F: tagagggcgctggaagctctaa (SEQ ID NO: 35)
[0227] B2M LHA-R: gggaaccacacacggcacttac (SEQ ID NO: 32)
[0228] B2M RHA-F: aagagcctgatcttcagcgcc (SEQ ID NO: 33)
[0229] B2M RHA-R: gcaaagcacataaagtccttggcac (SEQ ID NO: 36)
[0230] CCR5 LHA-F: aattagcttggtgtggtggcg (SEQ ID NO: 37)
[0231] CCR5 LHA-R: gggaaccacacacggcacttac (SEQ ID NO: 32)
[0232] CCR5 RHA-F: aagagcctgatcttcagcgcc (SEQ ID NO: 33)
[0233] CCR5 RHA-R: gtccgtgtcacaagcccaca (SEQ ID NO: 38)
[0234] CIITA LHA-F: gtcaggatatttgaggtatccacatttggg (SEQ ID NO: 39)
[0235] CIITA LHA-R: gggaaccacacacggcacttac (SEQ ID NO: 32)
[0236] CIITA RHA-F: aagagcctgatcttcagcgcc (SEQ ID NO: 33)
[0237] CIITA RHA-R: gggtaggtcgtttcacctctctaaacc (SEQ ID NO: 40)
[0238] rDNA LHA-F: cctgagaaacggctaccaca (SEQ ID NO: 41)
[0239] rDNA LHA-R: gaactgcttccttcacgacat (SEQ ID NO: 42)
[0240] (2) The PCR system is shown in Table 1:
[0241] Table 1 PCR system
[0242] (3) The PCR cycle conditions are as follows:
[0243] (4) The PCR products are subjected to agarose gel electrophoresis to observe whether there is a target band;
[0244] (5) The cells with the upstream identification of the target band are selected, the PCR process is repeated, and the product is sequenced.
[0245] AAVS1, B2M, CCR5, CIITA each site respectively pick 96 iPSCs monoclonal for expansion culture and extraction of genomic DNA (gDNA), using the primer LHA-F / R across the upstream homologous arm region, the primer RHA-F / R across the downstream homologous arm region for PCR amplification identification. In the rDNA region targeting experiment, a total of 10 G418 resistant clones were picked, of which 5 product fragment sizes were about 1600bp (Figure 3). The PCR products with correct fragment size were sequenced to confirm that the product sequence was consistent with the expected (Figure 5), which proved that the site-specific integration was successful, and 5 rDNA aPD1 iPSCs were obtained. Among them, the iPSCs monoclonal at AAVS1, CCR5, CIITA three sites were identified by PCR, and it was confirmed that no iPSCs clones with site-specific integration of anti-PD1 scFv were obtained. Two iPSCs clones at B2M site were amplified by PCR to obtain the corresponding size products (Figure 4), and the sequencing identification showed that the product sequence matched the theoretical sequence (Figure 6). Two B2M-anti-PD1 scFv iPSCs with site-specific integration were obtained by PCR identification, and the clone morphology is shown in Figure 7. The two iPSCs are named aPD1 iPSC-1 and aPD1 iPSC-2. Thus, under the same operating conditions, the gene expressing anti-PD1 scFv was not integrated into AAVS1, CCR5, CIITA three sites, while B2M site and rDNA region were successfully site-specifically integrated.
[0246] 2. Western Blot detection of aPD1-FLAG protein expression level of rDNA aPD1 iPSCs and B2M aPD1 iPSCs
[0247] (1) Collect iPSCs cells, add 100 μL cell lysis solution, lyse on ice for 30 min;
[0248] (2) After lysis, transfer the cell lysate to an EP tube and lyse on ice; centrifuge at 4°C 12000g for 10 min;
[0249] (3) Transfer the supernatant after centrifugation to a new EP tube, and then use the Pierce BCA Protein Assay Kit of Thermo company for BCA protein quantification; TM
[0250] (4) Prepare SDS-PAGE gel: use the SDS-PAGE gel rapid preparation kit of Biyun Tian company to prepare 12% separation gel and 4% concentration gel;
[0251] (5) Loading: Place the prepared SDS-PAGE gel in the electrophoresis tank, and prepare fresh 1x running buffer and add it to the electrophoresis tank. Add the prepared protein sample to the well in order. Run at a constant current of 80V for 30min, then at 120V for 60min;
[0252] (6) Transfer: Prepare 1x transfer buffer in advance and pre-cool it in a -20°C refrigerator. Cut off the concentrated gel, measure the length and width of the separation gel, and cut out a PVDF membrane of the same size with a ruler. Soak the membrane in methanol for 5min, then balance it in the transfer buffer for 20min. Then, according to the "sandwich sequence", black tank end: sponge pad + filter paper + separation gel + membrane + filter paper + sponge pad: red tank end. The whole process is carried out in the transfer buffer, and bubbles are continuously removed. Run at a constant voltage of 252mA for 90min. This process is carried out on ice;
[0253] (7) Blocking: After the transfer is completed, soak the membrane with TBST from top to bottom, then move it to 5% skimmed milk for 1h of shaking bed blocking;
[0254] (8) Antibody incubation: Dilute the primary antibody with TBST or 5% skimmed milk to the appropriate concentration, pour it into the small box, and incubate it at 4°C overnight. Decolorize with TBST at room temperature, and wash it on the shaking bed for 3 times, 10min each time;
[0255] (9) Absorb the primary antibody, add the secondary antibody in the box, and incubate it on the shaking bed for 1h. Wash it with TBST for 3 times, 10min each time;
[0256] Developing.
[0257] The results of the development are shown in Figure 8. No aPD1-FLAG protein expression was detected in the cell lysate of the rDNA aPD1 iPSCs. The cell lysate of the B2M aPD1 iPSCs showed obvious aPD1-FLAG protein secretion. The intracellular aPD1-FLAG protein expression level of B2M aPD1 iPSC-1 was higher than that of B2M aPD1 iPSC-2. Therefore, although the anti-PD1 scFv expression gene was successfully integrated in the rDNA region, the rDNA region could not express aPD1-FLAG protein, and no protein expression was found. The B2M site was successfully integrated, and obvious protein expression was observed.
[0258] 3. PCR identification of B2M gene locus editing
[0259] (1) Using extracted aPD1 iPSC-1, aPD1 iPSC-2 gDNA as template, using primer B2M-F / R to perform PCR amplification, unedited blank iPSCs can obtain 513bp size product, while for site-specific integration of aPD1 iPSC-1, aPD1 iPSC-2, if both copies of B2M locus are site-specific integration of anti-PD1 scFv, no 513bp size product is produced, if only one copy is integrated with anti-PD1 scFv, 513bp size product can still be obtained. The editing of B2M locus of the two iPSCs is detected by combining the PCR product size and sequencing results.
[0260] The primer nucleotide sequence used in this example is:
[0261] B2M-F: gaagtcctagaatgagcgccc (SEQ ID NO: 43)
[0262] B2M-R: gagatccagccctggactagc (SEQ ID NO: 44)
[0263] (2) The PCR system is shown in Table 2:
[0264] Table 2 PCR system
[0265] (3) PCR cycle conditions:
[0266] (4) The PCR products were subjected to agarose gel electrophoresis to observe whether there were target bands;
[0267] (5) The cells with target bands in the upstream identification were selected, the PCR process was repeated, and the products were sequenced.
[0268] As shown in Figure 9, aPD1 iPSC-1 did not obtain 513bp size product, and this clone was double copy integration of anti-PD1 scFv. aPD1 iPSC-2 produced 513bp size product, and the sequencing result (Figure 10) showed that multiple base deletions occurred at the B2M site, indicating that this clone was single copy integration of anti-PD1 scFv, and the other copy was only edited and did not perform anti-PD1 scFv integration.
[0269] Example 3 aPD1 iPSCs are directionally differentiated into aPD1 iMSCs and MSC characteristics are detected
[0270] 1. aPD1 iPSCs are directionally differentiated into aPD1 iMSCs
[0271] (1) Select iPSCs with good growth status, rinse 1-2 times with 1 mL DPBS, then add an appropriate amount of TrypLE TM Express, and incubate for 3 min in a cell incubator. Resuspend the iPSCs in mTeSR TM Plus to prepare a single-cell suspension. Take about 200,000 cells and inoculate them into one well of a Matrigel-coated 12-well plate. Add mTeSR TM Plus medium containing 10 μM Y-27632, and culture. Use STEMdiff TM Mesenchymal Progenitor Kit (Stemcell, #05240) for subsequent differentiation.
[0272] (2) Culture for 1-2 days until the iPSCs reach a confluence of 40-50% (preferably no more than 50%). Discard the culture medium and wash twice with DPBS. Add 1 mL of STEMdiff TM -ACF Mesenchymal Induction Medium to start differentiation, and record P0 generation.
[0273] (3) Use STEMdiff TM -ACF Mesenchymal Induction Medium for continuous 3 days, and change the medium every day.
[0274] (4) On the 4th day, discard the medium and gently rinse twice with DPBS. Add 1 ml of 15-25°C pre-warmed MesenCult TM -ACF Medium, and add 1 μL of 10 mM Y-27632.
[0275] (5) On the 5th day, change the fresh MesenCult TM -ACF Medium for continuous culture, and add 1 μL of 10 mM Y-27632. Meanwhile, use MesenCult TM -ACF Attachment Substrate to coat a 6-well plate, and place it in a cell incubator for overnight coating.
[0276] (6) On the 6th day, discard the medium and wash the well twice with DPBS. Digest the cells with TrypLE TM Express at room temperature for 90 s, discard the TrypLE TM Express, and use 2 ml of complete MesenCult TM -ACF Medium to blow up the cells, and inoculate them all into a previously coated MesenCultTM - Add 2 μL of 10 μM Y-27632 into each well of a 6-well plate of ACF Attachment Substrat, and note P1 generation;
[0277] (7) When P1 generation cells are confluent, subculture them into a 10 cm dish of pre-coated MesenCult TM - Continue to use complete MesenCult in each well of a 6-well plate of ACF Attachment Substrat, and note P2 generation; TM - Continue to use ACF Medium and add Y-27632 at a final concentration of 10 μM, and culture for 2-3 days (the cell culture time should be reached, otherwise the cells will be aged when subcultured into a 10 cm dish). Then subculture them into a 10 cm dish of pre-coated MesenCult
[0278] (8) Change the medium of P2 generation cells with fresh complete MesenCult every day TM - Continue to use ACF Medium and add Y-27632 at a final concentration of 10 μM, and culture for 2-3 days (the cell culture time should be reached, otherwise the cells will be aged when subcultured into a 10 cm dish). Then subculture them into a 10 cm dish of pre-coated MesenCult
[0279] (9) When P3 generation cells are 90% confluent, subculture them into a 6 cm dish of pre-coated MesenCult TM - Continue to use ACF Attachment Substrat in a 6 cm dish, and note P4 generation; TM - Continue to use ACF Attachment Substrat in a 6 cm dish, and note P4 generation;
[0280] (10) P4 generation cells will slowly proliferate in a 6 cm dish, and the medium can be changed every other day, i.e., complete MesenCult containing Y-27632 at a final concentration of 10 μM TM - Continue to use ACF Medium, and about 5 days later, the cells in a 6 cm dish will be 90% confluent;
[0281] (11) P4 generation cells can be subcultured for expansion when they are 90% confluent, and note P5 generation;
[0282] (12) After P5 generation, the cells will proliferate faster, and can be frozen or expanded as needed;
[0283] (13) P6 generation and later cells can be used for subsequent identification.
[0284] As shown in FIG. 11, aPD1 iMSC-1 was obtained by directional differentiation of aPD1 iPSC-1, and aPD1 iMSC-2 was obtained by directional differentiation of aPD1 iPSC-2. Both iMSCs had typical MSC morphology, exhibiting a fibroblast-like morphology significantly different from that of iPSCs.
[0285] 2. Flow cytometry detection of iMSC surface markers
[0286] (1) Aspirate the culture medium of iMSCs, wash twice with DPBS, and use TrypLE TM Express room temperature to digest cells for 3 min, resuspend with an appropriate amount of complete culture medium, and transfer to a 15 mL centrifuge tube, centrifuge at 175 g for 5 min;
[0287] (2) After aspirating the supernatant, wash the cells once with DPBS, and centrifuge at 175 g for 5 min again;
[0288] (3) After centrifugation, aspirate the supernatant, add 100 μL of 5% FBS-DPBS to resuspend the cells, then add BV421-CD45, BV421-HLA-DR, APC-CD105, BV421-CD34, PE-Cy7-CD90, FITC-CD44, and Precp-Cy5.5-CD73, each 5 μL, and add 0.1 μL of dead and live dye APC-Cy7 at the same time, incubate at room temperature for 20 min in the dark;
[0289] (4) After incubation, add 2 volumes of 5% FBS-DPBS to terminate incubation, centrifuge at 175 g for 5 min, discard the supernatant, resuspend the cells with 150 μL of 5% FBS-DPBS per tube, and detect by flow cytometry within 1 h.
[0290] As shown in FIG. 12, the flow cytometry analysis results of aPD1 iMSC-1 and aPD1 iMSC-2 surface markers meet the ISCT identification standard, showing CD44+, CD73+, CD90+, CD105+, CD34- / CD45- / HLA-DR- characteristics.
[0291] 3. Identification of iMSCs multi-lineage differentiation potential
[0292] (1) Differentiate iMSCs into osteoblasts: use MesenCult Osteogenic Diff Kit (Stemcell, #05465) and follow the instructions. Seed iMSCs into a six-well plate at a density of about 3 x 10 5iMSCs were seeded into 6-well plates at a density of about 5 x 105cells per well. After the cell confluence reached 70%, the wells were washed twice with DPBS, and then 2 mL of MSC osteogenic differentiation medium was used for differentiation culture. The medium was replaced every 2 days. After 2 weeks of differentiation culture, the cells were stained and identified with alizarin red (Cyagen).
[0293] (2) Differentiation of iMSCs into adipocytes: MesenCult Adipogenic Diff Medium (Stemcell, #05412) was used according to the instructions. iMSCs were seeded into six-well plates at a density of about 3 x 105cells per well. After the cell confluence reached 100%, the MSC adipogenic differentiation medium was used for culture. The medium was replaced every 2 days. After 3 weeks of differentiation culture, the cells were stained and identified with oil red O (Cyagen). 5 5 (3) Differentiation of iMSCs into chondrocytes: MesenCult-ACF Chondro Diff Medium (Stemcell, #05455) was used according to the instructions. iMSCs were seeded into six-well plates at a density of about 5 x 105cells per well. After 24 h, the MSC chondrocyte differentiation medium was used for culture. The medium was replaced every 2 days. After 2 weeks of differentiation culture, the cells were stained and identified with alizarin blue (Cyagen).
[0294] The staining results are shown in Figure 13. aPD1 iMSC-1 and aPD1 iMSC-2 have the potential to differentiate into osteoblasts, adipocytes, and chondrocytes.
[0295] Example 4 Detection of aPD1 iMSC protein expression level
[0296] 1. Western Blot detection of aPD1-FLAG protein expression in aPD1 iMSC cell lysate
[0297] (1) Collect iMSC cells, add 100 μL cell lysate, and lyse on ice for 30 min;
[0298] (2) After lysis, transfer the cell lysate to an EP tube and lyse on ice; centrifuge at 4°C 12000g for 10 min;
[0299] (3) Transfer the supernatant after centrifugation to a new EP tube, and then use the Pierce BCA Protein Assay Kit from Thermo to perform BCA protein quantification; TM
[0300] (4) Calculate the protein concentration according to the standard curve, and then calculate the total protein amount of the sample.
[0301] (4) Preparation of SDS-PAGE gel: 12% separation gel and 4% stacking gel were prepared using the SDS-PAGE gel rapid preparation kit from Beyotime.
[0302] (5) Sample loading: Place the prepared SDS-PAGE gel in an electrophoresis tank and prepare fresh 1× running buffer. Add the prepared protein samples to the wells in order. Run at a constant current of 80 V for 30 min, then at 120 V for 60 min.
[0303] (6) Transfer: Prepare 1× transfer buffer in advance and place it in a -20℃ refrigerator to pre-cool. Cut off the concentrated gel, measure the length and width of the separation gel, and use a ruler to cut out PVDF membranes of the same size. Soak them in methanol for 5 minutes and then equilibrate them in transfer buffer for 20 minutes. Then follow the "sandwich sequence": black slot end: sponge pad + filter paper + separation gel + membrane + filter paper + sponge pad red slot end. The entire operation process is carried out in transfer buffer, and bubbles are constantly removed; constant pressure 252mA for 90 minutes. This process is carried out on ice.
[0304] (7) Blocking: After the transfer is completed, the membrane is soaked with TBST from top to bottom, and then moved to 5% skim milk for blocking on a shaker for 1 hour;
[0305] (8) Antibody incubation: Dilute the primary antibody to an appropriate concentration with TBST or 5% skim milk powder, pour into a small box, incubate at 4°C overnight, and wash three times with TBST on a shaker at room temperature for 10 min each time;
[0306] (9) Aspirate and discard the primary antibody, add the secondary antibody into the box, incubate on a shaker for 1 hour, and wash three times with TBST, each time for 10 minutes;
[0307] (10) Perform development.
[0308] 2. Western Blot Detection of B2M Protein Expression in aPD1 iMSCs Cell Lysate
[0309] The operation method is the same as step 1.
[0310] 3. Western Blot detection of aPD1-FLAG protein secretion in the supernatant of aPD1 iMSCs cells
[0311] (1) iMSCs supernatant was collected and thoroughly mixed with methanol and chloroform at a ratio of 4:4:1, followed by centrifugation at 13,000 g for 5 min.
[0312] (2) Discard the supernatant, leaving about 200 μl to avoid aspirating the protein precipitate;
[0313] (3) Add equal volume of 200ul methanol, gently invert to wash, stand for 5-10min, precipitate protein, centrifuge 13000g 5min;
[0314] (4) Discard the supernatant, open the cover, constant temperature dry heating instrument 50℃ drying 5min;
[0315] (5) Add 100uL protein loading mixture, blow the precipitate, constant temperature dry heating instrument incubation 95℃ 10min;
[0316] (6) Western Blot sample, electrophoresis, membrane transfer, development, etc. The operation of step 1 is described.
[0317] The results of the development are shown in Figure 14. Whether or not IFN-γ (R&D, #285-IF / CF) is used for stimulation, aPD1-FLAG protein expression can be detected in the aPD1 iMSC-1 and aPD1 iMSC-2 cell lysates, and there is no B2M protein expression. Significant aPD1-FLAG protein secretion can be detected in the supernatant of aPD1 iMSC-1 and aPD1 iMSC-2 cells. Compared with aPD1 iMSC-2, the aPD1-FLAG protein expression level in aPD1 iMSC-1 is higher both in the cell and in the supernatant. Whether in the cell or in the supernatant, the expression level of aPD1 iMSC-1 with double copy integration is better than that of aPD1 iMSC-2 with single copy integration.
[0318] 4. ELISA detection of aPD1-FLAG protein secretion in aPD1 iMSC cell supernatant
[0319] (1) Blank iMSC, aPD1 iMSC-1, aPD1 iMSC-2 were inoculated with 10 6 cells in a 6-well plate, and the total volume of the culture medium was 2mL. After 24h, the iMSC culture supernatant was collected and centrifuged at 1000g for 5min to remove cell debris;
[0320] (2) Take 96-well enzyme-labeled plates, add 50ng of hPD-1 protein (R&D, #1086-PD) to each well, cover the sealing film, and place it at 4℃ overnight;
[0321] (3) After the coating is completed, gently remove the sealing film, invert the plate to shake off the liquid in the hole, and immediately invert it on a clean absorbent paper and pat a few times to prevent liquid backflow;
[0322] (4) Add 100μL / well Washing buffer (bioss, #C04-01004), place on a shaker, and wash the plate quickly at room temperature for 3min, a total of 3 times;
[0323] (5) Add 200 μL blocking solution (bioss, #C04-01002) to each well, and incubate at 37°C for 2 h;
[0324] (6) After blocking, wash 3 times as in (4);
[0325] (7) The standard sample uses aPD1 scFv-FLAG protein synthesized and quantified by Baiying Biotechnology, which is prepared into the required concentration for the standard curve using coating solution (bioss, #C04-01001): 200 ng / μL, 100 ng / μL, 50 ng / μL, 25 ng / μL, 12.5 ng / μL;
[0326] (8) Dilute the supernatant sample collected in (1) 4 times using coating solution (bioss, #C04-01001);
[0327] (9) Add the standard sample and sample to the well plate according to the layout, ensure the consistency of operation between the duplicate wells, and pay attention to not touch the well wall and well bottom during the process of adding sample;
[0328] (10) After sealing the plate with sealing film, incubate at 37°C for 2 h, and then wash 3 times after incubation;
[0329] (11) Add 100 μL of anti-FLAG-HRP antibody (sigma, #A8592) to each well, seal the plate with sealing film, and incubate at 37°C for 1 h; wash 3 times after incubation;
[0330] (12) Add 100 μL of color developing solution (bioss, #C04-03002-30) to each well, seal the plate with sealing film, and incubate at 37°C for 30 min;
[0331] (13) Add 50 μL of stop solution (bioss, #C04-03002-30), and immediately detect the absorbance value at 450 nm.
[0332] The ELISA results are shown in Figure 15. Higher aPD1-FLAG protein expression levels can be detected in the supernatant of aPD1 iMSC-1 and aPD1 iMSC-2 cells, among which the secretion amount of aPD1 iMSC-1 cells with double copy integration is 1674 ng / 10 6 cells / 24 h, and the secretion amount of aPD1 iMSC-1 cells with single copy integration is 1212 ng / 10 6 cells / 24 h.
[0333] 5. Flow cytometry detection of HLA-ABC protein expression on the surface of aPD1 iMSCs
[0334] (1) Aspirate the culture medium of iMSCs, wash twice with DPBS, and resuspend with TrypLE TM Express the cells at room temperature for 3 min, resuspend with an appropriate amount of complete culture medium, and then transfer into a 15 mL centrifuge tube and centrifuge at 175 g for 5 min;
[0335] (2) After aspirating the supernatant, wash the cells once with DPBS, and centrifuge at 175 g for 5 min again;
[0336] (3) After centrifugation, aspirate the supernatant, add 100 μL of 5% FBS-DPBS to resuspend the cells, and then add 5 μL of PE-HLA-ABC (Biolegend) respectively, and incubate at room temperature for 20 min in the dark;
[0337] (4) After incubation, add 2 times the volume of 5% FBS-DPBS to terminate the incubation, centrifuge at 175 g for 5 min, discard the supernatant, resuspend the cells with 150 μL of 5% FBS-DPBS per tube, and detect by flow cytometry.
[0338] The flow cytometry results are shown in FIG. 16. The control UCMSC and blank iMSC both express HLA-ABC, and the expression level of HLA-ABC increases after stimulation with IFN-γ. However, aPD1 iMSC-1 and aPD1 iMSC-2 do not express HLA-ABC.
[0339] Example 5: Detection of the binding of aPD1-FLAG secreted by aPD1 iMSCs to PD-1 + 293T cells
[0340] 1. Construction of a HEK293T cell line overexpressing PD-1 protein (hereinafter referred to as PD-1 293T cells)
[0341] A HEK293T cell line overexpressing PD-1 protein (hereinafter referred to as PD-1 293T cells) was constructed using a lentivirus carrying PD1-GFP (purchased from Shanghai Heyuan Biotechnology). In the present embodiment, the HEK293T cell line can be constructed using conventional methods known in the art, and no particular limitation is made herein.
[0342] The PD-1 nucleotide sequence carried by the lentivirus is as follows: (SEQ ID NO: 45)
[0343] 2. Flow cytometry detection of the binding of aPD1-FLAG secreted by aPD1 iMSCs to PD-1 + 293T cells
[0344] (1) Use 12-well transwell plates, seed 293T:PD-1 293T = 1:1 mixed cell population 2x10 5
[0345] (2) Seed iMSCs 2x10 5
[0346] (3) After 24h co-incubation, collect 293T+PD-1 293T cell population in upper chamber, flow cytometry to detect aPD1-FLAG binding on PD-1 293T cell surface.
[0347] About 48% of the cells in the mixed cell population seeded in the upper chamber expressed PD-1 protein (Figure 17 left). When aPD1-FLAG secreted by aPD1 iMSCs binds to PD-1 protein, aPD1-FLAG can be detected on the surface of PD-1 293T (Figure 17 middle). About 80% of PD-1 293T surface detected aPD1-FLAG binding when co-cultured with aPD1 iMSC-1, about 60% of PD-1 293T surface detected aPD1-FLAG binding when co-cultured with aPD1 iMSC-2, and no aPD1-FLAG binding was detected on the surface of 293T cells (Figure 17 right), indicating that aPD1-FLAG secreted by aPD1 iMSCs can specifically bind to PD-1 protein.
[0348] Example 6 Detection of aPD1-FLAG secreted by aPD1 iMSCs blocking human PDL1 binding to human PD-1+293T cells
[0349] 1, Seed PD-1 293T cells in 24-well plates at 10 5
[0350] 2, After 24h, when PD-1 293T morphology is stable, add iMSCs supernatant to each well, and incubate with PD-1 293T for 1h;
[0351] 3, Then add 0.5μg human PDL1-IgG1 protein (R&D, #156-B7-100), continue to incubate for 1h;
[0352] 4, Collect PD-1 293T cell population, flow cytometry to detect PDL1-IgG1 protein binding on PD-1 293T cell surface.
[0353] Figure 18, left panel is the peak chart of the results of flow detection of PDL1-IgG1 protein binding to the surface of PD-1 293T cells, and the right panel shows that when blank iMSC supernatant is added, PDL1-IgG1 protein can normally bind to PD-1 protein on the surface of PD-1 293T cells, and when aPD1 iMSC-1 and aPD1 iMSC-2 culture supernatant is added, the binding level of PDL1-IgG1 protein to PD-1 protein on the surface of PD-1 293T cells is reduced, indicating that aPD1-FLAG protein in the supernatant of aPD1 iMSCs can block the binding of PDL1-IgG1 to PD-1 protein, and aPD1 iMSC-1 has a better blocking effect, which also indicates that the PD1 antibody secreted by aPD1 iMSC-1 has a higher expression level. Based on the experimental results in this embodiment, aPD1 iMSC-1 is selected for subsequent functional experiments.
[0354] Example 7 Detection of the promoting effect of aPD1-FLAG secreted by aPD1 iMSCs on the killing function of human PBMC
[0355] 1. HCC827 human lung adenocarcinoma cell line 5x10 4 (Wuhan Pnnsy Life Science Co., Ltd.) was inoculated in the upper chamber of a Transwell six-well plate, and iMSC cells 1.5x10 5 ;
[0356] 2. After 12h, when HCC827 was stable, PBMC 5x10 5 isolated from the peripheral blood of a healthy donor (effector cells: target cells = 10: 1) was added to the upper chamber.
[0357] 3. After co-culturing for 48h, the HCC827 cells in the upper chamber were collected, stained with PE Annexin V Apoptosis Detection Kit (BD biosciences, #559763), and then the apoptosis rate of HCC827 cells was detected by flow cytometry.
[0358] Figure 19 shows the flow cytometry analysis results of the apoptosis rate of HCC827 cells. Anti-PD1 monoclonal antibody Keytruda (selleck biological) was used as a positive control to verify the stability of the co-culture system, and the aPD1 iMSC group showed an increase in the apoptosis rate of HCC827 cells, indicating that aPD1-FLAG secreted by aPD1 iMSC can promote the killing ability of human PBMC on HCC827.
[0359] Example 8 Detection of the promoting effect of aPD1-FLAG secreted by aPD1 iMSCs on the killing function of human PBMC
[0360] 1, CT26 cells (Zhejiang Meisen Cell Technology Co., Ltd.) in the logarithmic growth phase were inoculated at 1 x 10 6 into the right flank of BALB / chPD-1 humanized mice (Jiangsu Jicui Yekang Biotechnology Co., Ltd.) subcutaneously;
[0361] 2, When the tumor volume reached 60-80 mm 3 , the mice were grouped and injected with solvent DPBS, blank iMSCs 3 x 10 6 , and treatment cells aPD1 iMSCs 3 x 10 6 , respectively, once every three days, for a total of three times. Twelve days after the last administration, the mice were sacrificed as the experimental endpoint.
[0362] 3, During the experiment, the body weight of the mice was recorded, and the survival state of the mice was observed, and the subcutaneous tumor volume was measured.
[0363] All experimental animals were active, and their eating and other states were normal. The mice in the DPBS group and the blank iMSCs group were significantly emaciated near the endpoint, but were affected by the weight of the tumor, and their body weight increased to a certain extent. After injection of treatment cells, the body weight of the mice was relatively stable, and there were no abnormal phenomena (Figure 20).
[0364] As shown in Figure 21, at the end of the experiment, the average tumor volume of the solvent DPBS group was 1776.53 mm 3 , the average tumor volume of the blank iMSCs group was 1418.14 mm 3 , the tumor growth inhibition rate TGI was 20.17%, and the average tumor volume of the aPD1 iMSCs treatment cell group was 444.88 mm 3 , and the TGI was 74.96%. The aPD1 iMSCs treatment group showed a significant inhibitory effect on CT26 subcutaneous transplanted tumors compared with the solvent DPBS group and the blank iMSCs group.
[0365] Therefore, the expression frame of the PD1 antibody was site-specifically integrated into the B2M locus of iPSCs, overcoming the problem of difficulty in integration or difficulty in achieving high expression after integration when site-specifically integrated into other sites. Further, the expression frame of the PD1 antibody was site-specifically integrated into the B2M locus of iPSCs, achieving excellent expression results and better antitumor effects.
[0366] Example 9 Construction of anti-TNF-α scFv-carrying targeting vector and nuclear transfer iPSCs
[0367] 1, Construction of anti-TNF-α scFv-carrying targeting vector
[0368] The anti-TNF-α scFv targeting vector carrying two signal peptides (Gluc signal peptide and IgG V signal peptide) was constructed, and the Gluc-anti-TNF-α scFv and IgG V-anti-TNF-α scFv were respectively targeted into the B2M site of iPSCs using the CRISPR / Cas9 gene editing tool (as described in Example 1 above). The main elements of the constructed targeting vector and the targeting schematic diagram are shown in Figure 22.
[0369] The gene target site was designed at the first exon of human B2M, and the upstream and downstream sequences thereof were selected as the homologous arms, EF-1α was selected as the promoter for the expression of the exogenous gene, and the target gene sequence was synthesized by Shenguo Bioengineering (Shanghai) Co., Ltd.
[0370] The amino acid sequence of the anti-TNF-α scFv used (derived from CN1300173C) is as follows:
[0371] Heavy chain variable region: (SEQ ID NO: 46)
[0372] Hinge region: (SEQ ID NO: 47)
[0373] Light chain variable region: (SEQ ID NO: 48)
[0374] The nucleotide sequence of the anti-TNF-α scFv used (derived from CN1300173C) is as follows:
[0375] Heavy chain variable region: (SEQ ID NO: 49)
[0376] Hinge region: (SEQ ID NO: 50)
[0377] Light chain variable region: (SEQ ID NO: 51)
[0378] The amino acid sequence of the signal peptide Gluc is: MGVKVLFALICIAVAEA; (SEQ ID NO: 52)
[0379] The nucleotide sequence of the signal peptide Gluc is: (SEQ ID NO: 53)
[0380] The amino acid sequence of the signal peptide IgG V is: MDWTWRFLFVVAAATGVQS; (SEQ ID NO: 54)
[0381] The nucleotide sequence of the signal peptide IgG V is: (SEQ ID NO: 55)
[0382] The sequence of the targeting vector of Gluc-anti-TNF-α scFv is: (SEQ ID NO: 56)
[0383] The sequence of the targeting vector of IgG V-anti-TNF-α scFv is: (SEQ ID NO: 57)
[0384] 2. Targeting vector carrying anti-TNF-α scFv nucleo-transferred iPSCs
[0385] The nucleo-transferring method for B2M is as follows:
[0386] (1) Good state of the iPSCs to be targeted is inoculated in a 6-well plate coated with Vitronectin (Nuwacell), ncEpic culture is used, and the medium is changed every day;
[0387] (2) When the cell confluence is 80%-90%, prepare for targeting, 2 hours before targeting, replace the ncEpic medium of the cells with ncEpic medium containing 10 μM Y-27632 (Stem Cell), and continue to culture in the incubator;
[0388] (3) Prepare the LONZA nucleofector and Amaxa Human Stem Cell Nucleofector Starter Kit transfection kit (LONZA, #VPH-5002);
[0389] (4) After changing the medium for 2 hours, add 18 μL of Supplement 1 and 82 μL of Solution 2 in a sterile EP tube to prepare the nucleo-transferring solution, and stand at room temperature for 15 min for standby;
[0390] (5) During the standby period, aspirate the medium of the cells to be nucleo-transferred, add 1 mL of DPBS and gently rinse, repeat three times, then add 1 mL of TrypLE TM Express (Gibco, #12604-021), and place in the incubator for 37°C digestion for 3 minutes;
[0391] (6) Aspirate the digestion solution, blow the cells down into a single-cell suspension with culture medium, collect them into a 15 mL centrifuge tube, count them using a hemocytometer, take a suspension containing 1.2 million cells based on the count concentration, centrifuge at 110 g for 5 min at room temperature, and prepare for nuclear transfection;
[0392] (7) Mix the vector plasmid and the gene editing tool plasmid in a certain ratio, add them to the nuclear transfer solution in (4), and let them stand at room temperature for 5 minutes;
[0393] (8) Resuspend the cells to be nuclear transfected with the mixture in (7), transfer them to a nuclear transfection cup, place them in a nuclear transfection instrument, and perform nuclear transfection using the B-016 nuclear transfection program;
[0394] (9) After nuclear transfer, quickly add 500 μL of ncEpic medium to the nuclear transfer cup and incubate at 37°C for 5 min;
[0395] (10) Using the disposable plastic pipette provided with the kit, inoculate the cell suspension after nuclear transfection dropwise into a six-well plate covered with Vitronectin, add Y27632 at a final concentration of 10 μM, gently shake the cells, and place them in an incubator for culture.
[0396] (11) After nuclear transfection, the cells were treated with ncEpic and the medium was changed at 12 h and 36 h, and then every 24 h;
[0397] (12) After the cells have proliferated normally, the culture medium was discarded and 1 mL of DPBS was added to rinse gently. Repeat this twice and then 1 mL of TrypLE TM Express, placed in an incubator at 37°C for 3 minutes;
[0398] (13) Aspirate the digestion solution and blow the cells down into a single-cell suspension with culture medium. Collect the cells into a 15 mL centrifuge tube and count them using a hemocytometer. Take an appropriate amount of the cell suspension according to the count concentration and centrifuge at 110 g for 5 min at room temperature. Take 500 cells for single-cell inoculation.
[0399] (14) Seed the cells in a 6 cm dish pre-coated with Vitronectin, add 3 mL of Clone R (Stemcell, #05888) medium, gently shake the cells, and culture in an incubator;
[0400] (15) After about 6-8 days of culture, when the single cell clone grows to the size of a 10x microscope field of view, use a small tip to break the clone into small pieces and aspirate them into a 48-well plate pre-coated with Vitronectin for culture. When the confluence of the selected single clone reaches 80%-90%, it is passaged and expanded, and the crude cells are lysed to identify the site-specific integration of the single clone. The positive clone is expanded and cultured for further use in experiments and frozen.
[0401] Example 10 Identification of iPSCs monoclonal after nuclear transfer and their expression
[0402] 1. Trans-homologous arm PCR identification
[0403] (1) Take the cell lysate of iPSCs monoclonal as template, if it is a monoclonal of site-specific integration, then use primers B2M RHA-F / R to amplify a product of about 1000bp in length across the downstream homologous arm by PCR.
[0404] The primer nucleotide sequence used in the embodiments of the present application is:
[0405] B2M RHA-F: gactacaaggacgacgacgacaag (SEQ ID NO: 28)
[0406] B2M RHA-R: gcaaagcacataaagtccttggcac (SEQ ID NO: 36)
[0407] (2) The PCR system used for B2M site integration identification is shown in Table 3:
[0408] Table 3 PCR system
[0409] The PCR cycle conditions are:
[0410] (3) Perform agarose gel electrophoresis on the PCR product to observe whether there is a band of interest;
[0411] (4) Select the cells with the band of interest in the upstream identification, repeat the PCR process, and send the product for sequencing.
[0412] For Gluc-anti-TNF-α scFv and IgG V-anti-TNF-α scFv integrated at the B2M site, 25 and 58 iPSCs monoclonals were respectively picked up, and 5 iPSCs clones of each amplified the product of corresponding size by PCR (Figure 23), which were named as G1, G2, G3, G4, G5, V1, V2, V3, V4, V5 respectively. It was known by sequencing identification that the sequence of the product matched the theoretical sequence (Figure 24). 5 strains of B2M-Gluc-anti-TNF-α scFv iPSCs and 5 strains of B2M-IgG V-anti-TNF-α scFv iPSCs were obtained by PCR identification.
[0413] 2. ELISA detection of anti-TNF-a scFv protein expression level in Gluc-anti-TNF-a scFv iPSCs and IgG V-anti-TNF-a scFv iPSCs culture supernatant
[0414] (1) TrypLE Express was used to digest iPSCs cells into single cells. The digestion solution was discarded, and the cells were blown down with culture medium. The cells were counted using a hemocytometer, and 800,000 cells were inoculated into a Vitronectin-coated 12-well plate. After 12 h, the culture medium was discarded, and 1 mL of fresh culture medium was added for 24 h. The supernatant was collected, and the cell debris was removed by centrifugation. TM After the iPSCs cells were digested into single cells by Express, the digestion solution was discarded, and the cells were blown down with culture medium. The cells were counted using a hemocytometer, and 800,000 cells were inoculated into a Vitronectin-coated 12-well plate. After 12 h, the culture medium was discarded, and 1 mL of fresh culture medium was added for 24 h. The supernatant was collected, and the cell debris was removed by centrifugation.
[0415] The anti-TNF-a scFv protein level in the cell supernatant was detected using a FLAG ELISA kit (Cayman, #501560). The operation steps were performed according to the kit instructions.
[0416] As shown in Figure 25, the anti-TNF-a scFv protein secretion level detection results showed that the expression levels of G2 and G5 in the five clones of Gluc-anti-TNF-a scFv iPSCs were relatively higher, about 0.35 ug / 106 cells / 24 h, while only V1 in the five clones of IgG V-anti-TNF-a scFv iPSCs could be detected with weak expression, and the measured values of other single clones were lower than the background value. Therefore, the Gluc signal peptide has a stronger promoting effect on the secretion of anti-TNF-a scFv in iPSCs than IgG V.
[0417] Example 11 Detection of protein expression level in anti-TNF-a scFv iMSCs cell supernatant
[0418] (1) iPSCs clones G5 and V1 were directionally differentiated into G5 iMSCs and V1 iMSCs, and the differentiation steps are described in Example 3, step 1 of PD1 protocol. Blank iMSCs, G5 iMSCs, and V1 iMSCs were inoculated with 10 6 cells in a six-centimeter dish, and the total volume of the culture medium was 3 mL. After 24 h, the iMSC culture supernatant was collected, and the cell debris was removed by centrifugation at 1000 g for 5 min.
[0419] (2) The anti-TNF-a scFv protein level in the cell supernatant was detected using a FLAG ELISA kit (Cayman, #501560). The operation steps were performed according to the kit instructions.
[0420] The ELISA results are shown in Figure 26. The relative concentrations of FLAG-tagged in G5 iMSCs and V1 iMSCs samples were measured to be 311.3 ng / ml and 34.8 ng / ml, respectively. According to the conversion indicated by the detection kit, the secretion levels of the target protein anti-TNF-a scFv in the culture supernatant of G5 iMSCs and V1 iMSCs were 2.63 ug / 10 6 cells / 24h and 0.29 ug / 10 6 cells / 24h, respectively.
[0421] It can be seen that the expression frame of anti-TNF-a scFv is integrated into the B2M locus of iPSCs, and both Gluc signal peptide and IgG V signal peptide have high secretion of anti-TNF-a scFv protein. Among them, Gluc signal peptide can significantly improve the secretion of anti-TNF-a scFv protein, which is about 9 times of IgG V signal peptide guided protein expression. Both Gluc signal peptide and IgG V signal peptide can achieve the desired high expression and secretion effect in mesenchymal stem cells.
[0422] Example 12 Construction of Targeting Vector Carrying BDDF8-CO Expression Frame and Nuclear Transferring iPSCs
[0423] 1. Construction of Targeting Vector Carrying BDDF8-CO Expression Frame
[0424] In this embodiment, B2M region is used as the site for the site-specific integration of exogenous genes, and a corresponding targeting vector carrying the codon-optimized B-domain-deleted F8 (hereinafter referred to as BDDF8-CO) expression frame is constructed. The BDDF8-CO expression frame is site-specifically integrated into the B2M locus using CRISPR / Cas9 gene editing tools. The main elements of the targeting vector and the site-specific integration diagram are shown in Figure 27. The nucleotide sequence encoding the BDDF8-CO expression frame is inserted into the multiple cloning site of the pUC57-kan expression vector by Beijing Qikexin Biotechnology Co., Ltd. to construct a targeting vector plasmid carrying the BDDF8-CO expression frame.
[0425] The B2M sgRNA nucleotide used in this embodiment is:
[0426] The homologous arm nucleotide sequence of the targeting vector in this embodiment is as follows:
[0427] B2M LHA: (SEQ ID NO: 58)
[0428] B2M RHA: (SEQ ID NO: 2)
[0429] The BDDF8-CO amino acid sequence used in the specific embodiment of the present application is as follows: (SEQ ID NO: 59)
[0430] The BDDF8-CO nucleotide sequence used in the specific embodiment of the present application is as follows: (SEQ ID NO: 60)
[0431] The signal peptide (SP) is a signal peptide sequence, and its amino acid sequence is: MGVKVLFALICIAVAEA; (SEQ ID NO: 52)
[0432] The nucleotide sequence of the SP signal peptide sequence is: (SEQ ID NO: 53)
[0433] The nucleotide sequence of the complete targeting vector in this embodiment is as follows: (SEQ ID NO: 61)
[0434] 2. Targeting vector carrying BDDF8-CO expression frame, iPSCs and single cell culture
[0435] (1) The well-conditioned iPSCs to be targeted were inoculated in a 6-well plate coated with Matrigel (Corning, #354277), and mTeSR TM Plus (Stemcell, #05825) was used for culture, and the medium was changed every day;
[0436] (2) When the confluence of the cells reached 80%-90%, the targeting was prepared, and 2 hours before the targeting, the cells were changed to mTeSR TM Plus medium containing 10 μM Y-27632 (STEMCELL Technologies, #72304), and the cells were placed in the incubator for continued culture;
[0437] (3) After 2 hours of medium change, the culture medium was aspirated, 1 mL of DPBS was added for gentle washing, which was repeated twice, and then 1 mL of TrypLE TM Express (Gibco, #12604-021) was added, and the cells were placed in the incubator for 37°C digestion for 3 minutes;
[0438] (4) Aspirate the digestion solution, and use the culture medium to blow the cells into a single-cell suspension. Collect the suspension into a 15 mL centrifuge tube, count the cells using a hemocytometer, and take a suspension containing 1 million cells according to the counted concentration. Centrifuge at 1000 rpm at room temperature for 5 min, and prepare for nucleic acid transfection;
[0439] (5) At the same time, prepare a ThermoFisher Neon nucleic acid transfection instrument and a 100 μL kit of the transfection system (ThermoFisher, #MPK10096). Install the nucleic acid transfection tube into the base, add 3 ml of buffer E2, and select program 14 for standby; TM
[0440] (6) Use 100 μL of buffer R to resuspend the centrifuged cells, and transfer the cells to a sterile EP tube. Add the nucleic acid transfection plasmid, mix in the EP tube, and stand by;
[0441] (7) Take out the kit-matched pipette and tip, push the pipette to the bottom, insert the tip tightly, and then aspirate 100 μL of the mixed cell plasmid suspension;
[0442] (8) Place the pipette + tip into the nucleic acid transfection tube, and clamp tightly to perform nucleic acid transfection;
[0443] (9) Take out the pipette + tip, slowly drop the cell suspension into the culture medium, add Y-27632 to the final concentration of 10 μM to the well plate, gently shake the cells, and place the well plate into the incubator for culture.
[0444] (10) After nucleic acid transfection, use mTeSR TM Plus to culture the cells, and change the medium every day;
[0445] (11) After the cells normally proliferate, aspirate the culture medium, add 1 mL of DPBS to gently rinse, repeat twice, add 1 mL of TrypLE TM Express into the incubator to digest at 37 °C for 3 min;
[0446] (12) Aspirate the digestion solution, and use the culture medium to blow the cells into a single-cell suspension. Collect the suspension into a 15 mL centrifuge tube, count the cells using a hemocytometer, and take a suspension containing 1 million cells according to the counted concentration. Centrifuge at 1000 rpm at room temperature for 5 min, and prepare for nucleic acid transfection;
[0447] (13) Add PE-HLA-A / B / C antibody (Biolegend, #311406) to the cell suspension, avoid light, incubate for 30 min, then add 500 μl of DPBS, and centrifuge at 3000 g for 5 min.
[0448] (14) Discard the supernatant, and use 1 ml of mTeSR TM Plus resuspend the cells. Meanwhile, prepare 5 96-well plates pre-coated with Matrigel, discard Matrigel, and add 200 μl of mTeSR containing 100*RevitaCell (Thermo, #A2644501) to each well TM Plus.
[0449] (15) Use the WOLF cell sorter (Nanocellect) to analyze the cells first, select HLA-A / B / C negative cells, and inoculate them in a 96-well plate for single cell inoculation. A small amount of cells are inoculated in B2 well as a positive well.
[0450] (16) After 2h of incubation in the cell incubator, take a photo with Celigo Image Cytometer (Nexcelom).
[0451] (17) When the single cell clone group grows to about 300 μm in diameter, subculture and expand, extract DNA according to the genomic extraction kit (Novozyme, #DC112-01) instruction to identify the single clone site-specific integration. The positive clone is expanded and cultured for further experiment, and is frozen.
[0452] Example 13: iPSCs single clone identification of site-specific integration of BDDF8-CO expression frame
[0453] 1. Cross-upstream and downstream homologous arm PCR identification
[0454] (1) Take the extracted iPSCs single clone gDNA as a template, and use the cross-upstream homologous arm primer Screen L-F / R and the cross-downstream homologous arm primer Screen R-F / R for PCR amplification, respectively. If it is a single clone of site-specific integration, 1055bp and 980bp products can be amplified by PCR, respectively.
[0455] The primer nucleotide sequence used in the embodiment of the present application is:
[0456] Screen L-F: tagagggcgctggaagctctaa (SEQ ID NO: 35)
[0457] Screen L-R: gtgaggcccaggacctgtac (SEQ ID NO: 62)
[0458] Screen R-F: gtccctattggcgttactatgggaac (SEQ ID NO: 63)
[0459] Screen R-R: gcaaagcacataaagtccttggcac (SEQ ID NO: 36)
[0460] (2) The PCR system is shown in Table 4:
[0461] Table 4 PCR system
[0462] (3) PCR cycle conditions:
[0463] (4) The PCR products were subjected to agarose gel electrophoresis to observe whether there were target bands;
[0464] (5) The cells identified with target bands were selected, the PCR process was repeated, and the products were sequenced.
[0465] After nuclear transfer and single cell culture, 254 single cell clones were obtained, which were expanded and extracted gDNA, and then identified by PCR amplification using primers Screen L-F / R across the upstream homologous arm region and primers Screen R-F / R across the downstream homologous arm region, and Sanger sequencing of PCR products (completed by Beijing Genki Biotechnology Co., Ltd.). After identification, 8 single clones (BDDF8-CO iPSCs) could amplify the corresponding size of the product by PCR (Figure 28), and sequencing identification showed that the product sequence matched the theoretical sequence (Figure 29).
[0466] 2. PCR identification of B2M locus editing
[0467] (1) Using the extracted gDNA of 8 positive iPSC single clones as a template, primers Screen L-F and Screen R-R were used for PCR amplification. Unedited iPSCs could obtain a 1588bp product, while for positive iPSC single clones with site-specific integration, if both copies of the B2M locus were site-specifically integrated with the BDDF8-CO expression cassette, no 1588bp product was produced, and if only one copy was integrated with the BDDF8-CO expression cassette, a 1588bp product could still be obtained. The size of the PCR product and the sequencing results were combined to detect the editing of the B2M locus of the iPSCs.
[0468] (2) The PCR system is shown in Table 5:
[0469] Table 5 PCR system
[0470] (3) PCR cycle conditions:
[0471] (4) PCR products were subjected to agarose gel electrophoresis to observe whether there were target bands;
[0472] (5) Cells with identified target bands were selected, and the PCR process was repeated. The products were sequenced.
[0473] As shown in Figure 30, BDDF8-CO iPSC-2, 3, 4, and 7 did not obtain a product of 1588 bp in size, indicating that the double copies of the above four clones integrated the BDDF8-CO expression frame in the genome. BDDF8-CO iPSC-1, 5, 6, and 8 produced a product of 1588 bp in size, and the sequencing results (Figure 31) showed that random insertion and deletion occurred at the B2M site (BDDF8-CO iPSC-6 failed to complete sequencing due to low PCR product yield), indicating that these clones integrated the BDDF8-CO expression frame in a single copy, and the other copy was edited randomly by insertion and deletion, and did not produce BDDF8-CO expression frame integration.
[0474] Example 14 Directional differentiation of BDDF8-CO iPSCs into BDDF8-CO iMSCs
[0475] The method is the same as the differentiation method in the PD1 scheme of step 1a in Example 3. BDDF8-CO iMSC-2 was obtained by directional differentiation of BDDF8-CO iPSC-2 with double copies of site-specific integration of BDDF8-CO expression frame. It was identified that BDDF8-CO iMSC-2 had a typical MSC fibroblast-like morphology, the cell surface markers met the MSC characteristics, and had a three-lineage differentiation potential.
[0476] Example 15 Detection of protein expression level of BDDF8-CO iMSCs
[0477] 1. ELISA detection of FVIII protein secretion in BDDF8-CO iMSCs cell supernatant
[0478] (1) Wild-type iMSC and BDDF8-CO iMSC-2 were inoculated with 106 cells in a 6-well plate, and the total volume of the culture medium was 1.5 mL. After 24 hours, the iMSC culture medium supernatant was collected, and the cell debris was removed by centrifugation at 1000g for 5 minutes;
[0479] (2) Human Factor VIII ELISA Kit (Novus Biologicols, #NBP3-18716) was used to detect the FVIII content in the supernatant according to the kit instructions.
[0480] ELISA results are shown in Figure 32. Almost no FVIII expression was detected in the culture supernatant of wild-type iMSC cells, while a higher FVIII protein expression level of 372.29 ng / 10 6 cells / 24h was detected in the culture supernatant of BDDF8-CO iMSC-2 cells. The secretion effect achieved in this embodiment is much higher than that achieved in the prior art ("Restoration of FVIII Function and Phenotypic Rescue in Hemophilia A Mice by Transplantation of MSCs Derived From F8-Modified iPSCs", Liyan Qiu, et al, Frontiers in Cell and Developmental Biology, Volume 9, 2021.2.11), which also integrates BDD-F8 into iPSCs, but the integration site is the rDNA region, and the cells after integration are differentiated into iMSC cells. The F8 secretion amount of the obtained iMSC cells is 0.59 ± 0.11 ng / (10 6 cells per 24 hours) and 0.68 ± 0.14 ng / (10 6 cells per 24 hours).
[0481] Therefore, for iMSC cells, the B2M locus is a suitable integration site for integrating nucleotide sequences encoding secreted proteins, and high secretion effect can be achieved. The secretion amount of secreted proteins in mesenchymal stem cells is much higher than that of other integration sites.
[0482] Example 16: Detection of FVIII coagulation activity in BDDF8-CO iMSCs cell culture supernatant by automatic coagulation analyzer
[0483] (1) Wild-type iMSC and BDDF8-CO iMSC-2 were inoculated with 106 cells in a 6-well plate, and the total volume of the culture medium was 1.5 mL. After 24 h, the iMSC culture supernatant was collected and centrifuged at 1000 g for 5 min to remove cell debris.
[0484] (2) The percentage of FVIII coagulation activity in each group of culture supernatant was detected by using an automatic coagulation analyzer (Hesunmeikang, #CS-2400) through an endogenous coagulation factor activity detection test. The operation was performed according to the instrument instruction manual and the reagents supplied with the instrument.
[0485] The results of FVIII coagulation activity detection are shown in Figure 33. Almost no FVIII coagulation activity was detected in the culture supernatant of wild-type iMSCs, while the FVIII coagulation activity in the culture supernatant of BDDF8-CO iMSC-2 cells was very high, exceeding 200%.
[0486] Therefore, the BDDF8-CO expression frame is integrated into the B2M locus of iPSCs, and excellent high expression effect is achieved. The cells integrated at the site can secrete high content and high coagulation activity FVIII coagulation factor.
[0487] Example 17 Construction of Targeting Vector Carrying GH-HyFc Expression Frame and Nuclear Transferred iPSCs
[0488] 1. Construction of Targeting Vector Carrying GH-HyFc Expression Frame
[0489] In this embodiment, the B2M region locus is used as the site for site-specific integration of exogenous genes. In the specific embodiments of the present application, the B2M region locus is the coordinate NC_000015.10:44711391-44721145 region of the human reference genome version 38 (GRCh38 / hg38) human genome. In this embodiment, a targeting vector carrying a codon-optimized GH with Hybrid Fc (hereinafter referred to as GH-HyFc) expression frame is first constructed. The nucleotide sequence of the targeting vector is shown in SEQ ID NO: 64. The GH-HyFc expression frame is site-specifically integrated into the B2M locus using a CRISPR / Cas9 gene editing tool. The main elements of the targeting vector and the site-specific integration schematic diagram are shown in Figure 34. The nucleotide sequence encoding the GH-HyFc expression frame is inserted into the multiple cloning site of the pUC57-kan expression vector to construct a targeting vector plasmid carrying the GH-HyFc expression frame (the targeting vector plasmid is synthesized by Beijing Qikong Biotechnology Co., Ltd.). The B2M sgRNA nucleotide is shown in SEQ ID NO: 3, the homologous arm B2M LHA nucleotide sequence of the targeting vector is shown in SEQ ID NO: 65, and the B2M RHA nucleotide sequence is shown in SEQ ID NO: 2.
[0490] Nucleotide sequence of the targeting vector (SEQ ID NO: 64)
[0491] B2M LHA (SEQ ID NO: 65):
[0492] The amino acid sequence of GH-HyFc used in the embodiments of the present application is shown as SEQ ID NO: 66, and the nucleotide sequence is shown as SEQ ID NO: 67. The signal peptide (SP) is a signal peptide, and the amino acid sequence thereof is: MGVKVLFALICIAVAEA (SEQ ID NO: 52); the nucleotide sequence of the SP signal peptide sequence is: ATGGGCGTGAAGGTGCTGTTTGCCCTGATTTGCATCGCCGTGGCCGAGGCC (SEQ ID NO: 53).
[0493] GH-HyFc amino acid sequence (SEQ ID NO: 66)
[0494] GH-HyFc nucleotide sequence (SEQ ID NO: 67)
[0495] 2. Targeting vector carrying GH-HyFc expression frame, nuclear transfer iPSCs and single cell culture
[0496] (1) Good state of the iPSCs to be targeted was inoculated in a 12-well plate coated with Matrigel (Corning, #354277), and mTeSR TM Plus (Stemcell, #05825) was used for culture, and the medium was changed every day;
[0497] (2) When the confluence of the cells was 80%-90%, the targeting was prepared, and 2 hours before the targeting, the cells were changed with mTeSR TM Plus medium containing 10 μM Y-27632 (STEMCELL Technologies, #72304), and were placed in an incubator for continued culture;
[0498] (3) After 2 hours of medium change, the culture medium was aspirated, 1 mL of DPBS was added for gentle washing, which was repeated twice, and then 1 mL of TrypLE TM Express (Gibco, #12604-021) was added, and the cells were placed in an incubator for 37°C digestion for 3 minutes;
[0499] (4) The digestion solution was aspirated, and the cells were blown into a single cell suspension with the medium, which was collected in a 15 mL centrifuge tube, and the number of cells was counted using a hemocytometer. According to the counted concentration, a suspension containing 1.8 million cells was taken, and centrifuged at 1000 rpm at room temperature for 5 min, and was prepared for nuclear transfer;
[0500] (5) At the same time, the ThermoFisher Neon nucleofector and the Neon TMTransfection system 100 μL kit (ThermoFisher, #MPK10096), install the nucleic transfer tube into the base, add 3 mL buffer E2, select program 14 standby;
[0501] (6) Resuspend the centrifuged cells with 100 μL buffer R and transfer to a sterile EP tube, add the nucleic transfer plasmid, mix in the EP tube and standby;
[0502] (7) Take out the kit matching pipette and tip, push the pipette to the bottom, insert the tip tightly, and then suck 100 μL of mixed cell plasmid suspension;
[0503] (8) Place the pipette + tip into the nucleic transfer tube and clamp tightly, and then perform nucleic transfer;
[0504] (9) Take out the pipette + tip, slowly drop the cell suspension into the medium, add Y-27632 to the final concentration of 10 μM to the well plate, gently shake the cells, and then place in the incubator for culture.
[0505] (10) After nucleic transfer, the cells are cultured with mTeSR TM Plus and the medium is changed every day;
[0506] (11) After the cells normally proliferate, aspirate the culture medium, add 1 mL DPBS and gently rinse, repeat twice, then add 1 mL TrypLE TM Express, and place in the incubator at 37°C for 3 minutes;
[0507] (12) Aspirate the digestion solution, blow the cells into a single cell suspension with medium, collect into a 1.5 mL EP tube, centrifuge at 300g for 5 minutes, discard the supernatant, and resuspend the cells with DPBS.
[0508] (13) Add PE-HLA-A / B / C antibody (Biolegend, #311406) to the cell suspension, avoid light, incubate for 30 minutes, then add 500 μL DPBS, centrifuge at 300g for 5 minutes.
[0509] (14) Discard the supernatant, resuspend the cells with 1 mL mTeSR TM Plus. At the same time, prepare 5 96-well plates coated with Matrigel in advance, aspirate Matrigel, add 200 μL mTeSR TM Plus containing 100*RevitaCell (Thermo, #A2644501) to each well.
[0510] (15) First, the cells were analyzed by WOLF cell sorter (Nanocellect), and the HLA-A / B / C negative cells were selected for single cell inoculation in 96-well plates. A small amount of cells were inoculated in B2 well as positive well.
[0511] (16) After 2h of culture in the cell incubator, Celigo Image Cytometer (Nexcelom) was used for photographing.
[0512] (17) When the single cell clone group grew to about 300μm in diameter, it was subcultured and expanded, and the DNA was extracted according to the instructions of the genomic extraction kit (Novozyme, #DC112-01) for single clone site-specific integration identification. The positive clones were expanded and cultured for further experiments, and were frozen.
[0513] Example 18 Identification of iPSCs Single Clone with Site-specific Integration of GH-HyFc Expression Frame
[0514] 1. Cross-upstream and downstream homologous arm PCR identification
[0515] (1) The extracted iPSCs single clone gDNA was used as a template, and cross-upstream homologous arm primers TYB-GSH-UP-F / R and cross-downstream homologous arm primers 3-191-down-F / R were used for PCR amplification. If it is a single clone with site-specific integration, 1060bp and 915bp products can be amplified by PCR, respectively.
[0516] The primer nucleotide sequences used in the embodiments of the present application are as follows:
[0517] TYB-GSH-UP-F: tagagggcgctggaagctctaa (SEQ ID NO: 35)
[0518] TYB-GSH-UP-R: gggaaccacacacggcacttac (SEQ ID NO: 32)
[0519] 3-191-down-F: acagtggataagagccggtg (SEQ ID NO: 68)
[0520] 3-191-down-R: tctacaaacgtcgcgtgct (SEQ ID NO: 69)
[0521] (2) The PCR system is shown in Table 6:
[0522] Table 6 PCR system
[0523] (3) PCR cycle conditions
[0524] (4) Run the PCR product on agarose gel electrophoresis to observe whether there is a target band;
[0525] (5) Select cells with the target band, repeat the PCR process, and send the product for sequencing.
[0526] After nuclear transfection and single-cell culture, a total of 218 single-cell clones were obtained. These clones were expanded and genomic DNA (gDNA) was extracted. PCR amplification and Sanger sequencing of the PCR products were performed using primers spanning the upstream homology arm region, TYB-GSH-UP-F / R, and primers spanning the downstream homology arm region, 3-191-down-F / R (provided by Beijing Qingke Biotechnology Co., Ltd.). Eleven single clones (GH-HyFc iPSCs) were able to amplify products of the appropriate size by PCR (Figure 35), and sequencing confirmed that the product sequences matched the theoretical sequence (Figure 36).
[0527] 2. PCR identification of B2M locus editing
[0528] (1) Using the extracted gDNA of 11 positive iPSCs monoclonal clones as templates, PCR amplification was performed using primers TYB-GSH-UP-F & TYB-GSH-down-R. Unedited iPSCs produced a 1588 bp product. For site-directed integration positive iPSCs monoclonal clones, if both copies of the B2M locus were site-directedly integrated with the GH-HyFc expression cassette, no 1588 bp product was produced. However, if only one copy was integrated with the GH-HyFc expression cassette, a 1588 bp product was still produced. The PCR product size and sequencing results were combined to detect the editing status of the B2M locus in iPSCs.
[0529] The nucleotide sequences of the primers used in the examples of the present invention are:
[0530] TYB-GSH-UP-F: tagagggcgctggaagctctaa (SEQ ID NO: 35)
[0531] TYB-GSH-down-R: gcaaagcacataaagtccttggcac (SEQ ID NO: 36)
[0532] (2) PCR system is shown in Table 7:
[0533] Table 7 PCR system
[0534] (3) PCR cycling conditions
[0535] (4) PCR products were subjected to agarose gel electrophoresis to observe whether there were target bands;
[0536] (5) Cells identified with target bands were selected, PCR was repeated, and the products were sequenced.
[0537] As shown in Figure 37, GH-HyFc iPSC-1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 all produced a product of 1588 bp in size, and the sequencing results (Figure 38) showed that random insertion and deletion occurred in the B2M gene locus region, indicating that these clones were single copy integration of GH-HyFc expression frame, and the other copy was edited to occur random insertion and deletion (Indels), and did not produce GH-HyFc expression frame integration.
[0538] Example 19 Directional differentiation of GH-HyFc iPSCs into GH-HyFc iMSCs
[0539] GH-HyFc iPSC-3, GH-HyFc iPSC-9 which selected single copy site-specific integration of GH-HyFc expression frame were directionally differentiated to obtain GH-HyFc iMSC-3, GH-HyFc iMSC-9 (the differentiation method is the same as the differentiation method in the PD1 scheme of step 1a in Example 3). It was identified that GH-HyFc iMSC-3, GH-HyFc iMSC-9 had typical MSC fibroblast-like morphology, cell surface markers consistent with MSC characteristics, and possessed tri-lineage differentiation potential.
[0540] Example 20 Detection of protein expression level of GH-HyFc iMSCs
[0541] ELISA detection of GH-HyFc protein secretion in GH-HyFc iMSCs cell supernatant
[0542] 1. Wild-type iMSC, GH-HyFc iMSC-3, GH-HyFc iMSC-9 were inoculated with 10 6 cells in a 6cm dish, and the total volume of the culture medium was 4mL. After 24h, the iMSC culture medium supernatant was collected, and the cell fragments were removed by centrifugation at 1000g for 5min;
[0543] 2. Human Growth Hormone ELISA Kit (Abeam, #ab190811) was used to detect the content of GH-HyFc in the supernatant according to the kit instructions.
[0544] ELISA results are shown in Figure 39. Almost no GH-HyFc expression was detected in the culture supernatant of Wild-type iMSC cells, while higher GH-HyFc protein expression levels were detected in the culture supernatant of GH-HyFc iMSC-3 and GH-HyFc iMSC-9 cells, which were 410.72 ng / 10 6 cells / 24h and 607.28 ng / 10 6 cells / 24h, respectively. Thus, for iMSC cells, the B2M locus is a suitable integration site for site-directed integration of nucleotide sequences encoding secreted proteins, and high secretion can be achieved.
[0545] Example 21 Nb2-11 cell proliferation method for detecting the function of GH-HyFc in the culture supernatant of GH-HyFc iMSCs
[0546] 1. Wild-type iMSC, GH-HyFc iMSC-3, and GH-HyFc iMSC-9 were inoculated at 10 6 cells per 6 cm dish, and the total volume of the culture medium was 4 mL. After 48 h, the iMSC culture supernatant was collected and centrifuged at 1000 g for 5 min to remove cell debris.
[0547] 2. Nb2-11 cells in the logarithmic growth phase were mixed by blowing and centrifuged at 350 g for 5 min. The cells were washed twice with Nb2-11 basal medium (DMEM(HG) + 1% NEAA + 1% HS), and then counted for viable cells. The cells were diluted with Nb2-11 basal medium to a suspension containing 1.0 x 10 5 cells per mL, and 50 μL was added to each well of a 96-well transparent flat-bottom white plate (about 5000 cells per well). Two replicates were set up for each sample, and the plate was incubated in an incubator for 48 h to slow the growth rate (to avoid inoculation into the edge wells of the 96-well plate).
[0548] 3. The culture medium of Wild-type iMSC, GH-HyFc iMSC-3, and GH-HyFc iMSC-9 was added to the above 96-well transparent flat-bottom white plate at 50 μL per well, and the plate was incubated at 37°C and 5% CO2 for 48 h.
[0549] 4. After 48 h, the CellTiter-Glo® Luminescent Cell Viability Assay Kit (Promega, #G7570) was used to detect the number of Nb2-11 cells in each well according to the method described in the kit manual. The more cell proliferation, the stronger the proliferative ability of GH-HyFc.
[0550] As shown in Figure 40, there was no significant difference in the growth rate of Nb2-11 cells between the Wild-type iMSC group and the negative control a-MEM medium group, which were 10.06% and 5.7%, respectively; the growth rate of Nb2-11 cells of the GH-HyFc iMSC-3 and GH-HyFc iMSC-9 groups were 61.17% and 68.58%, respectively, which were significantly improved compared with the Wild-type iMSC group.
[0551] In summary, the GH-HyFc expression frame is site-specifically integrated into the B2M locus of iMSCs, achieving excellent high expression and high secretion effects, and the cells with site-specific integration of the B2M locus secrete high content of GH-HyFc protein with a proliferation-promoting effect.
[0552] Example 22 Construction of Targeting Vector Carrying GLP-1RA and Nucleofection iPSCs
[0553] 1. Construction of Targeting Vector Carrying GLP-1RA
[0554] The present application constructs a GLP-1RA targeting vector carrying codon optimization and signal peptide modification, and uses CRISPR / Cas9 gene editing tools (as described in Example 17 above) to target the codon-optimized and signal peptide-modified GLP-1RA expression frame into the B2M site of iPSCs. The main elements of the constructed targeting vector and the targeting schematic diagram are shown in Figure 41.
[0555] A gene targeting site is designed at the first exon of human B2M, and the upstream and downstream sequences thereof are selected as the homologous arms. EF-1a is used as the promoter for the expression of the exogenous gene, and the GLP-1RA expression frame is designed to contain the Gaussia luciferase signal peptide (Gaussi in Figure 41) and the furin cleavage site (F in Figure 41). The nucleotide sequence of the targeting vector (the nucleotide sequence thereof is shown as SEQ ID NO: 70) is synthesized by Genechem (Shanghai) Co., Ltd.
[0556] Nucleotide sequence of the targeting vector (SEQ ID NO: 70)
[0557] The B2M sgRNA nucleotide used in this embodiment is as follows:
[0558] The homologous arm nucleotide sequence of the targeting vector in this embodiment is as follows:
[0559] LHA as shown in SEQ ID NO: 65; RHA as shown in SEQ ID NO: 2.
[0560] The GLP-1RA amino acid sequence used in the embodiments of the present application is shown as SEQ ID NO: 71, and the amino acid sequence thereof is derived from CN101974090B. The GLP-1RA nucleotide sequence used in the embodiments of the present application is shown as SEQ ID NO: 72. The Gaussia luciferase signal peptide (abbreviated as SP) is a signal peptide sequence, and the amino acid sequence thereof is shown as SEQ ID NO: 52. The nucleotide sequence of the SP signal peptide sequence is shown as SEQ ID NO: 53.
[0561] GLP-1RA amino acid sequence (SEQ ID NO: 71)
[0562] GLP-1RA nucleotide sequence (SEQ ID NO: 72)
[0563] 2. Targeting vector carrying GLP-1RA expression frame, nuclear transfer iPSCs and single cell culture
[0564] (1) The well-conditioned iPSCs to be targeted were inoculated in a 6-well plate coated with Matrigel (Corning, #354277), and mTeSR TM Plus (Stemcell, #05825) was used for culture, and the medium was changed every day;
[0565] (2) When the confluence of the cells reached 80%-90%, the cells were prepared for targeting. Two hours before the targeting, the cells were changed to mTeSR TM Plus medium containing 10 μM Y-27632 (STEMCELL Technologies, #72304), and were placed in an incubator for continued culture;
[0566] (3) After 2 hours of medium change, the culture medium was aspirated, 1 mL of DPBS was added for gentle washing, and the operation was repeated twice. Then, 1 mL of TrypLE TM Express (Gibco, #12604-021) was added, and the plate was placed in an incubator for 37°C digestion for 3 minutes;
[0567] (4) The digestion solution was aspirated, and the cells were blown into a single cell suspension with medium, and were collected in a 15 mL centrifuge tube. The cell concentration was counted using a hemocytometer, and a suspension containing 1 million cells was taken according to the counted concentration. The suspension was centrifuged at 1000 rpm and at room temperature for 5 minutes, and was prepared for nuclear transfer;
[0568] (5) Meanwhile, prepare ThermoFisher Neon nucleofector and Neon TM Transfection system 100ul kit (ThermoFisher, #MPK10096), install the nucleofector tube into the base, add 3ml buffer E2, select program 14 standby;
[0569] (6) Resuspend the centrifuged cells with 100ul buffer R and transfer to a sterile EP tube, add the nucleofected plasmid, mix in the EP tube and standby;
[0570] (7) Take out the kit matched pipette and tip, push the pipette to the bottom, insert the tip tightly, and then suck 100ul of mixed cell plasmid suspension;
[0571] (8) Put the pipette + tip into the nucleofector tube and clamp tightly, and then perform nucleofection;
[0572] (9) Take out the pipette + tip, slowly drop the cell suspension into the medium, add Y-27632 to the final concentration of 10uM to the well plate, gently shake the cells, and put them into the incubator for culture.
[0573] (10) After nucleofection, the cells are cultured with mTeSR TM Plus and the medium is changed every day;
[0574] (11) After the cells normally proliferate, aspirate the culture medium, add 1ml DPBS and gently rinse twice, then add 1ml TrypLE TM Express, put into the incubator and digest at 37℃ for 3min;
[0575] (12) Aspirate the digestion solution, blow the cells into a single cell suspension with medium, collect into a 1.5ml EP tube, centrifuge at 3000g for 5min, discard the supernatant, and resuspend the cells with DPBS.
[0576] (13) Add PE-HLA-A / B / C antibody (Biolegend, #311406) to the cell suspension, avoid light, incubate for 30min, then add 500ul DPBS, centrifuge at 3000g for 5min.
[0577] (14) Discard the supernatant, resuspend the cells with 1ml mTeSR TM Plus. Meanwhile, prepare 5 96-well plates coated with Matrigel, aspirate Matrigel, add 200ul mTeSR TM Plus containing 100*RevitaCell (Thermo, #A2644501) to each well.
[0578] (15) Use WOLF cell sorter (Nanocellect) to analyze the cells first, select HLA-A / B / C negative cells for single cell inoculation in 96-well plates, and inoculate a small amount of cells in B2 well as positive well.
[0579] (16) After 2h of incubation in the cell incubator, take a photo with Celigo Image Cytometer (Nexcelom).
[0580] (17) When the single cell clone group grows to about 300μm in diameter, it is subcultured and expanded, and the DNA is extracted according to the genomic extraction kit (Novozyme, #DC112-01) instruction to identify the single clone site integration. The positive clone is expanded and cultured for further experiment, and is frozen.
[0581] Example 23 Identification of iPSCs Single Clone with Site-specific Integration of GLP-1RA Expression Frame
[0582] 1. Cross-upstream and downstream homologous arm PCR identification
[0583] (1) Take the extracted iPSCs single clone gDNA as the template, and use the cross-upstream homologous arm primers TYB-GSH-2-UP-F & TYB-GSH-UP-R and the cross-downstream homologous arm primers 6-31-R-F4 & 6-31-R-R4 for PCR amplification. If it is a single clone with site-specific integration, 1053bp and 989bp products can be amplified respectively.
[0584] The primer nucleotide sequence used in the embodiment of the present application is:
[0585] TYB-GSH-2-UP-F: tagagggcgctggaagctctaa (SEQ ID NO: 35)
[0586] TYB-GSH-UP-R: gggaaccacacacggcacttac (SEQ ID NO: 32)
[0587] 6-31-R-F4: aacaactacaagaccacgcc (SEQ ID NO: 73)
[0588] 6-31-R-R4: cagccaagcattctacaaacg (SEQ ID NO: 74)
[0589] (2) The PCR system used for B2M site integration identification is shown in Table 8:
[0590] Table 8 PCR system
[0591] PCR cycle conditions are as follows:
[0592] (3) The PCR products are subjected to agarose gel electrophoresis to observe whether there is a target band;
[0593] (4) The cells identified with the target band are selected, the PCR process is repeated, and the product is sequenced.
[0594] After nuclear transfer and single cell culture, 64 single cell clones were obtained. After expanding culture and extracting genomic DNA (gDNA), Sanger sequencing was performed using the primer TYB-GSH-2-UP-F & TYB-GSH-UP-R across the upstream homologous arm region and the primer 6-31-R-F4 & 6-31-R-R4 across the downstream homologous arm region (completed by Shanghai Biotechnology Co., Ltd.). After identification, 11 single clones (6-31 iPSCs) could amplify the corresponding size product by PCR (Figures 42 and 43), and sequencing identification showed that the product sequence matched the theoretical sequence (Figure 44).
[0595] 2. PCR identification of B2M locus editing
[0596] (1) The extracted gDNA of 11 positive iPSC single clones was used as a template for PCR amplification using primers TYB-GSH-2-up-F & TYB-GSH-2-down-R. The unedited iPSCs could obtain a 1588bp product, while for the positive iPSC single clones with site-specific integration, if both copies of the B2M locus were site-specifically integrated with the GLP-1RA expression cassette, no 1588bp product was produced, and if only one copy was integrated with the GLP-1RA expression cassette, a 1588bp product could still be obtained. The PCR product size and sequencing results were combined to detect the B2M locus editing of the iPSCs.
[0597] (2) The PCR system is shown in Table 9:
[0598] Table 9 PCR system
[0599] (3) PCR cycle conditions:
[0600] (4) The PCR products are subjected to agarose gel electrophoresis to observe whether there is a target band;
[0601] (5) The cells identified with the target band are selected, the PCR process is repeated, and the product is sequenced.
[0602] As shown in Figure 45, GLP-1RA iPSC-3, 11, 51, 58 did not obtain the product of 1588bp size, which indicated that the above four clones had double copies of GLP-1RA expression frame integrated in the genome. GLP-1RA iPSC-21, 31, 32, 34, 40, 42, 44 produced a product of 1588bp size, and the sequencing results (Figure 46) showed that B2M site had random insertion and deletion, indicating that these clones had single copy of GLP-1RA expression frame integrated, and the other copy was edited by random insertion and deletion, and did not produce GLP-1RA expression frame integration.
[0603] Example 24 GLP-1RA iPSCs are directionally differentiated into GLP-1RA iMSCs
[0604] GLP-1RA iPSC-11 and GLP-1RA iPSC-51 which had double copies of GLP-1RA expression frame integrated were selected to be directionally differentiated into GLP-1RA iMSC-11 and GLP-1RA iMSC-51 (the differentiation method was the same as the differentiation method in the PD1 scheme of step 1a in Example 3). It was identified that GLP-1RA iMSC-11 and GLP-1RA iMSC-51 had typical MSC fibroblast-like morphology, cell surface markers consistent with MSC characteristics, and possessed tri-lineage differentiation potential.
[0605] Example 25 Detection of protein expression level of GLP-1RA iMSCs
[0606] ELISA detection of GLP-1 protein secretion in GLP-1RA iMSCs cell supernatant
[0607] 1. Wild-type iMSC, GLP-1RA iMSC-11 and GLP-1RA iMSC-51 were inoculated with 10 6 cells in a 6cm dish, and the total volume of the culture medium was 4mL. After 48h, the iMSC culture medium supernatant was collected, and the cell debris was removed by centrifugation at 1000g for 5min;
[0608] 2. Human GLP-1 (7-36) SimpleStep Kit (ab184857) was used to detect the content of GLP-1 in the supernatant according to the kit instructions, and the content of GLP-1RA was calculated according to the molecular weight.
[0609] The ELISA results are shown in Figure 47. Almost no GLP-1 expression was detected in the culture supernatant of wild-type iMSC cells, while higher GLP-1RA protein expression was detected in the culture supernatant of GLP-1RA iMSC-11 and GLP-1RA iMSC-51 cells, which were 1.77 x 10 4 ng / 10 6 cells / 24h / mL and 1.90 x 10 4 ng / 10 6 cells / 24h / mL, respectively. The total expression of GLP-1RA protein per 10 6 iMSC cells in 24h was 7.08 x 10 4 ng and 7.6 x 10 4 ng, respectively. Therefore, for iMSC cells, the B2M locus is a suitable integration site for site-specific integration of nucleotide sequences encoding secreted proteins, and can achieve high secretion effect. The secretion amount of secreted protein GLP-1 receptor agonist in mesenchymal stem cells is much higher than that of other integration sites.
[0610] In summary, site-specific integration of the GLP-1RA expression cassette into the B2M locus of iMSCs achieved excellent expression and secretion effect. The cells with site-specific integration can secrete GLP-1RA molecules with an unexpectedly high expression amount.
[0611] The above has exemplarily described the embodiments of the technical solutions of the present disclosure. It should be understood that the protection scope of the present disclosure is not limited to the above embodiments. Any modification, equivalent replacement, improvement, etc. made by those skilled in the art within the spirit and principles of the present disclosure shall be included in the protection scope of the claims of the present application.
Claims
1. An engineered cell, characterized in that The engineered cells are site-specifically integrated with a nucleic acid encoding a secretory protein.
2. The engineered cell according to claim 1, characterized in that The engineered cells are selected from engineered mesenchymal stem cells, and / or engineered IPSC cells and cells derived therefrom.
3. The engineered cell according to claim 2, characterized in that The engineered mesenchymal stem cells are derived from adult cells or stem cells; Preferably, the engineered mesenchymal stem cells are derived from pluripotent stem cells, more preferably, the pluripotent stem cells are selected from induced pluripotent stem cells; Preferably, the engineered mesenchymal stem cells are derived from bone marrow, fat, muscle, heart, umbilical cord blood or umbilical cord.
4. The engineered cell according to claim 2, characterized in that The derived cells include CAR-iNK, dopaminergic neural precursor cells, CAR-iMac, cardiomyocytes, endothelial progenitor cells, iNK cells, retinal cells, neurons, osteoblasts, hematopoietic stem cells, blood cells, B cells, fibroblasts, hair cells, monocytes, macrophages, Treg cells, renal progenitor cells, lung epithelial cells, endothelial cells, megakaryocytes, smooth muscle cells, skeletal muscle cells, chondrocytes, bone cells, adipocytes, hepatocytes, pancreatic islet cells, keratinocytes, melanocytes, and dendritic cells.
5. The engineered cell according to claim 1, characterized in that The site of site-directed integration is located at the B2M locus.
6. The engineered cell according to claim 1, characterized in that The secretory protein is selected from a dipeptide, an oligopeptide, a polypeptide or a short protein; wherein the secretory protein is composed of less than 2500 amino acids, preferably less than 2400, 2000, 1500, 1000, 900, 800, 700, 600, 500, 400, 300, 200 amino acids.
7. The engineered cell according to claim 1, characterized in that The secretory proteins include one or more of immune checkpoint inhibitors, TNF-α inhibitors, GLP-1 receptor agonists, growth hormones, coagulation factors, interleukins, insulin, interferons, tumor necrosis factors, enzymes, and growth factors; Preferably, the immune checkpoint is selected from one or more of PD1, PD-L1, CTLA-4, TIGIT, LAG-3, and TIM-3, more preferably PD1; Preferably, the immune checkpoint inhibitor is an antibody or an antibody fragment, more preferably a full-length antibody or a single-chain antibody; Preferably, the immune checkpoint inhibitor is a full-length antibody or single-chain antibody of PD1, more preferably a single-chain antibody of PD1; Preferably, the TNF-α inhibitor is selected from TNF-α receptor or TNF-α antibody, more preferably etanercept, adalimumab, secukinumab, infliximab, golimumab, becelimumab; Preferably, the interleukin is selected from members of the leukocyte family, more preferably IL-2, IL-7, IL-10, IL-11, IL-12, IL-15, IL-23 and IL-24; Preferably, the tumor necrosis factor family member is selected from TNF, LTA, LTB, FASLG, TNFSF8, TNFSF9, TNFSF10, TNFSF11, TNFSF12, TNFSF13, TNFSF14, TNFSF15, TNFSF18, EDA, and TRAIL; Preferably, the interferon is selected from interferon α, β, and γ; Preferably, the GLP-1 receptor agonist is selected from polypeptide GLP-1 receptor agonists, more preferably polypeptide GLP-1 receptor agonists whose polypeptide chains are not chemically modified or are chemically modified, such as exenatide, benaglutide, dulaglutide, or albiglutide; Preferably, the growth hormone is selected from natural or recombinant human growth hormone, including short-acting recombinant human growth hormone or long-acting recombinant human growth hormone; Preferably, the coagulation factor is selected from the group consisting of prothrombin complex, fibrinogen, antifibrinogen, recombinant coagulation factor VIIa, recombinant coagulation factor VIII, recombinant coagulation factor IX, and recombinant coagulation factor X; Preferably, the growth factor is selected from epidermal growth factor, platelet-derived growth factor, fibroblast growth factor, GM-CSF, G-CSF; Preferably, the enzyme is selected from lipase, amylase, trypsin, chymotrypsin, lysozyme, urokinase, L-asparaginase, glutaminase, neuraminidase.
8. The engineered cell according to claim 1, characterized in that The nucleic acid encoding the secretory protein includes at least one of a coding region, a leader sequence, a signal peptide sequence, exons, introns and an expression frame.
9. The engineered cell according to claim 8, characterized in that The expression cassette includes an operably linked promoter sequence, a signal peptide sequence, and a nucleic acid sequence encoding a secretory protein; more preferably, the expression cassette includes an operably linked promoter sequence, a signal peptide sequence, a nucleic acid sequence encoding a secretory protein, a screening marker or tag; further preferably, the expression cassette includes an operably linked promoter sequence, a signal peptide sequence, a nucleic acid sequence encoding a secretory protein, a screening marker or tag, and a Poly (A) tail.
10. The engineered cell according to claim 9, characterized in that The signal peptide is an exogenous signal peptide; Preferably, the signal peptide is a combination of one or more strong secretory signal peptides suitable for secretory proteins; Preferably, the strong secretory signal peptide is selected from secretecon, Gaussia luciferase (Gluc), Mouse Ig Kappa, Human IgG V, Human IgK VIII, Ig heavy chain signal peptide 7 (H7), Igκ light chain signal peptide 1 (L1); Preferably, the promoter sequence is located upstream of the nucleic acid sequence, and the promoter is used to control the expression of the secretory protein; Preferably, the promoter is selected from CMV promoter, EF1α promoter, SV40 promoter, CAG promoter, PGK promoter or UBC promoter; Preferably, the selection marker is selected from ampicillin (Ampr), chloramphenicol (Camr), karatomycin (Kanr), tetracycline (Tetr), puromycin (Puro), G418, hygromycin beta (Hygr), Zeocin, and blasticidin; Preferably, the tag is selected from FLAG, His, GST, HA, c-Myc, HSV, V5, SUMO, eGFP / eCFP / eYFP / mCherryeGFP.
11. The engineered cell according to claim 1, characterized in that The engineered cells further include one or more of the following: (1) expressing at least one of a chimeric antigen receptor, CD64, CD47, HLA-E or uncleavable HLA-E, HLA-G or uncleavable HLA-G; (2) regulated expression of one or more MHC-I and / or MHC-II human leukocyte antigens; preferably, the MHC-I and / or MHC-II human leukocyte antigens are selected from one or more of HLA-A, HLA-B, HLA-C, HLA-DPA1, HLA-DPB1, HLA-DQA1, HLA-DQB1, HLA-DRA, B2M, TAP1, TAP2, LMP2, LMP7, TNFRSF1A, CD8B, CD8A, CCR7, CXCR6, IL2RA, GZMB, GNLY, CKB, P2RY6, ADCY2, CHRM1, ERAP1, ERAP2, Tapasin, CD74, HLA-DO, HLA-DM, CLIP, Cathepsins, RFX5, RFXAP, RFXANK, and CIITA; more preferably, regulated expression of CIITA is included; (3) regulated expression of CD54 and / or CD58; Preferably, the regulated expression includes no expression or reduced expression.
12. The engineered cell according to claim 1, characterized in that Compared with cells with site-specific integration of the rDNA region, the engineered cells have a higher expression level of secretory proteins.
13. The engineered cell according to claim 1, characterized in that The expression amount of the engineered cells is that one million mesenchymal stem cells secrete more than 20 ng, preferably more than 30 ng, preferably more than 40 ng, preferably more than 50 ng, preferably more than 100 ng, preferably more than 200 ng, preferably more than 300 ng, preferably more than 400 ng, preferably more than 500 ng of the secretory protein every 24 hours.
14. The engineered cell according to claim 1, characterized in that Compared with wild-type cells, the engineered cells have a higher expression level of secretory proteins.
15. The method for preparing the engineered cell according to any one of claims 1 to 14, characterized in that: The method comprises introducing a nucleic acid encoding a secretory protein into a site of site-directed integration in the cell; Preferably, the expression cassette encoding the secretory protein is introduced into the site of site-directed integration of the cell by means of a meganuclease, zinc finger nuclease (ZFNs), transcription activator-like effector nuclease (TALEN) and / or CRISPER / Cas system; more preferably the CRISPER / Cas system.
16. The method for preparing engineered cells according to claim 15, characterized in that: Introducing an expression cassette encoding a secretory protein into the site of site-directed integration of the cell via a targeting vector, an sgRNA vector, and / or a nuclease or nuclease expression vector; Preferably, the targeting vector comprises a 5' homology arm-an expression cassette encoding a secretory protein-a 3' homology arm; Preferably, the 5' homology arm and the 3' homology arm are respectively homologous to the sequence in the site of the site-directed integration; more preferably, the 5' homology arm and the 3' homology arm are respectively homologous to the sequence in the B2M locus; Preferably, the lengths of the 5' homology arm and the 3' homology arm are 2-1000 bp respectively; Preferably, the 5' homology arm and the 3' homology arm are respectively homologous to sequences with a length of 2-1000 bp upstream and downstream of the PAM sequence in the site of site-directed integration; Preferably, the sgRNA is used to bind to the nuclease and guide the nuclease to cleave the DNA by recognizing the PAM sequence of the target sequence in the site of site-directed integration; Preferably, the sgRNA is partially or fully complementary to the target sequence; more preferably, the sgRNA is partially or fully complementary to the target sequence in the B2M locus; Preferably, the nuclease is selected from one or more of Cas12a, Cas12b, Cas13, Cas14, Cas9, CasX, CasY, C2c2, Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas10, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm1, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3 and Csf4; Preferably, the vector is a non-viral vector, preferably pUC, pET, or pGEX.
17. The method for preparing engineered cells according to claim 15, characterized in that: This includes introducing nucleic acids encoding secretory proteins into iPSCs cells for site-directed integration, followed by directed differentiation to obtain derived cells; Preferably, the derived cells are engineered mesenchymal stem cells.
18. The method for preparing engineered cells according to claim 15, characterized in that: The site-directed integration includes double-copy integration or single-copy integration.
19. The method for preparing engineered cells according to claim 15, characterized in that: The method of introduction is non-viral; Preferably, the introduction method is selected from: vector transformation, transfection, heat shock, electroporation, transduction, and microinjection.
20. A preparation characterized in that The invention comprises the engineered cell according to any one of claims 1 to 14 and a pharmaceutically acceptable excipient.
21. A pharmaceutical composition, characterized in that comprising the engineered cell according to any one of claims 1 to 14, Preferably, other therapeutic agents are also included, including antipyretic analgesics, antiasthmatics, antibiotics, antidepressants, antidiabetics, anti-inflammatory drugs, antitumor drugs, antianxiety drugs, immunomodulators, sedatives and hypnotics, antianginal drugs, antipsychotics, antimanic drugs, antiarthritis drugs, antiarrhythmic drugs, antigout drugs, anticoagulants, thrombolytics, antifibrinolytics, hemorheology drugs, antiplatelet drugs, anticonvulsants, antiparkinsonian drugs, antihistamines, drugs for calcium regulation, antiviral drugs, bronchodilators, hormones, lipid-lowering drugs, proteins, polypeptides, nucleic acids, antiulcer or antireflux drugs, antiemetics, diagnostic agents, and nutritional drugs; More preferably, the anti-tumor drugs include paclitaxel and its derivatives, docetaxel, camptothecin and its derivatives, etoposide, teniposide, doxorubicin hydrochloride, cyclophosphamide, dactinomycin, bleomycin, daunomycin, doxorubicin, epirubicin, mitomycin, methotrexate, 5-fluorouracil, carboplatin, carmustine, lomustine, cisplatin, vinblastine, vincristine, tamoxifen, sulfamethoxazole, and phenylephrine.
22. A pharmaceutical composition according to claim 21, characterized in that The other therapeutic agent is administered in combination with the engineered cells; Preferably, the combined administration includes continuous administration in any order or at any time intervals, so that two or more therapeutic agents exert their biological activities simultaneously; more preferably, the combined administration produces a synergistic therapeutic effect.
23. Use of the engineered cell according to any one of claims 1 to 14, the preparation according to claim 20, or the pharmaceutical composition according to claim 21 or 22 in the preparation of drugs for diagnosing, preventing, and treating diseases; Preferably, the diseases include, but are not limited to, cell proliferative diseases, including tumors, melanoma, non-small cell lung cancer, renal cell carcinoma, colorectal cancer, breast cancer, pancreatic cancer, head and neck cancer, and other solid tumors; blood system diseases, including leukemia, anemia, lymphoma, hemophilia, leukopenia, thrombocytopenia, angiogenesis disorders, Kaposi's sarcoma, etc.; autoimmune diseases, including Crohn's disease, ulcerative colitis, allergies, inflammatory bowel disease, arthritis, psoriasis, and respiratory inflammation, asthma, and organ transplant rejection; metabolic diseases, including diabetes, growth hormone deficiency, and growth retardation in children; infections, including viral infections, bacterial infections, fungal infections, and parasitic infections; digestive system diseases, including indigestion and pancreatic diseases; skin injuries, including trauma and burns; Preferably, the drug is administered intravenously, intramuscularly, intraperitoneally, cerebrospinal, subcutaneously, intrathecally, orally, topically or by inhalation.
24. Use of the B2M locus in the engineered cell according to any one of claims 1 to 14 for increasing the expression of secretory proteins by mesenchymal stem cells.
25. A method for preparing a secretory protein, characterized in that: The method comprises using the engineered cell according to any one of claims 1 to 14 to express a secretory protein; Preferably, the secretory proteins include immune checkpoint inhibitors, TNF-α inhibitors, GLP-1 receptor agonists, growth hormones, coagulation factors, interleukins, insulin, interferons, tumor necrosis factors, enzymes, and growth factors.
26. A method for increasing the expression of a secretory protein, characterized in that: The method comprises culturing the engineered cell according to any one of claims 1 to 14 to obtain a secretory protein; Preferably, the secretory proteins include immune checkpoint inhibitors, TNF-α inhibitors, GLP-1 receptor agonists, growth hormones, coagulation factors, interleukins, insulin, interferons, tumor necrosis factors, enzymes, and growth factors.
Citation Information
Patent Citations
Targeting vector for site-specific integration of exogenous genes and application of targeting vector
CN110564764A
Genetically Engineered Cells and Uses Thereof
US20220184123A1
Strategies for knock-INS at b2m safe harbor sites
WO2024050349A2