Gene editing method for simultaneous knock-in of DNA fragments at multiple sites and application thereof

Abstract

Provided are a gene editing method for the simultaneous knock-in of DNA fragments at multiple sites and an application thereof. The method comprises the following steps: making a plurality of double-stranded DNA nicks in a target gene; designing a plurality of homology-directed repair templates; designing exogenous DNA fragments on the homology-directed repair templates; constructing the plurality of homology-directed repair (HDR) templates on the same vector in series; and respectively enabling knock-in of the exogenous DNA fragments into the double-stranded DNA nicks by means of the vector. The multi-site multi-fragment gene knock-in provided by this gene editing method can bring a plurality of DNA fragments into a single vector by means of HDR and enable simultaneous and precise insertion of a plurality of exogenous genes into a target genome at distinct sites, thereby greatly reducing gene editing costs and also increasing the editing efficiency. The gene editing method can be used for basic research and clinical application research.

Description

Gene editing method for simultaneously knocking in DNA fragments at multiple sites and application thereof TECHNICAL FIELD

[0001] The present application relates to the technical field of biological cell gene editing, and particularly relates to a gene editing method for simultaneously knocking in DNA fragments at multiple sites. BACKGROUND

[0002] With the rapid development of gene editing technology, technologies such as CRISPR / Cas9 have been widely used in biomedical research, bioengineering and agricultural fields as an efficient and precise gene editing tool. In many cases, it is necessary to simultaneously edit multiple gene sites or knock in multiple DNA fragments in a gene using gene editing technology to achieve more complex gene regulation or functional modification. For example, in disease treatment and gene therapy, for complex diseases or diseases related to multiple genes, multiple genes need to be regulated simultaneously to achieve better therapeutic effect. In addition, in the cultivation of engineered strains and transgenic plants, it is often necessary to introduce multiple exogenous DNA fragments into the genome to achieve specific functional modification.

[0003] However, although gene editing technologies such as CRISPR / Cas9 can achieve editing at multiple sites, it usually needs multiple editing or multiple editing events to complete, and the operation is complex and the efficiency is low. In addition, for the requirement of simultaneously inserting multiple DNA fragments, the current gene editing technology has not been able to provide an efficient and simple solution. Therefore, it is of great theoretical significance and practical value to develop a gene editing method that can simultaneously knock in DNA fragments at multiple sites or simultaneously modify multiple genes. The successful development of such a method will expand new possibilities for the further development and application of gene editing technology, and provide strong technical support for innovation in the fields of biomedical research, bioengineering and agriculture.

[0004] SUMMARY TECHNICAL PROBLEM

[0005] At present, the insertion of multiple exogenous genes into cells is carried out by inserting them one by one in the order of single genes, such as using lentivirus to insert exogenous genes, or using single AAV virus, ssDNA carrier, etc. to insert multiple exogenous genes one by one after making one or more double-stranded DNA cuts using CRISPR / Cas technology. However, this method not only has complicated gene knockout and knock-in operation steps, but also increases the cost of preparing engineered cells, affecting the preparation efficiency. TECHNICAL SOLUTION

[0006] To solve the above technical problems, the application discloses a high-efficiency, simple-operation and low-cost knock-in technology for simultaneously knocking in multiple gene fragments at multiple sites; the technology is characterized in that, after a double-stranded DNA cut is made by a CRISPR / Cas gene editing technology, multiple exogenous target gene fragments are connected to form a same vector; by means of HDR (homologous recombination-mediated repair), the exogenous target gene fragments are accurately inserted into different specific cut sites of a genome at one time; the vector can be provided by an AAV, a plasmid, a PCR amplified fragment, a single-stranded DNA or other DNA fragments; and the vector can be delivered into cells by an electric transformation, a virus or an LNP.

[0007] The technical scheme for solving the problems of the application is as follows:

[0008] A gene editing method for simultaneously knocking in DNA fragments at multiple sites, characterized by comprising the following steps:

[0009] A plurality of double-stranded DNA cuts are made in a target gene by using a CRISPR / Cas gene editing technology;

[0010] A homologous mediated repair template is designed, which has the same number of double-stranded DNA cuts as the target gene;

[0011] An exogenous DNA fragment is designed on each of the homologous mediated repair templates;

[0012] All the homologous mediated repair templates with the designed exogenous DNA fragments are connected to form a same vector;

[0013] By using the vector and a homologous recombination DNA repair method, each of the exogenous DNA fragments is knocked into a corresponding double-stranded DNA cut in the target gene, so that multiple DNA fragments are simultaneously knocked in at multiple sites.

[0014] In the gene editing method, the target gene includes a TRAC gene, a TCR response gene and a TGFBR2 receptor gene.

[0015] In the gene editing method, the TCR response gene includes one or more of PD-1, 41-BB and IL-2.

[0016] In the gene editing method, when the double-stranded DNA cut is made in the target gene by using the CRISPR / Cas, the method further comprises the following steps:

[0017] According to a nucleic acid sequence of the target gene, two or more gRNA nucleic acid sequences are designed by using the CRISPR / Cas gene editing technology;

[0018] Under the action of CRISPR / Cas, by designing the gRNA nucleic acid sequence, the gRNA site corresponding to the target gene is knocked out respectively, and double-stranded DNA cuts consistent with the number of gRNA nucleic acid sequences are made.

[0019] In the above gene editing method, the gRNA site is a 5'UTR site, a 5'UTR to 3'UTR site, or a 3'UTR site.

[0020] In the above gene editing method, the exogenous DNA fragment includes one or more of a CAR gene, a cytokine gene, and a functional protein; the cytokine gene includes one or two of IL-7, IL-10, IL-12, IL-15, IL-18, and IL-21 genes; and the functional protein includes a fluorescent protein and / or an antibody.

[0021] In the above gene editing method, when designing the homology-mediated repair template, the following steps are further included:

[0022] According to the designed gRNA nucleic acid sequence, an upstream homologous nucleic acid sequence and a downstream homologous nucleic acid sequence for homologous recombination-mediated repair are designed at both ends of each gRNA nucleic acid sequence, and a homology-mediated repair template is constructed.

[0023] In the above gene editing method, when designing an exogenous DNA fragment in each homology-mediated repair template, the following steps are further included:

[0024] According to the nucleic acid sequences on the left and right sides of each double-stranded DNA cut, an upstream homologous nucleic acid sequence and a downstream homologous nucleic acid sequence for homologous recombination-mediated repair are designed at both ends of each exogenous DNA fragment by using CRISPR / Cas gene editing technology.

[0025] In the above gene editing method, when inserting each exogenous DNA fragment into the corresponding double-stranded DNA cut by the vector, the following steps are further included:

[0026] According to the nucleic acid sequence of the double-stranded DNA cut, each exogenous DNA fragment connected in the same vector is used as a homology-mediated repair template in different regions of the vector, and the exogenous DNA fragment is inserted into the corresponding double-stranded DNA cut according to the upstream homologous nucleic acid sequence and the downstream homologous nucleic acid sequence for homologous recombination-mediated repair carried by each exogenous DNA fragment.

[0027] In the above gene editing method, the vector includes one of an adeno-associated virus, a plasmid, a PCR amplicon, and ssDNA.

[0028] In the gene editing method, when the vector knocks in each of the exogenous DNA fragments into the respective corresponding double-stranded DNA cut, the delivery mode of the vector for delivering the exogenous DNA fragments is electroporation, virus or LNP cell.

[0029] In the gene editing method, the delivery system for inserting the exogenous DNA fragments into the double-stranded DNA cut by the vector is added with an inhibitor; for example, the inhibitor is one or more of DNA-PK inhibitors, RS-1 and L755507; wherein the inhibitor is one or both of AZD7648 and M3814.

[0030] The gene sequence or gene fragment obtained by the gene editing method or the engineered modified cell can be applied to prepare a drug or a component of a drug for treating and / or preventing tumors and cancers. Advantages

[0031] The application provides a high-efficiency multi-site and multi-fragment gene simultaneous knock-in method, which can accurately insert multiple DNA fragments into different sites of a genome in a HDR manner at one time, thereby reducing the cost of gene editing and increasing the efficiency of gene editing.

[0032] The application focuses on connecting DNA repair templates at different sites into a DNA sequence in a series manner, so that the purpose of one-time delivery can be achieved, and the technology can be applied to multi-DNA fragment knock-in at different sites based on the principle of HDR, thereby simplifying the gene editing steps and improving the gene knock-in efficiency. BRIEF DESCRIPTION OF DRAWINGS

[0033] FIG. 1 is a gene editing process flowchart provided by the application;

[0034] FIG. 2 is a schematic diagram of a homology-directed repair template for inserting an exogenous gene IL-15-GFP into a cut;

[0035] FIG. 3 is a schematic diagram of a homology-directed repair template for inserting exogenous genes IL-15-GFP and CAR into a cut;

[0036] FIG. 4 is a schematic diagram of a homology-directed repair template for inserting exogenous genes IL-18-GFP and CAR into multiple cuts;

[0037] FIG. 5 is a schematic diagram of the exogenous gene GFP vector structure corresponding to the 5'UTR site, the 5'UTR to 3'UTR site and the 3'UTR site, respectively, in Example 1;

[0038] FIG. 6 is a schematic diagram of the exogenous gene GFP vector structure corresponding to the 5'UTR to 3'UTR site in Example 2;

[0039] Figure 7 is a schematic diagram of the vector structure of the DNA fragments of the respective single exogenous genes (GFP gene, CAR gene, IL-15 gene and anti-PD-1 gene) corresponding to the 5' UTR site and the 3' UTR site in Example 3;

[0040] Figure 8 is a schematic diagram of the vector structure of the DNA fragments of the respective multiple exogenous genes (CAR, GFP, RFP, BFP, YFP, IL-18, IL-10, anti-CTLA4, etc.) corresponding to the 5' UTR site and the 3' UTR site in Example 4;

[0041] Figure 9 is a schematic diagram of the vector structure of the DNA fragments of the respective multiple exogenous genes corresponding to the 5' UTR site and the 3' UTR site in Example 5;

[0042] Figure 10 is a flow cytometry detection diagram of the gene knockout on the PD-1 endogenous gene of the T cells in Example 6;

[0043] Figure 11 is a flow cytometry detection diagram of the gene knockout on the IL-2 endogenous gene of the T cells in Example 6;

[0044] Figure 12 is a flow cytometry detection diagram of the gene knockout on the TRAC endogenous gene of the T cells in Example 6;

[0045] Figure 13 is a flow cytometry detection diagram of the gene knockout on the PD-1 endogenous gene of the T cells in Example 6;

[0046] Figure 14 is a flow cytometry detection diagram of the expression of the exogenous gene CAR knock-in in the 7-CAR-T cells in Example 6;

[0047] Figure 15 is a flow cytometry detection diagram of the expression of the exogenous gene IL-12 knock-in in the 7-CAR-T cells in Example 6;

[0048] Figure 16 is a flow cytometry detection diagram of the expression of the exogenous gene GFP knock-in in the 7-CAR-T cells in Example 6;

[0049] Figure 17 is a flow cytometry detection diagram of the expression of the exogenous gene CAR knock-in in the 8-CAR-T cells in Example 6;

[0050] Figure 18 is a flow cytometry detection diagram of the expression of the exogenous gene IL-18 knock-in in the 8-CAR-T cells in Example 6;

[0051] Figure 19 is a growth amplification detection curve of four kinds of cells in Example 6;

[0052] Figure 20 is a flow cytometry detection diagram of the CAR positive rate of the NT cells in Example 6;

[0053] Figure 21 is a flow cytometry diagram of Nectin4-CAR-T cell CAR positive rate of Example 6;

[0054] Figure 22 is a flow cytometry diagram of 7-CAR-T cell CAR positive rate of Example 6;

[0055] Figure 23 is a flow cytometry diagram of 8-CAR-T cell CAR positive rate of Example 6;

[0056] Figure 24 is a flow cytometry diagram of NT cell expression of Example 6;

[0057] Figure 25 is a flow cytometry diagram of Nectin4-CAR-T cell expression of Example 6;

[0058] Figure 26 is a flow cytometry diagram of 7-CAR-T cell two exogenous genes IL-12 and GFP knock-in expression of Example 6;

[0059] Figure 27 is a flow cytometry diagram of 8-CAR-T cell exogenous gene IL-18 knock-in expression of Example 6;

[0060] Figure 28 is a curve diagram of specific tumor killing rate of four T cells in Example 6 at an effector to target ratio (E:T = 1:1);

[0061] Figure 29 is a flow cytometry diagram of exogenous gene CAR knock-in expression in T cells of Example 7;

[0062] Figure 30 is a flow cytometry diagram of exogenous gene CAR knock-in expression in NK cells of Example 7;

[0063] Figure 31 is a flow cytometry diagram of exogenous gene CAR knock-in expression in CIK cells of Example 7;

[0064] Figure 32 is a flow cytometry diagram of exogenous gene CAR knock-in expression in DC cells of Example 7;

[0065] Figure 33 is a flow cytometry diagram of exogenous gene CAR knock-in expression in macrophages of Example 7;

[0066] Figure 34 is a curve diagram of 10 cell growth amplification detection in Example 7;

[0067] Figure 35 is a curve diagram of specific tumor killing rate of NT and 7-CAR-T cells in Example 7 at an effector to target ratio (E:T = 1:1);

[0068] Figure 36 is a curve diagram of specific tumor killing rate of NK and 7-CAR-NK cells in Example 7 at an effector to target ratio (E:T = 1:1);

[0069] Figure 37 is a graph showing the specific tumor killing rate of CIK and 7-CAR-CIK cells in Example 7 at an effector to target ratio (E:T = 1:1);

[0070] Figure 38 is a graph showing the specific tumor killing rate of DC and 7-CAR-DC cells in Example 7 at an effector to target ratio (E:T = 1:1);

[0071] Figure 39 is a graph showing the specific tumor killing rate of macrophages (M) and 7-CAR-M in Example 7 at an effector to target ratio (E:T = 1:1). Best Mode for Carrying Out the Invention

[0072] The preferred embodiments of the present application are further described in detail below with reference to the accompanying drawings.

[0073] The present application provides a multi-site and multi-gene simultaneous knock-in technology, which aims to introduce an anti-tumor CAR gene and one or more exogenous genes into the corresponding site of immune cells, such as the 5'UTR site, the 5'UTR to 3'UTR site, or the 3'UTR site; thereby enhancing the anti-tumor activity and persistence of immune cells (such as T cells, NK cells, CD cells, etc.), which aims to revolutionize the CAR- immune cell combination therapy for solid tumors.

[0074] The present application uses CRISPR / Cas9 gene editing technology to simultaneously introduce multiple gRNAs targeting different target sites into immune cells through electroporation to generate multiple double-stranded break cuts (also known as gene site knockout) at the corresponding gene sites, and uses a vector (such as AAV, plasmid, or PCR amplicon) carrying the CAR and one or more exogenous genes as a template to simultaneously insert the CAR and one or more exogenous genes into the corresponding gene sites of immune cells.

[0075] This multi-site and multi-gene simultaneous knock-in technology uses a single vector to introduce multiple genes such as CAR and exogenous genes into multiple different immune cell gene sites at the same time, avoiding multiple transduction steps, simplifying the operation process, reducing experimental costs, and allowing for site-specific gene editing. The innovative method has significantly promoted the CAR- immune cell engineering technology.

[0076] The implementation principle of the present application is:

[0077] The DNA fragments of multiple segments are combined in a tandem manner by using a DNA template for HDR (homology directed repair, HDR) repair, and then delivered into cells by a single vector through a DNA delivery technology (such as electroporation, LNP cell or virus), so that the cells perform DNA repair by using different regions of the DNA fragments as HDR repair templates, thereby achieving the purpose of simultaneously knocking in multiple exogenous DNA fragments into multiple DNA cuts by a single vector.

[0078] The key points of the present application are:

[0079] 1) The gene knock-in method can manufacture multiple double-stranded DNA cuts by using gene editing technologies such as ZFN, TALENT, CRISPR / Cas, and then insert multiple exogenous DNA fragments into the corresponding double-stranded DNA cuts by using HDR and the like;

[0080] 2) The HDR repair template can be delivered by using vectors such as AAV, plasmid, PCR amplicon, single-stranded DNA or other DNA fragments;

[0081] 3) The exogenous DNA fragments can be inserted into the double-stranded DNA cuts of the endogenous genes of the cells by using delivery methods such as electroporation, virus or LNP;

[0082] 4) The DNA repair templates of different sites are connected in a tandem manner to form a DNA sequence, thereby achieving the purpose of simultaneously delivering and inserting multiple exogenous genes into different cuts of the endogenous genes of the cells by using a single vector, and realizing gene editing.

[0083] The gene editing technologies mentioned above can be gene editing technologies such as ZFN, TALENT and CRISPR / Cas. The present application preferably uses CRISPR / Cas to design gRNA nucleic acid sequences and manufacture multiple double-stranded DNA cuts on the endogenous genes (i.e. target genes) of the cells; wherein the target genes can be one or more of the TRAC gene, the TCR response gene and the TGFBR2 receptor gene; the TCR response gene can include one or more of PD-1, 41-BB and IL-2.

[0084] As shown in FIG. 1, the present application provides a gene editing method for simultaneously knocking in DNA fragments at multiple sites, and the process steps are as follows:

[0085] S1, using CRISPR / Cas to manufacture multiple double-stranded DNA cuts in the target genes (i.e. endogenous genes);

[0086] S2, designing homology directed repair templates with the same number of double-stranded DNA cuts;

[0087] S3. Designing an exogenous DNA fragment on each homology-directed repair template;

[0088] S4. Constructing multiple homology-directed repair templates in a tandem manner on the same vector;

[0089] S5. Knocking in each exogenous DNA fragment into the corresponding double-stranded DNA cut by the vector and using homologous recombination DNA repair, to achieve simultaneous multi-site and multi-DNA fragment gene knock-in.

[0090] The step S1 of the above gene editing method further includes the following steps:

[0091] S11. Designing two or more gRNA nucleic acid sequences according to the nucleic acid sequence of the target gene using CRISPR / Cas gene editing technology;

[0092] S12. Knocking out the corresponding gRNA site on the target gene by CRISPR / Cas gene editing technology and the gRNA nucleic acid sequence designed in step S11, to produce double-stranded DNA cuts consistent with the number of gRNA nucleic acid sequences.

[0093] In the above step S1, the site of the double-stranded DNA cut, i.e., the gRNA site, can be a 5' UTR site, a 5' UTR to 3' UTR site, or a 3' UTR site. The number of double-stranded DNA cuts can be two, three, or four or more, according to the corresponding design as needed, each designed gRNA nucleic acid sequence can correspond to one double-stranded DNA cut, and each double-stranded DNA cut corresponds to the insertion of a DNA fragment.

[0094] In the step S2 of the above gene editing method, the homology-directed repair template design further includes the following steps:

[0095] According to the gRNA nucleic acid sequence designed in the above step S11, an upstream homologous nucleic acid sequence (LA) and a downstream homologous nucleic acid sequence (RA) capable of carrying homologous recombination-mediated repair are designed at both ends of each gRNA nucleic acid sequence, to construct a homology-directed repair template.

[0096] The number of homology-directed repair templates is the same as the number of double-stranded DNA cuts, to ensure that one double-stranded DNA cut matches one homology-directed repair template, and that the exogenous gene or exogenous DNA fragment is inserted into the double-stranded DNA cut site through the homology-directed repair template.

[0097] In the step S3 of the above gene editing method, when designing an exogenous DNA fragment on each homology-directed repair template, the following steps are further included:

[0098] According to the nucleic acid sequence of the left and right sides of the double-stranded DNA cut obtained in step S12, upstream homologous nucleic acid sequences (LA) and downstream homologous nucleic acid sequences (RA) capable of carrying homologous recombination-mediated repair are respectively designed at both ends of each exogenous DNA fragment.

[0099] In the present application, the upstream homologous nucleic acid sequences (LA) and the downstream homologous nucleic acid sequences (RA) of the homologous recombination-mediated repair template can also be referred to as left and right homologous arms (LA, RA).

[0100] Among them, the exogenous DNA fragment includes one or several of the CAR gene, the cytokine gene and the functional protein; and the cytokine gene can include one or more of the IL-7 gene, the IL-10 gene, the IL-12 gene, the IL-15 gene, the IL-18 gene and the IL-21 gene; the functional protein can include a fluorescent protein and / or an antibody, and the fluorescent protein includes one or more of the GFP, RFP, BFP and YFP genes; the antibody includes one or more of anti-PD1, anti-CTLA4, anti-TIGIT, anti-TIM3 and anti-LAG3. The left and right homologous arms (LA, RA) at both ends of each exogenous DNA fragment are respectively the same as the left and right homologous arms (LA, RA) of the corresponding homologous recombination-mediated repair template, that is, the corresponding nucleic acid sequences are the same.

[0101] In order to facilitate observation, tracking and verification of the knock-in rate of the cytokine, the exogenous gene GFP fluorescent protein gene (also one of the exogenous genes) can also be designed after other exogenous genes in the DNA fragment, such as IL-15-GFP, IL-18-GFP, etc., as exogenous genes to be knocked into the double DNA cut of the target gene.

[0102] The step S4 of the above gene editing method further includes the following steps:

[0103] The homologous recombination-mediated repair templates obtained in the above step S2 are constructed in the same vector in a head-to-tail series manner according to the upstream homologous nucleic acid sequences (LA), the downstream homologous nucleic acid sequences (RA), the upstream homologous nucleic acid sequences (LA), the downstream homologous nucleic acid sequences (RA), etc.

[0104] Alternately connected in head-to-tail mode, such as the mode of “-LA-A1-RA-LA-A2-RA-LA-A3-RA-” connected with each other; wherein, A1, A2, A3 respectively represent three segments of exogenous DNA fragments, which are respectively designed on three different homologous recombination-mediated repair templates, such as “-LA-A1-RA-”, “-LA-A2-RA-” and “-LA-A3-RA-”. One or more genes or gene expression frames can be designed on each segment of DNA fragment, such as A1 can include an exogenous gene CAR, IL-15 or GFP, or multiple exogenous genes CAR-IL-15, IL-15-GFP or CAR-IL-18-GFP, etc. That is, one exogenous DNA fragment can be designed with one exogenous gene expression frame, or multiple exogenous gene expression frames; however, one homologous recombination-mediated repair template can only correspond to one DNA fragment, and one DNA fragment can only be inserted into one double-stranded DNA cut.

[0105] In step S5 of the above gene editing method, when each of the exogenous DNA fragments is inserted into the corresponding double-stranded DNA cut by the vector, the following steps are further included:

[0106] According to the nucleic acid sequences on the left and right sides of the double-stranded DNA cut, each segment of the exogenous DNA fragments connected in the same vector is respectively taken as a different region of the vector as a homologous-mediated repair template, and according to the upstream homologous nucleic acid sequence (LA) and the downstream homologous nucleic acid sequence (RA) for homologous recombination-mediated repair carried by each segment, the exogenous DNA fragments are respectively inserted into the corresponding double-stranded DNA cut.

[0107] In the above step S5, the vector can be any one of adeno-associated virus, plasmid, PCR amplicon, ssDNA, and when the vector knocks in each segment of the exogenous DNA fragment into the corresponding double-stranded DNA cut, the delivery mode of the vector for delivering the exogenous DNA fragment is electroporation, virus or LNP cell.

[0108] When constructing the vector, the homologous-mediated repair template is respectively constructed into the adeno-associated virus AAV, plasmid, PCR amplicon, ssDNA vector, and the delivery mode of electroporation, virus or LNP cell is used for exogenous DNA fragment delivery.

[0109] In the delivery system when the vector inserts the exogenous DNA fragment into the double-stranded DNA cut, an inhibitor can also be added to inhibit the self-repair of the double-stranded DNA cut and improve the introduction efficiency (i.e. knock-in rate) of the exogenous DNA fragment. The inhibitor is one or more of DNA-PK inhibitors, RS-1 and L755507; wherein, the DNA-PK inhibitor includes one or both of AZD7648 and M3814.

[0110] The gene editing method for simultaneously knocking in a DNA fragment at multiple sites provided by the application can be applied to gene editing in various cells, especially gene editing in immune cells, such as T cells, NK cells, CIK cells, DC cells, macrophages and the like.

[0111] Before the gene editing method for simultaneously knocking in a DNA fragment at multiple sites provided by the application is implemented, the following preparation work is done.

[0112] I. gRNA nucleic acid sequence design

[0113] In the application, multiple gRNA nucleic acid sequences of a target gene are designed by CRISPR / Cas gene editing technology, and then each gRNA nucleic acid sequence makes a respective double-stranded DNA cut on the target gene.

[0114] Taking a target gene, such as a TRAC gene, a PD-1 gene (TCR response gene), a 41-BB gene (TCR response gene), an IL-2 gene (exogenous cytokine), and a TGFBR2 receptor gene (protein), as an example, the respective gRNA nucleic acid sequences are designed as shown below, and three gRNA nucleic acid sequences are designed for each target gene, and each gRNA nucleic acid sequence can make a corresponding DNA cut. When making the cut, only one gRNA nucleic acid sequence needs to be selected for gene knockout. The specific gRNA nucleic acid sequences are as follows.

[0115] (1) The gRNA sequence corresponding to the TRAC gene is any one of the following groups:

[0116] 1.1, the nucleic acid sequence of TRAC-gRNA1 is shown in SEQ ID NO. 1: CCAGCTGCTCGTGATGGACTGGG, and the gene editing site corresponds to the 5'UTR site of the TRAC gene;

[0117] 1.2, the nucleic acid sequence of TRAC-gRNA2 is shown in SEQ ID NO. 2: TGTACCAGCTGAGAGACTCTCGG, and the gene editing site corresponds to the 5'UTR to 3'UTR site of the TRAC gene;

[0118] 1.3, the nucleic acid sequence of TRAC-gRNA3 is shown in SEQ ID NO. 3: AGCAAGACGACTGGGGACCCTGG, and the gene editing site corresponds to the 3'UTR site of the TRAC gene;

[0119] (2) The nucleic acid sequence of gRNA1 corresponding to PD-1 in the TCR response gene is any one of the following groups:

[0120] 1.4, the nucleic acid sequence of PD-1-gRNA1 is shown as SEQ ID NO. 4: GGAGAAGGCGGCACTCTGGTGGG, and the gene editing site corresponds to the 5' UTR site of the PD-1 gene;

[0121] 1.5, the nucleic acid sequence of PD-1-gRNA2 is shown as SEQ ID NO. 5: CCGGGCTGGCTGCGGTCCTCGGG, and the gene editing site corresponds to the 5' UTR to 3' UTR site of the PD-1 gene;

[0122] 1.6, the nucleic acid sequence of PD-1-gRNA3 is shown as SEQ ID NO. 6: AGACCCTCCACCATGAGCCCGGG, and the gene editing site corresponds to the 3' UTR site of the PD-1 gene;

[0123] (Three), the nucleic acid sequence of gRNA1 corresponding to IL-2 in the TCR response gene is as follows:

[0124] 1.7, the nucleic acid sequence of IL-2-gRNA1 is shown as SEQ ID NO. 7: ACCCCC AAAGACTGACTGAATGG, and the gene editing site corresponds to the 5' UTR site of the IL-2 gene;

[0125] 1.8, the nucleic acid sequence of IL-2-gRNA2 is shown as SEQ ID NO. 8: GATTTACAGATGATTTTGAATGG, and the gene editing site corresponds to the 5' UTR to 3' UTR site of the IL-2 gene;

[0126] 1.9, the nucleic acid sequence of IL-2-gRNA3 is shown as SEQ ID NO. 9: AATATAGTATCTATGTAGATTGG, and the gene editing site corresponds to the 3' UTR site of the IL-2 gene.

[0127] (Four), the nucleic acid sequence of gRNA1 corresponding to the TGFBR2 receptor gene is as follows:

[0128] 1.10, the nucleic acid sequence of TGFBR2-gRNA1 is shown as SEQ ID NO. 10: ACTTCAACTCAGCGCTGCGGGGG, and the gene editing site corresponds to the 5' UTR site of the TGFBR2 gene;

[0129] 1.11, the nucleic acid sequence of TGFBR2-gRNA2 is shown as SEQ ID NO. 11: TGCTGGCGATACGCGTCCACAGG, and the gene editing site corresponds to the 5' UTR to 3' UTR site of the TGFBR2 gene;

[0130] 1.12, the nucleic acid sequence of TGFBR2-gRNA3 is shown as SEQ ID NO. 12: TGCTTATCCCCACAGCTTACAGG, and the gene editing site corresponds to the 3' UTR site of the TGFBR2 gene;

[0131] (Five), the nucleic acid sequence of gRNA1 corresponding to 41-BB in the TCR response gene is as follows:

[0132] 1.13, the nucleic acid sequence of 41-BB-gRNA1 is shown as SEQ ID NO. 13: GGAGAAGGCGGCACTCTGGTGGG, and the gene editing site corresponds to the 5' UTR site of the 41-BB gene;

[0133] 1.14, the nucleic acid sequence of 41-BB-gRNA2 is shown as SEQ ID NO. 14: CCGGGCTGGCTGCGGTCCTCGGG, and the gene editing site corresponds to the 5' UTR to 3' UTR site of the 41-BB gene;

[0134] 1.15, the nucleic acid sequence of 41-BB-gRNA3 is shown as SEQ ID NO. 15: AGACCCTCCACCATGAGCCCGGG, and the gene editing site corresponds to the 3' UTR site of the 41-BB gene.

[0135] II. Design of homology-mediated repair template

[0136] For the above designed gRNA nucleic acid sequence, a homology-mediated repair template is designed, that is, each gRNA nucleic acid sequence corresponds to the designed upstream and downstream homologous nucleic acid sequences (LA / RA) (i.e. left and right homologous arms) as follows.

[0137] 2.1, the LA and RA sequences corresponding to TRAC-gRNA1 are shown as SEQ ID NO. 51 and SEQ ID NO. 52, respectively;

[0138] 2.2, the LA and RA sequences corresponding to TRAC-gRNA2 are shown as SEQ ID NO. 53 and SEQ ID NO. 54, respectively;

[0139] 2.3, the LA and RA sequences corresponding to TRAC-gRNA3 are shown as SEQ ID NO. 55 and SEQ ID NO. 56, respectively;

[0140] 2.4, the LA and RA sequences of PD-1-gRNA1 are shown as SEQ ID NO. 57 and SEQ ID NO. 58, respectively;

[0141] 2.5, the LA and RA sequences of PD-1-gRNA2 are shown as SEQ ID NO. 59 and SEQ ID NO. 60, respectively;

[0142] 2.6, the LA and RA sequences of PD-1-gRNA3 are shown as SEQ ID NO. 61 and SEQ ID NO. 62, respectively;

[0143] 2.7, the LA and RA sequences of IL-2-gRNA1 are shown as SEQ ID NO. 63 and SEQ ID NO. 64, respectively;

[0144] 2.8, the LA and RA sequences of IL-2-gRNA2 are shown as SEQ ID NO. 65 and SEQ ID NO. 66, respectively;

[0145] 2.9, the LA and RA sequences of IL-2-gRNA3 are shown as SEQ ID NO. 67 and SEQ ID NO. 68, respectively;

[0146] 2.10, the LA and RA sequences of TGFBR2-gRNA1 are shown as SEQ ID NO. 69 and SEQ ID NO. 70, respectively;

[0147] 2.11, the LA and RA sequences of TGFBR2-gRNA2 are shown as SEQ ID NO. 71 and SEQ ID NO. 72, respectively;

[0148] 2.12, the LA and RA sequences of TGFBR2-gRNA3 are shown as SEQ ID NO. 73 and SEQ ID NO. 74, respectively;

[0149] 2.13, the LA and RA sequences of 41-BB-gRNA1 are shown as SEQ ID NO. 75 and SEQ ID NO. 76, respectively;

[0150] 2.14, the LA and RA sequences of 41-BB-gRNA2 are shown in SEQ ID NO. 77 and SEQ ID NO. 78, respectively:

[0151] 2.15, the LA and RA sequences of 41-BB-gRNA3 are shown in SEQ ID NO. 79 and SEQ ID NO. 80, respectively:

[0152] III. Design of upstream and downstream homologous nucleic acid sequences of exogenous genes

[0153] As shown in FIGS. 2 and 4, since the exogenous genes, such as CAR or IL-15, are initiated by the promoter of the target gene (endogenous gene); therefore, a regulatory element is added in front of the exogenous gene, such as T2A regulatory element is added in front of CAR, and IRES regulatory element is added in front of other exogenous genes; and using the principle of homologous recombination, left and right homologous arms (LA, RA) with the same nucleic acid sequence on the left and right sides of the double-stranded cut site are designed at both ends of the exogenous gene, and an exogenous DNA fragment is inserted into the double-stranded cut to realize gene editing of simultaneous knock-in of multiple DNA fragments. Therefore, the upstream and downstream homologous nucleic acid sequences of the exogenous gene are the same as the upstream and downstream homologous nucleic acid sequences of the corresponding homologous recombination template; in this way, the homologous recombination template can realize the tandem insertion of the exogenous gene.

[0154] As shown in FIG. 2, a double-stranded cut inserts two exogenous genes IL-15-GFP: target gene upstream homologous nucleic acid sequence (LA), exogenous DNA fragment (IL-15-GFP), and target gene downstream homologous nucleic acid sequence (RA);

[0155] As shown in FIG. 3, a cut inserts multiple exogenous genes IL-15-GFP and CAR: target gene upstream homologous nucleic acid sequence (LA), exogenous DNA fragment (IL-15-GFP-CAR), and target gene downstream homologous nucleic acid sequence (RA);

[0156] As shown in FIG. 4, multiple cuts insert multiple exogenous genes IL-18-GFP and CAR: target gene upstream homologous nucleic acid sequence (LA), exogenous DNA fragment (IL-18-GFP), target gene downstream homologous nucleic acid sequence (RA), exogenous DNA fragment (CAR), target gene upstream homologous nucleic acid sequence (LA), and target gene downstream homologous nucleic acid sequence (RA). Embodiments of the present application

[0157] The technical solutions of the present application are further illustrated in detail below through some specific implementations.

[0158] (I) verification of expression of genes

[0159] Example 1

[0160] The purpose of this example is to verify whether the genes in each exogenous DNA fragment are expressed by designing gRNA nucleic acid sequences corresponding to different target genes to make DNA nicks at different sites through CRISPR / Cas9 gene editing technology.

[0161] In this example, the vector is AAV; the endogenous genes are the TRAC gene, the PD-1 gene, the IL-2 gene and the TGFBR2 gene of T cells; the nicking sites are the 5'UTR site, the 5'UTR to 3'UTR site and the 3'UTR site; and the exogenous gene is the fluorescent protein GFP gene.

[0162] 1.1, T cell acquisition and activation

[0163] Mononuclear cells were isolated from donor peripheral blood, and ficol separation technology was used to perform density gradient centrifugation, and T cells were enriched using a T cell sorting kit (CD3 MicroBeads, human-lyophilized, 130-097-043), and T cells were activated and expanded using magnetic beads coupled with anti-CD3 / anti-CD28; X-VIVO medium containing 10% FBS and 300 IU / ml rh-IL2 was used as the culture medium, and all T cells were cultured in a 37°C, 5% CO2 incubator, to obtain activated T cells for standby use.

[0164] 1.2, design of gRNA nucleic acid sequence and GFP structure

[0165] 1.2.1, design of gRNA nucleic acid sequence

[0166] Twelve groups of T cells were prepared, and the 5'UTR site, 5'UTR to 3'UTR site and 3'UTR site on the TRAC gene, PD-1 gene, IL-2 gene and TGFBR2 gene of each group of T cells were respectively designed to correspond to the gRNA nucleic acid sequence as shown in SEQ ID NO. 1 to SEQ ID NO. 12.

[0167] 1.2.2, design of exogenous DNA fragment

[0168] As shown in FIG. 5, because the GFP structure inserted by the exogenous gene is started by the promoter of the endogenous TRAC gene, PD-1 gene, IL-2 gene, and TGFBR2 gene, and is inserted at the 5'UTR site, 5'UTR to 3'UTR site, and 3'UTR site, respectively, T2A or IRES regulatory elements are added in front of GFP for different regions; using the principle of homologous recombination, the same left and right homologous arm (LA, RA) nucleic acid sequences as the corresponding nick site nucleic acid sequences are designed at both ends of the GFP gene fragment, and an exogenous DNA fragment structure containing the GFP gene, i.e., a GFP homologous mediated repair template, is obtained.

[0169] According to the 12 groups of gRNA nucleic acid sequences designed in the first step of the embodiment, the nucleic acid sequences of the respective homologous mediated repair templates (LA, RA) are shown in SEQ ID NO. 51-SEQ ID NO. 74 as described above.

[0170] 1.3, manufacturing double-stranded DNA nicks

[0171] By electroporation, the 5'UTR site, 5'UTR to 3'UTR site, and 3'UTR site of the TRAC gene, PD-1 gene, IL-2 gene, and TGFBR2 gene of the 12 groups of T cells are knocked out, respectively, to manufacture respective corresponding double-stranded DNA nicks, as follows:

[0172] The activated T cell suspension of each group was subjected to magnetic bead removal after the preheating of DPBS and the mixing of 12 groups of T cells with complete medium in a 37°C incubator.

[0173] After the magnetic bead removal, each group of cells was counted, centrifuged at 500g for 5 min, and the supernatant was discarded. Each group of T cell precipitate was resuspended with 1 mL of 2% FBS+DPBS washing solution to obtain a cell suspension, and each group of cell suspension was placed in a 37°C incubator for standby.

[0174] After incubation of the RNP system at room temperature for 15 min, each group of T cell suspension after magnetic bead removal was taken out from the 37°C incubator and transferred to a centrifuge tube, and centrifuged at 100g for 10 min. After centrifugation, the supernatant was discarded, and 2x10 6 cells / 20μL of Lonza electroporation buffer was added to each group of cell precipitate; wherein the components of the Lonza electroporation buffer (SuppLement 1:P3 cell line solution=1:4.5) are shown in Table 1.

[0175] Table 1 Components of Lonza electroporation buffer

[0176] Mix 12 groups of 20 μL cell suspensions with 2.9 μL of the incubated RNP system respectively to obtain 12 groups of cell RNP mixtures, and then transfer each group of cell RNP mixture into 12 groups of 16-hole electroporation holes for electroporation. After electroporation, immediately add 80 μL of preheated DPBS to each electroporation hole, and then transfer the 16-hole electroporation plate to a 37°C incubator for incubation for 15 min; the 5'UTR site, 5'UTR to 3'UTR site and 3'UTR site on the TRAC gene, PD-1 gene, IL-2 gene and TGFBR2 gene of the 12 groups of T cells are knocked out (see Table 3 for details); the RNP electroporation system component allocation is shown in Table 2.

[0177] Table 2 RNP electroporation system component table

[0178] The reagent "TRAC-gRNA, PD-1-gRNA, IL-2-gRNA or TGFBR2-gRNA" in Table 2 is a general term for gRNA corresponding to each endogenous gene, which can represent gRNA1, gRNA2 or gRNA3, which respectively correspond to the gRNA in Table 3 of the present embodiment; therefore, Table 6 actually corresponds to 12 groups of RNP electroporation system components.

[0179] 1.4, insertion of exogenous GFP gene

[0180] The 12 groups of GFP homology-mediated repair templates designed in step 1.2.2 of the present embodiment are constructed into 12 groups of AAV vectors, and 12 segments of exogenous DNA fragments are delivered by using electroporation.

[0181] After electroporation, 20 μl of AAV virus is added to 12 groups of X-VIVO complete medium, and then the 12 groups of cell suspensions incubated in a 37°C incubator are transferred into 12 groups of RNP electroporation systems to obtain 12 groups of gene-edited T cells, which are placed in a 37°C, 5% CO2 constant temperature incubator for overnight culture. The 12 segments of GFP gene fragments are inserted into the 5'UTR site, 5'UTR to 3'UTR site and 3'UTR site on the TRAC gene, PD-1 gene, IL-2 gene and TGFBR2 gene in the 12 groups of T cells by 12 groups of AAV respectively by electroporation, to obtain the corresponding engineering modified T cells, as shown in Table 3.

[0182] The gene expression (knockout rate and knock-in rate) in T cells is verified by flow cytometry, and the results are shown in Table 3.

[0183] Table 3 Gene expression in engineering modified T cells

[0184] As can be seen from Table 3, after the DNA cut made by the gene editing method of the present application at different sites (e.g., 5'UTR site, 5'UTR to 3'UTR site and 3'UTR site) in different endogenous genes (e.g., TRAC gene, PD-1 gene, IL-2 gene, TGFBR2 gene) and the insertion of an exogenous DNA fragment, the exogenous DNA fragment can be normally expressed.

[0185] Example 2

[0186] The purpose of this example is to verify whether the genes in each exogenous DNA fragment are expressed after the insertion of an exogenous DNA fragment into a double-stranded DNA cut in a target gene by different vectors and in different delivery modes.

[0187] In this example, the vectors are AAV, plasmid, PCR amplicon, ssDNA, etc.; the endogenous gene is the TRAC gene of T cells, and the cut site is the 5'UTR to 3'UTR site; and the exogenous DNA fragment is the fluorescent protein GFP gene.

[0188] 2.1, T cell acquisition and activation

[0189] The content of step 1.1 in Example 1 is the same.

[0190] 2.2, design of nucleic acid sequence of gRNA and structure of GFP

[0191] 2.2.1, design of nucleic acid sequence of gRNA of endogenous gene

[0192] Prepare 7 groups of T cells, and design 7 groups of corresponding TRAC-gRNA2 nucleic acid sequences according to the 5'UTR to 3'UTR site on the TRAC gene of each group of T cells, as shown in SEQ ID NO. 2.

[0193] 2.2.2, design of structure of exogenous DNA fragment containing GFP gene

[0194] As shown in FIG. 6, since the exogenous inserted GFP structure is started by the promoter of the endogenous TRAC gene and inserted at the 5'UTR to 3'UTR site, a T2A regulatory element is added in front of the GFP; using the principle of homologous recombination, left and right homologous arms (LA, RA) are designed at both ends of the GFP gene fragment, respectively, which are the same as the corresponding site, to obtain the structure of the exogenous DNA fragment containing the GFP gene, i.e., the GFP homologous mediated repair template. The nucleic acid sequences of the 7 groups of TRAC-5'UTR~3'UTR-gRNA2 corresponding homologous mediated repair templates (LA, RA) are SEQ ID NO. 53 and SEQ ID NO. 54.

[0195] 2.3, making double-stranded DNA cut on T cells

[0196] Knockout of the 5'UTR to 3'UTR site of the TRAC gene in 7 groups of T cells was achieved by electroporation as follows:

[0197] For each of the 7 groups of T cells, preheat DPBS in a 37°C incubator and mix it with the complete culture medium of each group of T cells. Then, demagnetize the activated T cell suspensions of each group.

[0198] After removing the magnetic beads, count the cells in each group and centrifuge at 500 g for 5 min. Discard the supernatant and resuspend the T cell pellet in 1 mL of 2% FBS + DPBS. Place the cell resuspension in a 37°C incubator until ready for use.

[0199] After incubating the RNP system for 15 minutes at room temperature, the T cells with demagnetized beads were removed from the 37°C incubator and transferred to a centrifuge tube. The cells were centrifuged at 100 g for 10 minutes. After the centrifugation was complete, the supernatant was discarded and 2 × 10 cells were added to each group. 6 Add Lonza electroporation buffer to the cell pellet in an amount of 20 μL. The components of Lonza electroporation buffer are shown in Table 1.

[0200] Seven groups of 20 μL of cells were mixed with 3.4 μL of incubated RNP system to obtain seven groups of cell RNP mixtures. Each group of cell RNP mixtures was then transferred to seven groups of 16-well electroporation wells for electroporation. After electroporation, 80 μL of preheated DPBS was immediately added to each electroporation well, and the plate was moved to a 37°C incubator and incubated for 15 minutes together with the 16-well electroporation plate. The 5'UTR to 3'UTR site on the TRAC gene in the seven groups of T cells was knocked out. The composition of the RNP electroporation system is shown in Table 4.

[0201] Table 4 RNP electroporation system component distribution

[0202] 2.4. Insertion of exogenous GFP gene

[0203] In this embodiment, the exogenous GFP gene can be inserted into the DNA incision by AAV vector delivery or LNP (including plasmids, PCR amplicons, ssDNA and other vectors). Depending on the different vectors and delivery methods, the insertion of the exogenous GFP gene can take the following two forms.

[0204] 2.4.1 AAV vector-mediated exogenous GFP gene insertion

[0205] A set of GFP homology-mediated repair templates designed in step 2.2.2 of this example was constructed into an AAV vector, and DNA fragments were delivered using a viral approach, as shown in Table 6.

[0206] After the end of the electroporation, 20 μl of AAV virus was added to the X-VIVO complete medium, the cell suspension incubated in a 37°C incubator was transferred into the RNP electroporation system, and the gene-edited T cells were placed in a 37°C, 5% CO2 constant temperature incubator for overnight culture. The GFP gene fragment was inserted into the 5'UTR to 3'UTR site on the TRAC gene in the T cells by AAV to obtain the engineered T cells, as shown in Table 6.

[0207] 2.4.2 Plasmid, PCR amplicon, ssDNA vector-mediated insertion of exogenous GFP gene

[0208] The 6 groups of GFP homology-mediated repair templates designed in step 2.2.2 of this example were constructed into plasmids, PCR amplicons, ssDNA, etc. (of which 2 groups of plasmids, PCR amplicons, and ssDNA vectors), and DNA fragment delivery was performed using electroporation and LNP cell methods, as shown in Table 6.

[0209] After the end of the electroporation, 20 μl of AAV virus was added to the X-VIVO complete medium, the cell suspension incubated in a 37°C incubator was transferred into the RNP electroporation system, and the gene-edited T cells were placed in a 37°C, 5% CO2 constant temperature incubator for overnight culture. The GFP gene fragment was inserted into the 5'UTR to 3'UTR site on the TRAC gene in the T cells by AAV to obtain the engineered T cells, as shown in Table 6.

[0210] Table 5 RNP electroporation system component table

[0211] The three groups of RNP electroporation system component tables in Table 5 are: ① group components: PGA, TRAC-gRNA2, plasmid, and TrueCut Cas9; ② group components: PGA, TRAC-gRNA2, PCR amplicon, and TrueCut Cas9; and ③ group components: PGA, TRAC-gRNA2, ssDNA, and TrueCut Cas9.

[0212] The gene expression (knockout rate and knock-in rate) in the T cells was verified by flow cytometry, and the results are shown in Table 6.

[0213] Table 6 Gene expression in engineered T cells

[0214] As can be seen from Table 6, by the gene editing method of the present application, the exogenous gene GFP can be delivered by different vectors (such as AAV, plasmid, PCR amplicon, ssDNA vector) to the DNA cut and can be normally expressed.

[0215] Example 3

[0216] The purpose of this example is to verify whether the genes in the plurality of different exogenous DNA fragments are expressed with the endogenous genes after being inserted into different double-stranded DNA cut sites on different endogenous genes.

[0217] In this example, the vector is AAV; the endogenous genes are the TRAC gene and the IL-2 gene of T cells, the cut sites are the 5' UTR site and the 3' UTR site; and the exogenous DNA fragments are the DNA fragments of the GFP gene, the CAR gene, the anti-PD1 gene and the IL-15 gene.

[0218] 3.1, T cell acquisition and activation

[0219] The content of step 1.1 in Example 1 is the same.

[0220] 4.2, design of nucleic acid sequence of gRNA and structure of exogenous gene

[0221] 4.2.1, design of nucleic acid sequence of gRNA of endogenous gene

[0222] Prepare 8 groups of T cells, and according to the 5' UTR site and the 3' UTR site on the TRAC gene, the PD-1 gene, the IL-2 gene and the TGFBR2 gene of each group of T cells, the nucleic acid sequence of the respective gRNA is designed as follows:

[0223] 1) The 5' UTR site of the TRAC gene is shown as SEQ ID NO. 1;

[0224] 2) The 3' UTR site of the TRAC gene is shown as SEQ ID NO. 3;

[0225] 3) The 5' UTR site of the PD-1 gene is shown as SEQ ID NO. 4;

[0226] 4) The 3' UTR site of the PD-1 gene is shown as SEQ ID NO. 6;

[0227] 5) The 5' UTR site of the IL-2 gene is shown as SEQ ID NO. 7;

[0228] 6) The 3' UTR site of the IL-2 gene is shown as SEQ ID NO. 9;

[0229] 7), TGFBR2 gene 5'UTR site, as shown in SEQ ID NO. 10;

[0230] 8), TGFBR2 gene 3'UTR site, as shown in SEQ ID NO. 12.

[0231] 3.2.2, design of exogenous gene structure

[0232] In this embodiment, the exogenous DNA fragments are respectively DNA fragments containing GFP gene, CAR gene, IL-15 gene and anti-PD-1 gene.

[0233] As shown in Figure 7, since the single gene structure inserted by the exogenous DNA fragment is started by the promoter of the endogenous TRAC gene, PD-1 gene, IL-2 gene and TGFBR2 gene, and is inserted at the 5'UTR site and the 3'UTR site, respectively, T2A or IRES regulatory elements are added in front of the single gene for different regions. In addition, since it is necessary to insert different exogenous genes into the corresponding double-stranded DNA cut at one time, it is necessary to concatenate two or more exogenous genes into the vector, and finally, using the principle of homologous recombination, left and right homologous arms (LA, RA) identical to the corresponding sites are designed at both ends of the exogenous gene fragment, respectively, to obtain the corresponding exogenous DNA fragment structure, i.e., DNA fragments containing GFP gene, CAR gene, IL-15 gene and anti-PD-1 gene homologous repair template.

[0234] According to the 8 groups of gRNA nucleic acid sequences designed in step 4.2.1 of this embodiment, the nucleic acid sequences of the corresponding homologous repair templates (LA, RA) are as follows:

[0235] 1), TRAC gene 5'UTR site, LA / RA homologous arms are shown in SEQ ID NO. 51 and 52, respectively;

[0236] 2), TRAC gene 3'UTR site, LA / RA homologous arms are shown in SEQ ID NO. 55 and 56, respectively;

[0237] 3), PD-1 gene 5'UTR site, LA / RA homologous arms are shown in SEQ ID NO. 57 and 58, respectively;

[0238] 4), PD-1 gene 3'UTR site, LA / RA homologous arms are shown in SEQ ID NO. 61 and 62, respectively;

[0239] 5), IL-2 gene 5'UTR site, LA / RA homologous arms are shown in SEQ ID NO. 63 and 64, respectively;

[0240] 6), IL-2 gene 3'UTR site, LA / RA homologous arms are shown in SEQ ID NO. 67 and 68, respectively;

[0241] 7), TGFBR2 gene 5'UTR site, LA / RA homologous arms are shown in SEQ ID NO. 69 and 70, respectively;

[0242] 8), TGFBR2 gene 3'UTR site, LA / RA homologous arms are shown in SEQ ID NO. 73 and 74, respectively.

[0243] 3.3, manufacturing a plurality of double-stranded DNA cuts

[0244] By electrotransformation, the 5'UTR site and 3'UTR site on the TRAC gene, PD-1 gene, IL-2 gene, and TGFBR2 gene of the 8 groups of T cells in step 3.2.1 of the present embodiment were knocked out respectively, to manufacture the corresponding double-stranded DNA cuts respectively, as follows:

[0245] 8 groups of T cells, preheat DPBS with 8 groups of T cell complete culture medium respectively in a 37°C incubator, and then remove the magnetic beads from the activated T cell suspension of each group;

[0246] After removing the magnetic beads, count the cells in each group, centrifuge at 500g for 5 min, discard the supernatant, resuspend the T cell precipitate in each group with 1 mL of 2% FBS+DPBS washing solution, and place the cell resuspension of each group in a 37°C incubator for standby;

[0247] After incubating the RNP system at room temperature for 15 min, remove the T cells from which the magnetic beads have been removed from the 37°C incubator and transfer them to a centrifuge tube, centrifuge at 100g for 10 min; after centrifugation, discard the supernatant, and add Lonza electrotransformation buffer to each group of cell precipitate at 2x10 6 cells / 20μL; wherein the components of the Lonza electrotransformation buffer are shown in Table 1.

[0248] Mix 8 groups of 20μL cells with 3.4μL of the incubated RNP system to obtain 8 groups of cell RNP mixtures, and then transfer each group of cell RNP mixture to 8 groups of 16-hole electrotransformation holes, immediately after electrotransformation, add 80μL of preheated DPBS to each electrotransformation hole, and transfer the 16-hole electrotransformation plate to a 37°C incubator for incubation for 15 min; thereby achieving the knockout of the TRAC gene, PD-1 gene, IL-2 gene, and 5'UTR site and 3'UTR site on the TGFBR2 gene of the 12 groups of T cells (see Table 9 for details); the components of the RNP electrotransformation system are prepared as shown in Tables 7 and 8.

[0249] Table 7 Components of RNP electrotransformation system

[0250] Table 8 RNP electroporation system component table

[0251] 3.4, insertion of exogenous DNA fragments

[0252] The 8 groups of homology-mediated repair templates designed in step 3.2.2 of this embodiment, each containing 8 segments of exogenous DNA fragments corresponding to the GFP gene, the CAR gene, the IL-15 gene and the anti-PD-1 gene, were respectively constructed into 8 groups of AAV vectors, and each of the 8 segments of exogenous DNA fragments was delivered by electroporation.

[0253] After the end of electroporation, 20 μl of AAV virus was added to the 8 groups of X-VIVO complete culture medium, and the 8 groups of cell suspensions incubated in a 37°C incubator were respectively transferred into 8 groups of RNP electroporation systems. The 8 groups of T cells edited by gene editing were placed in a 37°C, 5% CO2 constant temperature incubator for overnight culture. Through 8 groups of AAV, 8 segments of exogenous genes such as the GFP gene fragment, the exogenous CAR gene fragment, the exogenous IL-15 gene fragment and the exogenous anti-PD-1 fragment were respectively delivered to the 5'UTR site and the 3'UTR site on the TRAC gene, the PD-1 gene, the IL-2 gene and the TGFBR2 gene of the 8 groups of T cells by electroporation, to obtain the corresponding engineering modified T cells (see Table 9 for details).

[0254] The gene expression (knockout rate and knock-in rate) in T cells was verified by flow cytometry detection, and the results are shown in Table 9.

[0255] Table 9 Gene expression in engineering modified T cells

[0256] As can be seen from Table 9, by the gene editing method of the present application, the knockout of different sites (such as the 5'UTR site, the 3'UTR site) in different endogenous genes (such as the TRAC gene, the PD-1 gene, the IL-2 gene, the TGFBR2 gene) can make multiple DNA cuts; at the same time, after multiple exogenous DNA fragments (such as the GFP gene fragment, the CAR gene fragment, the IL-15 gene fragment and the anti-PD-1 fragment) are inserted into the corresponding DNA cut site, each exogenous gene and each endogenous gene can be normally expressed.

[0257] Example 4

[0258] The purpose of this embodiment is to verify whether the genes in each exogenous DNA fragment and the endogenous genes are expressed after inserting multiple different exogenous DNA fragments into each double-stranded DNA cut site on different endogenous genes.

[0259] In this embodiment, the vector is AAV; the endogenous gene is the TRAC gene, PD-1 gene, IL-2 gene and TGFBR2 gene of T cells, the DNA site is the 5'UTR site and 3'UTR site; the exogenous DNA fragment is a DNA fragment of a fluorescent protein (such as a GFP, RFP, BFP, YFP gene), a CAR gene, an antibody protein (anti-PD1, anti-CTLA4) and a cytokine (such as an IL-10 gene, an IL-18 gene).

[0260] 4.1, T cell acquisition and activation

[0261] The content of step 1.1 in embodiment 1 is the same.

[0262] 4.2, design of nucleic acid sequence of gRNA and structure of exogenous gene

[0263] 4.2.1, design of nucleic acid sequence of gRNA

[0264] Prepare 8 groups of T cells, and according to the 5'UTR site and 3'UTR site on the TRAC gene, PD-1 gene, IL-2 gene and TGFBR2 gene of each group of T cells, the nucleic acid sequence of the corresponding gRNA is designed as follows:

[0265] 1), the 5'UTR site of the TRAC gene, as shown in SEQ ID NO. 1;

[0266] 2), the 3'UTR site of the TRAC gene, as shown in SEQ ID NO. 3;

[0267] 3), the 5'UTR site of the PD-1 gene, as shown in SEQ ID NO. 4;

[0268] 4), the 3'UTR site of the PD-1 gene, as shown in SEQ ID NO. 6;

[0269] 5), the 5'UTR site of the IL-2 gene, as shown in SEQ ID NO. 7;

[0270] 6), the 3'UTR site of the IL-2 gene, as shown in SEQ ID NO. 9;

[0271] 7), the 5'UTR site of the TGFBR2 gene, as shown in SEQ ID NO. 10;

[0272] 8), the 3'UTR site of the TGFBR2 gene, as shown in SEQ ID NO. 12.

[0273] 4.2.2, design of exogenous gene structure

[0274] In this embodiment, the exogenous DNA fragments are selected to be the exogenous DNA fragments corresponding to the gene combinations of CAR, GFP, RFP, BFP, YFP, IL-18, IL-10, anti-CTLA4, etc. For example, the CAR-RFP gene combination DNA fragment, the IL-18-BFP gene combination DNA fragment, the IL-10-YFP gene combination DNA fragment, and the anti-CTLA4-GFP gene combination DNA fragment.

[0275] As shown in FIG. 8, since the single gene structure inserted by each exogenous gene is started by the promoter of the endogenous TRAC gene, the PD-1 gene, the IL-2 gene, and the TGFBR2 gene, and is inserted at the 5'UTR site and the 3'UTR site, respectively, T2A or IRES regulatory elements are added in front of the single gene for different regions. In addition, since different exogenous genes need to be inserted into the corresponding multiple double-stranded DNA cuts at one time, two or more exogenous genes need to be connected in the vector, and finally, the same left and right homologous arms (LA, RA) corresponding to the corresponding sites are designed at both ends of the exogenous gene fragment according to the principle of homologous recombination, to obtain the corresponding exogenous DNA fragment structure, i.e., the DNA fragment homologous repair template corresponding to each exogenous DNA gene. According to the 8 groups of gRNA nucleic acid sequences designed in step 4.2.1 of this embodiment, the nucleic acid sequences of the homologous repair templates (LA, RA) designed correspondingly are as follows:

[0276] 1) The LA / RA homologous arms at the 5'UTR site of the TRAC gene are shown in SEQ ID NO. 51 and 52, respectively;

[0277] 2) The LA / RA homologous arms at the 3'UTR site of the TRAC gene are shown in SEQ ID NO. 55 and 56, respectively;

[0278] 3) The LA / RA homologous arms at the 5'UTR site of the PD-1 gene are shown in SEQ ID NO. 57 and 58, respectively;

[0279] 4) The LA / RA homologous arms at the 3'UTR site of the PD-1 gene are shown in SEQ ID NO. 61 and 62, respectively;

[0280] 5) The LA / RA homologous arms at the 5'UTR site of the IL-2 gene are shown in SEQ ID NO. 63 and 64, respectively;

[0281] 6) The LA / RA homologous arms at the 3'UTR site of the IL-2 gene are shown in SEQ ID NO. 67 and 68, respectively;

[0282] 7), TGFBR2 gene 5'UTR site, LA / RA homologous arms are shown in SEQ ID NO. 69 and 70, respectively;

[0283] 8), TGFBR2 gene 3'UTR site, LA / RA homologous arms are shown in SEQ ID NO. 73 and 74, respectively.

[0284] 4.3, making multiple DNA nicks on T cells

[0285] By electroporation, the 5'UTR site and 3'UTR site of the TRAC gene, PD-1 gene, IL-2 gene, and TGFBR2 gene of the 8 groups of T cells in step 4.2.1 of this example were treated, respectively, as follows:

[0286] 8 groups of T cells, preheat DPBS with complete culture medium for each group of T cells in a 37°C incubator, and then remove the magnetic beads from each group of activated T cell suspension;

[0287] After removing the magnetic beads, count each group of cells, centrifuge at 500g for 5 min, discard the supernatant, resuspend each group of T cell pellets with 1 mL of 2% FBS+DPBS wash solution, and place each group of cell resuspension in a 37°C incubator for standby;

[0288] After incubating the RNP system at room temperature for 15 min, remove the 8 groups of T cells without magnetic beads from the 37°C incubator and transfer them to centrifuge tubes, centrifuge at 100g for 10 min; after centrifugation, discard the supernatant, and add Lonza electroporation buffer to each group of cell pellets at 2x10 6 The components of the Lonza electroporation buffer are shown in Table 1.

[0289] Mix 8 groups of 20 μL cells with 3.4 μL of the incubated RNP system to obtain 8 groups of cell RNP mixtures, and then transfer each group of cell RNP mixture to 8 groups of 16-hole electroporation holes. After electroporation, immediately add 80 μL of preheated DPBS to each electroporation hole, and transfer the 16-hole electroporation plate to a 37°C incubator for incubation for 15 min; achieve knockout of the TRAC gene, PD-1 gene, IL-2 gene, and 5'UTR site and 3'UTR site of the TGFBR2 gene of the 8 groups of T cells, respectively (see Table 12 for details); due to the difference between the endogenous gene and the exogenous DNA fragment, the components of the RNP electroporation system will also be different, as shown in Tables 10 and 11.

[0290] Table 10 RNP electroporation system component table

[0291] Table 11 RNP electroporation system component table

[0292] 4.4, insertion of exogenous genes

[0293] Eight groups of homology-mediated repair templates containing the corresponding eight segments of exogenous DNA fragments of fluorescent proteins (such as GFP, RFP, BFP, YFP genes), CAR genes, antibody proteins (anti-PD1, anti-CTLA4), and cytokines (such as IL-10 genes, IL-18 genes) designed in step 4.2.2 of this example were respectively constructed into the same eight groups of AAV vectors, and each of the eight segments of exogenous DNA fragments was delivered by electroporation.

[0294] After the end of electroporation, 20 μl of AAV virus was added to the eight groups of X-VIVO complete culture medium, and the system was mixed. After incubation in a 37°C incubator, the eight groups of cell suspensions were transferred into the eight groups of RNP electroporation systems, and the eight groups of gene-edited T cells were placed in a 37°C, 5% CO2 constant temperature incubator for overnight culture. The eight segments of exogenous DNA fragments were inserted into the 5'UTR site and the 3'UTR site of the TRAC gene, the PD-1 gene, the IL-2 gene, and the TGFBR2 gene of the T cells by the eight groups of AAV respectively by electroporation, and the corresponding engineering modified T cells were obtained (see Table 12 for details).

[0295] The gene expression (knockout rate and knock-in rate) in the T cells was verified by flow cytometry detection, and the results are shown in Table 12.

[0296] Table 12 Gene expression in engineering modified T cells

[0297] As can be seen from Table 12, by the gene editing method of the present application, DNA nicks are made in different endogenous genes (such as TRAC gene, PD-1 gene, IL-2 gene, TGFBR2 gene) at different sites (such as 5'UTR site, 3'UTR site), and after the insertion of DNA fragments containing multiple exogenous genes, such as fluorescent proteins (such as GFP, RFP, BFP, YFP genes), CAR genes, antibody proteins (anti-PD1, anti-CTLA4), and cytokines (such as IL-10 genes, IL-18 genes), each exogenous gene and endogenous gene can be normally expressed.

[0298] Example 5

[0299] The purpose of this example is to verify whether the inhibitors in the delivery system of the vector delivering exogenous genes can normally express the exogenous genes and the endogenous genes.

[0300] In this embodiment, the vector is AAV, the CAR exogenous gene is inserted into the 5'UTR to 3'UTR site on the TRAC gene of T cells, and the IL-15+GFP exogenous gene is inserted into the 3'UTR site on the IL-2 gene of T cells; the difference in gene editing efficiency of different inhibitor combinations is compared;

[0301] 5.1, T cell acquisition and activation

[0302] The same as the content of step 1.1 in embodiment 1.

[0303] 5.2, design of nucleic acid sequence of gRNA and IL-15+GFP structure

[0304] 5.2.1, design of nucleic acid sequence of endogenous gene gRNA

[0305] Prepare 9 groups of T cells, and design the nucleic acid sequence of gRNA corresponding to the 5'UTR to 3'UTR site on the TRAC gene and the 3'UTR site on the IL-2 gene of T cells according to the 5'UTR to 3'UTR site on the TRAC gene and the 3'UTR site on the IL-2 gene of 9 groups of T cells; wherein the nucleic acid sequence of TRAC-gRNA2 gene corresponding to 5'UTR to 3'UTR site is shown as SEQ ID NO. 2, and the nucleic acid sequence of IL-2-gRNA3 gene corresponding to 3'UTR site is shown as SEQ ID NO. 9.

[0306] 5.2.2, design of exogenous gene CAR and IL-15+GFP structure

[0307] As shown in Figure 9, since the CAR structure is started by the promoter of the endogenous TRAC, a T2A regulatory element is added in front of the CAR. In addition, in order to be able to express IL-15+GFP protein while expressing IL-2, an IRES regulatory element is added in front of IL-15+GFP in this embodiment. Since it is necessary to insert different exogenous genes into the corresponding double-stranded DNA cut at one time, it is necessary to concatenate two or more exogenous genes into the vector, and finally, using the principle of homologous recombination, the same left and right homologous arms (LA, RA) are designed at both ends of the CAR and IL-15+GFP gene fragments, respectively, to obtain the structure of double-target genes (CAR, IL-15+GFP), i.e. the homologous mediated repair template corresponding to CAR and IL-15+GFP, respectively.

[0308] According to the gRNA nucleic acid sequence designed in step 6.2.1 of the present embodiment, the nucleic acid sequences of the homology-mediated repair templates (LA, RA) corresponding to TRAC-gRNA2 are shown in SEQ ID NO. 53 and 54, respectively, and the nucleic acid sequences of the homology-mediated repair templates (LA, RA) corresponding to IL-2-gRNA3 are shown in SEQ ID NO. 71 and 72, respectively.

[0309] 5.3, DNA nicking on TRAC gene and IL-2 gene on T cells

[0310] By electroporation, knockout of 9 groups of T cells on the 5'UTR to 3'UTR site of the TRAC gene and the 3'UTR site of the IL-2 gene, respectively, are as follows:

[0311] 9 groups of T cells, preheat DPBS with complete culture medium for each group of T cells in a 37°C incubator, and then perform magnetic bead removal on the activated T cell suspension of each group;

[0312] After magnetic bead removal, count the cells in each group, centrifuge at 500g for 5 min, discard the supernatant, resuspend the T cell pellet in each group with 1 mL of 2% FBS+DPBS wash solution, and place the cell resuspension of each group in a 37°C incubator for standby;

[0313] After incubating the RNP system at room temperature for 15 min, remove each group of T cells from the 37°C incubator and transfer them to a centrifuge tube, centrifuge at 100g for 10 min; after centrifugation, discard the supernatant, and add 2x10 6 Add Lonza electroporation buffer to each cell pellet at 20μL per 20μL; the components of the Lonza electroporation buffer are shown in Table 1.

[0314] Mix 9 groups of 20μL cells with 3.4μL of the incubated RNP system to obtain 9 groups of cell RNP mixtures, and then transfer each group of cell RNP mixture to 9 groups of 16-hole electroporation holes. After electroporation, immediately add 80μL of preheated DPBS to each electroporation hole, and transfer the 16-hole electroporation plate to a 37°C incubator for incubation for 15 min; achieve knockout of the 5'UTR to 3'UTR site of the TRAC gene and the 3'UTR site of the IL-2 gene on 4 groups of T cells (as shown in Table 14); the component allocation table of the RNP electroporation system is shown in Table 14.

[0315] Table 13 RNP electroporation system component table

[0316] In Table 13, two groups of RNP electric conversion system component formulations are given: Group 1: PGA, TRAC-gRNA2 and TrueCut Cas9; Group 2: PGA, IL-2-gRNA3 and TrueCut Cas9.

[0317] 5.4, insertion of exogenous genes

[0318] The 9 groups of exogenous CAR, IL-15+GFP gene homology-mediated repair templates designed in step 5.2.2 of this example were constructed into the same AAV vector, and DNA fragment delivery was performed by electric conversion.

[0319] After electric conversion, 20 μl of AAV virus was added to the X-VIVO complete culture medium to obtain a culture medium mixing system, and inhibitors (such as one or more of AZD7648, M3814 or small molecule compounds such as RS-1 and L755507) were added to the culture medium mixing system. After mixing the system, the cell suspension incubated in a 37°C incubator was transferred into the RNP electric conversion system, and the gene-edited T cells were placed in a 37°C, 5% CO2 constant temperature incubator for overnight culture. The CAR and IL-15+GFP gene fragments were inserted into the 5'UTR to 3'UTR site on the TRAC gene and the 3'UTR site on the IL-2 gene in the T cells by AAV, and the engineering modified T cells were obtained, as shown in Table 14.

[0320] The gene expression (knockout rate and knockin rate) in T cells was verified by flow cytometry, and the results are shown in Table 14.

[0321] Table 14 Gene expression in engineering modified T cells

[0322] As can be seen from Table 14, after adding inhibitors to the delivery system during the delivery of the exogenous gene to the nick site of the endogenous gene by the vector, it can be seen from groups 2 to 8 that the inhibitors can improve the introduction efficiency of the exogenous DNA fragment, that is, the inhibitors can inhibit the self-repair of double-stranded DNA nicks and improve the introduction efficiency of the exogenous DNA fragment; at the same time, the addition of the inhibitors does not affect the normal expression of the endogenous gene and the exogenous gene.

[0323] (ii) Functional verification of cells after gene editing

[0324] Example 6

[0325] 6.1, orthogonal test design of T cell gene editing method

[0326] The present embodiment will be designed by orthogonal combination experiment with the gene editing methods of T cells in embodiments 1 to 5, such as vector, transduction method, number and type of endogenous genes, gene editing site, number and type of inserted exogenous genes, and type of inhibitor, to show the universality and verify the preparation of T cell function; the orthogonal test design is shown in Table 15.

[0327] Table 15 Orthogonal test design table for preparation of engineered T cells

[0328] 6.2, Functional verification of engineered T cells

[0329] 6.2.1, Endogenous gene knockout expression rate and exogenous gene knockout expression rate

[0330] The universal verification of the combination of the method of the present application is carried out according to the design scheme in Table 15 of the orthogonal experiment, and the verification results are shown in Table 16.

[0331] Taking numbers 7 and 8 in Table 16 as examples, the function of CAR-T cells prepared by the method of the present application is described.

[0332] From the gene sequencing results shown in Figures 10 to 13, the knockout efficiency of gRNA corresponding to the nucleic acid sequence in numbers 7 and 8 in Table 16 on T cell PD-1 endogenous gene + IL-2 endogenous gene, TRAC endogenous gene + PD-1 endogenous gene is 97.77%, 96.43%, 94.87%, 97.23% respectively; that is, the gene knockout efficiency is relatively high. Figure 10 represents the PD-1 endogenous gene, Figure 11 represents the IL-2 endogenous gene, Figure 12 represents the TRAC endogenous gene, and Figure 13 represents the PD-1 endogenous gene.

[0333] After knocking out the endogenous genes PD-1 + IL-2 and TRAC + PD-1 in human immune T cells, the nucleic acid sequence shown in Table 18 numbers 7 and 8 is knocked in, and the corresponding CAR-T cells in Table 24 numbers 7 and 8 are simply referred to as 7-CAR-T and 8-CAR-T cells, respectively. The exogenous gene knockout efficiency results are shown in Figures 14 to 18. Figures 14 to 18 are divided into exogenous gene knockout gene expression rate graphs; among them, Figures 14 to 16 represent the knockout expression rate graphs of exogenous genes CAR, IL-12 and GFP in number 7, and Figures 17 to 18 represent the knockout expression rate graphs of exogenous genes CAR and IL-18 in number 8.

[0334] 6.2.2, T cell function verification

[0335] 7-CAR-T and 8-CAR-T cells were transferred to 24-well plates and incubated in a 37°C, 5% CO2 constant temperature incubator for standby.

[0336] NT cells (blank control sample), Nectin4-CAR-T cells (positive control cells), 7-CAR-T and 8-CAR-T cells, etc. were cultured respectively, and the number of cells was detected on the 5th, 7th, 9th, 11th, and 13th day, respectively, and the CAR positive rate, the expression of exogenous genes, and the expression of inserted endogenous genes of T cells were detected respectively; wherein, during the T cell culture process, the medium was supplemented and subcultured every 1-2 days. This part is prior art, and will not be described here.

[0337] The expansion detection results of the four kinds of T cells are shown in FIG. 19. As shown in FIG. 19, the expansion of NT cells (blank control sample) and Nectin4-CAR-T cells has little difference, and the expansion of 7-CAR-T and 8-CAR-T cells after electroporation has a certain influence on cell expansion, but the overall expansion of cells can meet the subsequent experimental requirements.

[0338] As shown in FIGS. 20-23, the CAR positive rate detection results of NT cells (blank control sample), Nectin4-CAR-T cells, 7-CAR-T and 8-CAR-T cells are 0.39%, 92.03%, 88.35%, and 85.96%, respectively; therefore, the expression of the CAR gene knocked in by electroporation is lower than that of normal CAR-T cells, but its function will not lose expression due to electroporation.

[0339] As shown in FIGS. 24-27, the four kinds of T cells, such as NT, Nectin4-CAR-T, 7-CAR-T, and 8-CAR-T cells, wherein the 7-CAR-T cells contain two kinds of exogenous genes: IL-12 and GFP, and the expression rate of the exogenous gene IL-18 of the 8-CAR-T cells is 45.20%, 48.34%, and 50.53%, respectively, which is better than the expression rate of NT and Nectin4-CAR-T.

[0340] The positive rate, the expression of exogenous genes, and the expression of inserted endogenous genes of the four kinds of T cells are shown in Table 17.

[0341] Table 17 Expression efficiency of endogenous genes of T cells after insertion of exogenous genes

[0342] As shown in Table 17, after the exogenous CAR and IL-12 gene are inserted into the 5'UTR to 3'UTR site of the endogenous IL-2 or PD-1 gene, respectively, the expression rate of the respective endogenous gene (10%, 9%) is much lower than that after the exogenous CAR and IL-18 gene are inserted into the 3'UTR site of the endogenous TRAC or PD-1 gene, respectively, the expression rate of the respective endogenous gene (99%, 98%); it is indicated that the insertion of the exogenous gene into the 5'UTR to 3'UTR site will affect the expression of the endogenous gene; therefore, when editing T cells, different gene sites need to be selected for knock-out and insertion according to different purposes.

[0343] 6.2.3, verification of the tumor killing rate of the engineered T cells

[0344] As shown in FIG. 28, the specific tumor killing rate curves of four T cells in the effector target ratio (E:T = 1:1). As shown in FIG. 28, the 7-CAR-T and 8-CAR-T cells after gene editing are significantly better than the NT cells and Nectin4-CAR-T cells without gene editing in terms of killing efficiency or tumor killing rate. The reason is that the target gene knocked into the IL-12 or IL-18 gene of the immune T cell is induced to express after being stimulated by the target antigen, which has a positive effect on the CAR-T cell, so the killing efficiency is better than that of the T cell without gene editing.

[0345] (III) Functional verification of exogenous genes on different immune cells

[0346] Example 7

[0347] 7.1, verification of the endogenous gene knock-out rate and the exogenous gene knock-in rate;

[0348] Taking No. 8 in Table 20 of Example 6 as an example, it is applied in immune cells such as T cells, NK cells, CIK cells, DC cells, and macrophage cells. The TRAC gene knock-out of these immune cells is determined, and the results are shown in Table 18.

[0349] Table 18: Gene knock-out rate table of each immune cell TARC

[0350] As shown in the gene knock-out efficiency results in Table 18, the TRAC gene knock-out efficiency of the gRNA corresponding to the nucleic acid sequence on the T cells, NK cells, CIK cells, DC cells, and macrophage cells is 93%, 92%, 90%, 91%, and 89%, respectively, indicating that the gene knock-out efficiency is relatively high.

[0351] The TRAC gene in T cells, NK cells, CIK cells, DC cells, and macrophages immunized in humans was knocked out, and the nucleic acid sequence of the exogenous gene CAR shown in the scheme corresponding to No. 8 in Table 18 was knocked in, and the nucleic acid sequence gRNA was knocked in T cells, NK cells, CIK cells, DC cells, and macrophages, respectively, into the corresponding TRAC gene knockout site. The results of the knock-in efficiency are shown in Figures 21 to 25.

[0352] In Figures 29 to 33, the respective corresponding knock-in efficiency figures represent the knock-in efficiency of the exogenous gene CAR on the TRAC gene of T cells, NK cells, CIK cells, DC cells, and macrophages, respectively. The respective corresponding knock-in efficiencies are 63.14%, 72.72%, 79.97%, 73.16%, and 66.39%, respectively. Thus, the knock-in efficiency of the exogenous gene in different immune cells is relatively high.

[0353] 7.2, immune cell expansion and growth verification

[0354] CAR-T, CAR-NK, CAR-CIK, CAR-DC, and CAR-macrophage cells obtained in the scheme corresponding to No. 7 in Table 18 of Example 6 were used, which were referred to as 7-CAR-T, 7-CAR-NK, 7-CAR-CIK, 7-CAR-DC, and 7-CAR-M, respectively.

[0355] The 7-CAR-T, 7-CAR-NK, 7-CAR-CIK, 7-CAR-DC, and 7-CAR-M cells were transferred to a 24-well plate and incubated at 37°C in a 5% CO2 incubator for further culture.

[0356] Ten kinds of cells, including NT cells, NK cells, CIK cells, DC cells, macrophages, 7-CAR-T, 7-CAR-NK, 7-CAR-CIK, 7-CAR-DC, and 7-CAR-M cells, were cultured, and the number of cells was detected on days 5, 7, 9, 11, and 13, respectively. The CAR positive rate, expression of the exogenous gene, and insertion of the endogenous gene were detected in T cells, respectively. During the cell culture process, the culture medium was supplemented and subcultured every 1-2 days. This part is prior art and will not be described here.

[0357] As shown in Figure 34, the results of the amplification detection of 10 kinds of cell growth. As can be seen from Figure 34, the relative proliferation of NT cells, NK cells, CIK cells, DC cells, macrophages (blank control) is faster, while 7-CAR-T, 7-CAR-NK, 7-CAR-CIK, 7-CAR-DC and 7-CAR-M cells after electroporation, the electroporation will have a certain influence on cell expansion, but the influence is not big, 7-CAR-T, 7-CAR-NK, 7-CAR-CIK, 7-CAR-DC and 7-CAR-M cells also expand, and the overall expansion can also meet the subsequent test requirements.

[0358] 7.3, immune cell knockout and knock-in verification

[0359] The immune cells in 7.2 are used, the endogenous gene is PD-1, the exogenous gene is IL-18, and the knockout or insertion site is the 3'UTR site.

[0360] As shown in Table 25, the positive rate, expression of exogenous gene, and expression detection results of the inserted endogenous gene of NT cells, NK cells, CIK cells, DC cells, macrophages, 7-CAR-T, 7-CAR-NK, 7-CAR-CIK, 7-CAR-DC and 7-CAR-M, etc. 10 kinds of cells are shown in Table 19.

[0361] Table 19: Knockout rate of each immune cell TARC gene

[0362] As can be seen from Table 19, the exogenous gene detection results of NT cells, NK cells, CIK cells, DC cells, macrophages, 7-CAR-T, 7-CAR-NK, 7-CAR-CIK, 7-CAR-DC and 7-CAR-M, etc. 10 kinds of cells show that the exogenous IL-18 gene knocked in by electroporation can be normally expressed; at the same time, since the exogenous gene is inserted into the 3'UTR position, it also does not affect the expression of the endogenous gene PD-1.

[0363] 7.4, verification of the tumor killing rate of immune cells

[0364] The immune cells in 7.2 are used, the endogenous gene is PD-1, the exogenous gene is IL-18, and the knockout or insertion site is the 3'UTR site.

[0365] [Corrected according to Rule 91 06.05.2024] As shown in Figures 35 to 39, the specific killing rate curve of 10 kinds of T cells such as NT cells, NK cells, CIK cells, DC cells, macrophages, 7-CAR-T, 7-CAR-NK, 7-CAR-CIK, 7-CAR-DC and 7-CAR-M at the effector-target ratio (E:T = 1:1); wherein Figure 35 represents the NT and 7-CAR-T cell killing rate curve, Figure 36 represents the NK and 7-CAR-NK cell killing rate curve, Figure 37 represents the DC and 7-CAR-DC cell killing rate curve, Figure 38 represents the CIK and 7-CAR-CIK cell killing rate curve, and Figure 39 represents the macrophage and 7-CAR-M cell killing rate curve.

[0366] As can be seen from Figures 35 to 39, the 7-CAR-T, 7-CAR-NK, 7-CAR-CIK, 7-CAR-DC and 7-CAR-M cells after gene editing have better killing efficiency or tumor killing rate than NT cells, NK cells, CIK cells, DC cells and macrophages without gene editing. It is thus confirmed that the gene editing technology in the present patent can be applied to various immune cells. Industrial applicability

[0367] The multi-site, multi-fragment gene knock-in technology provided by the present application can simultaneously and accurately insert multiple DNA fragments into different sites of the target genome by HDR (Homology directed repair) using a vector. This gene editing technology not only reduces the cost of gene editing, but also increases the editing efficiency and can be used for basic research and clinical application research.

Claims

1. A method for gene editing of simultaneous multi-loci knock-in of a DNA fragment, the method comprising, The method comprises the following steps: Making multiple double-stranded DNA cuts in the target gene by using CRISPR / Cas gene editing technology; Designing homologous recombination repair templates in the same number as the double-stranded DNA cuts; Designing an exogenous DNA fragment on each homologous recombination repair template; Constructing all the homologous recombination repair templates with the designed exogenous DNA fragments in a tandem manner on the same vector; Knocking each exogenous DNA fragment into the corresponding double-stranded DNA cut in the target gene by using the vector and homologous recombination DNA repair to achieve multi-site and multi-DNA fragment gene knock-in.

2. The method of gene editing of claim 1, wherein, The target gene includes TRAC gene, TCR response gene, and TGFBR2 receptor gene.

3. The method of gene editing of claim 2, wherein, The TCR response gene includes one or more of PD-1, 41-BB, and IL-2.

4. The method of gene editing of claim 1, wherein, When making double-stranded DNA cuts in the target gene by using CRISPR / Cas, the method further comprises the following steps: According to the nucleic acid sequence of the target gene, designing two or more gRNA nucleic acid sequences by using CRISPR / Cas gene editing technology; Under the action of CRISPR / Cas, knocking out the corresponding gRNA site on the target gene by using the designed gRNA nucleic acid sequence to make double-stranded DNA cuts in the same number as the gRNA nucleic acid sequence.

5. The method of gene editing of claim 4, wherein, The gRNA site is a 5'UTR site, a 5'UTR to 3'UTR site, or a 3'UTR site.

6. The method of gene editing of claim 4, wherein, When designing the homologous recombination repair template, the method further comprises the following steps: According to the designed gRNA nucleic acid sequence, designing upstream and downstream homologous nucleic acid sequences that can carry homologous recombination repair at both ends of each gRNA nucleic acid sequence to construct the homologous recombination repair template.

7. The method of gene editing of claim 1, wherein, The exogenous DNA fragment includes one or more of a CAR gene, a cytokine gene, and a functional protein.

8. The method of gene editing of claim 7, wherein, The cytokine gene includes one or two of IL-7 gene, IL-10 gene, IL-12 gene, IL-15 gene, IL-18 gene, and IL-21 gene; the functional protein includes a fluorescent protein and / or an antibody.

9. The method of gene editing of claim 8, wherein, The fluorescent protein includes one or more of GFP, RFP, BFP, and YFP gene; the antibody includes one or more of anti-PD1, anti-CTLA4, anti-TIGIT, anti-TIM3, and anti-LAG3.

10. The method of gene editing of claim 1, wherein, When designing an exogenous DNA fragment on each homologous recombination repair template, the method further comprises the following steps: According to the nucleic acid sequence on the left and right sides of each double-stranded DNA cut, designing upstream and downstream homologous nucleic acid sequences that can carry homologous recombination repair at both ends of each exogenous DNA fragment.

11. The method of gene editing of claim 10, wherein, When inserting each exogenous DNA fragment into the corresponding double-stranded DNA cut by using the vector, the method further comprises the following steps: According to the nucleic acid sequences on the left and right sides of the double-stranded DNA cut, each of the foreign DNA fragments in series in the same vector is taken as a different region of the vector as a homology-mediated repair template, and according to the upstream and downstream homologous nucleic acid sequences for homologous recombination-mediated repair carried by each of the foreign DNA fragments, the foreign DNA fragments are inserted into the corresponding double-stranded DNA cut.

12. The method of gene editing of claim 1, wherein, The vector comprises one of an adeno-associated virus, a plasmid, a PCR amplicon, and ssDNA.

13. The method of gene editing of claim 1, wherein, When the vector knocks in each of the foreign DNA fragments into the corresponding double-stranded DNA cut, the delivery mode of the vector for delivering the foreign DNA fragments is electroporation, a virus, or LNP cells.

14. The method of genetic editing of claim 13, wherein, An inhibitor is added to the delivery system when the vector inserts the foreign DNA fragments into the double-stranded DNA cut.

15. The method of genetic editing of claim 14, wherein, The inhibitor is one or more of a DNA-PK inhibitor, RS-1, and L755507.

16. The method of genetic editing of claim 15, wherein, The DNA-PK inhibitor includes one or both of AZD7648 and M3814.

17. An engineered modified cell prepared by the gene knock-in method according to any one of claims 1 to 16.

18. Use of the engineered modified cell according to claim 17 in the preparation of a drug for treating and / or preventing tumors and cancers.

Images