Nucleic acid delivery using direct binding of nucleic acids to rbcs

Abstract

Described herein are compositions and methods utilizing red blood cells having nucleic acids thereto. In certain embodiments, the nucleic acid is RNA or DNA.

Description

NUCLEIC ACID DELIVERY USING DIRECT BINDING OF NUCLEIC ACIDS TO RBCSTECHNICAL FIELD

[0001] The present invention relates generally to biotechnology and nucleic acid delivery systems. More specifically, it concerns compositions comprising red blood cells (RBCs) bound to nucleic acids. Embodiments of the invention include carriers to deliver therapeutic nucleic acids. RBC-based carriers can be used to elicit immune responses and ser e as therapeutic tools for the treatment of various diseases.BACKGROUND

[0002] Nucleic acid-sensing is an essential feature of the immune response, critical for triggering downstream inflammation. The nucleic acid-sensing TLRs (TLR3, 7, 8, and 9) are primarily localized intracellularly in the vesicular system. Although not previously known to be on erythrocytes, we have recently discovered the presence of TLR9 on the surface of mammalian erythrocytes. Notably, the interaction between CpG-DNA and erythrocyte TLR9 offers significant advantages to the host, as it accelerates erythrophagocytosis and facilitates DNA delivery to immune cells. Thus, erythrocytes emerge as early messengers, triggering critical inflammatory responses essential for host defense. Under basal conditions, RBCs were found to sequester CpG, serving as a physiological rheostat to maintain homeostasis by scavenging low levels of cell-free CpG-DNA.

[0003] Red blood cell (RBC) transfusion is a critical component of modern clinical and surgical practice. RBC transfusions have played a vital role in saving lives for several decades, and the demand continues to grow due to medical advancements and an aging population.

[0004] Parallel to the widespread use of RBCs in transfusion medicine, gene therapy has emerged as a promising strategy for treating a variety of conditions, including genetic disorders, cancers, viral infections, and neurological diseases. A major challenge in gene therapy is the efficient and targeted delivery of genetic material into cells, particularly ensuring that the therapeutic nucleic acids remain stable and are properly expressed in the desired cell types.

[0005] Various DNA and RNA delivery systems have been developed to overcome these challenges, including viral vectors, lipid nanoparticles, liposomes, and electroporation. However, these methods areassociated with several disadvantages. Viral vectors, while effective at transducing cells, may trigger immune responses, carry risks of insertional mutagenesis, and have limited cargo capacity. Non-viral approaches such as liposomes and nanoparticles often suffer from poor targeting efficiency, low cellular uptake, rapid clearance, and cytotoxicity. Physical methods like electroporation and microinjection, though useful in vitro, are generally impractical or damaging for “in vivo” applications. Moreover, many of these approaches are unsuitable for repeated dosing due to immunogenicity or toxicity concerns.

[0006] Because mature RBCs lack a nucleus and do not replicate, they are immunologically inert and can circulate in the bloodstream for extended periods without eliciting strong immune responses. Techniques have been developed to engineer RBC precursors to express exogenous proteins by introducing transgenes prior to terminal differentiation.

[0007] A significant obstacle to RNA-based therapies is the rapid degradation of oligonucleotides by cellular and serum nucleases. Therefore, there is a pressing need for improved methods and compositions that enhance the stability of therapeutic RNA, prevent nuclease degradation, and increase the efficiency of intracellular delivery and gene editing.

[0008] Accordingly, there is a need in biomedical and biotechnology for effective mechanisms to deliver immunogenic nucleic acids into target cells.SUMMARY OF THE INVENTION

[0009] Accordingly, the present invention provides carrier, composition, method of preparing and delivering the composition including a red blood cell having a nucleic acid molecule.

[0010] In one embodiment, the invention provides a carrier for nucleic acid comprising one or more red blood cells having at least one nucleic acid molecule adsorbed thereto.

[0011] In another embodiment, the invention provides a composition for delivery of nucleic acid comprising one or more red blood cells having at least one nucleic acid molecule absorbed thereto.

[0012] In an embodiment, the nucleic acid molecule is selected from the group consisting of exogenous nucleic acid, host-derived nucleic acid, synthetic nucleic acid, recombinant nucleic acid, viral nucleic acid, plasmid nucleic acid, chemically modified nucleic acid, and chimeric nucleic acid.

[0013] In another embodiment, the at least one nucleic acid molecule is adsorbed independently of the receptors.

[0014] In yet another embodiment, the at least one nucleic acid molecule is adsorbed on RBCs by receptor dependent binding.

[0015] In another exemplary embodiment, the red blood cells (RBCs) are highly purified red blood cells. The RBCs have a purity of at least 95 percent.

[0016] In an exemplary embodiment, the RBCs have a purity of 98% percent or more.

[0017] In yet another exemplary embodiment, the red blood cells (RBCs) are substantially unmodified red blood cells.

[0018] In yet another exemplary embodiment, the invention includes modifying the RBCs to increase binding affinity for the nucleic acids.

[0019] In an embodiment, the nucleic acid molecule is a DNA or RNA.

[0020] In an embodiment, the RNA is bound to the RBC through TLR7 ligand present on a surface of the RBC.

[0021] In an embodiment, the DNA is bound to the RBC through TLR9 ligand present on a surface of the RBC.

[0022] In an embodiment, wherein the RNA is selected from messenger RNA (mRNA), small interfering RNA (siRNA), microRNA (miRNA), self-amplifying RNA (saRNA), guide RNA (gRNA), long non-coding RNA (IncRNA), single-stranded RNA (ssRNA), RNA fusions, mitochondrial RNA, transfer RNA (tRNA), ribosomal RNA (rRNA), small nuclear RNA (snRNA), small nucleolar RNA (snoRNA), PlWI-interacting RNA (piRNA), circular RNA (circRNA), enhancer RNA (eRNA), noncoding RNA (ncRNA), antigen-encoding RNA, tumor-associated antigen RNA, viral RNA, bacterial RNA, parasitic RNA, fungal RNA, pathogen-associated molecular pattern RNA, or combinations thereof.

[0023] In another embodiment, the RNA is selected from mRNA, miRNA or ssRNA.

[0024] In yet another embodiment, the RNA is a viral RNA.

[0025] In an embodiment, the DNA is selected from the group consisting of mitochondrial DNA, bacterial DNA, pathogen-derived DNA, immunostimulatory DNA (ISD), viral DNA, synthetic DNA, recombinant DNA, plasmid DNA, antigen-encoding DNA, tumor-associated antigen DNA, chemically modified DNA, and combinations thereof.

[0026] In an embodiment, the pathogenic DNA is a combination of a pathogen-derived DNA with an immunostimulatory DNA.

[0027] In an embodiment, the immunostimulatory DNA is unmethylated immunostimulatory CpG. However, any other suitable immunostimulatory DNA capable of performing the same function as described herein can be used.

[0028] In an embodiment, the pathogenic DNA is selected from one or more bacterial species belonging to the genera Staphylococcus, Klebsiella, Legionella, Pseudomonas, Escherichia, Salmonella, Clostridium, Enterococcus, Acinetobacter, Bacillus, Bartonella, Bordetella, Borrelia, Brucella, Campylobacter, Chlamydia, Chlamydophila, Clostridium, Corynebacterium, Enterococcus, Francisella, Haemophilus, Helicobacter, Leptospira, Listeria, Mycoplasma, Neisseria, Pseudomonas, Rickettsia, Salmonella, Shigella, Mycobacterium, Streptococcus, Treponema, Ureaplasma, Vibrio, and Yersinia. This list is non-exclusive and any other pathogenic DNA may be capable of being bound by the RBCs in the manner as disclosed in the present invention.

[0029] In an embodiment, the RBC is autologous.

[0030] In another embodiment, the RBC is from a donor.

[0031] In an embodiment, the red blood cells (RBCs) are substantially free of other blood components.

[0032] In an embodiment, the invention provides a method of preparing the composition for delivery of nucleic acids. The method includes isolating RBCs from a blood sample to obtain a purified RBC enriched sample; mixing a solution of nucleic acid sample to the RBC enriched sample to adsorb the nucleic acid molecules; and incubating the mixture at a temperature of 30-40 degC.

[0033] In an embodiment, the RBCs are isolated from the blood sample using beads.

[0034] In an exemplary embodiment, the incubation of the mixture in a buffer is at 37oC.

[0035] In an embodiment, the RBCs are treated with a chemical selected from neuraminidase, Human NEU1-NEU4, Heparinase I, Heparinase III, Chondroitinase ABC, Hyaluronidase, O-Glycosidase, PNGase F, Sodium periodate or Trypsin to increase binding affinity for the nucleic acids.

[0036] In an embodiment, the RBCs are treated with neuraminidase to enhance detection of TLR receptors in the surface of the RBCs.

[0037] In an embodiment, the buffer is selected from phosphate-buffered saline (PBS), Tris-HCl, HEPES, citrate buffer, acetate buffer, cell culture-compatible buffers or culture media-derived buffers.

[0038] In an embodiment, the invention provides a method of delivering a composition to a subject in need thereof. The method includes administering a composition comprising one or more red blood cells having at least one nucleic acid molecule adsorbed thereto.

[0039] In another embodiment, the invention provides a method of inducing an immune response to an antigen. The method includes administering a composition comprising one or more red blood cells having at least one nucleic acid molecule adsorbed thereto wherein the composition is immunogenic in vivo by eliciting an antibody response against the nucleic acid in vivo.

[0040] In an embodiment, the antigen is selected from one or more of tumor-associated antigens, viral antigens, bacterial antigens, parasitic antigens, fungal antigens, or autoantigens.

[0041] In an embodiment, the bacterial antigen is an antigen selected from one or more of bacterial species belonging to the genera Staphylococcus, Klebsiella, Legionella, Pseudomonas, Escherichia, Salmonella, Clostridium, Enterococcus, Acinetobacter, Bacillus, Bartonella, Bordetella, Borrelia, Brucella, Campylobacter, Chlamydia, Chlamydophila, Clostridium, Corynebacterium, Enterococcus, Francisella, Haemophilus, Helicobacter, Leptospira, Listeria, Mycoplasma, Neisseria, Pseudomonas, Rickettsia, Salmonella, Shigella, Mycobacterium, Streptococcus, Treponema, Ureaplasma, Vibrio, and Yersinia.

[0042] In an exemplary embodiment, the invention provides a method of administering to a mammal, an immunologically effective amount of a composition comprising one or more red blood cells having at least one nucleic acid molecule adsorbed thereto.

[0043] In an advantageous aspect, the invention utilizes RBCs as delivery vehicles for stable and functional nucleic acids represents a promising solution to these challenges. The invention provides a simpler, more direct approach of using RBCs as carriers of oligonucleotides such as guide RNA (gRNA) or small interfering RNA (siRNA).

[0044] Another advantage of the invention is the use of substantially unmodified RBCs which are directly bound to the nucleic acid molecules for simpler and enhanced delivery systems.

[0045] In one aspect, a composition comprising a red blood cell (RBC) having a recombinant nucleic acid molecule adsorbed thereto is provided. In certain embodiments, the nucleic acid is a DNA molecule or RNA molecule. In certain embodiments, the RNA molecule is an antisense oligonucleotide (ASO), mRNA, siRNA, miRNA, saRNA, gRNA, IncRNA, or an RNA fusion.

[0046] In another aspect, a method of delivering a recombinant nucleic acid to a subject in need thereof is provided. The method includes administering a red blood cell having the recombinant nucleic acid adsorbed thereto to the subject. In certain embodiments, the nucleic acid is a DNA molecule or RNA molecule. In certain embodiments, the RNA molecule is an antisense oligonucleotide (ASO), mRNA, siRNA, miRNA, saRNA, gRNA, IncRNA, or an RNA fusion.

[0047] In another aspect, a method of inducing an immune response to a cancer antigen is provided. The method includes administering a composition as described herein, wherein the nucleic acid encodes a cancer antigen.

[0048] In another aspect, a method of inducing an immune response to an antigen for treatment of an autoimmune disease is provided. The method includes administering as described herein, wherein the nucleic acid encodes an antigen.

[0049] In yet another aspect, a method of diagnosing or characterizing a cancer in a subject is provided. The method includes contacting a red blood cell (RBC) containing sample from the subject with a reagent capable of detecting a tumor-associated RNA in the sample wherein the red blood cell-containing sample is substantially free from all other blood components other than RBCs; and diagnosing the subject with a cancer or characterizing a cancer when the tumor-associated RNA is detected in the sample.

[0050] In other aspects, compositions and kits for performing the methods described herein are provided.BRIEF DESCRIPTION OF THE DRAWINGS

[0051] The novel features of the invention are set forth with particularity in the appended claims. A better understanding of the features and advantages of the present invention will be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of the invention are utilized, and the accompanying drawings of which:

[0052] Figures 1A-E show RBCs express TLR7. (Figure 1A) GPA+ / CD41' cells express TLR7. Flow cytometry on purified RBCs from healthy donors was performed. RBCs were stained with GPA, CD41, and TLR7. GPA and CD41 staining is shown in the left panel, TLR7 staining on the GPA+ cells is shown in the middle panel, histograms are provided in the right panel (Figure IB) qRT-PCR quantification of relative levels of CD41 transcript in RBC preparations from healthy donors or patients with sepsis. Buffycoat was used as a positive control. RBC preparations are devoid of CD41. (C-D) Flow cytometry detection of TLR7 on RBCs from healthy donors

[0053] Figure 1C shows representative histograms of a healthy donor according to an embodiment of the invention.

[0054] Figure ID shows summarized data for geometric mean fluorescence intensity (GMFI) according to an embodiment of the invention.

[0055] Figure IE shows confocal micrograph for immunofluore scent staining of TLR7 (green) and Band 3 (magenta) using two distinct pairs of antibodies according to an embodiment of the invention.

[0056] Figure 2A-D shows the interaction of TLR7 with Band3 and TLR9 on RBCs according to an embodiment of the invention.

[0057] Figure 2A shows proximity ligation assay (PLA) for TLR7 (; the antibody clone is indicated on the micrograph. Scale bar represents 5pm. Figures 2A-D show TLR7 is proximal to Band 3 on the RBC membrane (Figure 2A) PLA for TLR7 (PAI-28109) and Band 3 (A-6) and (Figure 2B) PLA for TLR7 (4G6) and TLR9 (ab37154) on RBCs from a healthy donor. (Figure 2C) PLA for TLR7 (4G6) and Band 3 (abl08414) on RBCs from healthy donors and sepsis patients, PLA signal (red) and autofluorescence of RBCs (green) are shown. Each pair of images represents a unique donor or patient, n=13 donors, 8-9 independent experiments. (Figure 2D) Quantification of PLA signals from (C). The difference between healthy donors and patients was evaluated by one-way ANOVA with Sidak’s multiple comparison, *P=0.03, **P=0.003. Scale bar represents 5pm.

[0058] Figures 3A-G show RBCs bind RNA (Figure 3A-B) Binding of Cy5-RNA40 to RBCs from healthy donors. Representative histograms (A) and summarized data (B) are shown, n=9, **P=0.008 for 500nM v PBS and **P=0.002 for lOOOnM v PBS. (Figure 3C-D) Binding of virus particles to RBCs. 107RBCs were incubated with indicated concentrations of influenza vims (Figure 3C) or ZIKV (Figure 3D) particles, and RBC-associated viral RNA was quantified with qRT-PCR. Amplicons for influenza matrix (M) and nucleoprotein (NP), and ZIKV envelope (Figure 3E) and non- structural protein 5 (NS5) were used. (Figure 3E-G) Viral RNA binding to RBCs. RBCs were incubated with 0.1 ng influenza vims RNA (Figure 3E), 1 ng ZIKV RNA (Figure 3F), or 1 ng SARS-CoV-2 RNA (G), and RBC- associated viral RNA was quantified with qRT-PCR. One-way ANOVA with Dunnett’s post-hoc test was used in (Figure 3B-D), and t-test was used in Figure 3 (E-G) *P<0.05; **P<0.01; ***P<0.005.Figures 4A-H show ODN 2088 and Enpatoran attenuate RBC- RNA acquisition. (Figure 4A) Binding of RNA40 to RBCs in the presence of TLR7-Fc. Percent RNA40+cells and a representative histogram are shown. (Figure 4B) RNA40 binding to RBCs in the presence of ODN2088. Percent RNA+cells and a representative histogram are shown. *P =0.018, P=0.032 (for OnM v 5000 nM), one-way ANOVA with Sidak’s multiple comparison. (Figure 4C) RNA40 binding to RBCs in the presence of Enpatoran (100 nM), percent RNA+cells and MFI are shown, *P=0.039 for RNA40+ cells and *P=0.046 for MFI. (Figure 4D) representative histogram, for C and D, n= 6 healthy donors, each line dot pair represents an individual donor.

[0059] Figure 4E shows binding of RNA40 to RBCs in the presence of ODN2088, percent RNA+ cells, according to an embodiment of the invention.

[0060] Figure 4F shows a representative histogram according to an embodiment of the invention.

[0061] Figure 4G-4H shows the binding of ZIKV (Figure 4G) or SARS-CoV-2 (Figure 4H) according to an embodiment of the invention.

[0062] Figure 5 shows how RNA is internalized by mature red blood cells (RBCs) according to an embodiment of the invention.

[0063] Figure 6 shows that RBCs enhance dose-dependent delivery of microRNA to macrophages according to an embodiment of the invention.

[0064] Figure 7 shows that RBCs enhance mRNA delivery to immune cells according to an embodiment of the invention.

[0065] Figure 8 shows that RBC-mediated delivery of bacterial RNA induces TNF release in RAW264.7 macrophages according to an embodiment of the invention.

[0066] Figure 9 shows that RBCs enhance RNA delivery to macrophages according to an embodiment of the invention.

[0067] Figure 10A-10C shows Desialylation and small molecule treatment enhance TLR9 surface detection and CpG DNA acquisition by RBCs according to an embodiment of the invention.

[0068] Figure 11 A shows acquisition of pathogen derived genomic DNA by murine RBCs according to an embodiment of the invention.

[0069] Figure 1 IB shows cell-free hemoglobin detected in the supernatant of macrophages incubated with media or DNA according to an embodiment of the invention.

[0070] Figure 12A-12D shows Murine RBCs acquire and deliver DNA to remote organs and immune cells according to an embodiment of the invention.

[0071] Figure 12A shows TNF-a production by peritoneal macrophages 4 hours following treatment with media according to an embodiment of the invention.

[0072] Figure 12B shows Ly6G staining of liver sections 6 hours following transfusion of CpG or CpG-treated RBCs. Original magnification, x 10 according to an embodiment of the invention.

[0073] Figure 12C shows Quantification of Ly6G+ cells according to an embodiment of the invention.

[0074] Figure 12D shows Plasma IL-6 levels 6 hours after transfusion of mice with CpG-treated WT or TLR9-KO RBCs according to an embodiment of the invention.

[0075] Figure 13A shows RBCs were incubated with Legionella sp. followed by 16S rRNA gene amplicon sequencing on the RBCs according to an embodiment of the invention.

[0076] Figure 13B shows RBC-associated bDNA was quantified by qPCR of the 16S rRNA gene according to an embodiment of the invention.

[0077] Figure 13C shows RBC-associated bDNA contained a greater diversity of bacterial taxa than did negative control specimens according to an embodiment of the invention.

[0078] Figure 13D shows Bacterial taxa detected in RBCs (both in health and sepsis) were distinct from those of negative control specimens and distinct from each other according to an embodiment of the invention.

[0079] Figure 13E shows abundance rank analysis demonstrated the influence of some contaminant taxa on RBC taxa (e.g., Comamonadaceae) as well as distinct taxa within RBC specimens not detected in negative control specimens according to an embodiment of the invention.

[0080] Figure 13F shows a direct comparison of prominent bacterial families across negative controls and RBC from healthy individuals and patients with sepsis according to an embodiment of the invention.

[0081] Figure 13G shows among patients with sepsis, the acute inflammatory cytokine IL-6 was positively correlated with RBC-bound bDNA diversity according to an embodiment of the invention.

[0082] Figure 14A shows the images of smooth and altered single RBCs using flow cytometry as per an embodiment of the invention.

[0083] Figure 14B shows flow cytometry for CpG-treated human RBCs probed for CD47 and TLR9 as per an embodiment of the invention.

[0084] Figure 15 shows RNA-seq detection of transcripts from tumor-associated genes using RBCs according to an embodiment of the invention.

[0085] Figure 16 shows RBCs acquire BIRC5 transcripts from tumor cells according to an embodiment of the invention.

[0086] The figures herein are for illustrative purposes only and are not necessarily drawn to scale.DETAILED DESCRIPTION OF THE INVENTION

[0087] Although the present invention is described in detail below, it is to be understood that this invention is not limited to the methodologies, protocols and reagents described herein as these may vary. It is also to be understood that the terminology used herein is not intended to limit the scope of the present invention, which will be limited only by the appended claims. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of the ordinary skill in the art.

[0088] In the following, the elements of the present invention will be described. These elements are listed with specific embodiments; however, they may be combined in any manner and in any number to create additional embodiments. The variously described examples and preferred embodiments should not be construed to limit the present invention to only the explicitly described embodiments. This description should be understood to support and encompass embodiments which combine the explicitly described embodiments with any number of the disclosed and / or preferred elements. Furthermore, any permutations and combinations of all described elements in this application should be considered disclosed by the description of the present application unless the context indicates otherwise.

[0089] Throughout this specification and the claims which follow, unless the context requires otherwise, the term “comprise”, and variations such as “comprises” and “comprising”, will beunderstood to imply the inclusion of a stated member, integer or step but not the exclusion of any other non-stated member, integer or step. The term “consist of’ is a particular embodiment of the term “comprise”, wherein any other non-stated member, integer or step is excluded. In the context of the present invention, the term “comprise” encompasses the term “consist of’. The term “comprising” thus encompasses “including” as well as “consisting” e.g., a composition “comprising” X may consist exclusively of X or may include something additional e.g., X+Y.

[0090] The terms “a” and “an” and “the” and similar reference used in the context of describing the invention (especially in the context of the claims) are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context. Recitation of ranges of values herein is merely intended to serve as a shorthand method of referring individually to each separate value falling within the range. Ranges and values are to be interpreted as including each individual value within the range.

[0091] With respect to the use of substantially any plural or singular terms herein, those having skill in the art can translate from the plural to the singular or from the singular to the plural as is appropriate to the context or application. The various singular / plural permutations may not be expressly set forth herein for sake of clarity. The term “substantially,” where used, means to a “large extent”. However it also allows for complete exclusion unless context requires otherwise. No element not explicitly claimed should be considered essential to the invention.Sample

[0092] By the terms “patient” or “subject” as used herein is meant a mammalian animal, including a human, a veterinary or farm animal, a wild animal, a domestic animal or pet, and animals normally used for clinical research, including non-human primates, dogs and mice. In certain embodiments, the subject of these methods is a human. In one embodiment, the subject is suspected of having a tumor, or a complication therefrom. In embodiments, the compositions, kits and methods described herein rely on the observation that RBC-containing samples can be used to detect, diagnose, treat and help predict outcome of various tumors.

[0093] As used herein, the term “sample” or “patient sample” refers to a biological sample derived from a subject which contains red blood cells (RBCs). Also known as erythrocytes, RBCs are the mostcommon type of cell found in the blood, with each cubic millimeter of blood containing 4-6 million cells.

[0094] In certain embodiments, the sample is substantially free from all other blood components other than RBCs. Thus, in one embodiment, a sample of whole blood is obtained from a subject, and RBCs are isolated, concentrated or purified. In one embodiment, the sample is filtered to remove non-RBCs, and RBCs are isolated from the sample based on size. RBCs have a diameter of about 6-8 pM.

[0095] In one embodiment, the sample is about 100 pL, 200 pL, 300 pL, 400 pL, 500 pL, 600 pL, 700 pL, 800 pL, 900 pL, 1 mL, including all integers therebetween. In an exemplary embodiment as discussed in this application, the sample used for delivering DNA in an animal model is 100 pL- 200 pL. For human beings, the sample is about 25ml, 50ml, 75ml, 100ml, 125ml, 150ml, 175ml, 200ml etc, including all integers therebetween. This would vary depending on the weight of the animal or human being. Thus, the exemplary volumes are non-limiting. The sample must contain a sufficient number of red blood cells.

[0096] In some embodiments, a sample is obtained from a subject and treated to purify or enrich the sample for RBC. For example, the sample may be filtered to remove components smaller than and / or larger than an RBC, which is about 6-8 pM in diameter. The sample may also be sorted by density of the blood components, with the RBC component being isolated for use as described herein.

[0097] In certain embodiments, the RBC are derived from the subject for which ultimate administration is intended, i.e., autologous RBC. In other embodiments, the RBC are from a donor.Nucleic Acids

[0098] In certain embodiments, a composition a red blood cell (RBC) having a recombinant nucleic acid molecule adsorbed thereto. In certain embodiments, the recombinant nucleic acid molecule is an RNA or DNA molecule.

[0099] Compared to conventional protein-targeted and DNA-based medicines, RNA-based therapeutics are more prospective due to their distinct physicochemical and physiological properties. RNA molecules such as small interfering RNA (siRNAs), and microRNAs (miRNAs) can directly target mRNAs and noncoding RNAs (ncRNAs) through Watson-Crick base-pairing. Therefore, RNA can theoretically target any gene of interest by selecting the correct nucleotide sequence on the targetRNA. In addition, in vitro transcribed (IVT) mRNA is for protein replacement treatment or immunization after entering the cytoplasm. Moreover, clustered regularly interspaced short palindromic repeat (CRISPR)- based genome editing can directly modify target RNA sequences to treat specific disorders. RNA aptamers can also block protein activity, similar to small-molecule inhibitors and antibodies.[000100] In certain embodiments, the nucleic acid molecule is an RNA, an antigen, a cancer antigen, mRNA, siRNA, miRNA, saRNA, gRNA, IncRNA, ssRNA, RNA fusion, mitochondrial RNA (mt- mRNA, mt-rRNA, mt-tRNA), transfer RNA, rRNA, snRNA, snoRNA, piRNA, circRNa, eRNA, ncRNA, a viral RNA, a bacterial RNA or combinations thereof.[000101] In certain embodiments, the RNA encodes a cancer antigen. The cancer antigen may include, without limitation, Prostate-Specific Antigen (PSA), CA-125, CA 15-3, CA 19-9, CEA (Carcinoembryonic Antigen), HER2 / neu, AFP (Alpha-fetoprotein), BRCA1 and BRCA2, MUC1, NY- ESO-1, Prostate-Specific Membrane Antigen (PSMA), PAP (Prostatic Acid Phosphatase), Glypican-3 (GPC3), Melan-A, Tyrosinase, WTI (Wilms Tumor Protein), EpCAM (Epithelial Cell Adhesion Molecule), PD-LI (Programmed Death-Ligand I), Carcinogenic Embryonic Antigen (CEACAM5), or Prostate-Specific Membrane Antigen (PSMA).[000102] In certain embodiments, the RNA encodes an antigen used for immune tolerization. The antigen may include, without limitation, Insulin, Myelin Basic Protein (MBP), Heat Shock Proteins (HSP), Collagen, Ovalbumin (OVA), Influenza Hemagglutinin (HA), GAD65 (Glutamic Acid Decarboxylase 65), Type II Collagen, Thyroglobulin, MOG (Myelin Oligodendrocyte Glycoprotein), Proteolipid Protein (PLP), DNA, Citrullinated Peptides, Histone, Albumin, Egg Protein, Beta-lactoglobulin, Wheat Gluten, Peanut Protein, a-Gal (Galactose-alpha-l,3-galactose), Ragweed Pollen, or Timothy Grass Pollen.[000103] Other useful RNAs include, without limitation, mRNA vaccines, Nusinersen (Spinraza), Eteplirsen (Exondys 51), Inotersen (Tegsedi), Volanesorsen, Patisiran (Onpattro), Givosiran (Givlaari), Lumasiran (Oxlumo), Fitusiran, Modema's personalized cancer vaccines (mRNA-4157 and mRNA- 5671), BioNTech's individualized neoantigen- specific immunotherapies, Translate Bio’s MRT5OO5, miRNA-targeting therapeutics, and RNAi-based therapies. See, e.g., Zhu, Y., Zhu, L., Wang, X. et al. RNA-based therapeutics: an overview and prospectus. Cell Death Dis 13, 644 (2022). https : / / doi 022-05075-2, which is incorporated herein by reference.[000104] According to an exemplary embodiment, the invention provides a method of preparing the composition. The method includes the steps of centrifuging whole blood at 3000 x g for 5-20 minutes; after removal of plasma and the buffy coat, red blood cells (RBCs) are isolated from the remaining packed cell fraction using MACS columns or leukoreduction filters; incubating RBCs with RNA or DNA at specified concentrations; sealing tubes with Parafilm, and incubated at 30-40°C on a nutator for at least 2 hours to allow interaction of nucleic acids with RBCs.[000105] In an exemplary embodiment, the incubation is at 37°C.Methods of detection and / or diagnosis[000106] In another aspect, provided herein are methods of detecting tumors in a sample from a subject. The methods include contacting a red blood cell-containing sample from a subject with a reagent capable of detecting a tumor-associated RNA fusion gene in the sample. In one embodiment, the subject is diagnosed with a tumor when the tumor-associated RNA fusion gene is detected in the sample. In certain embodiment, the method further includes treating the subject when the tumor-associated RNA fusion gene is detected.[000107] The compositions, methods and kits described herein are, in some embodiments, used to detect and identify cancerous tumors. As used herein the term “cancer” refers to or describes the physiological condition in mammals that is typically characterized by unregulated cell growth. In certain embodiments, the cancer is associated with an RNA fusion gene. In one embodiment, the term cancer means any cancer characterized by the presence of a solid tumor. In another embodiment, a cancer is a hematological cancer. The cancer may include, without limitation, melanoma, cervical cancer, breast cancer, brain cancer, colon / rectal cancer, ovarian cancer, adrenal cancer, anal cancer, bile duct cancer, bladder cancer, bone cancer, endometrial cancer, esophagus cancer, eye cancer, kidney cancer, laryngeal cancer, liver cancer, head and neck cancer, nasopharyngeal cancer, osteosarcoma, oral cancer, ovarian cancer, pancreatic cancer, prostate cancer, rhabdomosarcoma, salivary gland cancer, stomach cancer, testicular cancer, thyroid cancer, vaginal cancer, lung cancer, lymphoma, myeloma, and neuroendocrine cancer. In certain embodiments, the cancer is cervical cancer caused by human papillomavirus.[000108] In certain embodiments, atypical cells, neoplastic changes, abnormal cells, precursor cells, dysplastic cells, cells with early signs of cancer are included.[000109] In certain embodiments, the compositions, methods, and kits include a reagent / reagents capable of detecting a tumor-associated RNA fusion gene. In certain embodiments, the RNA fusion gene is one of the genes listed in Table 1 or Table 2.[000110] A tumor-associated RNA fusion is a genetic anomaly found in cancer cells where two separate genes, or parts of genes, from different chromosomes become fused together, resulting in an abnormal RNA transcript. This fusion can lead to the production of a novel protein or a dysregulated expression of one or both of the original genes, contributing to tumor development and progression.[000111]RNA fusions can arise from chromosomal rearrangements, such as translocations or inversions, that bring two genes into close proximity, allowing their RNA transcripts to be spliced together. These fusion events can result in the activation of oncogenes, the inactivation of tumor suppressor genes, or the creation of fusion proteins with altered functions, all of which can promote tumorigenesis by driving uncontrolled cell growth, proliferation, and survival.[000112] Tumor-associated RNA fusions are important biomarkers in cancer diagnostics and prognostics and can serve as potential therapeutic targets. Identifying and characterizing these fusion events can provide insights into the molecular mechanisms driving cancer development and may lead to the development of targeted therapies aimed at disrupting the function of fusion proteins or their downstream signaling pathways.[000113 ] In one embodiment, the reagent is able to detect the tumor by forming a complex with a tumor- associated RNA fusion gene in the sample. In one embodiment, the subject is diagnosed with a tumor when the complex comprised of the tumor-associated RNA fusion gene and reagent is detected in the sample. In yet another embodiment, the reagent is capable of amplifying the tumor-associated RNA fusion gene, or product thereof. Certain RNA fusions are known in the art, and include, without limitation, those found in Table 1 and Table 2.[000114] Vari ous methods and techniques are known for detecting, amplifying or binding a tumor- associated RNA fusion in a sample. Such methods include nucleic acid-based methods (e.g., PCR-based methods) and protein-based methods (e.g., ELISA or flow cytometry). The reagents described herein are specific to a tumor-associated RNA fusion. By specific to a tumor-associated RNA fusion, it is meant that the reagent binds, identifies or amplifies a particular nucleic acid containing the RNA fusion.[000115] In one embodiment, the reagent described herein comprises multiple reagents, where each reagent capable of detecting a different specific tumor. In one embodiment, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 25, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 or more different reagents are contained in the composition or utilized in the methods.[000116]In one embodiment, the reagent is capable of detecting, binding, specifically complexing with, or measuring the level of a tumor-associated RNA fusion when present in the sample. In one embodiment, the reagents are those which are capable of detecting or measuring the amount or level of a RNA fusion using nucleic acids, e.g., DNA or RNA.[000117] The diagnostic reagent may be a polynucleotide or genomic probe that hybridizes to the tumor DNA or RNA. Such polynucleotides may be about 20, about 22, about 25 or more nucleotides in length. In another embodiment, the diagnostic reagent is a PCR primer-probe set that amplifies and detects a polynucleotide sequence of the suspected RNA fusion. In one embodiment, the reagent is immobilized on a substrate. In another embodiment, the diagnostic reagent comprises a microarray, a microfluidics card, a computer-readable chip or chamber. Suitable assays utilizing the described polynucleotide, genomic probe, or a pair of PCR primers may include but are not limited to PCR, reverse-transcriptase PCR, quantitative PCR, southern blot analysis, dot-blot hybridization and fluorescence in situ hybridization (FISH). Conventional methods or tools can be utilized by one of skill in the art in designing suitable polynucleotide, genomic probe, or a pair of PCR primers as described, in view of the tumor to be detected. [000118] The reagents may be tagged or labeled with reagents capable of providing a detectable signal, depending upon the assay format employed. Such labels are capable, alone or in concert with other compositions or compounds, of providing a detectable signal. Most desirably, the label is detectable visually, e.g., colorimetrically. A variety of enzyme systems operate to reveal a colorimetric signal in an assay, e.g., glucose oxidase (which uses glucose as a substrate) releases peroxide as a product that in the presence of peroxidase and a hydrogen donor such as tetramethyl benzidine (TMB) produces an oxidized TMB that is seen as a blue color. Other examples include horseradish peroxidase (HRP) or alkaline phosphatase (AP), and hexokinase in conjunction with glucose-6-phosphate dehydrogenase that reacts with ATP, glucose, and NAD+ to yield, among other products, NADH that is detected as increased absorbance at 340 nm wavelength.[000119] Other label systems that may be utilized in the methods described herein are detectable by other means, e.g., colored latex microparticles (Bangs Laboratories, Indiana). Still other labels include fluorescent compounds, radioactive compounds or elements.[000120] Preferably, a reagent is associated with, or conjugated to a fluorescent detectable fluorochromes, e.g., fluorescein isothiocyanate (FITC), phycoerythrin (PE), allophycocyanin (APC), coriphosphine-0 (CPO) or tandem dyes, PE-cyanin-5 (PC5), and PE-Texas Red (ECD). Commonly used fluorochromes include fluorescein isothiocyanate (FITC), phycoerythrin (PE), allophycocyanin (APC), and also include the tandem dyes, PE-cyanin-5 (PC5), PE-cyanin-7 (PC7), PE-cyanin-5.5, PE-Texas Red (ECD), rhodamine, PerCP, fluorescein isothiocyanate (FITC) and Alexa dyes. Combinations of such labels, such as Texas Red and rhodamine, FITC +PE, FITC + PECy5 and PE + PECy7, among others may be used depending upon assay method. Detectable labels for attachment to antibodies useful in methods described herein may be easily selected from among numerous compositions known and readily available to one skilled in the art of diagnostic assays.[000121] Provided herein, in one aspect, is a method of diagnosing cancer in a subject. The method includes contacting a red blood cell-containing sample (as described herein) from the subject with a reagent capable of detecting a tumor-associated RNA fusion in the sample and diagnosing the subject with cancer when tumor-associated RNA fusion is detected in the sample. In one embodiment, the sample is substantially free from all other blood components other than RBCs (e.g., plasma, white blood cells, platelets, etc.) In one embodiment, the sample volume is about 1 pL to about 10 pL.[000122]In some embodiments, DNA or RNA is extracted from the RBC containing sample. Methods for DNA and RNA extraction and detection are known in the art. For example, see Heyer, E.E., Deveson, I.W., Wooi, D. et al. Diagnosis of fusion genes using targeted RNA sequencing. Nat Commun 10, 1388 (2019), which is incorporated herein by reference.[000123]In some embodiments, the DNA is then subjected to amplification by PCR. Thus, in certain embodiments, the reagent capable of detecting a tumor-associated molecule in the sample includes PCR primers. Using the extracted DNA and primers, the gene region targeted for amplification is amplified by PCR, using primers known in the art, and as described herein and by Heyer et al, cited above.[000124] In certain embodiments, the reagent capable of detecting a tumor-associated RNA fusion in the sample includes an oligonucleotide probe. In a hybridization-based method, probe design is a crucial step: the efficiency depends on a strong affinity between the specific target and the short oligonucleotide probes. In, for example, a gene chip format, multiple (up to thousands) of specific DNA probes are provided that can bind to mutation regions of the DNA sequence being analyzed. Each probe is a short sequence of DNA that is complementary to a specific region of the DNA being analyzed.[000125] The prepared DNA sample is then added to the gene chip and allowed to hybridize, or bind, to the DNA probes on the chip. If the DNA in the sample contains a mutation or variation in the sequence, it will not hybridize to the corresponding probe on the chip. When the presence or absence of an amplification product by PCR is specified by a DNA chip, a label is added to the amplification product. The labeling method is not particularly limited, but a fluorescent label can be preferably used. When fluorescent labeling is performed by PCR, an amplification product in which only the ends are labeled can be generated using a fluorescently labeled primer. In addition, an amplification product containing a label therein can also be generated using a fluorescently labeled nucleic acid synthesis substrate. In any case, Cy5 or Cy3 can be suitably used as the fluorescent labeling component. Furthermore, as a label, it is also possible to use a label other than fluorescence, such as digoxigenin, biotin, and a radioisotope.[000126] Moreover, a general thermal cycler etc. can be used as an apparatus which performs PCR reaction. The reaction conditions for PCR can be performed, for example, as follows.[000127] (A) 940C. 2 minutes, (b) 940C. (DNA denaturation step) 30 seconds, (c) 600C. (annealing step) 30 seconds, (d) 720C. (DNA synthesis step) 60 seconds ((b) to (D) 35 cycles), (e) 720C. 3 minutes. These conditions are provided as an example and not intended to limit the invention.[000128]In certain embodiments, it is desirable to use a DNA chip in order to specifically identify a plurality of tumor-associated molecules simultaneously in one system. It is preferable to use a DNA chip on which a sequence complementary to a probe sequence is immobilized. These probes each have a specific sequence for each target molecule, and can hybridize only with the amplification product of the corresponding gene region, so that each target molecule to be tested can be specifically detected simultaneously.[000129] The DNA chip can be produced by an existing general method using the above probe. For example, when an affixed type DNA chip is produced, the probe can be immobilized on a glass substrateby a DNA spotter and a spot corresponding to each probe can be formed. When a synthetic DNA chip is produced, it can be produced by synthesizing a single-stranded oligo DNA having the above sequence on a glass substrate by a photolithography technique. Furthermore, the substrate is not limited to glass, and a plastic substrate, a silicon wafer, or the like can also be used. Further, the shape of the substrate is not limited to a flat plate shape, and may be various three-dimensional shapes, and a substrate having a functional group introduced so that a chemical reaction can be performed on the surface can be used.Treatment[000130] In some embodiments of the methods described herein, the subject is treated cancer after being diagnosed with the same. In certain embodiments, follow-up testing, including DNA sequencing, biopsy, MRI, CAT scan, PET scan, etc. may be performed before or after performance of the method described herein.[000131] In certain embodiments, treatment includes administration of a chemotherapeutic agent. Chemotherapeutic agents are compounds that exhibit anticancer activity and / or are detrimental to a cell (e.g., a toxin). Suitable chemotherapeutic agents for use in the methods disclosed herein include, but are not limited to: toxins (e.g., saporin, ricin, abrin, ethidium bromide, diptheria toxin, Pseudomonas exotoxin, and others listed above); alkylating agents (e.g., nitrogen mustards such as chlorambucil, cyclophosphamide, ifosfamide, mechlorethamine, melphalan, and uracil mustard; aziridines such as thiotepa; methanesulphonate esters such as busulfan; nitrosoureas such as carmustine, lomustine, and streptozocin; platinum complexes such as cisplatin and carboplatin; bioreductive alkylators such as mitomycin, procarbazine, dacarbazine and altretamine); DNA strand-breakage agents (e.g., bleomycin); topoisomerase II inhibitors (e.g., amsacrine, dactinomycin, daunorubicin, idarubicin, mitoxantrone, doxorubicin, etoposide, and teniposide); DNA minor groove binding agents (e.g., plicamydin); antimetabolites (e.g., folate antagonists such as methotrexate and trimetrexate; pyrimidine antagonists such as fluorouracil, fluorodeoxyuridine, CB3717, azacitidine, cytarabine, and floxuridine; purine antagonists such as mercaptopurine, 6-thioguanine, fludarabine, pentostatin; asparginase; and ribonucleotide reductase inhibitors such as hydroxyurea); tubulin interactive agents (e.g., vincristine, vinblastine, and paclitaxel (Taxol)); hormonal agents (e.g., estrogens; conjugated estrogens; ethinyl estradiol; diethylstilbesterol; chlortrianisen; idenestrol; progestins such as hydroxyprogesterone caproate, medroxyprogesterone, and megestrol; and androgens such as testosterone, testosterone propionate,fluoxy me sterone, and methyltestosterone); adrenal corticosteroids (e.g., prednisone, dexamethasone, methylprednisolone, and prednisolone); leutinizing hormone releasing agents or gonadotropin-releasing hormone antagonists (e.g., leuprolide acetate and goserelin acetate); and antihormonal antigens (e.g., tamoxifen, antiandrogen agents such as flutamide; and antiadrenal agents such as mitotane and aminoglutethimide). In one embodiment, the chemotherapeutic agent is selected from the group consisting of: placitaxel (Taxol®), cisplatin, docetaxol, carboplatin, vincristine, vinblastine, methotrexate, cyclophosphamide, CPT-11, 5 -fluorouracil (5-FU), gemcitabine, estramustine, carmustine, adriamycin (doxorubicin), etoposide, arsenic trioxide, irinotecan, and epothilone derivatives.[000132] In certain embodiments, treatment for cancer includes one or more of the following, optionally in addition to chemotherapy:Radiation therapy: This treatment involves using high-energy radiation to kill cancer cells. It can be delivered externally or internally, and is often used in combination with surgery or chemotherapy.Immunotherapy: This treatment uses the body’s immune system to fight cancer. It works by stimulating the immune system to recognize and attack cancer cells. Some examples of immunotherapy include checkpoint inhibitors, CAR-T cell therapy, and cancer vaccines.Targeted therapy: This treatment targets specific molecules or proteins that are involved in the growth and spread of cancer cells. Examples of targeted therapies include tyrosine kinase inhibitors and monoclonal antibodies.Hormone therapy: This treatment is used for cancers that are hormone-sensitive, such as breast and prostate cancer. It works by blocking or reducing the production of hormones that stimulate the growth of cancer cells.Surgery: This treatment involves removing cancerous tumors or tissue from the body. It is often used in combination with other treatments, such as radiation or chemotherapy.Palliative care: This treatment focuses on managing symptoms and improving quality of life for patients with advanced or terminal cancer. It includes pain management, emotional support, and other forms of supportive care.Compositions and Kits[000133] The compositions, kits and methods described herein include reagents which are capable of detecting, binding, specifically complexing with, or measuring the level of the tumor-associated molecule. Such reagents include those which are capable of detecting, or measuring the abundance of, said molecule at the nucleic acid level. Suitable reagents include those for detection by polymerase chain reaction (PCR). Suitable reagents can be purchased commercially. In addition, suitable reagents may be designed by the person of skill in the art based on the published sequences of the specific tumor of interest. In one embodiment, the reagents are PCR primers and / or probes. In addition, other suitable components are included to allow for the identification and / or quantitation of the subject tumor. Such components include, e.g., enzymes, buffers and deoxynucleotides necessary for reverse transcription and / or PCR, preferably for qualitative and / or quantitative RT-PCR, detectable probes and / or an internal control.[000134] Any combination of the described reagents for the detection of the subject tumor- associated molecule can be assembled in a diagnostic kit. For example, one embodiment of a diagnostic kit includes reagents for at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 25, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 tumor-associated genetic mutations. In one embodiment, the kit includes reagents for 5 or 6 tumor-associated genetic mutations. In one embodiment, one or more of the reagents is associated or bound to a detectable label or bound to a substrate.[000135]For these reagents, the labels may be selected from among many known diagnostic labels, including those described above. Similarly, the substrates for immobilization may be any of the common substrates, glass, plastic, a microarray, a microfluidics card, a chip or a chamber.[000136] It is intended that any of the compositions described herein can be a kit containing multiple reagents or one or more individual reagents. For example, one embodiment of a composition includes a substrate upon which one or more of the reagents are immobilized.[000137] In another embodiment, the composition is a kit also contains optional detectable labels, immobilization substrates, optional substrates for enzymatic labels, as well as other laboratory items. In one embodiment, the kit contains a standard for use as a control.[000138] The invention is now described with reference to the following examples. These examples are provided for the purpose of illustration only and the invention should in no way be construed as beinglimited to these examples but rather should be construed to encompass any and all variations that become evident as a result of the teaching provided herein.[000139] Specific Embodiments1. A composition comprising a red blood cell (RBC) having a recombinant nucleic acid molecule adsorbed thereto.2. The composition of embodiment 1, wherein the recombinant nucleic acid molecule is a DNA molecule or RNA molecule.3. The composition of embodiment 2, wherein the RNA molecule is an antisense oligonucleotide(ASO), mRNA, siRNA, miRNA, saRNA, gRNA, IncRNA, or an RNA fusion.4. The composition of any one of embodiments 1 to 3, wherein the RBCs are autologous.5. The composition of any one of embodiments 1 to 3, wherein the RBCs are from a donor.6. The composition of any one of embodiments 1 to 5, wherein the nucleic acid7. encodes an antigen, a cancer antigen, an antisense oligonucleotide (ASO), mRNA, siRNA, miRNA, saRNA, gRNA, IncRNA, or an RNA fusion.8. A method of delivering a recombinant nucleic acid to a subject in need thereof, the method comprising administering a red blood cell having the recombinant nucleic acid adsorbed thereto to the subject.9. The method of embodiment 7, wherein the recombinant nucleic acid molecule is a DNA molecule or RNA molecule.10. The method of embodiment 8, wherein the RNA molecule is an antisense oligonucleotide (ASO), mRNA, siRNA, miRNA, saRNA, gRNA, IncRNA, or an RNA fusion.11. The method of any one of embodiments 7 to 9, wherein the RBCs are autologous.12. The method of any one of embodiments 7 to 9, wherein the RBCs are from a donor.13. The method of any one of embodiments 7 to 11, wherein the subject has cancer than that is treated by the recombinant nucleic acid.14. The method of any one of embodiments 7 to 12, wherein the recombinant nucleic acid encodes an antigen.15. The method of any one of embodiments 7 to 13, wherein the subject has cancer.16. The method of any one of embodiments 7 to 14, wherein the recombinant nucleic acid encodes a cancer antigen.17. A method of inducing an immune response to a cancer antigen, the method comprising administering a composition of any one of embodiments 1 to 6.18. A method of inducing an immune response to an antigen for treatment of an autoimmune disease, the method comprising administering a composition of any one of embodiments 1 to 6.19. A method of inducing an immune response to an antigen, the method comprising administering a composition of any one of embodiments 1 to 6.20. A method of diagnosing or characterizing a cancer in a subject, the method comprising21. contacting a red blood cell -containing sample from the subject with a reagent capable of detecting a tumor-associated RNA in the sample wherein the red blood cell containing sample is anticallyially free from all other blood components other than RBCs; and22. diagnosing the subject with a cancer or characterizing a cancer when the tumor-associated RNA is detected in the sample.23. The method according to embodiment 19, wherein the RNA is a RNA fusion gene selected from Table 1 or Table 2.24. The method according to embodiment 19, wherein the cancer is a cancer of the lung, cervix, breast, brain, prostate, thyroid, colon, or pancreas.25. The method according to embodiment 20, wherein the reagent comprises multiple reagents, each capable of detecting a different specific tumor-associated RNA fusion gene.26. The method according to embodiment 20, wherein the specific tumor-associated RNA fusion gene found in the sample is identified.27. The method according to embodiment 20, wherein the method further comprises treating the subject for cancer, when diagnosed with the same.28. The method according to embodiment 24, wherein the treatment is specific to the identified tumor- associated RNA fusion gene.29. The method according to embodiment 19, wherein the diagnostic method is performed at the point of care.30. The method according to embodiment 19, further comprising filtering the blood sample to remove non-RBC blood cells.31. The method according to embodiment 19, wherein the sample volume is 10 uL or less.32. The method according embodiment 28, wherein the sample volume is from about 1 uL to about 5 ul.33. The method according to embodiment 19, wherein the sample contains at least 1 million RBC.34. The method according to embodiment 19, wherein the RBCs are enriched from the sample.35. The method according to embodiment 19, wherein the sample is substantially free of other blood components.36. The method according to embodiment 19, wherein the subject is suspected of having cancer.[000140] Further Specific Embodiments1. A carrier for nucleic acid comprising: one or more red blood cells (RBCs) having at least one nucleic acid molecule adsorbed thereto.2. The carrier of embodiment 1, wherein the nucleic acid molecule is selected from the group consisting of exogenous nucleic acid, host-derived nucleic acid, synthetic nucleic acid, recombinant nucleic acid, viral nucleic acid, plasmid nucleic acid, chemically modified nucleic acid, and chimeric nucleic acid.3. The carrier of embodiment 1 or 2, wherein the at least one nucleic acid molecule is adsorbed independently of receptors.4. The carrier of embodiment 1, 2 or 3, wherein the at least one nucleic acid molecule is adsorbed on RBCs by receptor dependent binding.5. The carrier of any one of embodiments 1 to 4, wherein the at least one nucleic acid molecule is a DNA or RNA6. The carrier of embodiment 5, wherein the RNA is bound to the RBC through TLR7 ligand present on a surface of the RBC.7. The carrier of embodiment 5, wherein the DNA is bound to the RBC through TLR9 ligand present on a surface of the RBC.8. The carrier of embodiment 5 or 6, wherein the RNA is selected from messenger RNA (mRNA), small interfering RNA (siRNA), microRNA (miRNA), self-amplifying RNA (saRNA), guide RNA (gRNA), long non-coding RNA (IncRNA), single-stranded RNA (ssRNA), RNA fusions, mitochondrial RNA, transfer RNA (tRNA), ribosomal RNA (rRNA), small nuclear RNA (snRNA), small nucleolar RNA (snoRNA), PlWI-interacting RNA (piRNA), circular RNA (circRNA), enhancer RNA (eRNA), non-coding RNA (ncRNA), antigen-encoding RNA, tumor-associated antigen RNA, viral RNA, bacterial RNA, parasitic RNA, fungal RNA, pathogen-associated molecular pattern RNA, or combinations thereof.9. The carrier of embodiment 8, wherein the RNA is selected from mRNA, miRNA or ssRNA.10. The carrier of embodiment 8, wherein the RNA is a viral RNA.11. The carrier of embodiment 5 or 7, wherein the DNA is selected from the group consisting of mitochondrial DNA, bacterial DNA, pathogen-derived DNA, immunostimulatory DNA (ISD), viral DNA, synthetic DNA, recombinant DNA, plasmid DNA, antigen-encoding DNA, tumor-associated antigen DNA, chemically modified DNA, and combinations thereof.12. The carrier of embodiment 11, wherein the DNA is a combination of a pathogen-derived DNA with an immunostimulatory DNA.13. The carrier of embodiment 11, wherein the immunostimulatory DNA is unmethylated immunostimulatory CpG.14. The carrier of embodiment 11, wherein the pathogenic DNA is selected from one or more bacterial species belonging to the genera Staphylococcus, Klebsiella, Legionella, Pseudomonas, Escherichia, Salmonella, Clostridium, Enterococcus, Acinetobacter, Bacillus, Bartonella, Bordetella, Borrelia,Brucella, Campylobacter, Chlamydia, Chlamydophila, Clostridium, Corynebacterium, Enterococcus, Francisella, Haemophilus, Helicobacter, Leptospira, Listeria, Mycoplasma, Neisseria, Pseudomonas, Rickettsia, Salmonella, Shigella, Mycobacterium, Streptococcus, Treponema, Ureaplasma, Vibrio, and Yersinia.15. The carrier of any one of embodiments 1 to 14, wherein the one or more RBCs are substantially unmodified.16. The carrier of any one of embodiments 1 to 14, wherein the one or more RBCs are modified to increase binding affinity for the nucleic acids.17. The carrier of any one of embodiments 1 to 16, wherein the one or more RBCs are purified to a purity of at least 95 percent.18. The carrier of any one of embodiments 1 to 17, wherein the one or more RBCs are autologous.19. The carrier of any one of embodiments 1 to 17, wherein the one or more RBCs are from a donor.20. A composition for the delivery of nucleic acids comprising: one or more red blood cells having at least one nucleic acid molecule adsorbed thereto.21. The composition of embodiment 20, wherein the nucleic acid molecule is selected from the group consisting of exogenous nucleic acid, host-derived nucleic acid, synthetic nucleic acid, recombinant nucleic acid, viral nucleic acid, plasmid nucleic acid, chemically modified nucleic acid, and chimeric nucleic acid.22. The composition of embodiment 20 or 21, wherein the at least one nucleic acid molecule is adsorbed independently of receptors.23. The carrier of embodiment 20 or 21, wherein the at least one nucleic acid molecule is adsorbed on RBCs by receptor dependent binding.24. The composition of embodiments 20 to 23, wherein the at least one nucleic acid molecule is a DNA or RNA.25. The composition of embodiment 24, wherein the RNA is bound to the RBC through TLR7 ligand present on a surface of the RBC.26. The composition of embodiment 24, wherein the DNA is bound to the RBC through TLR9 ligand present on a surface of the RBC.27. The composition of embodiment 24 or 25, wherein the RNA is selected from messenger RNA (mRNA), small interfering RNA (siRNA), microRNA (miRNA), self-amplifying RNA (saRNA), guide RNA (gRNA), long non-coding RNA (IncRNA), single-stranded RNA (ssRNA), RNA fusions, mitochondrial RNA, transfer RNA (tRNA), ribosomal RNA (rRNA), small nuclear RNA (snRNA), small nucleolar RNA (snoRNA), PlWI-interacting RNA (piRNA), circular RNA (circRNA), enhancer RNA (eRNA), non-coding RNA (ncRNA), antigen-encoding RNA, tumor-associated antigen RNA, viral RNA, bacterial RNA, parasitic RNA, fungal RNA, pathogen-associated molecular pattern RNA, or combinations thereof.28. The composition of embodiment 27, wherein the RNA is selected from mRNA, miRNA or ssRNA.29. The composition of embodiment 27, wherein the RNA is a viral RNA.30. The composition of embodiment 24 or 26, wherein the DNA is selected from the group consisting of mitochondrial DNA, bacterial DNA, pathogen-derived DNA, immunostimulatory DNA (ISD), viral DNA, synthetic DNA, recombinant DNA, plasmid DNA, antigen-encoding DNA, tumor-associated antigen DNA, chemically modified DNA, and combinations thereof.31. The composition of embodiment 30, wherein the DNA is a combination of a pathogen-derived DNA with an immunostimulatory DNA.32. The composition of embodiment 30, wherein the immunostimulatory DNA is unmethylated immunostimulatory CpG.33. The composition of embodiment 30, wherein the pathogenic DNA is selected from one or more bacterial species belonging to the genera Staphylococcus, Klebsiella, Legionella, Pseudomonas, Escherichia, Salmonella, Clostridium, Enterococcus, Acinetobacter, Bacillus, Bartonella, Bordetella, Borrelia, Brucella, Campylobacter, Chlamydia, Chlamydophila, Clostridium, Corynebacterium, Enterococcus, Francisella, Haemophilus, Helicobacter, Leptospira, Listeria, Mycoplasma, Neisseria, Pseudomonas, Rickettsia, Salmonella, Shigella, Mycobacterium, Streptococcus, Treponema, Ureaplasma, Vibrio, and Yersinia.34. The composition of any one of embodiments 20 to 33, wherein the red blood cells are substantially free of other blood components.35. The composition of any one of embodiments 20 to 34, wherein the one or more RBCs are substantially unmodified.36. The composition of any one of embodiments 20 to 34, wherein the one or more RBCs are modified to increase binding affinity for the nucleic acids.37. The composition of any one of embodiments 20 to 34, wherein the one or more RBCs are purified to a purity of at least 95 percent.38. The composition of any one of embodiments 20 to 37, wherein the RBCs are autologous.39. The composition of any one of embodiments 20 to 37, wherein the RBCs are from a donor.40. A method of preparing the composition of any one of embodiments 20 to 39, the method comprising: isolating one or more RBCs from a blood sample to obtain an RBC enriched sample; mixing a solution of nucleic acid sample to the RBC enriched sample to adsorb the nucleic acid molecules; and incubating the mixture in a buffer at a temperature of 30-40 degC.41. The method of embodiment 40, wherein the RBCs are isolated from the blood sample using beads.42. The method of embodiment 40 or 41, further comprises modifying the RBCs to increase binding affinity for the nucleic acids.43. The method of embodiment 42, the RBCs are treated with a chemical selected from neuraminidase, Human NEU1-NEU4, Heparinase I, Heparinase III, Chondroitinase ABC, Hyaluronidase, O- Glycosidase, PNGase F, Sodium periodate or Trypsin to increase binding affinity for the nucleic acids.44. The method of embodiment 43, wherein the RBCs are treated with neuraminidase to enhance detection of TLR receptors in the surface of the RBCs.45. The method of any one of embodiments 40 to 44, wherein the nucleic acid sample comprises RNA or DNA.46. The method of any one of embodiments 40 to 45, wherein the buffer is selected from phosphate- buffered saline (PBS), Tris-HCl, HEPES, citrate buffer, acetate buffer, cell culture-compatible buffers or culture media-derived buffers.47. A method of delivering a composition to a subject in need thereof, the method comprising administering a composition comprising one or more red blood cells having at least one nucleic acid molecule adsorbed thereto.48. A method of inducing an immune response to an antigen, the method comprising:administering a composition comprising one or more red blood cells having at least one nucleic acid molecules adsorbed thereto wherein the composition is immunogenic in vivo by eliciting an antibody response against the nucleic acid in vivo.49. A method as in embodiment 47, wherein the antigen is selected from one or more of tumor- associated antigens, viral antigens, bacterial antigens, parasitic antigens, fungal antigens, or autoantigens.50. A method as in embodiment 48, wherein the bacterial antigen is an antigen selected from one or more of bacterial species belonging to the genera Staphylococcus, Klebsiella, Legionella, Pseudomonas, Escherichia, Salmonella, Clostridium, Enterococcus, Acinetobacter, Bacillus, Bartonella, Bordetella, Borrelia, Brucella, Campylobacter, Chlamydia, Chlamydophila, Clostridium, Corynebacterium, Enterococcus, Francisella, Haemophilus, Helicobacter, Leptospira, Listeria, Mycoplasma, Neisseria, Pseudomonas, Rickettsia, Salmonella, Shigella, Mycobacterium, Streptococcus, Treponema, Ureaplasma, Vibrio, and Yersinia.51. A method of administering to a mammal, an immunologically effective amount of a composition of any one of embodiments 20 to 39.ExamplesExample 1: Presence of TLR7 on RBCs[000141] The nucleic-acid sensing pattern recognition receptor (PRR) TLR9 is present on erythrocytes and Tlr7 is expressed in erythroid precursors. It was identified if TLR7 is present on RBCs. TLR7 is expressed on human RBCs purified from whole blood of healthy donors (Figure 1A). As shown in Figure 1A, Flow cytometry on purified RBCs from healthy donors was performed. qRT-PCR quantification of relative levels of CD41 transcript in RBC preparations from healthy donors or patients with sepsis. RBCs were stained with GPA, 5CD41, and TLR7. Buffy coat was used as a positive control. RBC preparations are devoid of CD41. GPA and CD41 staining are shown in the left panel, TLR7 staining on the GPA+ cells is shown in the middle panel, histograms are provided in the right panel. Using qRT-PCR to identify the platelet marker Itga2b (CD41), it was verified that our RBC preparations were devoid of platelets, which also express TLR7 and TLR9 (Figure IB) (Koupenova, M. et al., Blood 124, 791-802 (2014) and Aslam, R. et al., Blood 107, 637-641 (2006)). TLR7 expression was detected on permeabilized RBCs (Figure 1C and ID) and confirmed our observations with confocal microscopy using two distinct antibody clones against TLR7 (clone 4G6 an PAI-2809), Figure IE, Surface TLR7 expression was evaluated using flow cytometry with an antibody clone against TLR7 (A94B10). Low levels of surface TLR7 expression were detected on the RBC that appears to be heterogeneous across healthy donors.[000142] To determine the localization of TLR7 within the RBC, we next examined the interaction of TLR7 with the RBC membrane protein Band 3 via proximity ligation assay (Figure 2A-B). Using RBCs purified from whole blood from healthy donors we found low levels of close interaction between TLR7 and Band 3 using two distinct antibody combinations (Figure 2A and 2C). Micrographs for PLA signal (red) and autofluorescence (green) of RBCs were shown. Each column of images represents RBCs from a distinct donor or patient. In negative control, only 4G6 antibody was used. Each pair of micrograph represents a unique donor or patient.[000143] Figure 2B elucidates the quantification of PLA signals in accordance with an embodiment of the invention. Orange symbols depict COVID patients. Square (■) depicts pediatric patients. Difference between healthy donors and septic patients was evaluated by t-test, *: p<0.05. We also found that TLR7 interacts with TLR9 (Figure 2B), which interacts with Band 3 on the RBC membrane, although onceagain, very few PLA punctae were observed on RBCs from healthy donors (Hotz, M. J. et al., Am J Respir Crit Care Med 197, 470-480 (2018) and Lam, L. K. M. et al., Sci Transl Med 13, (2021)).[000144] Collectively, these data establish the presence of the RNA-sensing PRR TLR7 on human RBC membranes and associates with the RBC membrane protein Band 3.[000145] Band 3 alterations, including clustering and phosphorylation, are reported during inflammatory states, including sepsis and malaria (Turrini, F., Giribaldi, G., Carta, F., Mannu, F. & Arese, P., Redox report: communications in free radical research 8, 300-303 (2003) and Winograd, E., Prudhomme, J. G. & Sherman, I. W., Molecular and biochemical parasitology 142, 98-105 (2005) and Condon, M. R., Feketova, E., Machiedo, G. W., Deitch, E. A & Spolarics, Z., Biochim Biophys Acta 1772, 580-586 (2007)). Therefore, we asked if TLR7-Band 3 associations are increased in RBCs from patients with sepsis. While TLR7-Band 3 interactions in RBCs from healthy donors were detected by distinct PLA punctae, RBCs from patients with COVID-associated sepsis exhibited a robust PLA signal with aggregates of PLA punctae (Figure 2C). Figure 2C shows PLA for TLR7 (clone PAI-28109) and Band3 (B-3) on RBCs from a healthy donor. Figure 2D shows PLA for TLR7 (clone 4G6) and TLR9 (clone ab37154) on RBCs from a healthy donor. Scale bar represents 5pm.[000146] This enhanced association was more prominent in viral sepsis due to SARS-CoV-2 infection when compared to non-COVID sepsis (Figure 2C-D). Thus, TLR7 association with RBC membrane proteins is increased during SARS-CoV-2-induced sepsis.Example 2: RBCs binds exogenous RNA[000147] We next asked whether RBCs bind exogenous RNA. We found dose-dependent binding of a Cy5-labeled ssRNA oligoribonucleotide (RNA40) to healthy donor RBCs (Figure 3A-B). Representative histograms are shown in Figure 3A and summarized data is shown in Figure 3B. n=9, each line represent a unique donor. Differences in samples were evaluated with one-way ANOVA followed by Dunnett' s post-hoc test *, p<0.01.[000148] The acquisition of DNA by RBCs led to masking of the anti-phagocytic epitope of the marker of self, CD47. Hence, we asked whether RNA binding would elicit the same response in RBCs. RNA treatment of RBCs did not mask the CD47 anti-phagocytic epitope, suggesting that RNA and DNA have distinct effects on RBCs. We also asked whether RNA binding by RBCs would increase exposure of thesenescent protein phosphotidylserine (PS), on the RBCs. RNA-40 acquisition did not increase PS exposure on RBCS (Figure 2C). Collectively, these data demonstrate that ssRNA acquisition by RBCs does not accelerate RBC senescence.Example 3: RBC binding to pathogen derived RNA[000149] RNA- acquisition by RBCs were examined following incubation of RBCs with RNA viruses known to bind RBCs. It was first determined whether viral RNA would be acquired by RBCs following incubation with influenza virus (A / Puerto Rico / 8 / 1934 H1N1). qPCR for influenza virus RNA was performed following incubation of RBCs with increasing doses of influenza virions. Influenza virus RNA is detectable in RBCs following incubation of influenza virions with naive RBCs (Fig. 3C), indicating that RBCs acquire viral RNA following binding to virions. Zika Virus (ZIKV) is a mosquito-borne flavivirus that may persist in circulation for weeks after infection (Paz-Bailey, G. et al., New England Journal of Medicine 379, 1234-1243 (2018)). It has recently been reported that ZIKV is detected in the RBC fraction of transfusates, yet it is unknown if ZIKV directly binds to RBCs or infects erythroid precursors (Stone, M. et al., The Lancet Infectious Diseases 20, 1446- 1456 (2020)). 107RBCs were incubated with indicated concentrations of influenza virus (Figure 3C) or ZIKV (Figure 3D) particles, and RBC-associated viral RNA was quantified with qRT-PCR.[000150] As shown in Figures 3E-G Viral RNA binding to RBCs. RBCs were incubated with O.lng influenza virus RNA (Figure 3E), Ing ZIKV RNA (Figure 3F), or Ing SARS-CoV-2 RNA (Figure 3G) and REC- associated viral RNA was quantified with qRT-PCR. Amplicons for influenza matrix (M) and nucleoprotein (NP), and ZIKV envelope (Figure 3E) and non-structural protein 5 (NS5) were used. RBCs were incubated with 0.1 ng influenza virus RNA (Figure 3E), I ng ZIKV RNA (Figure 3F), or 1 ng SARS- CoV-2 RNA (G), and RBC-associated viral RNA was quantified with qRT-PCR. We found that naive, mature RBCs bind ZIKV (Figure 3D). We next asked whether RBCs acquire viral RNA by directly binding to RNA; we incubated RBCs with RNA extracted from influenza A virions, Zika virions, or SARS-CoV-2 RNA (Figure 3E- G). Two different amplicons for nucleocapsid (N1 and N2) were used for SARS-CoV-2.[000151] Although heterogeneity was observed in the ability of human RBCs to bind viral RNA, viral RNA adhered to / adsorbed to RBCs, suggesting that RBCs directly bind RNA from viruses.Example 4: RNA binding is attenuated with TLR7 inhibtors[000152] It was determined if blocking ssRNA binding with TLR7-Fc, inhibitory ODNs, or Enpatoran (a selective TLR7 / 8 inhibitor) would attenuate ssRNA acquisition by RBCs. RNA40 binding to RBCs was examined in the presence of increasing doses of soluble recombinant human TLR7-Fc. Inhibition of RNA- 40 binding to RBCs was observed in only one of three donors tested (Figure 4A). Figures 4A-B show the binding of RNA40 to RBCs in the presence ofTLR7-Fc. Percent RNA40+ cells (Figure 4A) and a representative histogram (Figure 4B) were shown. It was then assessed if inhibitory oligonucleotides could prevent RNA binding by RBCs. ODN 2088 and ODN 20959 are CpG-containing oligonucleotides that inhibit TLR7 and TLR9 responses in human and murine myeloid cells, whereas ODN 105870 is derived from ODN 20959 but contains a modified guanine that renders it inhibitory to TLR7, not TLR9 (Rommler, F. et al, The Journal of Immunology 191, 3240-3253 (2013) and Rommler, F. et al., PloS one 10, eOl 16703 (2015)). We observed a dose-dependent inhibition of RNA40 binding by RBCs in the presence of ODN 2088 (Figure 4B), although we observed substantial heterogeneity in the inhibition of RNA binding by ODN 2088 amongst donors. Figure 4C shows the Binding of polyUls ORN to RBCs and Figure 4 D shows competition of polyUls and RNA40 ORNs. 500nM RNA40 were incubated with RBC in the presence of indicated amount of polyUls ORN, and percent of cells positive for RNA40 was shown. (E- F) Binding of RNA40 to RBCs in the presence of ODN2088. Percent RNA+ cells are seen in Figure 4E and a representative histogram (Figure 4F) is shown. It is to be noted that in Figures 4A-E, differences across groups were performed with one-way ANOVA with Dunnett's post-hoc comparing to untreated samples. Each line in A, C, D, and E represents a unique healthy donor.[000153] However, attenuation of RBC-RNA binding by ODN20959 and ODN105870 was observed in only one donor (Figure 4A and 4B), and we did not observe statistically significant inhibition of RNA-40 binding to RBCs with these ODNs. We next tested the ability of ODN to inhibit viral RNA acquisition by RBCs and found that ODN 2088 attenuated pathogen-derived viral RNA acquisition (Figure 4C and 4D). [000154] Because ODN 2088 is an inhibitor of TLR7 and TLR9 and is not specific for TLR7 we next asked whether RNA40 acquisition by RBCs would be attenuated in the presence of Enpatoran, a smallmolecule TLR7 / 8 inhibitor. The addition of Enpatoran attenuated the uptake of RNA40 by RBCs (Figure 4C and 4D). Collectively, these data suggest that RBCs bind synthetic ssRNA which can be attenuated in the presence of the TLR7 inhibitor Enpatoran. Figures 4G-H show the binding of ZIKV (G) or SARS- CoV-2 (H) viral RNA in the presence of 5000nM ODN2088. Differences between groups were compared using paired t-test. *: p<0.05; **: p<0.01.Example 5: RNA is internalized by mature red blood cells (RBCs).[000155] As shown in Figure 5, Reticulocyte-depleted RBCs were isolated from healthy donor whole blood using anti-CD71 beads followed by positive selection with anti-glycophorin A (GPA) beads to enrich for mature RBCs. Cells were incubated with 500 nM RNA40, a synthetic single- stranded RNA derived from HIV-1, for 2 hours at 37 °C with gentle agitation. After washing, cells were stained with either SYTO RNASelect (SytoRNA), which detects intracellular RNA, or SYTOX Green, a cell- impermeable dye that labels surface-accessible nucleic acids. Staining was performed at room temperature for 20 minutes in the dark with rotation, followed by washing and resuspension in FACS buffer. Samples were analyzed by flow cytometry. As shown, incubation with RNA40 did not lead to an increase in SYTOX staining, indicating no significant accumulation of RNA on the RBC surface. In contrast, a marked increase in SytoRNA signal was observed, consistent with internalization of RNA40 into RBCs (right most panel).Example 6: RBCs deliver miRNA to immune cells[000156] As shown in Figure 6, Murine thioglycollate-elicited peritoneal macrophages were plated at 250 cells per well in a 24-well plate and allowed to adhere. Macrophages were then treated for 4 hours at 37 °C with one of the following: media alone, 1 x 107red blood cells (RBCs) alone, synthetic miR-122 alone (10, 100, 1,000, or 10,000 ng / mL), or RBCs pre-incubated with the same concentrations of miR-122. RBC + miR-122 complexes were prepared by incubating RBCs with miR-122 for 4 hours at 37 °C prior to treatment.[000157]After treatment, supernatants were collected, and tumor necrosis factor (TNFa) levels in the supernatants were measured by ELISA to assess macrophage activation.[000158] As shown, RBCs significantly enhanced the delivery of miR-122 to macrophages in a dosedependent manner, resulting in increased TNF secretion compared to miR-122 alone.Example 7: RBCs enhance mRNA delivery to immune cells.[000159]As shown in Figure 7, raw cells were incubated with media alone, RBCs alone (107), mRNA (eGFP mRNA) or RBCs loaded with different doses of GFP mRNA for 2 hours. The cells were treated for 24 hours, following treatment the supernatant was removed, and any remaining RBCs were lysed. GFP fluorescence was measured using a fluorimeter and is presented as Relative Fluorescence Units (RFU). Background fluorescence from cells alone was subtracted from all conditions.Example 8: RBC-mediated delivery of bacterial RNA[000160] As shown in Fig. 8A and 8B, RAW264.7 cells (2.5 x 105 / well) were plated 24 hours prior to treatment. Mouse red blood cells (RBCs) were isolated via cardiac puncture, leukoreduced, counted, and incubated with immunostimulatory bacterial RNA (100 nM; derived from Staphylococcus aureus strain SA197Ag) for 2 hours at 37 °C using either 1 x 106or 1 * 107RBCs per well. RBC-RNA complexes were then added to RAW cells, and supernatants were collected at 4 hours (Figure 8A) and 24 hours (Figure 8B) post-treatment. Controls included media alone, RBCs alone, and RNA alone. Supernatants were centrifuged to remove residual cells and RBCs, and TNF levels were measured by ELISA. Data represent the mean ± SEM of three independent biological replicates. Statistical analysis was performed using oneway ANOVA with Sidak’s multiple comparisons test. ****P < 0.0001. Thus, this example shows that RBC- mediated delivery of bacterial RNA induces TNF release in RAW264.7 macrophages.Example 9: Immuno response of naked RNA versus RBC-bound RNA[000161] Thiogylcollate elicited macrophages were seated in 24 well plates (250,000 / well). Leukoreduced RBCs were pre-incubated with miR-122 or mutant control RNA for miR-122 (mut miR) before addition to the wells. RNA, media, and RBCs alone were used as controls. Following a 16-hour incubation, the supernatant was collected and centrifuged to remove RBCs and debris. ELISA quantification of TNFa was performed, *P=0.015, ****P<0.0001. RBCs enhanced miR122 delivery to macrophages.[000162] This data suggests that RBCs increase miRNA activation of macrophages (Figure 9).[000163]We demonstrate that TLR7 is expressed on RBCs and observe increased membrane association of TLR7 during infection. Moreover, we show that RBCs can acquire RNA from pathogenic viruses and that RNA acquisition is attenuated by the TLR7 / 8 inhbitor Enpatoran. To our knowledge, these findings represent the first report of an RNA sensor on RBCs.[000164] It was observed that TLR7- Band 3 proximity was enhanced in patients with COVID- associated sepsis when compared with non-COVID septic patients and healthy control subjects. TLR7-TLR9 proximity in the RBC was also observed. The association of TLR7, TLR9, and Band 3 on the RBC surface during viral infection suggests a potential immune receptor complex on the RBC. Band 3 is an anion exchanger expressed on the RBC surface that forms various multi-protein macro complexes to maintain optimal RBC structure and function. Clustering proteins of similar function in close proximity is reminiscent of cellular membrane lipid rafts where molecules of related functions are concentrated to facilitate efficient signaling and regulation. Overlapping and interacting TLR signaling cascades have previously been demonstrated in pure immune cell populations, where TLR clustering during infection may serve to amplify downstream inflammatory responses. However, we have not observed cell-intrinsic signaling in RBCs following DNA-binding and RNA binding did not increase RBC senescence as measured by loss of CD47 or PS externalization (Lam, L. K. M. et al., Set TranslMed 13, eabj l008 (2021)). Therefore, we do not believe that the TLRs signal within the RBC but act as scavenger receptors to bind nucleotides.[000165] Our invention confirms the ability of RBCs to acquire exogenous TLR7 ligands, suggesting an additional role in sequestering ssRNA. Further, the impact of RBC-RNA binding on either dampening or enhancing the host inflammatory response to TLR7 ligands derived from pathogens or the host itself has been evaluated.[000166] In our experiments, fixation and detergent treatment were required for epitope accessibility of both TLR7 antibodies (4G6 and PAI-10826) raised against the TLR ectodomain; however, the proximal interactions of TLR7 and Band 3 and susceptibility of RNA binding to TLR7 inhibitory oligonucleotides suggest TLR7 is localized on the RBC plasma membrane. Indeed we were able to detect low levels of TLR7 on the RBC surface using an antibody previously shown to detect TLR7 on the surface of murine cells (Kanno, A etal., Nature communications 6, 6119 (2015)). (A94B10) for RBC surface staining, we were able to detect a low level of surface TLR7 expression that appears to be heterogeneous acrosshealthy donors. Because the structure of Band 3 changes as RBCs age and during inflammatory conditions, it will also be important to determine if TLR7 adopts a non-canonical topology on stressed RBC membranes or if our findings of increased Band 3- TLR7 proximity in critically ill patients with COVID- associated sepsis is due to enhanced epitope accessibility. Indeed, it has previously been demonstrated that the RBC membrane is altered during sepsis and several studies have demonstrated altered RBC rheology during COVID-19 infection (Bateman, R. M., Sharpe, M. D., Singer, M. & Ellis, C. G. Int J Mai Sci 18 (2017) and Nader, E. et al. Am I Hematol 97, 283-292 (2022) and Berzuini, A et al. Blood Trans / us 19, 34-36 (2021)).[000167] The above examples affirm the expression of the immune receptor TLR7 on RBCs and their capability to bind RNA. The ability of RBCs to capture exogenous RNA suggests that mature, enucleated RBCs function as an RNA scavenger or reservoir within the circulation.Example 10: Method of preparing a composition to deliver RNA using red blood cells[000168]RBC isolation: To separate blood fractions, blood samples were centrifuged at 3000 g for 10 minutes. Plasma and buffy coat were saved or aspirated depending on the experiment Red blood cells were purified from the remaining packed red cell fraction using magnetic-assisted cell sorting (MACS) or leukoreduction filters as previously described. ! 9 MACS-isolated RBCs were frozen and used in qPCR or fixed in 0.05% glutaraldehyde for staining (see below) whereas leukoreduced RBCs were immediately used in all functional assays. For RBCs used for qRT- PCR, and 5pL of packed RBCs were frozen after centrifugation and removal of the buffy coat and plasma.[000169] RNA was extracted from frozen RBCs using the RNeasy Plus Kit (Qiagen). At the final step, RNA was eluted in 30 pL RNase-free water, and 8 pL of freshly isolated RNA was reverse transcribed to cDNA using the Superscript First Strand Synthesis System (ThermoFisher).[000170] Virus stocks and RNA were provided by Dr. Andrew Vaughn (Influenza virus) and Dr. Kellie Jurado (Zika virus and SARS-CoV-2). All viral particle and RNA binding assays were performed in a 100 pL reaction volume in DNA or RNA lo-bind tubes (Eppendorf, 86-924). All viruses and corresponding RNAs were diluted in sterile PBS. 107RBCs were used in viral particle binding assays. For RNA binding inhibition, 1 ng viral RNA and 107RBCs were used. RBCs were incubated with virus particles or RNA for 2 hours at 37°C on a nutator. The tubes were rotated at 1 hour to ensure suspension of cells. For virus particle binding, RBCs were washed with PBS three times and frozen until RNA extraction. For viralRNA binding assays, the RNA-RBCs mixture was overlaid on 500 pL 30% sucrose in PBS at 4°C. Cells were pelleted by centrifugation at 13,000 rpm for 3 minutes, followed by two additional washes in PBS, and frozen until RNA extraction.[000171] A composition comprising RNA carrying RBCs was thus prepared.Example 11: Modifications of RBCs to increase binding affinity for nucleic acids[000172] Mature RBCs cannot transcribe new proteins. Hence, we investigated whether post-translational modifications might influence surface TLR9 display. Desialylation of RBCs enhances surface TLR9 detection and promotes DNA sequestration. Red blood cell (RBC) membranes are coated with sialic acids, which contribute to their net negative surface charge. To determine whether removal of these sialic acids enhances detection of TLR9 on the RBC surface, intact, non-permeabilized RBCs were treated with neuraminidase (NA) for two hours and analyzed by flow cytometry. As shown in Figure 10A and 10B, TLR9 surface detection increased markedly following desialylation. Figure 10A, 10B shows surface expression of TLR9 is increased following neuraminidase (NA) treatment of RBCs from two independent donors, with panel A showing data from donor 1 and panel B from donor 2. Flow cytometry was performed on intact, non-permeabilized cells. Figure 10C shows NA-treated RBCs acquire significantly more CpG DNA compared to untreated controls.[000173]In addition, our data demonstrates that desialylation enhances the ability of RBCs to sequester DNA, as observed following neuraminidase treatment (Figure 10C). Thus, modified RBCs in accordance with an embodiment of the invention were obtained.DNA delivery by RBC carriersExample 12: Method of preparing a composition to deliver DNA using red blood cells[000174] Bacterial genomic DNA was obtained from the American Type Culture Collection (ATCC) (25923D-5 for S. aureus ssp. aureus strain Seattle 1945; 47085D-5 for P. aeruginosa strain PAO1-LAC; 70072 ID-5 for K. pneumoniae strain MGH78578). Legionella pneumophila was a gift from Sunny Shin (University of Pennsylvania, Philadelphia, Pennsylvania, USA). The corresponding genomic DNA was extracted using a DNeasy kit (Qiagen). Integrated DNA Technologies (IDT) synthesized ODN1826 (CpG).[000175] Freshly isolated, leukoreduced RBCs were incubated with DNA at a ratio of 10 ng bDNA to 107 RBCs in 200 pL DMEM for 4 hours at 37°C on a nutator. ODN1826 (25 pg / mL) was used as a control. All binding reactions were carried out in Eppendorf DNA LoBind tubes. Thus, a DNA bound RBC composition was obtained.Example 13: In vitro DNA delivery by RBCs[000176] The DNA-RBC mixture was added to macrophages and incubated at 37°C for 4 hours. The supernatant containing RBCs were harvested and frozen at -80oC for ELISA. To evaluate hemolysis, 60 pL of the supernatant was centrifuged at 800g for 5 minutes, and 50 pL clarified supernatant was used to quantify cell-free hemoglobin using the QuantiChrome hemoglobin assay according to the manufacturer’s instructions.Example 14: DNA binding by murine RBCs[000177] DNA binding by murine RBCs. RBCs were isolated as previously described. RBCs were incubated with 1 ng bDNA in 200 pL PBS in an Eppendorf DNA lo-bind tube on a nutator at 37°C for 2 hours. The RBCs were then separated from the supernatant using sucrose-gradient centrifugation (30% sucrose cushion, 13,000g for 5 min). The isolated red cell pellets were frozen at -80°C until DNA extraction with a DNeasy blood kit (Qiagen). After DNA extraction, RBC-associated DNA was quantified with qPCR using QuantStudio 6 or 7 (Applied Biosystems) (the primers and probes). For S. aureus or A. pneumoniae, 16S multiplex primers were used in conjunction with the corresponding species-specific probe.[000178] We also saw that RBCs acquire microbial DNA and hemolysis is not increased upon DNA binding and co-incubation with macrophages. Figure 11A shows the acquisition of pathogen derived genomic DNA by murine RBCs (S. aureus, K. pneumoniae, or P. aeruginosa) in vitro. Paired- ttest, n=4- 5, **p=0.004, *P=0.021,*P=0.019 for S. aureus, K. pneumoniae, or P. aeruginosa. Figure 1 IB shows cell- free hemoglobin detected in the macrophage supernatant.Example 15: In vivo DNA delivery by RBCs[000179]Leukoreduced murine RBCs from WT or Tlr9-KO mice were washed with PBS and concentrated to a hematocrit of 40%. RBCs (160 pL) were mixed with 50 ig ODN1826 at 40 JJL and i.v. transfused into recipient mice. After 6 hours, blood was harvested via cardiac puncture, and plasma cytokines were quantified by ELISA. Livers were fixed in formalin and processed for histology as described below.[000180] In a murine model of polymicrobial sepsis, we show that RBCs captured microbial DNA during sepsis and that RBC Tlr9-mediated DNA delivery drove hyperinflammation. Moreover, RBCs from critically ill patients with sepsis had a distinct microbial DNA composition compared with those from healthy donors, which correlated with the systemic inflammatory response. Thus, we found that the process of RBC-mediated DNA capture and delivery shaped diverse host inflammatory responses during sepsis.Example 16: Generating an immune response in the body by RBC carrier mediated delivery[000181] We identified RBCs as critical regulators of the host inflammatory response during sepsis. Using a preclinical model of sepsis and genetic deletion of erythrocyte Tlr9, we demonstrate that circulating red cell-mediated DNA delivery drives heterogeneous host inflammatory responses through DNA capture and delivery to remote organs. In vitro, RBCs bound microbial DNA and increased DNA delivery to phagocytes, triggering inflammation. Moreover, RBCs from patients with sepsis had distinct microbial DNA profiles, and we identified RBCs as a distinct reservoir for microbial DNA Our invention unveil RBCs as reservoirs and carriers of microbial DNA, capable of influencing host inflammatory responses in several diseases including but not limiting to sepsis.[000182] Here, using a preclinical model of sepsis, erythroid TLR9-deficient mice, in vitro studies, and studies in humans, we demonstrate that animal models can recapitulate key clinical features of sepsis and even provide insight into heterogeneous host responses. There was heterogeneity in the inflammatory response to CS injection in WT and in Ery / 7 / '9 mice.[000183] Notably, distinct differences in tissue and systemic inflammatory cytokine production were observed in the absence of RBC TLR9 in the persistently hypothermic cluster. This observation implies that the mechanism of RBC-mediated DNA delivery plays a significant role in eliciting part of the host’s inflammatory response in this severe cluster.[000184] This identifies RBC TLR9-mediated DNA regulation as a potentially treatable trait in sepsis and hence as a method of treatment using the carrier of the present invention.Example 17: RBCs deliver DNA to immune cells, initiating inflammatory responses.[000185] To validate our observations in the sepsis model, we asked whether RBCs could increase the delivery of microbial DNA to immune cells. We first assessed the ability of RBCs to sequester pathogen derived DNA; RBCs were incubated with known quantities of bacterial DNA (bDNA) and then assayed for bDNA acquisition by qPCR. In vitro, we found that murine RBCs bound genomic DNA from common bacterial pathogens (Figure 11 A). We next treated peritoneal macrophages with genomic DNA from Staphylococcus aureus, Pseudomonas aeruginosa, or the immunostimulatory ODN CpG 1826 or DNA- treated WT or Tlr9-deficient RBCs. Microbial DNA alone did not result in macrophage activation as measured by TNF-a secretion. While microbial DNA alone did not lead to TNF-a release, S. aureus DNA carrying WT RBCs, but not S. aureus DNA-treated, Tlr9-deficient RBCs, induced robust TNF-a secretion (Figure 12A).[000186] Likewise, P. aeruginosa DNA alone did not result in macrophage activation or TNF-a release. However, immunostimulatory CpG did result in robust macrophage activation. CpG is the unmethylated motifs in bacteria and mitochondrial DNA that make them stimulatory and able to engage tlr9. They are also modified in the lab with different backbone so as not to be degraded. These are phosphothiorated oligonucleotides.[000187] In accordance with an embodiment of the invention, RBCs express surface TLR9 and bind CpG containing DNA, driving anemia and innate immune activation during inflammatory states.[000188] We now asked whether RBC Tlr9 mediated DNA delivers to remote organs in naive mice. The administration of WT RBCs and Tlr9-KO RBCs alone did not lead to liver inflammation as measured by increased neutrophil recruitment, while CpG did lead to increased liver neutrophil recruitment. CpG- treated WT RBCs increased liver neutrophils when compared with RBCs or CpG alone, whereas CpG- treated Tlr9-KO RBCs did not increase liver neutrophil recruitment (Figure 12, B and C). These data would suggest that RBCs through Tlr9 can deliver immunostimulatory DNA to remote organs, triggering inflammatory cell recruitment.[000189] Consistent with these results, infusion of CpG-treated Tlr9-KO RBCs resulted in decreased plasma IL-6 production when compared with infusion of CpG-treated WT RBCs (Figure 12D).[000190] Figure 12D shows plasma IL-6 levels 6 hours after transfusion of mice with CpG-treated WT or TLR9-KO RBCs. *P < 0.05 and **P < 0.01, by Kruskal-Wallis test and Dunn’s post hoc analysis (B) and unpaired, 2-tailed t test (D). n = 6-10 from 2 independent experiments.[000191]Notably, the interaction between CpG-DNA and erythrocyte TLR9 offers significant advantages to the host, as it accelerates erythrophagocytosis and facilitates DNA delivery to immune cells.[000192] Collectively, these findings suggested that RBCs are capable of supplying microbial DNA to immune cells and inciting inflammatory cytokine production.[000193] Referring to Figure 13 (A-G) analysis of bDNA associated with RBCs is shown in accordance with an embodiment of the invention. Figure 13 A shows RBCs were incubated with Legionella sp. followed by 16S rRNA gene amplicon sequencing on the RBCs. RBC-associated DNA was dominated by Ze / owe / Za-classified amplicons (97.5%). Figure 13B shows RBC-associated bDNA was quantified by qPCR of the 16S rRNA gene. Human RBCs had a greater quantity of bDNA than did negative control specimens, and RBCs from patients with sepsis had more bDNA than did RBCs from healthy volunteers. n = 27 healthy donors and n = 64 patients with sepsis. (C) RBC-associated bDNA contained a greater diversity of bacterial taxa than did negative control specimens. Negative control specimens included ddH2O, AE buffer, AE buffer run through DNA isolation columns, and DNA-free water. Figure 13D shows that bacterial taxa detected in RBCs (both in health and sepsis) were distinct from those of negative control specimens and distinct from each other. Figure 13E shows that abundance rank analysis demonstrated the influence of some contaminant taxa on RBC taxa (e.g., Comamonadaceae) as well as distinct taxa within RBC specimens not detected in negative control specimens. Figure 13F shows that direct comparison of prominent bacterial families across negative controls and RBC from healthy individuals and patients with sepsis. Figure 13G shows that among patients with sepsis, the acute inflammatory cytokine IL-6 was positively correlated with RBC-bound bDNA diversity. Unadjusted association of plasma IL-6 with community richness, the Shannon index, and community dominance are shown. When adjusted for the Acute Physiology and Chronic Health Evaluation (APACHE) score and vasopressor use, the association remained significant. Adjusted for the APACHE score: P = 0.039, P = 0.012, and E = 0.024 for richness, the Shannon index, and community dominance, respectively. Adjustedfor vasopressor use: P = 0.04, P = 0.006, and P = 0.013 for richness, the Shannon index, and community dominance, respectively, n = 20 healthy controls; n = 51 patients with sepsis Figure 13(C-G).[000194] In vitro experiments showed that WT RBCs could activate macrophages in the presence of bDNA, whereas RBCs from erythrocyte-specific Tlr9-KO (Erytlr9— / — ) mice did not. These data indicate that Tlr9-mediated DNA delivery by RBCs plays a crucial role in regulating the host’s inflammatory response. Additionally, in a focused model examining DNA delivery by RBCs, the absence of RBC Tlr9 impaired neutrophil recruitment to the liver following systemic DNA administration. Collectively, these findings underscore the importance of early RBC-mediated DNA delivery in driving the host inflammatory response.[000195] We observed consistent findings in our clinical cohort in which red cell-associated microbial DNA community richness correlated with IL-6, suggesting that RBC-mediated DNA delivery was a driver of the IL-6 response at the tissue level. These findings led us to speculate that RBCs contribute to the host inflammatory response and IL-6 signaling and may contribute to host diversity through intrinsically distinct DNA-binding capabilities.[000196] Our observations suggest that, during sepsis, in the presence of excess bDNA, RBCs deliver DNA to remote organs, driving inflammation.[000197] As seen in Figure 14A, the images of smooth and altered RBCs are shown. The images clearly show each RBC cell in the flow cytometry. The image clearly shows each RBC cell carrying CpG.[000198] In Figure 14B, flow cytometry is shown for CpG-treated human RBCs probed for CD47 and TLR9. Individual RBCs capturing CpG can be seen in the flow cytometry images.Materials and Methods[000199] Study approval for healthy adults Studies involving human subjects were approved by the University of Pennsylvania Institutional Review Board. Healthy volunteers between 18 and 65 years gave written informed consent before inclusion.[000200] Sepsis cohort RBCs were obtained from patients enrolled in the Molecular Epidemiology of Severe Sepsis in the ICU (MESSI) cohort or inpatient subjects positive for SARS-CoV-2 enrolled in the MESSLCOVID study at the University of Pennsylvania; inclusion and exclusion criteria for the MESSI and MESSLCOVID cohorts were previously reported (Mathew, D. et al., Science 369 (2020) andReilly, J.P. et al., Intensive CareMed , 1849-1858 (2018)). Human subjects or their proxies provided informed consent. All human subjects studies were performed in agreement with the Declaration of Helsinki.[000201] Pediatric Cohort: Subjects were selected from an ongoing prospective cohort study of intubated children with ARDS from the Children's Hospital of Philadelphia CHOP). The study was approved by the CHOP Institutional Review Board, with informed consent obtained from caregivers. Specific inclusion criteria were: 1) acute (:S 7 days of risk factor) respiratory failure requiring invasive ventilation, 2) age> 44 weeks corrected gestational age and< 17.5 years, 3) invasive ventilation via endotracheal tube, 4) bilateral infiltrates on chest radiograph, 5) oxygenation index 4 or oxygen saturation index 5 on 2 consecutive measurements at least 4 hours apart; 6) invasively ventilated :S 7 days before meeting above radiographic and oxygenation criteria; 7) invasive blood drawing access (central venous catheter, arterial catheter, or blood-drawing IV). Exclusion criteria were 1) weight< 3 kilograms, 2) cyanotic congenital heart disease, 3) tracheostomy, 4) invasively ventilated for> 7 days when meeting criteria above, 5) cardiac failure as predominant cause of respiratory failure, 6) primary obstructive airway disease (asthma, bronchiolitis) by judgement of clinician as the primary cause of respiratory failure, 7) alternative known chronic lung disease as cause of respiratory failure (cystic fibrosis, eosinophilic pneumonia, interstitial pneumonitis, pulmonary hemosiderosis, cryptogenic organizing pneumonia), 8) severe moribund state not expected to survive> 72 hours, 9) any limitations of care at time of screening, or 10) previous enrollment in this study.[000202] Antibodies TLR7 was detected with 4G6 (Novus Biological, FITC-conjugated at 5pg / assay or unconjugated at 2.5pg / mL), PAI-28109 (Invitrogen, 5pg / mL), or A94B10 (Biolegend, 5ug / mL). TLR9 was detected with ab37154 (Abeam, 5pg / mL). Band 3 was detected with abl08414 (Abeam, 1.4pg / mL) or A-6 / sc 133190 (Santa Cruz, Ipg / mL). Antibodies against CD41 (HIP8, APC-conjugated, 7.5pg / mL), GPA (HI264, PE-conjugated, 0.5pg / mL), and CD47 (CC2C6, APC-conjugated, 5pL / assay) were purchased from Biolegend.[000203] Oligonucleotides were purchased from IDT. The sequences are:RNA40-Cy5 or FAM: rG*rC*rC*rC*rG*rU*rC!W*rG*rU*rU*rG*rU*rG*rU*rG*rA*rC*rU*rC-Cy5 or 6-FAM;ODN2088: T*C*C*T*G*G*C*G*G*G*G*A*A*G*T;ODN20959: T*A*A*T*G*G*C*G*G*G*G*A*A*G*T;ODN105870: T*A*A*T*G*G*C*E*G*G*G*A*A*G*T, where "r" denotes ribonucleotide, denotes phosphorothioate bond, and "E" denotes 7-deaza-2' -deoxyguanosine.[000204] Flow cytometry: For surface staining, 250,000 cells were washed with and blocked in antihuman Fe block, followed by staining with CD45, CD41, and GPA Abs diluted in FACS buffer (PBS+ 2% FBS) for 30 minutes on ice. For TLR7 staining, cells were washed three times in PBS, fixed with 0.05% glutaraldehyde in PBS for 10 minutes at room temperature, washed in FACS buffer, and permeabilized in 0.1% Triton X-100 diluted in FACS buffer for 15 minutes. After three washes, cells were stained with FITC-conjugated anti-TLR7 Ab, 4G6, or isotype for 1 hour. Cells were washed twice before analysis (BD Fortessa and FlowJo). For surface TLR7 staining, cells were washed with PBS and stained with PE-conjugated anti TLR7 Ab, clone A94B10, for one hour at room temperature. Cells were washed twice then analyzed (Cytoflex and FlowJo).[000205] Immunofluorescence and microscopy: RBCs were fixed and permeabilized as above. RBCs were blocked in PBST (PBS+ 0.05% tween20) supplemented with 1% BSA and 5% goat serum for 1 hour at room temperature. 106fixed, permeabilized, and blocked RBCs were stained with primary Abs mentioned above diluted in PBST with 1% BSA overnight at 4°C. Cells were washed in PBST and stained in secondary Abs raised in goat (Jackson ImmunoResearch) for 1 hour at room temperature. After washing, RBCs were resuspended in PBS and mounted with Fluoromount G. Confocal micrographs were acquired with a VT- iSIM (Vi si tech).[000206] Transmission electron microscopy: RBCs were fixed in TEM fixative (4% Formaldehyde, 3.5% glutaraldehyde in 0. IM sodium cacodylate). Samples were processed and stained by Electron Microscopy Core at the University of Pennsylvania. The TLR7 antibody 4G6 was used in immunogold staining.[000207] Proximity ligation assay (PLA, DuoLink, Sigma): was carried out according to the manufacturer's protocol. Stained cells were resuspended in 10 uL PBS and mounted on Fluoromount G. Images were acquired with a Nikon 2A microscope. At least five fields were imaged for each sample, and the number of PLA punctae per cell were counted by two blinded personnel.[000208] qRT-PCR The QuantStudio7 Flex system (Applied Biosystems): was used to perform qRT-PCR. TaqMan Fast Universal master mix was used to detect CD41 (TaqMan assay HsOl 1 16228_ml) andSARS-CoV-2 RNA (IDT, 2019-nCoV RUO Kit). Zika Virus (ZIKV) and Influenza RNA were detected using the PowerUp SYBR Green master mix and primers listed below.ZIKV-E: 5'-TTGGTCATGATACTGCTGATTGC-3' and 5'- CCTTCCACAAAGTCCCTATTG C-3'. ZIKV-NS5: 5' -GGCCACGAGTCTGTACCAAA- 3' and 5'-AGCTTCACTGCAGTCTTC C-3'.Influenza-M: 5'- GGACTGCAGCGTAGACGCTT-3' and 5'-CATCCTGTTGTATATGAGGCC CAT-3'. Influenza-NP: 5' -GACGATGCAACGGCTGGTCTG-3' and 5' -ACCATTGTTCCAACT CCTTT-3'.16S qPCR on human RBCs:[000209] In an embodiment of the invention, RBCs were isolated using magnetic anti-glycophorin A (GPA) beads (Miltenyi Biotec) and then manually enumerated and aliquoted as 107 RBCs and saved at - 80°C until extraction. DNA extraction was performed using a DNeasy blood kit (Qiagen), and DNA was eluted in 152 pL buffer AE (10 mM Tris-Cl and 0.5 mM EDTA at a pH of 9.0). 16s DNA was evaluated using the Universal 16s primers, and PCR was run to 50 cycles and quantified using QuantStudio 6 or 7 (Applied Biosystems). When converting cycle thresholds to copy numbers, undetermined values were reported as “ 1 ” AE buffer and double-distilled water (ddH2O) negative controls were run with each qPCR reaction. For 16S sequencing, ddH2O, AE buffer, and AE buffer run through DNA isolation columns were included as negative controls. Three individual samples for each negative control were provided to the sequencing core. In addition to these controls, DNA-free water and gene-block negative controls were included in the sequencing.16S sequencing and analysis[000210] The 16S rRNA amplicon sequences were initially analyzed using QIIME2 (qiime2.org, version 2021.2). DADA2 was used for quality control, denoising, and amplicon sequence variant (ASV) creation (Callahan BJ, et al., Nat Methods. 2016). ASVd with fewer than 10 hits across samples were filtered out. A naive Bayesian classifier was used to assign taxonomy against the Greengenes (version 13.8) database. Microbial ecology analysis was performed using the vegan package 2.6-1 and R, 4.2.2 (Oksanen JF, et al. Accessed January 30, (2025), and R: A language and environment for statistical computing, (2024) and Wang Y, et al. Methods Ecol Evol. (2022)). For relative abundance and ordination analysis, samples were normalized to the percentage of total reads, and analysis was restricted to ASVs that were present at greaterthan 1% of the sample population. All ASVs were included in the diversity analysis. Direct community similarity comparisons were performed using the Bray-Curtis similarity index. Ordinations were performed using principal component analysis on Hellinger-transformed normalized OTU tables generated using Euclidean distances (Legendre P, Gallagher ED., Oecologia. 2001).[000211] Oligoribonucleotide (ORN) binding and inhibition: 250,000 RBCs resuspended in 100 pL sterile PBS were mixed with Cy5-labeled ORN (RNA40) in polypropylene tubes. In assays where inhibitors were tested, 500 nM RNA40 was incubated with RBCs in the presence of the specified concentrations of inhibitors. Recombinant human TLR7-Fc was obtained from R&D Systems and Enpatoran from Invivogen. The tubes were then sealed in Parafilm and incubated at 37°C for 2 hours on a nutator in the dark. Following inhibition with Enpatoran, cells were washed, resuspended in PBS, and incubated with live / dead aqua stain (Invitrogen) at room temperature for 30 minutes on a nutator protected from light. Cells were washed with PBS and analyzed by flow cytometry.[000212] CD47 and Annexin V staining: RBCs incubated with RNA40 for 2 hours were washed with FACS buffer twice and probed with 5 pg anti-CD47 Ab (CC2C6, Biolegend) for 1 hour. Cells were then washed with FACS buffer three times and analyzed by flow cytometry. For assessment of Phosphotidylserine externalization, RBCs were stained for Annexin V (Life Technologies).Cytokine quantification.[000213] Cytokine expression in mouse plasma was quantified with a custom U-plex cytokine panel (Meso Scale Discovery) of the following analytes: IL-6, TNF-a, IL-ip, IL-10, IL-12p70, IL-27p28, and IFN-y or by standard ELISA according to the manufacturer’ s protocol (DuoSet, R&D Systems). If a value was below the limit of detection, it was denoted with a zero.[000214] In an exemplary embodiment, RNA content is different between healthy and patient RBCs. RBCs were magnetically purified using glycophorin A-conjugated beads. RNA extracted from 107 RBC using Zymo Quick DNA / RNA Microprep kit were analyzed by TapeStation. Electrophoresis of RNA from RBCs and corresponding signal intensity profiles in two of the samples. EL1(L): electronic ladder, nt: nucleotide(s).Example 18: RBCs sequester extracellular RNA, and tumor RNA is detectable from RBCs.[000215] We recently asked whether RNA would be obtainable from RBCs from healthy donors and patients admitted to the hospital with an inflammatory state. As seen in Figure 15, in contrast to controls, we detected a substantial amount of RNA on RBCs during an acute inflammatory syndrome (sepsis). Since RBCs do not synthesize new proteins or contain RNA, this RNA is acquired from other host or microbial sources. Because cancer patients are reported to have elevated cell-free nucleic acids, we hypothesized that RBCs from patients with cancer will contain a substantial amount of RNA and provide an opportunity to characterize circulating free RNA patterns in lung cancer.Example 19: RNA-seq detection of transcripts from tumor-associated genes using RBCs.[000216]RBCs from two healthy donors and two sepsis patients were isolated and purified as previously described. RNA-seq analysis reveals expression of multiple tumor-associated genes (e.g., BIRC5, BRCA1, BRCA2, CCND1, and CDH1) in the analyzed samples (Figure 15). Note that samples 9 and 10 represent the same critically ill patient at different timepoints. These genes are commonly dysregulated in cancers and serve as markers of tumor-associated transcriptional activity. These proof-of-concept data suggest that RBCs can acquire tumor-related RNA and may serve as a novel source for detecting cancer-associated transcriptional signatures.Example 20: RBCs acquire BIRC5 transcripts from tumor cells.[000217] To validate our proof-of-concept findings, we investigated whether RBCs can acquire BIRC5 (Survivin) transcripts from tumor cells (Figure 16). BIRC5 is an inhibitor of apoptosis that is minimally expressed in healthy adult tissues but highly expressed in a variety of cancers, including breast, lung, gastric, colon, pancreatic, liver, prostate, and gliomas. It has been identified as a prognostic biomarker in several malignancies and is currently under investigation as a therapeutic target.[000218]BIRC5 expression was significantly increased in A549-treated RBCs compared to untreated controls (****P < 0.0001, one-way ANOVA with Sidak’s multiple comparisons test). Each data point represents the average of qPCR triplicates. Four distinct healthy donor RBC preparations were tested infour independent co-culture experiments. The negative control was PCR-grade water, and the positive control was lysate from one million A549 cells.[000219] Data are represented as cycle threshold (Ct) values, with 40 cycles set as the limit of detection. Samples that did not amplify, including untreated RBCs and the negative control, were recorded as undetermined. Lower Ct values indicate higher levels of transcript detection.[000220] The various aspects and embodiments disclosed herein are for purposes of illustration and are not intended to be limiting, with the true

Claims

CLAIMS:

1. A carrier for nucleic acid comprising: one or more red blood cells (RBCs) having at least one nucleic acid molecule adsorbed thereto.2 The carrier of claim 1, wherein the nucleic acid molecule is selected from the group consisting of exogenous nucleic acid, host-derived nucleic acid, synthetic nucleic acid, recombinant nucleic acid, viral nucleic acid, plasmid nucleic acid, chemically modified nucleic acid, and chimeric nucleic acid.3 The carrier of claim 1, wherein the at least one nucleic acid molecule is adsorbed independently of receptors.4 The carrier of claim 1, wherein the at least one nucleic acid molecule is adsorbed on RBCs by receptor dependent binding.5 The carrier of any one of claims 1 to 4, wherein the at least one nucleic acid molecule is a DNA or NA6 The carrier of claim 5, wherein the RNA is bound to the RBC through TLR7 ligand present on a surface of the RBC.7 The carrier of claim 5, wherein the DNA is bound to the RBC through TLR9 ligand present on a surface of the RBC.8 The carrier of claim 5, wherein the RNA is selected from messenger RNA (mRNA), antisense oligonucleotide (ASO), small interfering RNA (siRNA), microRNA (miRNA), self-amplifying RNA (saRNA), guide RNA (gRNA), long non-coding RNA (IncRNA), single- stranded RNA (ssRNA), RNA fusions, mitochondrial RNA, transfer RNA (tRNA), ribosomal RNA (rRNA), small nuclear RNA (snRNA), small nucleolar RNA (snoRNA), PlWI-interacting RNA (piRNA), circular RNA (circRNA), enhancer RNA (eRNA), non-coding RNA (ncRNA), antigen-encoding RNA, tumor-associated antigenRNA, viral RNA, bacterial RNA, parasitic RNA, fungal RNA, pathogen-associated molecular pattern RNA, or combinations thereof.

9. The carrier of claim 8, wherein the RNA is selected from mRNA, miRNA or ssRNA.

10. The carrier of claim 8, wherein the RNA is a viral RNA.

11. The carrier of claim 5, wherein the DNA is selected from the group consisting of mitochondrial DNA, bacterial DNA, pathogen-derived DNA, immunostimulatory DNA (ISD), viral DNA, synthetic DNA, recombinant DNA, plasmid DNA, antigen-encoding DNA, tumor-associated antigen DNA, chemically modified DNA, and combinations thereof.

12. The carrier of claim 11, wherein the DNA is a combination of a pathogen-derived DNA with an immunostimulatory DNA.

13. The carrier of claim 11, wherein the immunostimulatory DNA is unmethylated immunostimulatory CpG.

14. The carrier of claim 11, wherein the pathogenic DNA is selected from one or more bacterial species belonging to the genera Staphylococcus, Klebsiella, Legionella, Pseudomonas, Escherichia, Salmonella, Clostridium, Enterococcus, Acinetobacter, Bacillus, Bartonella, Bordetella, Borrelia, Brucella, Campylobacter, Chlamydia, Chlamydophila, Clostridium, Corynebacterium, Enterococcus, Francisella, Haemophilus, Helicobacter, Leptospira, Listeria, Mycoplasma, Neisseria, Pseudomonas, Rickettsia, Salmonella, Shigella, Mycobacterium, Streptococcus, Treponema, Ureaplasma, Vibrio, and Yersinia.

15. The carrier of claim 1, wherein the one or more RBCs are substantially unmodified.

16. The carrier of claim 1, wherein the one or more RBCs are modified to increase binding affinity for the nucleic acids.

17. The carrier of claim 1, wherein the one or more RBCs are purified to a purity of at least 95 percent.

18. The carrier of claim 1, wherein the one or more RBCs are autologous.

19. The carrier of claim 1, wherein the one or more RBCs are from a donor.

20. A composition for the delivery of nucleic acids comprising: one or more red blood cells having at least one nucleic acid molecule adsorbed thereto.

21. The composition of claim 20, wherein the nucleic acid molecule is selected from the group consisting of exogenous nucleic acid, host-derived nucleic acid, synthetic nucleic acid, recombinant nucleic acid, iral nucleic acid, plasmid nucleic acid, chemically modified nucleic acid, and chimeric nucleic acid.

22. The composition of claim 20, wherein the at least one nucleic acid molecule is adsorbed independently of receptors.

23. The carrier of claim 20, wherein the at least one nucleic acid molecule is adsorbed on RBCs by receptor dependent binding.

24. The composition of claims 20 to 23, wherein the at least one nucleic acid molecule is a DNA or NA.

25. The composition of claim 24, wherein the RNA is bound to the RBC through TLR7 ligand present on a surface of the RBC.

26. The composition of claim 24, wherein the DNA is bound to the RBC through TLR9 ligand present on a surface of the RBC.

27. The composition of claim 24, wherein the RNA is selected from messenger RNA (mRNA), antisense oligonucleotide (ASO), small interfering RNA (siRNA), microRNA (miRNA), self-amplifying RNA (saRNA), guide RNA (gRNA), long non-coding RNA (IncRNA), single-stranded RNA (ssRNA), RNA fusions, mitochondrial RNA, transfer RNA (tRNA), ribosomal RNA (rRNA), small nuclear RNA (snRNA), small nucleolar RNA (snoRNA), PlWI-interacting RNA (piRNA), circular RNA (circRNA), enhancer RNA (eRNA), non-coding RNA (ncRNA), antigen-encoding RNA, tumor-associated antigen RNA, viral RNA, bacterial RNA, parasitic RNA, fungal RNA, pathogen-associated molecular pattern RNA, or combinations thereof.

28. The composition of claim 27, wherein the RNA is selected from mRNA, miRNA or ssRNA.

29. The composition of claim 27, wherein the RNA is a viral RNA.

30. The composition of claim 24, wherein the DNA is selected from the group consisting of mitochondrial DNA, bacterial DNA, pathogen-derived DNA, immunostimulatory DNA (ISD), viral DNA, synthetic DNA, recombinant DNA, plasmid DNA, antigen-encoding DNA, tumor-associated antigen DNA, chemically modified DNA, and combinations thereof.

31. The composition of claim 31, wherein the DNA is a combination of a pathogen-derived DNA with an immunostimulatory DNA.

32. The composition of claim 30, wherein the immunostimulatory DNA is unmethylated immunostimulatory CpG.

33. The composition of claim 30, wherein the pathogenic DNA is selected from one or more bacterial species belonging to the genera Staphylococcus, Klebsiella, Legionella, Pseudomonas, Escherichia, Salmonella, Clostridium, Enterococcus, Acinetobacter, Bacillus, Bartonella, Bordetella, Borrelia, Brucella, Campylobacter, Chlamydia, Chlamydophila, Clostridium, Corynebacterium, Enterococcus, Francisella, Haemophilus, Helicobacter, Leptospira, Listeria, Mycoplasma, Neisseria, Pseudomonas,Rickettsia, Salmonella, Shigella, Mycobacterium, Streptococcus, Treponema, Ureaplasma, Vibrio, and Yersinia.

34. The composition of claim 20, wherein the red blood cells are substantially free of other blood components.

35. The composition of claim 20, wherein the one or more RBCs are substantially unmodified.

36. The composition of claim 20, wherein the one or more RBCs are modified to increase binding affinity for the nucleic acids.

37. The composition of claim 20, wherein the one or more RBCs are purified to a purity of at least 95 percent.

38. The composition of claim 20, wherein the RBCs are autologous.

39. The composition of claim 20, wherein the RBCs are from a donor.

40. A method of preparing the composition of claim 20, the method comprising: isolating one or more RBCs from a blood sample to obtain an RBC enriched sample; mixing a solution of nucleic acid sample to the RBC enriched sample to adsorb the nucleic acid molecules; and incubating the mixture in a buffer at a temperature of 30-40 degC.

41. The method of claim 40, wherein the RBCs are isolated from the blood sample using beads.

42. The method of claim 40, further comprises modifying the RBCs to increase binding affinity for the nucleic acids.

43. The method of claim 42, the RBCs are treated with a chemical selected from neuraminidase, Human NEU1-NEU4, Heparinase I, Heparinase III, Chondroitinase ABC, Hyaluronidase, O-Glycosidase, PNGase F, Sodium periodate or Trypsin to increase binding affinity for the nucleic acids.

44. The method of claim 43, wherein the RBCs are treated with neuraminidase to enhance detection of TLR receptors in the surface of the RBCs.

45. The method of claim 40, wherein the nucleic acid sample comprises RNA or DNA.

46. The method of claim 40, wherein the buffer is selected from phosphate-buffered saline (PBS), Tris- HC1, HEPES, citrate buffer, acetate buffer, cell culture-compatible buffers or culture media-derived buffers.

47. A method of delivering a composition to a subject in need thereof, the method comprising administering a composition comprising one or more red blood cells having at least one nucleic acid molecule adsorbed thereto.

48. A method of inducing an immune response to an antigen, the method comprising: administering a composition comprising one or more red blood cells having at least one nucleic acid molecules adsorbed thereto wherein the composition is immunogenic in vivo by eliciting an antibody response against the nucleic acid in vivo.

49. A method as claimed in claim 47, wherein the antigen is selected from one or more of tumor- associated antigens, viral antigens, bacterial antigens, parasitic antigens, fungal antigens, or autoantigens.

50. A method as claimed in claim 48, wherein the bacterial antigen is an antigen selected from one or more of bacterial species belonging to the genera Staphylococcus, Klebsiella, Legionella, Pseudomonas, Escherichia, Salmonella, Clostridium, Enterococcus, Acinetobacter, Bacillus, Bartonella, Bordetella,Borrelia, Brucella, Campylobacter, Chlamydia, Chlamydophila, Clostridium, Corynebacterium, Enterococcus, Francisella, Haemophilus, Helicobacter, Leptospira, Listeria, Mycoplasma, Neisseria, Pseudomonas, Rickettsia, Salmonella, Shigella, Mycobacterium, Streptococcus, Treponema, Ureaplasma, Vibrio, and Yersinia.

51. A method of administering to a mammal, an immunologically effective amount of a composition of claim 20.

52. A method of diagnosing or characterizing cancer in a subject, the method comprising: contacting a red blood cell (RBC) containing sample from the subject with a reagent capable of detecting a tumor-associated RNA in the sample wherein the red blood cell-containing sample is substantially free from all other blood components other than RBCs; and diagnosing the subject with a cancer or characterizing a cancer when the tumor-associated RNA is detected in the sample.

53. The method according to claim 52, wherein the RNA is a RNA fusion gene selected from Table 1 or Table 2.

54. The method according to claim 52, wherein the cancer is a cancer of the lung, cervix, breast, prostate, thyroid, colon, brain or pancreas.

55. The method according to claim 53, wherein the reagent comprises multiple reagents, each capable of detecting a different specific tumor-associated RNA fusion gene.

56. The method according to claim 53, wherein the specific tumor-associated RNA fusion gene found in the sample is identified.

57. The method according to claim 53, wherein the method further comprises treating the subject for cancer, when diagnosed with the same.

58. The method according to claim 57, wherein the treatment is specific to the identified tumor-associated RNA fusion gene.

59. The method according to claim 52, wherein the diagnostic method is performed at the point of care.

60. The method according to claim 52, further comprising filtering the blood sample to remove non-RBC lood cells.

61. The method according to claim 52, wherein the sample volume is 10 uL or less.

62. The method according claim 61, wherein the sample volume is from about 1 uL to about 5 ul.

63. The method according to claim 52, wherein the sample contains at least 1 million RBC.

64. The method according to claim 52, wherein the RBCs are enriched from the sample.

65. The method according to claim 52, wherein the subject is suspected of having cancer.

Images