Novel promoter and method for producing l-arginine using same

Abstract

The present disclosure relates to a novel polynucleotide having promoter activity and a method for producing L-arginine using same. A microorganism which has, introduced thereinto, the novel polynucleotide of the present disclosure having a mutation at a specific position in the promoter region of the BBD29_14250 gene exhibits a markedly increased ability to produce L-arginine, and thus the novel polynucleotide can be usefully employed for efficient production of L-arginine.

Description

Novel promoter and method for producing L-arginine using the same

[0001] Cross-citation with related application(s)

[0002] This application claims the benefit of priority to Korean Patent Application No. 10-2024-0071881, filed May 31, 2024, and Korean Patent Application No. 10-2024-0135801, filed October 7, 2024, the entire contents of which are incorporated herein by reference.

[0003] The present disclosure relates to a novel promoter and a method for producing L-arginine using the same, and more particularly, to a novel polynucleotide having promoter activity, a vector comprising the same, a host cell transformed with the vector, and a method for producing L-arginine using the host cell.

[0004]

[0005] Efforts to utilize microorganisms to produce high-yield target substances, such as amino acids or other useful compounds for various applications, such as feed, pharmaceuticals, and food, through genetic manipulation and / or the introduction of exogenous genes into biosynthetic pathways have been ongoing. One such method involves inducing overexpression of target genes in microorganisms, which requires a highly efficient gene expression system. Since promoters are a key factor in determining the level and regulation of gene expression, developing a useful promoter is essential for developing expression systems.

[0006] Microorganisms of the genus Corynebacterium produce amino acids including L-arginine. However, unlike other industrial microorganisms such as Escherichia coli or Bacillus subtilis, the general structure of the promoter sequence for gene expression in Corynebacterium microorganisms is unknown. Therefore, promoters have been developed by removing the promoter portion of an antibiotic resistance gene such as chloramphenicol, introducing chromosomal DNA isolated from Corynebacterium microorganisms after cutting it with an appropriate restriction enzyme, and then transforming Corynebacterium microorganisms with this, and measuring the antibiotic resistance of the resulting strain. As strong promoters derived from Corynebacterium microorganisms, Pcj1~7 promoters of various strengths are known (US 7662943 B2).

[0007] With the increasing demand for L-arginine, there is still an urgent need to develop a strong promoter for the overexpression of L-arginine-related genes as a method for producing L-arginine in high yields in microorganisms of the genus Corynebacterium.

[0008]

[0009] One aspect of the present disclosure provides a novel polynucleotide.

[0010] Another aspect of the present disclosure provides an expression cassette comprising the polynucleotide and a target gene.

[0011] Another aspect of the present disclosure provides a microorganism comprising the polynucleotide; or the polynucleotide and a target gene operably linked thereto.

[0012] Another aspect of the present disclosure provides a method for producing L-arginine, comprising the step of culturing the microorganism in a medium.

[0013] Another object of the present disclosure is to provide a use of the microorganism for producing L-arginine.

[0014]

[0015] This is specifically described as follows. Meanwhile, each description and embodiment disclosed in this disclosure can also be applied to each other description and embodiment. That is, all combinations of the various elements disclosed in this disclosure fall within the scope of this disclosure. Furthermore, the scope of this disclosure is not limited by the specific descriptions described below. Furthermore, those skilled in the art will recognize or ascertain, through routine experimentation alone, numerous equivalents to the specific embodiments of the present disclosure described herein. Furthermore, such equivalents are intended to be encompassed by this disclosure.

[0016]

[0017] Additionally, numerous papers and patents are referenced and cited throughout this disclosure. The disclosures of these cited papers and patents are incorporated by reference into this disclosure in their entirety, thereby providing a clearer understanding of the technical field to which this disclosure pertains and the content of this disclosure.

[0018]

[0019] One aspect of the present disclosure provides a polynucleotide comprising any one nucleotide sequence selected from the group consisting of SEQ ID NO: 15 to SEQ ID NO: 21. In one embodiment, the polynucleotide may be a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 21.

[0020] In the present disclosure, the phrase “a polynucleotide or polypeptide comprises a specific nucleotide sequence (nucleic acid sequence, base sequence) or amino acid sequence” may mean that the polynucleotide or polypeptide consists of or essentially comprises the specific nucleotide sequence (nucleic acid sequence, base sequence) or amino acid sequence.

[0021] As used herein, the term "polynucleotide" includes 2 or more, 5 or more, 10 or more, 13 or more, 20 or more, or 30 or more nucleotide monomers, wherein the nucleotide monomers may be covalently linked to form a chain.

[0022] The above polynucleotide may have promoter activity and / or may be used as a universal promoter.

[0023] In one example, the polynucleotide may have promoter activity for expression of microorganisms of the genus Corynebacterium.

[0024] The polynucleotide having the above promoter activity may be used interchangeably herein with “variant promoter”, and all of the terms described above may be used in the present disclosure.

[0025] According to one specific example, the polynucleotide can be utilized as a synthetic promoter having strong expression inducing activity.

[0026] As used herein, the term "promoter" may refer to a DNA region that includes a binding site for a polymerase and initiates transcription of a downstream target DNA. The promoter may be located 5' of the transcription start site. The promoter may be operably and / or regulatorily linked (enhanced or weakened in expression) upstream (toward the 5' end) of the target DNA. For example, the promoter may be forwardly linked to the 5' end of any gene to enhance (increase) the expression of the gene, or may be reversely linked to the 3' end of any gene to weaken (decrease) the expression of the gene. When a promoter is introduced in the reverse direction at the 3' end of any gene, for example, downstream of the stop codon, or preferably between the stop codon and the transcription terminator, it can induce transcription in the opposite direction to the normal transcription direction of the gene, thereby causing a collision with the RNA polymerase complex during the transcription process, thereby attenuating the expression of the gene.

[0027] The polymerase may refer to an enzyme that synthesizes primary transcript RNA from DNA, also called RNA polymerase or DNA-dependent RNA polymerase. The polymerase may be a prokaryotic RNA polymerase or a eukaryotic RNA polymerase (e.g., RNA polymerase I, RNA polymerase II, RNA polymerase III, RNA polymerase IV, or RNA polymerase V, etc.).

[0028] The polynucleotide according to one embodiment may be natural or non-natural, for example, it may be non-natural synthesized chemically or recombinantly.

[0029] In the present disclosure, the phrase "a polynucleotide or polypeptide comprises a specific nucleotide sequence (nucleic acid sequence, base sequence) or amino acid sequence" may mean that the polynucleotide or polypeptide consists of or essentially includes the specific nucleotide sequence (nucleic acid sequence, base sequence) or amino acid sequence, and may be interpreted as including (or not excluding) a sequence in which a mutation (deletion, substitution, modification, and / or addition) is added to the specific nucleic acid sequence (base sequence) or amino acid sequence within the scope of maintaining the original function and / or desired function of the polynucleotide or polypeptide. In addition, the expression "consists of a nucleotide sequence" does not exclude cases in which addition, and / or deletion, and / or mutation of nucleotides may occur during the process of linking to the target gene, such as the use of a restriction enzyme, when the polynucleotide is used by linking to the target gene as a promoter.

[0030] In one example, a polynucleotide or polypeptide “comprising a specific nucleotide sequence (nucleic acid sequence, base sequence) or amino acid sequence” may mean that the polynucleotide or polypeptide (i) consists of or essentially comprises the specific nucleotide sequence (nucleic acid sequence, base sequence) or amino acid sequence, or (ii) consists of or essentially comprises a nucleotide sequence or amino acid sequence that has at least 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 98%, 99.5%, or 99.9% homology with the specific nucleotide sequence (nucleic acid sequence, base sequence) or amino acid sequence and maintains its original function and / or desired function.

[0031] In one embodiment, the polynucleotide of the present disclosure may comprise a nucleotide sequence of SEQ ID NO: 15, wherein the nucleotide sequence of SEQ ID NO: 15 may be a sequence in which a portion of the promoter sequence of the PBBD29_12015 gene is mutated.

[0032] In one embodiment, the polynucleotide of the present disclosure may comprise a nucleotide sequence of SEQ ID NO: 16, wherein the nucleotide sequence of SEQ ID NO: 16 may be a sequence in which a portion of the promoter sequence of the PBBD29_07560 gene is mutated.

[0033] In one embodiment, the polynucleotide of the present disclosure may comprise a nucleotide sequence of SEQ ID NO: 17, wherein the nucleotide sequence of SEQ ID NO: 17 may be a sequence in which a portion of the promoter sequence of the PBBD29_12275 gene is mutated.

[0034] In one embodiment, the polynucleotide of the present disclosure may comprise a nucleotide sequence of SEQ ID NO: 18, wherein the nucleotide sequence of SEQ ID NO: 18 may be a sequence in which a portion of the promoter sequence of the PBBD29_01740 gene is mutated.

[0035] In one embodiment, the polynucleotide of the present disclosure may comprise a nucleotide sequence of SEQ ID NO: 19, wherein the nucleotide sequence of SEQ ID NO: 19 may be a sequence in which a portion of the promoter sequence of the PBBD29_04965 gene is mutated.

[0036] In one embodiment, the polynucleotide of the present disclosure may comprise a nucleotide sequence of SEQ ID NO: 20, wherein the nucleotide sequence of SEQ ID NO: 20 may be a sequence in which a portion of the promoter sequence of the PBBD29_05235 gene is mutated.

[0037] In one embodiment, the polynucleotide of the present disclosure may comprise a nucleotide sequence of SEQ ID NO: 21, wherein the nucleotide sequence of SEQ ID NO: 21 may be a sequence in which a portion of the promoter sequence of the PBBD29_14250 gene is mutated.

[0038] In this disclosure, the term “variation” means a genetically or non-genetically stable phenotypic change, and may be used interchangeably with “mutation” in this disclosure.

[0039] The polynucleotide (mutant promoter) of the present disclosure may have a promoter activity that is altered (increased or decreased) compared to a polynucleotide (wild-type polynucleotide) that does not contain the mutation. The polynucleotide may regulate (increase or decrease) the expression of a target gene operably linked thereto or the expression or activity of a protein encoded by the target gene, and further may regulate the expression of genes other than the target gene.

[0040]

[0041] The above "target gene" refers to a gene whose expression is to be controlled by the polynucleotide of the present disclosure for the purposes of the present disclosure, and in the case of a gene encoding a protein, it may be used interchangeably with "gene encoding the target protein." The protein encoded by the target gene may be expressed as a "target protein," and the gene encoding the "target protein" may be expressed as a "target gene."

[0042] The amino acid coding sequence of the above target gene can be modified in various ways within a range that does not change the protein sequence encoded by the target gene, due to the degeneracy of the codon or in consideration of the codon usage frequency preferred in the organism that is to express the target gene.

[0043] The polynucleotide of the present disclosure may be introduced into a suitable host cell together with an operably linked target gene, and may have an activity that increases the host cell's ability to produce a target substance (production amount), for example, the ability to produce an amino acid (production amount).

[0044] In one embodiment, the polynucleotide may be for increasing the production capacity (production amount) of amino acids, and specifically for increasing the production capacity (production amount) of L-arginine.

[0045] In addition, the nucleotide sequence of the polynucleotide can be additionally modified by conventionally known mutagenesis methods, such as directed evolution and site-directed mutagenesis, within a range that maintains the corresponding biological activity (promoter activity) and / or the desired activity (e.g., activity of increasing production of a target substance in a host cell).

[0046] Accordingly, the polynucleotide of the present disclosure may be composed of a nucleotide sequence having at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%, but less than 100%, homology or identity with one nucleotide sequence selected from the group consisting of SEQ ID NO: 15 to SEQ ID NO: 21, or may be composed of a sequence having the homology or identity but having some sequences added, deleted, or modified.

[0047] In the present disclosure, the polynucleotide may be essentially consisting of any one nucleotide sequence selected from the group consisting of SEQ ID NO: 15 to SEQ ID NO: 21. In another embodiment, the polynucleotide of the present disclosure may be consisting of any one nucleotide sequence selected from the group consisting of SEQ ID NO: 15 to SEQ ID NO: 21.

[0048]

[0049] As used herein, the terms 'homology' or 'identity' refer to the degree of similarity between two given amino acid sequences or nucleotide sequences, which may be expressed as a percentage. The terms homology and identity are often used interchangeably.

[0050] Sequence homology or identity of conserved polynucleotides or polypeptides is determined by standard alignment algorithms, and may be combined with default gap penalties established by the program being used. In practice, homologous or identical sequences can generally hybridize with all or part of the sequence under moderate or high stringency conditions. It should be appreciated that hybridization also includes hybridization with polynucleotides containing common codons or codons that take codon degeneracy into account.

[0051] Whether any two polynucleotide or polypeptide sequences are homologous or identical can be determined using known computer algorithms such as the "FASTA" program using default parameters, for example, as in Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: 2444. Alternatively, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) as performed in the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) (version 5.0.0 or later) can be determined using the GCG program package (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego, 1994, and [CARILLO ETA / .](1988) SIAM J Applied Math 48: 1073). For example, homology or identity can be determined using BLAST or ClustalW of the National Center for Biotechnology Information Database.

[0052] Homology or identity of polynucleotides or polypeptides can be determined by comparing sequence information using a GAP computer program, such as that disclosed, for example, in Smith and Waterman, Adv. Appl. Math (1981) 2:482, or in, for example, Needleman et al. (1970), J Mol Biol. 48:443. In brief, the GAP program can be defined as the total number of symbols in the shorter of the two sequences divided by the number of similarly arranged symbols (i.e., nucleotides or amino acids). Default parameters for the GAP program include (1) a binary comparison matrix (containing values ​​of 1 for identity and 0 for non-identity) and (2) a coding sequence matrix, as disclosed by Gribskov et al. (1986) Nucl. Acids Res. 48:443, and (3) a binary comparison matrix, containing values ​​of 1 for identity and 0 for non-identity, as disclosed by Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358 (1979). 14: 6745 weighted comparison matrix (or EDNAFULL (EMBOSS version of NCBI NUC4.4) permutation matrix); (2) a penalty of 3.0 for each gap and an additional penalty of 0.10 for each symbol in each gap (or a gap opening penalty of 10, a gap extension penalty of 0.5); and (3) no penalty for terminal gaps.

[0053] In one example, a polynucleotide comprising a specific nucleotide sequence provided in the present disclosure may be interpreted to include not only the specific nucleotide sequence or a nucleotide sequence substantially equivalent thereto, but also a polynucleotide fragment comprising a nucleotide sequence complementary to the specific nucleotide sequence. Specifically, a polynucleotide having the above complementarity can be identified under the conditions described below: Such conditions are specifically described in known literature. For example, conditions in which genes with high complementarity of 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 98% or more, 99.5% or more, or 99.9% or more hybridize, and genes with lower complementarity do not hybridize, or washing conditions of conventional Southern hybridization: 60°C, 1x SSC (saline-sodium citrate buffer), and 0.1% (w / v) SDS (Sodium Dodecyl Sulfate); 60°C, 0.1x SSC, and 0.1% SDS; Or, conditions for washing once, specifically two to three times, at a salt concentration and temperature equivalent to 68°C, 0.1x SSC, and 0.1% SDS can be listed, but are not limited thereto. Hybridization requires that two nucleotides have complementary sequences, but some base mismatches may be tolerated depending on the stringency of hybridization. The term "complementary" can be used to describe the relationship between nucleotide bases that can hybridize with each other. For example, in DNA, adenosine is complementary to thymine and cytosine is complementary to guanine. The stringency of hybridization between polynucleotides depends on the length and degree of complementarity of the polynucleotides, which is well known in the art (Sambrook et al., supra, 9.50-9.51, 11.7-11.8).

[0054] Furthermore, the polynucleotide of the present disclosure may be operably linked to a gene encoding a target protein, i.e., a target gene.

[0055] The term "operably linked" as used herein means that a polynucleotide having promoter activity of the present disclosure is functionally linked to a gene sequence to initiate and mediate transcription of the gene of interest. Operable linkages can be produced using genetic recombination techniques known in the art, and site-specific DNA cleavage and ligation can be produced using, but is not limited to, cleavage and ligation enzymes known in the art.

[0056] When the above polynucleotide is operably linked to a target gene, some nucleotides may be added, deleted, and / or mutated for use with the above cleavage and ligation enzymes.

[0057]

[0058] In one embodiment, the target gene may be, but is not limited to, a gene encoding a protein involved in the production of L-arginine of the present disclosure. The protein involved in the production of L-arginine may be, but is not limited to, a protein involved in at least one process or step of an intracellular production pathway (e.g., biosynthesis, metabolism, bioconversion, etc.), intracellular transport, and / or extracellular excretion pathway of L-arginine, such as enzymes (various synthetases, catabolic enzymes, phosphatases, carboxylases (e.g., pyruvate carboxylase, etc.), reductases, oxidases, decarboxylases, dehydrogenases, dehydratase, transferases, epimerases, etc.), intermediates, transport proteins, membrane proteins (channels, etc.), etc., but is not limited thereto.

[0059] In one embodiment, the target gene may be, but is not limited to, the PBBD29_12015, PBBD29_07560, PBBD29_12275, PBBD29_01740, PBBD29_04965, PBBD29_05235, or PBBD29_14250 gene.

[0060]

[0061] Another aspect of the present disclosure provides an expression cassette comprising a polynucleotide of the present disclosure and a gene of interest.

[0062] The polynucleotide and target gene are as described above.

[0063] As used herein, the term "expression cassette" refers to a unit cassette that includes a promoter and a target gene operably linked thereto, thereby enabling expression of the target gene downstream of the promoter. Various factors that can facilitate efficient expression of the target gene may be included internally or externally in such a gene expression cassette. The gene expression cassette may typically include, but is not limited to, a transcription termination signal, a ribosome binding site, and a translation termination signal in addition to a promoter operably linked to the target gene.

[0064]

[0065] Another aspect of the present disclosure provides a vector comprising a polynucleotide of the present disclosure; the polynucleotide and a target gene operably linked thereto; or the expression cassette.

[0066] The polynucleotide, target gene, and expression cassette are as described above. The vector may include a target gene operably linked to the polynucleotide.

[0067] As used herein, the term "vector" refers to a DNA construct containing a base sequence of a polynucleotide encoding a target protein operably linked to suitable regulatory sequences so as to enable expression of the target protein in a suitable host. The regulatory sequences may include a promoter capable of initiating transcription, an optional operator sequence for regulating transcription, a sequence encoding a suitable mRNA ribosome binding site, and / or a sequence regulating the termination of transcription and / or translation. After being transformed into a suitable host cell, the vector may be expressed independently of the genome (genome) of the host cell, or may be integrated into the genome of the host cell.

[0068] The vector usable in the present disclosure is not particularly limited as long as it is replicable in a host cell, and may be selected from all commonly used vectors. Examples of commonly used vectors include plasmids, cosmids, viruses, bacteriophages, etc., in a natural or recombinant state. For example, as the vector, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A, etc., can be used as a phage vector or a cosmid vector, and pDZ series, pBR series, pUC series, pBluescriptII series, pGEM series, pTZ series, pCL series, and pET series, etc., can be used as a plasmid vector. Specifically, examples include, but are not limited to, pDZ, pDC, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC, pDCM2, and pDC24 vectors.

[0069] The vector usable in the present disclosure may be an expression vector or a vector for insertion into the host cell chromosome. Insertion of the target DNA into the host cell chromosome using the insertion vector may be accomplished by any method known in the art, such as, but not limited to, homologous recombination or the CRISPR system. The vector may further include a selection marker to determine whether the vector is transformed or further whether the target DNA is inserted into the chromosome. The selection marker may be selected from genes that confer a selectable phenotype, such as drug resistance, nutrient requirement, cytotoxic agent resistance, or expression of a surface protein. In an environment treated with a selective agent, only cells expressing the selection marker survive or exhibit other phenotypic traits, thereby allowing the selection of transformed cells.

[0070] As used herein, the term "transformation" refers to the introduction of a target polynucleotide into a host cell. The transformed polynucleotide may be integrated into the host cell's chromosome or located extrachromosomally. Furthermore, the polynucleotide may be DNA and / or RNA, and may be introduced in any form as long as it can be functionally introduced into the host cell. For example, the polynucleotide may be introduced into the host cell in the form of an expression cassette, a genetic construct containing all elements necessary for autonomous expression, or in the form of a vector containing the same.

[0071] The above transformation method includes all methods for introducing the target polynucleotide into a cell, and can be performed by selecting an appropriate standard technique known in the art depending on the host cell. Examples include, but are not limited to, electroporation, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, and lithium acetate-DMSO method.

[0072]

[0073] Another aspect of the present disclosure provides a microorganism (host cell) comprising a polynucleotide of the present disclosure, the polynucleotide and a target gene operably linked thereto, or the expression cassette.

[0074] The polynucleotide, target gene, or expression cassette is as described above.

[0075] The polynucleotide, the polynucleotide and the target gene operably linked thereto, or the expression cassette may be introduced into a microorganism by transformation, but is not limited thereto.

[0076] In this disclosure, the term “microorganism” includes both wild-type microorganisms and microorganisms that have undergone genetic modification, either naturally or artificially, and is also a concept that includes microorganisms whose specific mechanisms are weakened or strengthened due to causes such as the insertion of external genes or the strengthening or weakening of the activity of endogenous genes.

[0077] The above microorganism may be a microorganism that naturally expresses a target gene or a microorganism that has the ability to produce a target product, or a microorganism that does not naturally express a target gene or a microorganism that has been given the ability to express a target gene or produce a target product to a parent strain that does not have the ability to produce a target product, but is not limited thereto. In one embodiment, the microorganism may be a microorganism that naturally produces an amino acid, specifically, produces L-arginine.

[0078] In the present disclosure, the term "target product" refers to a biologically active substance to be produced or the production of which is to be controlled (increased or decreased) using a polynucleotide provided in the present disclosure, a target gene operably linked thereto, an expression cassette comprising the same, a vector comprising the same, and / or a microorganism comprising the same, and is a concept that includes not only the biologically active substance to be ultimately produced but also the target protein that the microorganism can produce. For example, it may refer to the target protein itself encoded by the target gene, and / or all biologically active substances produced with the participation of the target protein. The above biologically active substance means all substances produced or derived from an organism (e.g., a cell) or having a certain function in a living body or in a cell, for example, amino acids (glycine, alanine, valine, leucine, isoleucine, threonine, serine, cysteine, glutamine, methionine, aspartic acid, asparagine, glutamic acid, lysine, arginine, histidine, phenylalanine, tyrosine, tryptophan, proline, O-acetyl homoserine, etc.), nucleic acids, vitamins (vitamins A, B (B1, B2, B3, B5, B6, B7, B9, B12, etc.), C, D, E, K, etc.), proteins (the target protein or other proteins, for example, hormones, growth factors, cytokines, immunoglobulins (antibodies), antigen proteins, receptors, ligands, functional fragments thereof (fragments having a target function), fusion proteins in which two or more are fused, etc.). It may be, but is not limited to, sugars (e.g., monosaccharides, disaccharides, polysaccharides, sugar alcohols, etc.), fatty acids (myristoleic acid, palmitoleic acid, sapienic acid, oleic acid, elaidic acid, vaccenic acid, linoleic acid, linolelaidic acid, arachidonic acid, eicosapentaenoic acid (EPA), erucic acid, docosahexaenoic acid (DHA), etc.), organic acids (lactic acid, citric acid, oxalic acid, uric acid, butyric acid, stearic acid, propionic acid, etc.).In addition, if the target protein is involved in the production of a substance, in addition to the above substances, metabolites thereof (such as polyhydroxyalkanoates (PHAs)), precursors thereof, and derivatives that maintain their biological activity may also be included in the target product.

[0079] In one embodiment, a microorganism comprising a polynucleotide of the present disclosure and a target gene operably linked thereto may be a microorganism having increased ability to produce amino acids as a target product, and specifically, may be a microorganism having increased ability to produce L-arginine. The microorganism having increased ability to produce L-arginine may be a microorganism having increased ability to produce L-arginine compared to a microorganism that does not comprise the polynucleotide of the present disclosure, for example, a microorganism in which the expression of any one gene selected from the group consisting of BBD29_12015, BBD29_07560, BBD29_12275, BBD29_01740, BBD29_04965, BBD29_05235, and BBD29_14250 genes is regulated by the polynucleotide before the introduction of the mutation, but is not limited thereto. The polynucleotide before the introduction of the mutation may be a wild-type polynucleotide, and may specifically be composed of any one nucleotide sequence selected from the group consisting of SEQ ID NO: 22 to SEQ ID NO: 28.

[0080] In the present disclosure, the term "unmodified microorganism" does not exclude a strain that contains a mutation that may occur naturally in a microorganism, and may refer to a wild-type strain or a natural strain itself, or a strain before its characteristics are changed by a genetic mutation caused by natural or artificial factors. For example, the unmodified microorganism may refer to a strain in which a mutant polynucleotide is not introduced or is introduced before the introduction of a mutant polynucleotide into the promoter region of any one gene selected from the group consisting of the BBD29_12015, BBD29_07560, BBD29_12275, BBD29_01740, BBD29_04965, BBD29_05235, and BBD29_14250 genes described in the present disclosure. The above “non-modified microorganism” may be used interchangeably with “pre-modified strain”, “pre-modified microorganism”, “non-modified strain”, “non-modified microorganism” or “reference microorganism”.

[0081] The microorganism of the present disclosure may include, without limitation, any microorganism into which the polynucleotide of the present disclosure is introduced and which can operate as a promoter.

[0082] In one embodiment, the microorganism may be, but is not limited to, a microorganism of the genus Corynebacterium sp., a microorganism of the genus Escherichia sp., or a microorganism of the genus Bacillus sp.

[0083] Specifically, the microorganism may be a microorganism of the genus Corynebacterium, and more specifically, may include, but is not limited to, Corynebacterium glutamicum, Corynebacterium stationis, Corynebacterium thermoaminogenes, Brevibacterium flavum, Brevibacterium lactofermentum, and strains prepared therefrom. Specifically, the microorganism of the genus Corynebacterium may be Corynebacterium glutamicum.

[0084] In one embodiment, the microorganism may be Corynebacterium glutamicum, in which a mutation has been introduced into the promoter of any one gene selected from the group consisting of BBD29_12015, BBD29_07560, BBD29_12275, BBD29_01740, BBD29_04965, BBD29_05235, and BBD29_14250 genes, but is not limited thereto.

[0085] In one embodiment, the microorganism with increased L-arginine productivity (production amount) of the present disclosure may have an L-arginine productivity (production amount) increased by about 1% or more, about 2% or more, about 3% or more, about 4% or more, about 5% or more, about 5.5% or more, or about 5.8% or more (the upper limit is not particularly limited and may be, for example, about 200% or less, about 150% or less, about 100% or less, or about 50% or less) compared to the parent strain before mutation or the unmodified microorganism, but is not limited thereto. In another embodiment, the microorganism of the present disclosure having increased L-arginine productivity (production amount) may have an L-arginine productivity (production amount) increased by about 1.01 times or more, about 1.02 times or more, about 1.03 times or more, about 1.04 times or more, about 1.05 times or more, about 1.055 times or more, or about 1.058 times or more (the upper limit is not particularly limited and may be, for example, about 10 times or less, about 5 times or less, about 3 times or less, about 2 times or less, or about 1.5 times or less), but is not limited thereto.

[0086] The term “about” above includes all ranges including ±0.5, ±0.4, ±0.3, ±0.2, ±0.1, etc., and includes all ranges of values ​​equal to or similar to the value following the term “about,” but is not limited thereto.

[0087]

[0088] Another aspect of the present disclosure provides a composition for producing L-arginine, comprising at least one selected from the group consisting of a polynucleotide of the present disclosure, the polynucleotide and a target gene operably linked thereto, the expression cassette, the vector, and the microorganism. The polynucleotide, the target gene, the expression cassette, the vector, and the microorganism are as described above.

[0089] In one example, the composition for producing L-arginine may further comprise any suitable excipient commonly used in compositions for producing L-arginine, such excipients may be, for example, but are not limited to, preservatives, wetting agents, dispersing agents, suspending agents, buffering agents, stabilizers, or isotonic agents.

[0090]

[0091] Another aspect of the present disclosure provides a use for producing L-arginine, comprising at least one selected from the group consisting of a polynucleotide of the present disclosure, the polynucleotide and a target gene operably linked thereto, the expression cassette, the vector, and the microorganism. The polynucleotide, the target gene, the expression cassette, the vector, and the microorganism are as described above.

[0092]

[0093] According to another aspect of the present disclosure, there is provided a use for producing a composition for producing L-arginine, comprising at least one selected from the group consisting of a polynucleotide of the present disclosure, the polynucleotide and a target gene operably linked thereto, the expression cassette, the vector, and the microorganism. The polynucleotide, the target gene, the expression cassette, the vector, and the microorganism are as described above.

[0094]

[0095] Another aspect of the present disclosure provides a method for producing a target product, comprising the step of culturing a microorganism comprising a polynucleotide of the present disclosure, the polynucleotide and a target gene operably linked thereto, the expression cassette or the vector in a medium.

[0096] The polynucleotide, target gene, expression cassette, vector, microorganism, and target product are as described above.

[0097] In one embodiment, the target product may be an L-amino acid, specifically L-arginine.

[0098] The above method may further include, after the culturing step, a step of recovering a target product from the cultured microorganism, the culture, or both.

[0099] The term "cultivation" as used herein refers to growing microorganisms under appropriately artificially controlled environmental conditions. The culturing process of the present disclosure can be performed using any suitable medium and culture conditions known in the art. Such culturing process can be easily adjusted and used by those skilled in the art depending on the selected strain. Specifically, the culturing process may be batch, continuous, and / or fed-batch, but is not limited thereto. Various such methods are disclosed, for example, in "Biochemical Engineering" (James M. Lee, Prentice-Hall International Editions, pp. 138-176, 1991).

[0100] In the present disclosure, the term “medium” refers to a material containing nutrients as a main component necessary for culturing the microorganisms of the present disclosure, and supplies nutrients and growth factors, including water essential for survival and growth. Specifically, the medium and other culture conditions used for culturing the microorganisms of the present disclosure may be any medium used for culturing general microorganisms without particular limitation, but the microorganisms of the present disclosure may be cultured under aerobic conditions while controlling temperature, pH, etc. in a general medium containing an appropriate carbon source, nitrogen source, phosphorus, inorganic compounds, amino acids, and / or vitamins. Specifically, culture media for microorganisms can be found in literature ["Manual of Methods for General Bacteriology" by the American Society for Bacteriology (Washington DC, USA, 1981)], etc.

[0101] The culture medium must suitably meet the requirements of the specific strain. For example, culture can be performed under aerobic conditions, controlling temperature, pH, etc., in a conventional medium containing appropriate carbon sources, nitrogen sources, amino acids, vitamins, etc. Carbon sources include carbohydrates such as glucose, fructose, and sucrose, and amino acids such as glutamic acid and cysteine. Specifically, natural organic nutrients such as starch hydrolysate and molasses can be used, and carbohydrates such as glucose, fructose, and sterilized pretreated molasses (i.e., molasses converted to reducing sugar) can be used. Other appropriate carbon sources can be used in various amounts without limitation, but are not limited thereto. Nitrogen sources include inorganic nitrogen sources such as ammonia; amino acids such as glutamic acid and cysteine; and organic nitrogen sources such as peptone, meat extract, and yeast extract. These nitrogen sources can be used alone or in combination, but are not limited thereto. The media may include, but are not limited to, phosphoric acid, potassium dihydrogen phosphate, or dipotassium hydrogen phosphate or their corresponding sodium-containing salts as the personnel. Inorganic compounds may include, but are not limited to, magnesium sulfate, iron sulfate, manganese sulfate, and calcium chloride, and other compounds may include amino acids, vitamins, and appropriate precursors. These media or precursors may be added to the culture in batch or continuous fashion, but are not limited to these.

[0102] During cultivation, compounds such as potassium hydroxide, ammonia, and phosphoric acid can be appropriately added to the culture to adjust the pH of the culture. Furthermore, foaming agents such as fatty acid polyglycol esters can be used to suppress foaming during cultivation. Furthermore, oxygen or an oxygen-containing gas can be injected into the culture to maintain an aerobic state. The culture temperature ranges from 27°C to 37°C, specifically from 30°C to 33°C. The cultivation period can continue until the desired amount of useful substances is obtained, and is typically 20 to 160 hours.

[0103] As used herein, the term "culture" refers to a substance containing a medium in which microorganisms are growing or have completed growth under appropriately artificially controlled environmental conditions. In a narrow sense, the culture does not include the grown microorganisms themselves, but in a broader sense, it may include them. The "culture" may include various target substances released into the medium by the microorganisms during growth, along with medium components formulated for microbial culture.

[0104] In the culture of the present disclosure, the culture temperature may be maintained at 20°C to 45°C, specifically 25°C to 40°C, 25°C to 40°C, 25°C to 37°C, 25°C to 35°C, 27°C to 40°C, 27°C to 37°C, 27°C to 35°C, 30°C to 40°C, 30°C to 37°C, or 30°C to 35°C, and the culture may be performed for about 10 to 160 hours, but is not limited thereto.

[0105] The target product produced by the culture of the present disclosure may be secreted into the medium or remain within the cells.

[0106] The step of recovering the above target product may be to collect the target product using a suitable method known in the art according to a culture method, such as a batch, continuous or fed-batch culture method. For example, various chromatography methods such as centrifugation, filtration, treatment with a crystallized protein precipitant (salting out method), extraction, ultrasonic disruption, ultrafiltration, dialysis, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, affinity chromatography, HPLC or a combination thereof may be used, but is not limited thereto, and the target product may be recovered from a medium or microorganism using a suitable method known in the art.

[0107] Additionally, the method for producing the target product of the present disclosure may additionally include a purification step. The purification may be performed using any suitable method known in the art. In one example, if the method for producing the target product of the present disclosure includes both a recovery step and a purification step, the recovery step and the purification step may be performed sequentially (or sequentially) regardless of the order, or may be performed simultaneously or integrated into a single step, but is not limited thereto.

[0108]

[0109] Another aspect of the present disclosure provides a method for increasing the productivity of a target product, comprising the step of culturing a microorganism comprising a polynucleotide of the present disclosure, the polynucleotide and a target gene, or an expression cassette comprising the polynucleotide and the target gene in a medium.

[0110] The polynucleotide, target gene, expression cassette, and microorganism are as described above.

[0111] In one embodiment, the target product may be an L-amino acid, specifically L-arginine.

[0112]

[0113] Another aspect of the present disclosure provides a method for producing a microorganism having increased production capacity of a target product, comprising the step of introducing into the microorganism a polynucleotide of the present disclosure, the polynucleotide and a target gene operably linked thereto, or an expression cassette comprising the polynucleotide and the target gene.

[0114] The polynucleotide, target gene, expression cassette, and microorganism are as described above.

[0115] In one embodiment, the target product may be an L-amino acid, specifically L-arginine.

[0116] In another aspect of the present disclosure, the present disclosure provides a composition, method, product, process, or use characterized by one or more elements disclosed in the present disclosure.

[0117]

[0118] The present disclosure relates to a novel polynucleotide having promoter activity and a method for producing L-arginine using the same. Since a microorganism into which the novel polynucleotide of the present disclosure is introduced has a significantly increased ability to produce L-arginine, the novel polynucleotide can be usefully utilized for efficiently producing L-arginine.

[0119]

[0120] Hereinafter, the present disclosure will be described in more detail through examples. These examples are intended solely to illustrate the present disclosure more specifically, and it will be apparent to those skilled in the art that the scope of the present disclosure is not limited by these examples, in accordance with the gist of the present disclosure.

[0121]

[0122] Example

[0123] (Throughout this disclosure, "%" used to indicate the concentration of a particular substance, unless otherwise stated, is (weight / weight) % for solid / solid, (weight / volume) % for solid / liquid, and (volume / volume) % for liquid / liquid.)

[0124]

[0125] Example 1. Production of arginine-producing microorganisms

[0126] Example 1-1. Production of Corynebacterium glutamicum CJR2 strain

[0127] To evaluate the production ability of L-arginine, Corynebacterium glutamicum strain CJR2 was produced by introducing △argR and argB (M54V) mutations into wild-type Corynebacterium glutamicum ATCC13869 (Ikeda, Masato et al., Applied and environmental microbiology 75(6)1635-41, 2009).

[0128] First, vectors introducing argR deletion and argB (M54V) mutation were constructed. Using the genomic DNA of Corynebacterium glutamicum ATCC13869 as a template, PCR using primer pairs of SEQ ID NOs: 1 and 2, 3 and 4, and overlapping PCR using primer pairs of SEQ ID NOs: 1 and 4 were performed to obtain a homologous recombination fragment having the argR deletion mutation sequence. In the same manner, PCR using primer pairs of SEQ ID NOs: 5 and 6, 7 and 8, and overlapping PCR using SEQ ID NOs: 5 and 8 were performed to prepare a homologous recombination fragment having the argB (M54V) mutation. The PCR reaction was denatured at 95°C for 5 minutes; After 27 cycles of denaturation at 95°C for 30 seconds, annealing at 60°C for 30 seconds, and polymerization at 72°C for 1 minute, the polymerization reaction was performed at 72°C for 5 minutes. The fragments obtained above were purified, and fusion cloning was performed using the In-Fusion® HD cloning kit (Clontech) according to the manual with the pDC24 vector (SEQ ID NO: 43) digested with SmaI restriction enzyme to obtain plasmids. The constructed vectors were named pDC24-ΔargR and pDC24-argB(M54V), respectively.

[0129] Next, the argR deletion mutation was introduced into the wild-type Corynebacterium glutamicum ATCC13869. Transformation was performed using the electric pulse method using the constructed pDC24-ΔargR plasmid (van der Rest et al., Appl Microbiol Biotechnol 52:541-545, 1999). Then, a second recombination was performed on a solid plate medium containing 4% sucrose, and PCR was performed using the primer pair of SEQ ID NO: 1 and 4 for the transformant that completed the second recombination, confirming that the deletion mutation was introduced into the argR gene on the chromosome. At this time, the PCR reaction was performed under the same conditions as above, and the transformant obtained in this way was named CJR1.

[0130]

[0131] <Solid plate medium (pH 7.0)>

[0132] Glucose 10 g, peptone 10 g, beef extract 5 g, yeast extract 5 g, brain heart infusion 18.5 g, NaCl 2.5 g, urea 2 g, sorbitol 91 g, agar 20 g (per 1 liter of distilled water)

[0133]

[0134] The argB (M54V) mutation was introduced into the above-mentioned Corynebacterium glutamicum CJR1 using the same method as above. The above-mentioned pDC24-argB (M54V) plasmid was used, and PCR was performed using the primer pair of SEQ ID NO: 5 and 8 on the transformant strain in which the second recombination was completed, confirming that the M54V mutation was introduced into the argB gene on the chromosome. The transformant strain was named CJR2.

[0135] The sequence information of the primers used in Example 1-1 is described in Table 1 below.

[0136] Sequence number name sequence (5'->3')1argR-5'-Ftgaattcgagctcggtaccccactggtgaactccttgtcc2argR-5'-Rttgaactagggcgctttaaaagttttc cggtgttgacgg3argR-3'-Fccgtcaacaccggaaaacttttaaagcgcccctagttcaa4argR-3'-Rgtcgactctagaggatcccccgttgaactgct tgccagcc5argB-5'-Ftgaattcgagctcggtaccctgcggctcgcacggttgctc6argB-5'-Racggtgcgcaagaagaccacgtcggcagcaaaagca gcct7argB-3'-Fggctgcttttgctgccgacgtggtcttcttgcgcaccgtg8argB-3'-Rgtcgactctagaggatccccctcttatcaggccaatcggt

[0137]

[0138] Example 1-2. Production of Corynebacterium glutamicum CJR100 strain

[0139] Based on the CJR2 strain produced in Example 1-1, a CJR100 strain with an enhanced N-acetyl-gamma-glutamyl-phosphate reductase (argC) gene was produced.

[0140] To enhance the activity of N-acetyl-gamma-glutamyl-phosphate reductase, argC (NCBI registration number BBD29_RS07530), a plasmid was constructed by replacing the wild-type promoter of the argC gene with Po2 using the Po2 promoter (US 10273491 B2), which is known as a strong promoter. The upstream and downstream regions of the argC gene were obtained. Specifically, to produce a strain into which argC with a Po2 promoter was introduced, PCR was performed using the chromosomal DNA of Corynebacterium glutamicum ATCC13869 as a template to amplify the upstream region of the argC gene using primers of SEQ ID NO: 9 and SEQ ID NO: 10, and the downstream region of the argC gene using primers of SEQ ID NO: 11 and SEQ ID NO: 12, respectively. In addition, a Po2 promoter fragment was obtained using the synthesized Po2 promoter as a template using primers of SEQ ID NO: 13 and SEQ ID NO: 14. Pfu UltraTM high-fidelity DNA polymerase (Stratagene) was used as a polymerase for the PCR reaction, and PCR was performed in the same manner as in Example 1-1. As a result, an 86 bp DNA fragment of the Po2 promoter region, a 610 bp DNA fragment upstream of Corynebacterium glutamicum ATCC13869argC, and a 1086 bp DNA fragment downstream of the Po2 promoter region were obtained, respectively. Using the amplified promoter and DNA fragments as templates, PCR was performed using the primers of SEQ ID NO: 9 and SEQ ID NO: 12 in the same manner as in Example 1-1. After DNA purification, the two fragments obtained above were fused to the pDC24 plasmid treated with SmaI restriction enzyme using the In-Fusion® HD cloning kit (Clontech). The resulting vector was named pDC24-Po2-argC.

[0141] Next, the CJR2 strain constructed in Example 1-1 was transformed using the electric pulse method using the pDC24-Po2-argC plasmid constructed above (van der Rest et al., Appl Microbiol Biotechnol 52:541-545, 1999). Then, a second recombination was performed on a solid plate medium containing 4% sucrose, and PCR was performed using primers of SEQ ID NOs: 9 and 14 for the transformant that completed the second recombination, confirming that the argC gene on the chromosome was strengthened by the Po2 promoter. At this time, the PCR reaction was performed under the same conditions as above, and the transformant obtained in this way was named CJR100.

[0142]

[0143] <Solid plate medium (pH 7.0)>

[0144] Glucose 10 g, peptone 10 g, beef extract 5 g, yeast extract 5 g, brain heart infusion 18.5 g, NaCl 2.5 g, urea 2 g, sorbitol 91 g, agar 20 g (per 1 liter of distilled water)

[0145] The sequence information of the primers used in Example 1-2 is described in Table 2 below.

[0146] SEQ ID NO: Name Sequence (5'->3')9argC-5'-FGTGAATTCGAGCTCGGTACCCGCCCCGAAAAGCCGTTAAAAG10argC-5'-RtgccaaaattcacgattattgCTCGAGTCTAGAGAGACGGGTTA11argC-3'-Fttattggag gagatcaaaacaATGACAATCAAGGTTGCAATC12argC-3'-RCAGGTCGGCGTCGCACCTTAAGGGGATCCTCTAGAGTCGACC13Po2-Fcaataatcgtgaattttggca14Po2-Rtgttttgatctcctccaataa

[0147]

[0148] Example 2. Selection of mutant strains with increased arginine production through artificial mutation.

[0149] Example 2-1. Random mutation induction through UV irradiation

[0150] To select mutant strains with increased arginine production, the arginine-producing strain CJR100, constructed in Example 1, was spread on a nutrient medium containing agar and cultured at 30°C for 16 hours. Hundreds of colonies thus obtained were irradiated with UV (ultraviolet mutation) at room temperature to induce random mutations in the genome of the strain. The composition of the nutrient medium is as follows.

[0151] Nutrient medium (pH 7.2)

[0152] Glucose 10 g, meat extract 5 g, polypeptone 10 g, sodium chloride 2.5 g, yeast extract 5 g, agar 20 g, urea 2 g (per 1 liter of distilled water)

[0153]

[0154] Example 2-2. Selection of strains with improved L-arginine production capacity

[0155] In order to select a mutant strain with increased arginine production ability compared to the parent strain CJR100, the CJR100 strain and the mutant strain in which random mutations were induced in Example 2-1 were cultured using the following method.

[0156] The above strains were each inoculated into a 96-Deep Well Plate-Dome (Bioneer) containing 400 μl of seed medium and cultured in a plate shaking incubator (TAITEC) at 32°C and 1200 rpm for approximately 48 hours. The arginine concentrations of approximately 3,000 cultured strains were individually confirmed using a near-infrared spectroscopy (NIR) analyzer, and the top four mutant strains with improved arginine production compared to the parent strain CJR100 were selected. The composition of the seed medium is as follows.

[0157] <Seed medium (pH 7.0)>

[0158] Glucose 20 g, peptone 10 g, yeast extract 5 g, urea 1.5 g, KH2PO4 4 g, K2HPO4 8 g, MgSO4·7H2O 0.5 g, biotin 100 ug, thiamine HCl 1000 ug, calcium-pantothenic acid 2000 ug, nicotinamide 2000 ug (based on 1 liter of distilled water)

[0159]

[0160] In order to finally select strains with reproducibly increased L-arginine production ability among the four mutant strains selected above, the L-arginine production concentration was evaluated by culturing them using the following method.

[0161] The four strains and the control group were each inoculated into a 250 ml corner-baffle flask containing 25 ml of the seed medium and cultured at 30°C for 20 hours with shaking at 200 rpm. Then, 1 ml of the seed culture was inoculated into a 250 ml corner-baffle flask containing 24 ml of the production medium and cultured at 30°C for 54 hours with shaking at 200 rpm.

[0162] <Seed medium (pH 7.0)>

[0163] Glucose 20 g, peptone 10 g, yeast extract 5 g, urea 1.5 g, KH2PO4 4 g, K2HPO4 8 g, MgSO4·7H2O 0.5 g, biotin 100 ug, thiamine HCl 1000 ug, calcium-pantothenic acid 2000 ug, nicotinamide 2000 ug (based on 1 liter of distilled water)

[0164] <Production medium (pH 7.2)>

[0165] Glucose 5%, ammonium sulfate 3%, potassium phosphate monobasic 0.1%, magnesium sulfate heptahydrate 0.2%, corn steep liquor 1.5%, NaCl 1%, yeast extract 0.5%, biotin 100 mg / L

[0166]

[0167] After the culture was completed, the L-arginine concentration in the culture solution was analyzed using high-performance liquid chromatography (HPLC), and the L-arginine production concentration of each mutant strain is shown in Table 3 below.

[0168] Strain nameL-Arg (g / L)CJR1005.8CJR100_mt16.0CJR100_mt22.5CJR100_mt36.3CJR100_mt45.9

[0169] As shown in Table 3 above, among the four selected mutant strains, CJR100_mt3 was finally selected as the mutant strain with the greatest increase in L-arginine production.

[0170]

[0171] Example 3. Mutation identification through whole-genome sequencing (WGS)

[0172] Whole-genome sequencing (WGS) was performed on the CJR100_mt3 strain selected in the above Example 2-2, and the sequence was analyzed. By comparing it with the parent strain CJR100 sequence (SEQ ID NOs: 22 to 28), mutations occurring in seven promoter regions were confirmed, and the sequences of the promoters including the mutations are shown in Table 4 below.

[0173] Sequence number NameExpressed protein (regulatory protein)Promoter sequence (5'->3') 15PBBD29_120 15hypothetical proteinCCTAAATCCAGCGCGTCTGCCAATTCCGCCACAAGCGCTTAATGCGGGTTTTACTATACATGGTGTAGTCCCAAATTAACTAATGCGGGTGACCAACTGCACCGTAAAAAAAATTCGCTTATCGTAAATCAGCAGGTAGAATAACACTCT 16PBBD29_07560Argininosuccinate synthaseGGCTTGTTAATCGCTTGTTAATGCAGGCAGGTAAGGTATAACCCGAGTGTTTTTTCGGGGAATACCAACCCTTTCAACACAATAATTTTCTTTAAACATCCTTGCTGTCCACCACGGCTGGCAAGGAACTTAAAATGAAGGAGCACACCTC 17PBBD29_12275ribonucleotide-diphosphate reductase subunit betaTAGGTGCGCTCTTCCCTTCTACAAATTTTTTTTGCTTTTCGACGCCACAATGCAGCGCGATTTCAGATCGCCAGCTTACCCCAACCGAAGCCCTTCAGAAGACCCGCCCCAGCCTATCAATTTTGGTCAAGTCGCCTAGCTTTAGACCTAG18PBBD29_01740phosphoserinephosphataseAAGGGACGGCCCGCGCCTCGGGGGGGTGTGCGCGGGCCGTCAGTAACCCGGCAACGGGGGGGGGGATTGTGCCGGGGCAGGCCACACTGTATATCGGGGCCTTGCACCTGAAATTATGGCATATCAAACGCCACAAGACAACATCAAACCCGATTATTTATTCGAATAACACGAATACTTAACAGTGTGGCAAATGACACTTCCCGCACGCCTTCTACATTCCCAATGCGCGACCCCAGCACGTCACTTCAATATCATTGGTAACTTTAGTTTCTTTCTCAGTCTTGGAAAGTTGCCAAAAAGCGCTAAACTATGCGGTG19PBBD29_04965D-lactatedehydrogenaseAGGAGGGGCCTACCCGGGCAGCGCCACGCCGTTCGATCCTTGACTACGCGCTACACCCTCATCTGTGAAGAGCCACCAAACCTGGGACGGTTCAAGCGGCGCTAGGCGAGTCTGATTGCTGCGTCGATCTATGGGGTGAGGGCAGTGGCCGACATCGCGGTCCGAACTATCGCGGTCCGAACCTACCGGAGTCCGAAAGTACCGCGGTCCGAACCTACCGGAGTCCGAAAGTACCGCGGTCCGAACCTACCGGAGTCCGAAAGTACCGCGGTCCGAAACTATCTGATGCGCATCTTGTACAATGAGGATG20PBBD29_05235BBD29_05235CGTCTCGAGGTGTCTTATATATAGAGGTATAGGGGAGAAAAATTGAGGGGGAGAATCCGGTCCCATCGACTTCCCCATCACTGCAGTCGCCAAAAGAGTCTGTGAGTCACATCCCAGGATGATCTCATGGCAGGAAAAGTCGGCCCGGGAAAATACCCCTGATCTTCATCGTGCCAGAGAAGGGCCGCGCATCTCGCGAGTGCGGCAGTATCCCTAAAAGTTACCCCCCCCCGAGACTATAAGTTCGTGTAACTGGTGCTGTTGCAAAGTTGGGGCAGTAGGAAGACCGGCGTGAAATAATCAGG21PBBD29_14250hypothetical proteinTGCGGTTGTCATGGTGACCTCTTCTCTGAAACGGACGGCGGGAGTAAACGGGCTGAAACCGATTGGCCCAACCTCATGGTCAGACCACAAGAATGTAAGGCATGTCACCTTTGATTGTCAATGGGGTGTAGCAAACAGGGGGTGGATTGTGTTGCCCTCGCCTTAACGTGTCTCCTGGGGTGTGGGGCTGGGTGACGTATCTGAGACGCTCGGCCTTGGGGGGGGGAAGGTACGAATATAATTTCGAATAATGTATGATCAAGACTCGTCTTTAAAATGGTATTTCAAATGTGAGGCAGT

[0174] (Expressed protein: a protein encoded by a gene whose expression is regulated by being operably linked to the promoter)

[0175] In the following examples, each mutation in Table 4 was evaluated to determine whether it affects the L-arginine production ability of a microorganism of the genus Corynebacterium, thereby identifying effective factors affecting the L-arginine production ability.

[0176]

[0177] Example 4. Production of an L-arginine-producing strain with a mutant promoter.

[0178] Example 4-1. Construction of a recombinant vector for introducing a mutant promoter.

[0179] To introduce each of the mutant promoters PBBD29_12015, PBBD29_07560, PBBD29_12275, BBD29_01740, PBBD29_04965, PBBD29_05235, and PBBD29_14250 in Table 4 above into the CJR100 strain, a vector including the target mutation was constructed.

[0180] Specifically, the genomic DNA of the CJR100_mt3 strain was extracted using a G-spin Total DNA Extraction Mini Kit (Intron, Cat. No. 17045) according to the protocol provided in the kit, and PCR was performed using the genomic DNA as a template. SolgTM Pfu-X DNA polymerase was used as the polymerase, and the PCR conditions were as follows: denaturation at 95°C for 4 minutes; 27 cycles of denaturation at 95°C for 30 seconds, annealing at 60°C for 30 seconds, and polymerization at 72°C for 50 seconds; and polymerization was performed at 72°C for 5 minutes. The sequences of the primer pairs used in the experiment are shown in Table 5 below.

[0181] 프라이머 명칭서열 (5’->3’)서열번호PBBD29_12015*_FtgaattcgagctcggtacccGTGATTCGTATTCCTCGGTG29PBBD29_12015*_RgtcgactctagaggatccccGTCTTCTTGCTCTGGCTGCG30PBBD29_07560*_FtgaattcgagctcggtacccGTTGTCATCACCGATACCTG31PBBD29_07560*_RgtcgactctagaggatccccGCTTCATGTACATGCCGTTT32PBBD29_12275*_FtgaattcgagctcggtacccAGCACCGCTTCTTCGTGCAG33PBBD29_12275*_RgtcgactctagaggatccccAGTTTCCCACCTTTTTGAAG34PBBD29_01740*_FtgaattcgagctcggtacccCGATGATGGTCTTGTCCAGA35PBBD29_01740*_RgtcgactctagaggatccccTGCCTGGAGATGTCCATCAA36PBBD29_04965*_FtgaattcgagctcggtacccCCACCAGTCAGGCCCGTGTT37PBBD29_04965*_RgtcgactctagaggatccccTACTCAGGGATATCTTTCGA38PBBD29_05235*_FtgaattcgagctcggtacccTCGCCGCGTTGTGTAAAGAA39PBBD29_05235*_RgtcgactctagaggatccccAGGTAGCACCACCTGCCGCC40PBBD29_14250*_FtgaattcgagctcggtacccTTCTAGATCTATTCGCCGAT41PBBD29_14250*_RgtcgactctagaggatccccTTGAAGACCAGCGCGGCGAC42

[0182] The obtained mutation introduction fragment and the pDC24 vector (SEQ ID NO: 43) treated with the restriction enzyme SmaI were cloned using the Gibson assembly method (DG Gibson et al., NATURE METHODS, VOL.6 NO.5, MAY 2009, NEBuilder HiFi DNA Assembly Master Mix) to obtain recombinant plasmids, and the vectors pDC24-Pn*_BBD29_12015; pDC24-Pn*_BBD29_07560; pDC24-Pn*_BBD29_12275; pDC24-Pn*_BBD29_01740; pDC24-Pn*_BBD29_04965; pDC24-Pn*_BBD29_05235; and named pDC24-Pn*_BBD29_14250.

[0183]

[0184] Example 4-2. Production of an L-arginine-producing strain with a mutant promoter.

[0185] The seven vectors produced in Example 4-1 were transformed into the CJR100 strain using electroporation, and strains in which the vectors were inserted into the chromosome by recombination of homologous sequences were selected on a kanamycin medium. Thereafter, the strains in which the mutant promoters were introduced were confirmed through PCR using the primers of SEQ ID NO: 44 and SEQ ID NO: 45; or SEQ ID NO: 46 and SEQ ID NO: 47; or SEQ ID NO: 48 and SEQ ID NO: 49; or SEQ ID NO: 50 and SEQ ID NO: 51; or SEQ ID NO: 52 and SEQ ID NO: 53; or SEQ ID NO: 54 and SEQ ID NO: 55; or SEQ ID NO: 56 and SEQ ID NO: 57; for transformants in which the second recombination was completed. PCR was performed in the same manner as in Example 4-1. The above recombinant strains were CJR100△Pn_BBD29_12015::Pn*_BBD29_12015, CJR100△Pn_BBD29_07560::Pn*_BBD29_07560, CJR100△Pn_BBD29_12275::Pn*_BBD29_12275, CJR100△Pn_BBD29_01740::Pn*_BBD29_01740, CJR100△Pn_BBD29_04965::Pn*_BBD29_04965, CJR100△Pn_BBD29_05235::Pn*_BBD29_05235, and It was named CJR100△Pn_BBD29_14250::Pn*_BBD29_14250; The sequences of the primer pairs used for confirmation are shown in Table 6 below.

[0186]

[0187] Sequence number name sequence (5'->3')44PBBD29_12015*_CFGGTGATCCCAGCGATACT45PBBD29_12015*_CRATAGGGCTTCAGCAAAGC46PBBD29_07560*_CFAGGGTAAGAAGGCTGTGT47PBBD29_075 60*_CRGGCGATAGCCTTGTCGCG48PBBD29_12275*_CFACAGGAAGGACTCCAGGA49PBBD29_12275*_CRCTCTGTGCCTTCATCCAG50PBBD29_01740*_CFGGGTTGTTGTCCATT TGTT51PBBD29_01740*_CRTTGCTCAGCGTGGATTTT52PBBD29_04965*_CFAGATGATCACAATGGGGC53PBBD29_04965*_CRGGTTGAAGATCTGTCGGG54PBBD29_05235*_ CFCGTCCGCTGCAAATATCT55PBBD29_05235*_CRTATAACGTTGTCCGGGCT56PBBD29_14250*_CFATTCTTCATCTTCGACGG57PBBD29_14250*_CRTCAAAGTGATGAACAGGG

[0188]

[0189] Example 5. Evaluation of L-arginine production capacity of strains with introduced mutant promoters.

[0190] In order to confirm the L-arginine production ability of the recombinant strains produced in Example 4-2 above, they were cultured and evaluated using the following method.

[0191] Each strain was inoculated into a 250 ml corner-baffle flask containing 25 ml of seed medium and cultured at 30°C for 20 hours with shaking at 200 rpm. 1 ml of seed culture was inoculated into a 250 ml corner-baffle flask containing 24 ml of production medium and cultured at 30°C for 54 hours with shaking at 200 rpm. The medium composition was the same as in Example 2-2, and the experiment was repeated three times.

[0192] After the culture was completed, the amount of L-arginine produced was measured using high-performance liquid chromatography (HPLC), and the average value of the analysis results is shown in Table 7 below.

[0193] Strain name L-arginine concentration (g / L) CJR100 5.9 CJR100 △Pn_BBD29_12015::Pn*_BBD29_12015 6.05 CJR100 △Pn_BBD29_07560::Pn*_BBD29_075606.03 CJR100 △Pn_BBD29_12275::Pn*_BBD29_122756.1 CJR100 △Pn_BBD2 9_01740::Pn*_BBD29_017406.08CJR100△Pn_BBD29_04965::Pn*_BBD29_049656.01CJR100△ Pn_BBD29_05235::Pn*_BBD29_052355.99CJR100△Pn_BBD29_14250::Pn*_BBD29_142506.24

[0194] As shown in Table 7, the arginine production of strains into which mutant promoters were introduced was increased or at an equivalent level compared to the parent strain. In particular, “CJR100△Pn_BBD29_14250::Pn*_BBD29_14250” was confirmed to have significantly improved L-arginine production compared to the parent strain CJR100.

[0195] Through this, it was confirmed that L-arginine could be produced more efficiently by introducing a mutant of the promoter that controls the expression of the BBD29_14250 gene.

[0196]

[0197] From the above description, those skilled in the art will understand that the present disclosure can be implemented in other specific forms without altering its technical spirit or essential characteristics. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not restrictive. The scope of the present disclosure should be interpreted as encompassing all changes or modifications derived from the meaning and scope of the following claims and their equivalent concepts, rather than the detailed description above.

Claims

1. A polynucleotide comprising a nucleotide sequence having 90% or more sequence identity with the nucleotide sequence of sequence number 21.

2. In the first paragraph, the polynucleotide comprises a nucleotide sequence of SEQ ID NO:

21.

3. An expression cassette comprising the polynucleotide of paragraph 1 and the target gene.

4. A microorganism of the genus Corynebacterium sp. comprising the polynucleotide of claim 1 or 2; or the polynucleotide and a target gene operably linked thereto.

5. In the fourth paragraph, the microorganism of the genus Corynebacterium is Corynebacterium glutamicum.

6. A method for producing L-arginine, comprising a step of culturing the microorganism of clause 4 in a medium.

7. A method for producing L-arginine, wherein the method further comprises a step of recovering L-arginine from a cultured medium or microorganism in the 6th paragraph.

8. Use of the microorganism of paragraph 4 or 5 for producing L-arginine.

9. A composition, method, product, process, or use characterized by one or more elements disclosed in the present disclosure.