Protein variant and l-arginine production method using same

A protein variant with an altered amino acid sequence at the 922nd position from the N-terminus, specifically substituting glycine with glutamic acid, improves L-arginine production in Corynebacterium microorganisms, addressing the need for enhanced productivity in existing technologies.

WO2025249709A1PCT designated stage Publication Date: 2025-12-04CJ CHEILJEDANG CORP
View PDF 9 Cites 0 Cited by

Patent Information

Application Number
PCT/KR2025/002418
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-10-07
Filing Date
2025-02-20
Publication Date
2025-12-04

AI Technical Summary

Technical Problem

Existing technologies for producing L-arginine using Corynebacterium microorganisms are in need of improvement to enhance productivity.

Method used

Development of a protein variant with an altered amino acid sequence at the 922nd position from the N-terminus, specifically substituting glycine with glutamic acid, and the use of a polynucleotide encoding this variant to increase L-arginine production in Corynebacterium microorganisms.

Benefits of technology

The protein variant enhances L-arginine production capacity, achieving increased productivity compared to wild-type proteins.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure PCTKR2025002418-APPB-IMG-000001
    Figure PCTKR2025002418-APPB-IMG-000001
  • Figure PCTKR2025002418-APPB-IMG-000002
    Figure PCTKR2025002418-APPB-IMG-000002
  • Figure PCTKR2025002418-APPB-IMG-000003
    Figure PCTKR2025002418-APPB-IMG-000003
Patent Text Reader

Abstract

The present disclosure relates to: a protein variant; a polynucleotide encoding the protein variant; a microorganism of the genus Corynebacterium, comprising at least one selected from the group consisting of the protein variant and the polynucleotide; and an L-arginine production method using the microorganism.
Need to check novelty before this filing date? Find Prior Art

Description

Protein variant and method for producing L-arginine using the same

[0001] Cross-citation with related application(s)

[0002] This application claims the benefit of priority to Korean Patent Application No. 10-2024-0071881, filed May 31, 2024, and Korean Patent Application No. 10-2024-0135802, filed October 7, 2024, the entire contents of which are incorporated herein by reference.

[0003] The present disclosure relates to a novel protein variant, a Corynebacterium genus microorganism comprising the protein variant, and a method for producing L-arginine using the microorganism.

[0004]

[0005] L-arginine is an amino acid, the basic building block of protein, and is used in animal feed, food additives, nutritional supplements, and pharmaceutical ingredients. Furthermore, L-arginine is essential for animal growth and reproduction, and is widely used in poultry and fish feed. Its use as a food amino acid is also increasing due to its muscle-building and waste-eliminating effects.

[0006] Based on this trend, various attempts are being made to improve productivity in the production of L-arginine using various microorganisms, including microorganisms of the genus Corynebacterium (US 2016-0145661 A1).

[0007]

[0008] Despite these efforts, the development of technologies to improve L-arginine production is still needed.

[0009]

[0010] One object of the present disclosure is to provide novel protein variants.

[0011] Another object of the present disclosure is to provide a polynucleotide encoding the protein variant.

[0012] Another object of the present disclosure is to provide a microorganism of the genus Corynebacterium, comprising at least one selected from the group consisting of the protein variants and polynucleotides encoding the same.

[0013] Another object of the present disclosure is to provide a method for producing L-arginine, comprising a step of culturing the microorganism in a medium.

[0014] Another object of the present disclosure is to provide a use of the microorganism for producing L-arginine.

[0015]

[0016] This is specifically explained as follows. Meanwhile, each description and embodiment disclosed in this disclosure can also be applied to each other description and embodiment. That is, all combinations of various elements disclosed in this disclosure fall within the scope of this disclosure. Furthermore, the scope of this disclosure is not limited by the specific descriptions described below. Furthermore, numerous papers and patent documents are referenced and cited throughout this disclosure. The disclosure contents of the cited papers and patent documents are incorporated into this disclosure in their entirety by reference to more clearly explain the level of the technical field to which this disclosure belongs and the contents of this disclosure.

[0017]

[0018] One aspect of the present disclosure provides a protein variant comprising an amino acid sequence in which the amino acid corresponding to the 922nd position from the N-terminus in the amino acid sequence of SEQ ID NO: 74 is replaced with a different amino acid from the original.

[0019] In the present disclosure, the sequence of sequence number 74 is as shown in Table 1 below.

[0020] Protein name (gene ID, gene name) Sequence (N-terminal → C-terminal) Sequence number excinuclease ABC subunit A (BBD29_07445,uvrA),

[0021] In one embodiment, the protein variant of the present disclosure described above may essentially consist of an amino acid sequence in which the amino acid corresponding to the 922nd position from the N-terminus in the amino acid sequence of SEQ ID NO: 74 is substituted with a different amino acid. In another embodiment, the protein variant of the present disclosure described above may consist of an amino acid sequence in which the amino acid corresponding to the 922nd position from the N-terminus in the amino acid sequence of SEQ ID NO: 74 is substituted with a different amino acid.

[0022] In the present disclosure, the amino acid sequence of SEQ ID NO: 74 may be a sequence of a protein (excinuclease ABC subunit A) encoded by the BBD29_07445 gene.

[0023] In one embodiment, the protein variant of the present disclosure described above may be a protein variant comprising an amino acid sequence in which the amino acid corresponding to the 922nd position from the N-terminus in the amino acid sequence of SEQ ID NO: 74 is substituted with glutamic acid (Glu, E).

[0024] In one embodiment, the amino acid corresponding to the 922nd position from the N-terminus in the amino acid sequence of SEQ ID NO: 74 may be, but is not limited to, glycine (Gly, G).

[0025] The protein variant of the present disclosure may have an activity that increases L-arginine production capacity compared to the wild type protein (polypeptide).

[0026] The protein variant of the present disclosure may include an amino acid sequence in which the amino acid corresponding to the 922nd position from the N-terminus in the amino acid sequence of SEQ ID NO: 74 is replaced with a different amino acid, or may include an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7%, or 99.9% homology or identity with the amino acid sequence. In addition, it is obvious that a variant having an amino acid sequence in which a part of the sequence is deleted, modified, substituted, conservatively substituted, or added is also included within the scope of the present disclosure, as long as it has such homology or identity and exhibits an efficacy corresponding to the variant of the present disclosure (efficacy of increasing L-arginine production).

[0027] For example, if the amino acid sequence has sequence additions or deletions, naturally occurring mutations, silent mutations or conservative substitutions that do not alter the function of the variant of the present disclosure at the N-terminus, C-terminus and / or within the amino acid sequence.

[0028] The term "conservative substitution" refers to the replacement of one amino acid with another amino acid having similar structural and / or chemical properties. Such amino acid substitutions may generally be based on similarities in the polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphipathic nature of the residues. Typically, conservative substitutions may have little or no effect on the activity of a protein or polypeptide.

[0029] As used herein, the term "variant" refers to a polypeptide in which one or more amino acids are conservatively substituted and / or modified, thereby differing from the amino acid sequence of the variant before the mutation, but retaining functions or properties. Such variants can generally be identified by modifying one or more amino acids in the amino acid sequence of the polypeptide and evaluating the properties of the modified polypeptide. That is, the ability of the variant may be increased, unchanged, or decreased compared to the polypeptide before the mutation. Additionally, some variants may include variants in which one or more portions, such as the N-terminal leader sequence or the transmembrane domain, are deleted. Other variants may include variants in which portions are deleted from the N- and / or C-terminus of the mature protein. The above term "variant" may be used interchangeably with terms such as variant, modification, variant polypeptide, variant protein, variant and variant (in English, modification, modified polypeptide, modified protein, mutant, mutein, divergent, etc.), and is not limited thereto if the term is used in the meaning of variant.

[0030] Additionally, variants may include deletions or additions of amino acids that have minimal impact on the properties and secondary structure of the polypeptide. For example, the N-terminus of the variant may be conjugated with a signal (or leader) sequence involved in co-translational or post-translational protein translocation. Furthermore, the variant may be conjugated to other sequences or linkers to facilitate identification, purification, or synthesis.

[0031] In one embodiment, the protein variant of the present disclosure described above may have a sequence homology or identity of at least 90%, 91%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, but less than 100%, to the amino acid sequence of SEQ ID NO: 74.

[0032]

[0033] Another aspect of the present disclosure provides a protein variant comprising any one amino acid sequence selected from the group consisting of amino acid sequences of SEQ ID NO: 15 to SEQ ID NO: 20. In one embodiment, the protein variant may be a protein variant comprising the amino acid sequence of SEQ ID NO: 20. In another embodiment, the variant of the present disclosure may essentially consist of the amino acid sequence of SEQ ID NO: 20. In yet another embodiment, the variant of the present disclosure may consist of the amino acid sequence of SEQ ID NO: 20.

[0034] In the present disclosure, the amino acid sequence of SEQ ID NO: 20 may be a sequence of a protein variant in which the 922nd amino acid of the protein (excinuclease ABC subunit A) encoded by the BBD29_07445 gene is substituted from glycine (Gly, G) to glutamic acid (Glu, E).

[0035] The protein variant of the present disclosure may comprise any one amino acid sequence selected from the group consisting of amino acid sequences of SEQ ID NO: 15 to SEQ ID NO: 20 (e.g., the amino acid sequence of SEQ ID NO: 20), or may comprise an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7%, or 99.9% homology or identity with said amino acid sequence. In addition, it is obvious that a variant having an amino acid sequence in which a part of the sequence is deleted, modified, substituted, conservatively substituted, or added is also included within the scope of the present disclosure, as long as it has such homology or identity and exhibits an efficacy corresponding to the variant of the present disclosure (efficacy of increasing L-arginine production).

[0036] For example, if the amino acid sequence has sequence additions or deletions, naturally occurring mutations, silent mutations or conservative substitutions that do not alter the function of the variant of the present disclosure at the N-terminus, C-terminus and / or within the amino acid sequence.

[0037] In the above protein variants, conservative substitutions, variants, etc. are as described above.

[0038]

[0039] As used herein, the terms "homology" or "identity" refer to the degree of similarity between two given amino acid sequences or base sequences, which may be expressed as a percentage. The terms homology and identity are often used interchangeably.

[0040] Sequence homology or identity of conserved polynucleotides or polypeptides is determined by standard alignment algorithms, and may be combined with default gap penalties established by the program being used. In practice, homologous or identical sequences can generally hybridize with all or part of the sequence under moderate or high stringency conditions. It should be appreciated that hybridization also includes hybridization with polynucleotides containing common codons or codons that take codon degeneracy into account.

[0041] Whether any two polynucleotide or polypeptide sequences are homologous or identical can be determined using known computer algorithms such as the "FASTA" program using default parameters, for example, as in Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: 2444. Alternatively, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) as implemented in the Needleman program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) (version 5.0.0 or later) can be determined using the GCG program package (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego, 1994, and [CARILLO ETA / .](1988) SIAM J Applied Math 48: 1073). For example, homology or identity can be determined using BLAST or ClustalW of the National Center for Biotechnology Information database.

[0042] Homology or identity of polynucleotides or polypeptides can be determined by comparing sequence information using a GAP computer program, such as that disclosed, for example, in Smith and Waterman, Adv. Appl. Math (1981) 2:482, or in, for example, Needleman et al. (1970), J Mol Biol. 48:443. In brief, the GAP program can be defined as the total number of symbols in the shorter of the two sequences divided by the number of similarly arranged symbols (i.e., nucleotides or amino acids). Default parameters for the GAP program include (1) a binary comparison matrix (containing values ​​of 1 for identity and 0 for non-identity) and (2) a coding sequence matrix, as disclosed by Gribskov et al. (1986) Nucl. Acids Res. 48:443, as disclosed by Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358 (1979). 14: 6745 weighted comparison matrix (or EDNAFULL (EMBOSS version of NCBI NUC4.4) permutation matrix); (2) a penalty of 3.0 for each gap and an additional penalty of 0.10 for each symbol in each gap (or a gap opening penalty of 10, a gap extension penalty of 0.5); and (3) no penalty for terminal gaps.

[0043] As an example of the present disclosure, the variant of the present disclosure described above may have an activity that increases L-arginine production ability compared to a wild type protein (polypeptide).

[0044]

[0045] As used herein, the term "corresponding to" refers to an amino acid residue at a position listed in a polypeptide, or an amino acid residue that is similar, identical, or homologous to the residue listed in the polypeptide. Identifying an amino acid at a corresponding position may be determining a specific amino acid in a sequence that references a particular sequence. As used herein, "corresponding region" generally refers to a similar or corresponding position in a related or reference protein.

[0046] For example, any amino acid sequence may be aligned with an amino acid sequence (e.g., an amino acid sequence of SEQ ID NO: 20) in which the amino acid corresponding to the 922nd position from the N-terminus in the amino acid sequence of SEQ ID NO: 74 is substituted with a different amino acid, and based on this, each amino acid residue of the amino acid sequence may be numbered by referring to the numerical position of the amino acid residue corresponding to the amino acid residue of the amino acid sequence (e.g., an amino acid sequence of SEQ ID NO: 20) in which the amino acid corresponding to the 922nd position from the N-terminus in the amino acid sequence of SEQ ID NO: 74 is substituted with a different amino acid. For example, a sequence alignment algorithm such as that described in the present disclosure can identify the position of an amino acid, or the position at which a modification such as a substitution, insertion, or deletion occurs, by comparing it with a query sequence (also referred to as a "reference sequence").

[0047] For such alignment, for example, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453), the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000), Trends Genet. 16: 276-277) can be used, but is not limited thereto, and any sequence alignment program known in the art, pairwise sequence comparison algorithm, etc. can be appropriately used.

[0048]

[0049] Another aspect of the present disclosure provides a polynucleotide encoding a protein variant of the present disclosure.

[0050] In the present disclosure, the term "polynucleotide" means a polymer of nucleotides in which nucleotide units (monomers) are covalently bonded to form a long chain, a DNA or RNA strand of a certain length or longer, and more specifically, a polynucleotide fragment encoding the variant.

[0051] In one example, the polynucleotide may be a polynucleotide encoding a protein variant comprising an amino acid sequence in which the amino acid corresponding to the 922nd position from the N-terminus in the amino acid sequence of SEQ ID NO: 74 is replaced with an amino acid different from the original.

[0052] In one example, the polynucleotide may comprise a polynucleotide comprising any one nucleotide sequence selected from the group consisting of the nucleotide sequences of SEQ ID NO: 21 to SEQ ID NO: 26, for example, the nucleotide sequence of SEQ ID NO: 26.

[0053] A polynucleotide encoding a protein variant of the present disclosure may have or comprise any one nucleotide sequence selected from the group consisting of nucleotide sequences of SEQ ID NO: 21 to SEQ ID NO: 26, for example, the nucleotide sequence of SEQ ID NO: 26. In another example, the polynucleotide may comprise a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7%, or 99.9% homology or identity with the nucleotide sequence. Additionally, it is obvious that a polynucleotide having a nucleotide sequence in which some of the sequences are deleted, modified, substituted, conservatively substituted or added is also included within the scope of the present disclosure, provided that the sequence encodes a polypeptide or protein having such homology or identity and exhibiting an effect corresponding to the variant of the present disclosure (increased L-arginine production).

[0054] In one example, the nucleotide sequence or amino acid sequence provided in the present disclosure may include a modification by conventional mutagenesis, such as directed evolution and / or site-directed mutagenesis, to the extent that it maintains its original function or desired function. In one example, a polynucleotide or polypeptide “comprising a particular nucleotide sequence or amino acid sequence” can mean that the polynucleotide or polypeptide (i) consists of or essentially comprises the particular nucleotide sequence or amino acid sequence, or (ii) consists of or essentially comprises an amino acid sequence that has at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or at least 99.9% homology to the particular nucleotide sequence or amino acid sequence and retains its original function and / or desired function.

[0055] The polynucleotide of the present disclosure may have various modifications in the coding region within a range that does not change the amino acid sequence of the variant of the present disclosure, taking into account the degeneracy of the codon or the codon preferred in the organism that is intended to express the variant of the present disclosure. Specifically, the polynucleotide of the present disclosure may have or include a base sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, and less than 100% homology or identity with any one nucleotide sequence selected from the group consisting of the nucleotide sequences of SEQ ID NO: 21 to SEQ ID NO: 26 (e.g., the nucleotide sequence of SEQ ID NO: 26), or may consist of or consist essentially of a base sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, and less than 100% homology or identity with the nucleotide sequence, but is not limited thereto.

[0056] Additionally, the polynucleotides of the present disclosure may include, without limitation, probes that can be prepared from known genetic sequences, for example, sequences that can hybridize under stringent conditions with a complementary sequence to all or part of the polynucleotide sequence of the present disclosure. The term "stringent conditions" refers to conditions that enable specific hybridization between polynucleotides. For example, conditions under which polynucleotides having high homology or identity hybridize with each other, polynucleotides having 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more homology or identity hybridize with each other, and polynucleotides having lower homology or identity do not hybridize with each other, or conditions under which washing conditions of typical southern hybridization are performed once, specifically twice or three times, at a salt concentration and temperature equivalent to 60°C, 1×SSC, 0.1% SDS, specifically 60°C, 0.1×SSC, 0.1% SDS, and more specifically 68°C, 0.1×SSC, 0.1% SDS.

[0057] Hybridization requires that two nucleic acids have complementary sequences, although mismatches between bases are possible depending on the stringency of hybridization. The term "complementary" is used to describe the relationship between nucleotide bases that can hybridize with each other. For example, in DNA, adenine is complementary to thymine, and cytosine is complementary to guanine. Accordingly, the polynucleotides of the present disclosure may also include isolated nucleic acid fragments that are complementary in their entirety, as well as substantially similar nucleotide sequences.

[0058] Specifically, a polynucleotide having homology or identity with the polynucleotide of the present disclosure can be detected using hybridization conditions including a hybridization step at a Tm value of 55°C and using the conditions described above. In addition, the Tm value may be, but is not limited to, 60°C, 63°C, or 65°C, and can be appropriately adjusted by a person skilled in the art depending on the purpose.

[0059] The appropriate stringency for hybridizing the above polynucleotides depends on the length and degree of complementarity of the polynucleotides, variables which are well known in the art.

[0060]

[0061] Another aspect of the present disclosure provides a vector comprising the polynucleotide of the present disclosure. The vector may be, but is not limited to, an expression vector for expressing the polynucleotide in a host cell.

[0062] The vector of the present disclosure may comprise a DNA construct comprising a base sequence of a polynucleotide encoding a target polypeptide operably linked to a suitable expression control region (or expression control sequence) so as to enable expression of the target polypeptide in a suitable host. The expression control region may comprise a promoter capable of initiating transcription, an optional operator sequence for regulating such transcription, a sequence encoding a suitable mRNA ribosome binding site, and sequences regulating the termination of transcription and translation. The vector may be capable of replicating or functioning independently of the host genome after being transformed into a suitable host cell, or may be integrated into the genome itself.

[0063] The vector used in the present disclosure is not particularly limited, and any vector known in the art can be used. Examples of commonly used vectors include plasmids, cosmids, viruses, and bacteriophages in a natural or recombinant state. For example, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A can be used as phage vectors or cosmid vectors, and pDZ series, pBR series, pUC series, pBluescriptII series, pGEM series, pTZ series, pCL series, and pET series can be used as plasmid vectors. Specifically, pDZ, pDC, pDCM2, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC, or pDC24 vectors can be used.

[0064] For example, a polynucleotide encoding a target polypeptide can be inserted into a chromosome via a vector for intracellular chromosomal insertion. The insertion of the polynucleotide into the chromosome can be achieved by any method known in the art, such as, but not limited to, homologous recombination. A selection marker for confirming the chromosomal insertion can be additionally included. The selection marker is used to select cells transformed with the vector, i.e., to confirm the insertion of the target nucleic acid molecule. Markers that confer a selectable phenotype, such as drug resistance, nutrient requirement, cytotoxic agent resistance, or expression of a surface polypeptide, can be used. In an environment treated with a selective agent, only cells expressing the selection marker survive or exhibit other phenotypic traits, thereby allowing the selection of transformed cells.

[0065] As used herein, the term "transformation" refers to introducing a vector containing a polynucleotide encoding a target polypeptide into a host cell or microorganism, such that the polypeptide encoded by the polynucleotide can be expressed within the host cell. The transformed polynucleotide can be located within the chromosome of the host cell or located extrachromosomally, as long as it can be expressed within the host cell. In addition, the polynucleotide includes DNA and / or RNA encoding the target polypeptide. The polynucleotide can be introduced in any form as long as it can be introduced into the host cell and expressed. For example, the polynucleotide can be introduced into the host cell in the form of an expression cassette, which is a genetic construct containing all the elements necessary for autonomous expression. The expression cassette can typically include a promoter, a transcription termination signal, a ribosome binding site, and a translation termination signal, which are operably linked to the polynucleotide. The above expression cassette may be in the form of a self-replicating expression vector. Furthermore, the polynucleotide may be introduced into a host cell in its own form and operably linked to a sequence necessary for expression in the host cell, but is not limited thereto.

[0066] Additionally, the term "operably linked" as used herein means that the polynucleotide sequence is functionally linked to a promoter sequence that initiates and mediates transcription of the polynucleotide encoding the target variant of the present disclosure.

[0067]

[0068] Another aspect of the present disclosure provides a microorganism of the genus Corynebacterium, comprising at least one member selected from the group consisting of a protein variant of the present disclosure and a polynucleotide of the present disclosure.

[0069] The microorganism of the present disclosure may comprise a protein variant of the present disclosure, a polynucleotide encoding the protein variant, or a vector comprising the polynucleotide of the present disclosure.

[0070] In the present disclosure, the term "microorganism (or strain)" includes both wild-type microorganisms and microorganisms that have undergone genetic modification naturally or artificially, and may be microorganisms that have had a specific mechanism weakened or strengthened due to causes such as insertion of an external gene or enhanced or inactivated activity of an endogenous gene, and may be microorganisms that include genetic modification for the production of a desired polypeptide, protein or product.

[0071] The microorganism of the present disclosure may be, but is not limited to, a microorganism comprising at least one of a protein variant of the present disclosure, a polynucleotide of the present disclosure, and a vector comprising a polynucleotide of the present disclosure; a microorganism modified to express a variant of the present disclosure or a polynucleotide of the present disclosure; a microorganism (e.g., a recombinant microorganism) expressing a variant of the present disclosure or a polynucleotide of the present disclosure; or a microorganism having the activity of a variant of the present disclosure (e.g., a recombinant microorganism).

[0072] The microorganism of the present disclosure may be a microorganism having L-arginine production ability.

[0073] The microorganism of the present disclosure may have an increased L-arginine productivity compared to a microorganism of the genus Corynebacterium that does not include at least one selected from the group consisting of the protein variant of the present disclosure described above and a polynucleotide encoding the protein variant (i.e., a protein variant comprising an amino acid sequence in which the amino acid corresponding to the 922nd position from the N-terminus in the amino acid sequence of SEQ ID NO: 74 is substituted with glutamic acid; or a microorganism that does not express a protein variant comprising any one amino acid sequence selected from the group consisting of amino acid sequences of SEQ ID NO: 15 to SEQ ID NO: 20, for example, the amino acid sequence of SEQ ID NO: 20, or a microorganism that expresses a wild-type protein corresponding to the protein variant).

[0074] The microorganism of the present disclosure may be a microorganism that naturally has the ability to produce L-arginine, or a parent strain that does not have the ability to produce L-arginine, into which a variant of the present disclosure or a polynucleotide encoding the same (or a vector including the polynucleotide) is introduced and / or a microorganism that is endowed with the ability to produce L-arginine, but is not limited thereto.

[0075] For example, the microorganism of the present disclosure is a cell or microorganism that is transformed with a vector containing a polynucleotide encoding the polynucleotide of the present disclosure or a variant of the present disclosure, and expresses a protein variant of the present disclosure. For the purposes of the present disclosure, the strain of the present disclosure may include any microorganism capable of producing L-arginine, including the variant of the present disclosure. For example, the microorganism of the present disclosure may be a recombinant microorganism whose L-arginine production ability is increased by introducing a polynucleotide encoding the variant of the present disclosure into a naturally occurring wild-type microorganism or a microorganism that produces L-arginine.

[0076] In one specific example, the microorganism of the present disclosure may have increased L-arginine production ability compared to a microorganism of the genus Corynebacterium that does not comprise at least one member selected from the group consisting of a protein variant of the present disclosure and a polynucleotide encoding the protein variant. The microorganism of the genus Corynebacterium that does not comprise at least one member selected from the group consisting of a protein variant of the present disclosure and a polynucleotide encoding the protein variant may be a natural wild-type microorganism or an unmodified microorganism, and may also be referred to as a parent strain.

[0077] The term "unmodified microorganism" in this disclosure does not exclude microorganisms that contain mutations that can occur naturally in microorganisms, and may refer to wild-type microorganisms or natural microorganisms themselves, or microorganisms before their traits are changed by genetic mutations caused by natural or artificial factors. For example, the unmodified microorganism may refer to a microorganism that has not been introduced or before the protein variant described in the present disclosure is introduced. The "unmodified microorganism" may be used interchangeably with "pre-modified strain," "pre-modified microorganism," "unmutated strain," "unmodified microorganism," or "reference microorganism."

[0078] In one embodiment, the unmodified microorganism may be, but is not limited to, a microorganism whose biosynthetic pathway of L-arginine has been additionally enhanced to increase the production of L-arginine.

[0079] In one embodiment, the non-modified microorganism may be, but is not limited to, a microorganism in which the argR gene encoding arginine repressor (ArgR) is deleted, a genetic mutation (M54V) is introduced into the argB gene encoding acetylglutamate kinase (ArgB), and / or the activity of N-acetyl-gamma-glutamyl-phosphate reductase (ArgC) is enhanced by promoter replacement, to enhance the biosynthetic pathway of L-arginine.

[0080] In one embodiment, the microorganism with increased L-arginine production of the present disclosure may have an L-arginine production ability increased by about 1% or more, about 1.5% or more, about 2% or more, about 2.5% or more, about 3% or more, about 3.5% or more, about 4% or more, about 4.5% or more, about 5% or more, about 5.5% or more, about 6% or more, or about 6.1% or more (the upper limit is not particularly limited and may be, for example, about 200% or less, about 150% or less, about 100% or less, or about 50% or less) compared to the parent strain before mutation or the unmodified microorganism, but is not limited thereto. In another embodiment, the microorganism with increased L-arginine production of the present disclosure may have an L-arginine production ability increased by about 1.01-fold or more, about 1.015-fold or more, about 1.02-fold or more, about 1.025-fold or more, about 1.03-fold or more, about 1.035-fold or more, about 1.04-fold or more, about 1.045-fold or more, about 1.05-fold or more, about 1.055-fold or more, about 1.06-fold or more, or about 1.061-fold or more (the upper limit is not particularly limited and may be, for example, about 10-fold or less, about 5-fold or less, about 3-fold or less, or about 2-fold or less) compared to the parent strain before mutation or the unmodified microorganism, but is not limited thereto.

[0081] The term “about” above includes all ranges including ±0.5, ±0.4, ±0.3, ±0.2, ±0.1, etc., and includes all ranges of values ​​equal to or similar to the value following the term “about,” but is not limited thereto.

[0082]

[0083] In one embodiment, the microorganism of the present disclosure is Corynebacterium glutamicum, Corynebacterium crudilactis, Corynebacterium deserti, Corynebacterium efficiens, Corynebacterium callunae, Corynebacterium stationis, Corynebacterium singulare, Corynebacterium halotolerans, Corynebacterium striatum, Corynebacterium pollutisoli, Corynebacterium It may be Corynebacterium imitans, Corynebacterium testudinoris, or Corynebacterium flavescens, or more specifically, Corynebacterium glutamicum.

[0084]

[0085] As used herein, the term "attenuation" of a polypeptide encompasses a reduction in activity or absence of activity compared to its intrinsic activity. The term "attenuation" may be used interchangeably with terms such as inactivation, deficiency, down-regulation, decrease, reduce, and attenuation.

[0086] The above weakening may also include cases where the activity of the polypeptide itself is reduced or eliminated compared to the activity of the polypeptide originally possessed by the microorganism due to mutation of the polynucleotide encoding the polypeptide, etc., cases where the overall polypeptide activity level and / or concentration (expression amount) within the cell is lower than that of the natural strain due to inhibition of expression of the gene of the polynucleotide encoding the polypeptide or inhibition of translation into the polypeptide, cases where the polynucleotide is not expressed at all, and / or cases where the polypeptide has no activity even if the polynucleotide is expressed. The above "intrinsic activity" refers to the activity of a specific polypeptide originally possessed by the parent strain, wild type, or unmodified microorganism before the change in phenotype when the phenotype is changed due to genetic mutation caused by natural or artificial factors. This may be used interchangeably with "activity before modification." The term "inactivation, deficiency, reduction, downregulation, deterioration, attenuation" of the activity of a polypeptide relative to its intrinsic activity means that the activity of a particular polypeptide is lowered compared to the activity that the parent strain or unmodified microorganism originally had prior to the transformation.

[0087] Attenuation of the activity of such polypeptides can be accomplished by any method known in the art, including but not limited to, and can be achieved by application of various methods well known in the art (e.g., Nakashima N et al., Bacterial cellular engineering by genome editing and gene silencing. Int J Mol Sci. 2014;15(2):2773-2793, Sambrook et al. Molecular Cloning 2012, etc.).

[0088] Specifically, the weakening of the polypeptide of the present disclosure is

[0089] 1) Deletion of all or part of a gene encoding a polypeptide;

[0090] 2) Modification of the expression control region (or expression control sequence) so as to reduce the expression of the gene encoding the polypeptide;

[0091] 3) Modification of the amino acid sequence constituting the polypeptide (e.g., deletion / substitution / addition of one or more amino acids in the amino acid sequence) so as to eliminate or weaken the activity of the polypeptide;

[0092] 4) Modification of the gene sequence encoding the polypeptide such that the activity of the polypeptide is eliminated or weakened (e.g., deletion / substitution / addition of one or more nucleotide bases in the nucleotide sequence of the polypeptide gene such that the polypeptide is modified such that the activity of the polypeptide is eliminated or weakened);

[0093] 5) Modification of the base sequence encoding the initiation codon or 5'-UTR region of a gene transcript encoding a polypeptide;

[0094] 6) Introduction of an antisense oligonucleotide (e.g., antisense RNA) that binds complementarily to a transcript of the gene encoding the polypeptide;

[0095] 7) Addition of a sequence complementary to the Shine-Dalgarno sequence in front of the Shine-Dalgarno sequence of a gene encoding a polypeptide to form a secondary structure to which ribosome attachment is impossible;

[0096] 8) Addition of a promoter that is transcribed in the opposite direction to the 3' end of the open reading frame (ORF) of the gene sequence encoding the polypeptide (Reverse transcription engineering, RTE); or

[0097] 9) Control of cellular localization of proteins (polypeptides); or

[0098] 10) It may be a combination of two or more selected from 1) to 9), but is not particularly limited thereto.

[0099] for example,

[0100] The above 1) deletion of part or all of the gene encoding the polypeptide may be the removal of the entire polynucleotide encoding the endogenous target polypeptide in the chromosome, replacement with a polynucleotide having some nucleotides deleted, or replacement with a marker gene.

[0101] In addition, the above 2) modification of the expression control region (or expression control sequence) may be a mutation in the expression control region (or expression control sequence) by deletion, insertion, non-conservative or conservative substitution, or a combination thereof, or replacement with a sequence having weaker activity. The expression control region includes, but is not limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence regulating the termination of transcription and translation.

[0102] In addition, the above 3) modification of the base sequence encoding the initiation codon or 5'-UTR region of the gene transcript encoding the polypeptide may be, for example, a substitution with a base sequence encoding another initiation codon having a lower polypeptide expression rate than the endogenous initiation codon, but is not limited thereto.

[0103] In addition, the modification of the amino acid sequence or polynucleotide sequence of the above 4) and 5) may be, but is not limited to, a mutation in the sequence of the amino acid sequence of the polypeptide or the polynucleotide sequence encoding the polypeptide, such as deletion, insertion, non-conservative or conservative substitution, or a combination thereof, so as to weaken the activity of the polypeptide, or replacement with an amino acid sequence or polynucleotide sequence improved to have weaker activity, or an amino acid sequence or polynucleotide sequence improved to have no activity. For example, the expression of a gene may be inhibited or weakened by introducing a mutation in the polynucleotide sequence to form a stop codon, but is not limited thereto.

[0104] 6) Introduction of an antisense oligonucleotide (e.g., antisense RNA) that complementarily binds to the transcript of the gene encoding the polypeptide may be described, for example, in the literature [Weintraub, H. et al., Antisense-RNA as a molecular tool for genetic analysis, Reviews - Trends in Genetics, Vol. 1(1) 1986].

[0105] 7) Addition of a sequence complementary to the Shine-Dalgarno sequence in front of the Shine-Dalgarno sequence of a gene encoding a polypeptide to form a secondary structure to which ribosome attachment is impossible may render mRNA translation impossible or slow it down.

[0106] 8) The addition of a promoter transcribed in the opposite direction to the 3' end of the ORF (open reading frame) of the gene sequence encoding the polypeptide (Reverse transcription engineering, RTE) may weaken the activity by creating an antisense nucleotide complementary to the transcript of the gene encoding the polypeptide.

[0107] 9) Control of the intracellular location of a protein (polypeptide) above may be to target the protein (polypeptide) to a specific organelle or specific intracellular space within the cell. For example, it may be to target the protein (polypeptide) to the periplasm or cytoplasm by adding or removing a leader sequence that functions to target the protein (polypeptide), but is not limited thereto.

[0108] Such attenuation of polypeptide activity may include, but is not limited to, a decrease in the activity or concentration or expression level of the corresponding polypeptide relative to the activity or concentration of the polypeptide expressed in the wild type or pre-transformed microbial strain, or a decrease in the amount of a product produced from the polypeptide.

[0109]

[0110] As used herein, the term "enhancement" of polypeptide activity means that the activity of the polypeptide is increased compared to the intrinsic activity. The enhancement may be used interchangeably with terms such as activation, up-regulation, overexpression, and increase. Here, activation, enhancement, up-regulation, overexpression, and increase may all include exhibiting an activity that was not originally present, or exhibiting an activity that is enhanced compared to the intrinsic activity or the activity before modification. The "intrinsic activity" refers to the activity of a specific polypeptide that a parent strain or an unmodified microorganism originally possessed before the trait change, when the trait change is caused by genetic mutation due to natural or artificial factors. This may be used interchangeably with "pre-modification activity." "Enhanced," "upregulated," "overexpressed," or "increased" the activity of a polypeptide relative to its intrinsic activity means that the activity and / or concentration (expression amount) of the specific polypeptide is improved compared to the activity and / or concentration (expression amount) that the parent strain or unmodified microorganism originally had prior to the transformation.

[0111] The above enhancement can be achieved by introducing an exogenous polypeptide, or by enhancing the activity and / or concentration (expression level) of an endogenous polypeptide. Whether the activity of the polypeptide is enhanced can be determined by an increase in the level of activity, expression level, or amount of product excreted from the polypeptide.

[0112] Enhancement of the activity of the above polypeptide can be achieved by applying various methods well known in the art, and is not limited as long as the activity of the target polypeptide can be enhanced compared to the microorganism before modification. Specifically, it may be achieved by using genetic engineering and / or protein engineering, which are routine methods of molecular biology and are well known to those skilled in the art, but are not limited thereto (e.g., Sitnicka et al. Functional Analysis of Genes. Advances in Cell Biology. 2010, Vol. 2. 1-16, Sambrook et al. Molecular Cloning 2012, etc.).

[0113] Specifically, the enhancement of the polypeptide of the present disclosure is

[0114] 1) Increase in the intracellular copy number of a polynucleotide encoding a polypeptide;

[0115] 2) Replacing the gene expression control region on the chromosome that codes for a polypeptide with a highly active sequence;

[0116] 3) Modification of the base sequence encoding the initiation codon or 5'-UTR region of a gene transcript encoding a polypeptide;

[0117] 4) Modification of the amino acid sequence of the polypeptide so as to enhance polypeptide activity;

[0118] 5) Modification of the polynucleotide sequence encoding the polypeptide so as to enhance the activity of the polypeptide (e.g., modification of the polynucleotide sequence of the polypeptide gene so as to encode a polypeptide modified so as to enhance the activity of the polypeptide);

[0119] 6) Introduction of a foreign polypeptide exhibiting the activity of the polypeptide or a foreign polynucleotide encoding the same;

[0120] 7) Codon optimization of polynucleotides encoding polypeptides;

[0121] 8) Analyzing the tertiary structure of the polypeptide and selecting the exposed portion to modify or chemically modify; or

[0122] 9) Control of cellular localization of proteins (polypeptides); or

[0123] 10) It may be a combination of two or more selected from 1) to 9), but is not particularly limited thereto.

[0124] The increase in the intracellular copy number of the polynucleotide encoding the polypeptide described above may be achieved by introducing into the host cell a vector capable of replicating and functioning independently of the host, to which the polynucleotide encoding the polypeptide is operably linked. Alternatively, the polynucleotide encoding the polypeptide may be achieved by introducing one copy or two or more copies into the chromosome of the host cell. The introduction into the chromosome may be performed by introducing into the host cell a vector capable of inserting the polynucleotide into the chromosome of the host cell, but is not limited thereto. The vector is as described above.

[0125] 2) Replacing the gene expression control region (or expression control sequence) on the chromosome encoding the polypeptide with a sequence having strong activity may be, for example, a mutation in the sequence such as deletion, insertion, non-conservative or conservative substitution, or a combination thereof to further enhance the activity of the expression control region, or replacement with a sequence having stronger activity. The expression control region may include, but is not particularly limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence regulating the termination of transcription and translation. As an example, it may be, but is not limited to, replacing the original promoter with a strong promoter.

[0126] Examples of known strong promoters include, but are not limited to, the CJ1 to CJ7 promoters (US Patent No. US 7662943 B2), the lac promoter, the trp promoter, the trc promoter, the tac promoter, the lambda phage PR promoter, the PL promoter, the tet promoter, the gapA promoter, the SPL7 promoter, the SPL13 (sm3) promoter (US Patent No. US 10584338 B2), the O2 promoter (US Patent No. US 10273491 B2), the tkt promoter, and the yccA promoter.

[0127] The above 3) modification of the base sequence encoding the initiation codon or 5'-UTR region of the gene transcript encoding the polypeptide may be, for example, a substitution with a base sequence encoding another initiation codon having a higher polypeptide expression rate than the endogenous initiation codon, but is not limited thereto.

[0128] The modification of the amino acid sequence or polynucleotide sequence of the above 4) and 5) may be, but is not limited to, a mutation in the sequence by deletion, insertion, non-conservative or conservative substitution, or a combination thereof in the amino acid sequence of the polypeptide or the polynucleotide sequence encoding the polypeptide to enhance the activity of the polypeptide, or replacement with an amino acid sequence or polynucleotide sequence improved to have stronger activity, or an amino acid sequence or polynucleotide sequence improved to have increased activity. The replacement may be specifically performed by inserting the polynucleotide into a chromosome by homologous recombination, but is not limited thereto. The vector used at this time may additionally include a selection marker to confirm whether or not chromosomal insertion has occurred. The selection marker is as described above.

[0129] The introduction of the foreign polynucleotide exhibiting the activity of the polypeptide as described above 6) may be the introduction into the host cell of a foreign polynucleotide encoding a polypeptide exhibiting the same / similar activity as the polypeptide. The foreign polynucleotide is not limited in its origin or sequence as long as it exhibits the same / similar activity as the polypeptide. The method used for the introduction may be performed by a person skilled in the art appropriately selecting a known transformation method, and the polypeptide may be produced by expressing the introduced polynucleotide in the host cell, thereby increasing its activity.

[0130] The above 7) codon optimization of a polynucleotide encoding a polypeptide may be codon optimization of an endogenous polynucleotide to increase transcription or translation within a host cell, or codon optimization of a foreign polynucleotide to achieve optimized transcription or translation within a host cell.

[0131] The above 8) analyzing the tertiary structure of a polypeptide and selecting an exposed portion to modify or chemically modify may be done by, for example, comparing the sequence information of the polypeptide to be analyzed with a database storing the sequence information of known proteins, determining a template protein candidate based on the degree of sequence similarity, confirming the structure based on this, and selecting an exposed portion to modify or chemically modify, and modifying or modifying it.

[0132] 9) Control of the intracellular location of a protein (polypeptide) above may be to target the protein (polypeptide) to a specific organelle or specific intracellular space within the cell. For example, it may be to target the protein (polypeptide) to the periplasm or cytoplasm by adding or removing a leader sequence that functions to target the protein (polypeptide), but is not limited thereto.

[0133] Such enhancement of polypeptide activity may be, but is not limited to, an increase in the activity or concentration of the corresponding polypeptide relative to the activity or concentration of the polypeptide expressed in the wild type or pre-transformed microbial strain, or an increase in the amount of a product produced from the polypeptide.

[0134]

[0135] In the microorganism of the present disclosure, modification of part or all of a polynucleotide (e.g., modification to encode the protein variant described above) may be induced by, but is not limited to, (a) homologous recombination using a vector for chromosomal integration into the microorganism or genome editing using engineered nucleases (e.g., CRISPR-Cas9) and / or (b) treatment with light and / or chemicals such as ultraviolet rays and radiation. The method for modifying part or all of the gene may include a method using DNA recombination technology. For example, a nucleotide sequence or vector containing a nucleotide sequence homologous to a target gene may be injected into the microorganism to cause homologous recombination, thereby causing deletion of part or all of the gene. The injected nucleotide sequence or vector may include, but is not limited to, a dominant selection marker.

[0136] In the microorganism of the present disclosure, the protein variant, polynucleotide, L-arginine, etc. are as described in the other aspects above.

[0137]

[0138] Another aspect of the present disclosure provides a method for producing L-arginine, comprising the step of culturing a microorganism of the genus Corynebacterium comprising a protein variant of the present disclosure or a polynucleotide of the present disclosure in a medium.

[0139] The method for producing L-arginine of the present disclosure may include a step of culturing a microorganism of the genus Corynebacterium comprising a protein variant of the present disclosure, a polynucleotide of the present disclosure, or a vector of the present disclosure in a medium.

[0140] In this disclosure, the term "cultivation" refers to growing a Corynebacterium microorganism of the present disclosure under appropriately controlled environmental conditions. The culturing process of the present disclosure can be performed using a suitable medium and culture conditions known in the art. Such a culturing process can be easily adjusted and used by those skilled in the art depending on the selected strain. Specifically, the culturing process may be batch, continuous, and / or fed-batch, but is not limited thereto.

[0141] In the present disclosure, the term "medium" refers to a material containing nutrients as a main component necessary for culturing a Corynebacterium microorganism of the present disclosure, and supplies nutrients and growth factors, including water essential for survival and growth. Specifically, the medium and other culture conditions used for culturing a Corynebacterium microorganism of the present disclosure may be any medium used for culturing a typical microorganism without particular limitation, but the Corynebacterium microorganism of the present disclosure may be cultured under aerobic conditions while controlling temperature, pH, etc. in a typical medium containing an appropriate carbon source, nitrogen source, phosphorus, inorganic compound, amino acid, and / or vitamin.

[0142] Specifically, culture media for strains of the genus Corynebacterium can be found in the literature ["Manual of Methods for General Bacteriology" by the American Society for Bacteriology (Washington DC, USA, 1981)].

[0143] In the present disclosure, the carbon source may include carbohydrates such as glucose, saccharose, lactose, fructose, sucrose, maltose, etc.; sugar alcohols such as mannitol, sorbitol, etc.; organic acids such as pyruvic acid, lactic acid, citric acid, etc.; amino acids such as glutamic acid, methionine, lysine, etc. In addition, natural organic nutrients such as starch hydrolysate, molasses, blackstrap molasses, rice winter, cassava, sugarcane bagasse, and corn steep liquor may be used, and specifically, carbohydrates such as glucose and sterilized pretreated molasses (i.e., molasses converted to reducing sugar) may be used, and other appropriate amounts of carbon sources may be used in various ways without limitation. These carbon sources may be used alone or in combination of two or more, but are not limited thereto.

[0144] The nitrogen source may include inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, ammonium carbonate, ammonium nitrate, etc.; organic nitrogen sources such as amino acids such as glutamic acid, methionine, glutamine, etc.; peptone, NZ-amine, meat extract, yeast extract, malt extract, corn steep liquor, casein hydrolysate, fish or its decomposition product, defatted soybean cake or its decomposition product, etc. These nitrogen sources may be used alone or in combination of two or more, but are not limited thereto.

[0145] The above-mentioned components may include potassium phosphate monobasic, potassium phosphate dibasic, or their corresponding sodium-containing salts. Inorganic compounds may include sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate, calcium carbonate, etc. In addition, amino acids, vitamins, and / or suitable precursors may be included. These components or precursors may be added to the medium in batch or continuous manner, but are not limited thereto.

[0146] In addition, during the cultivation of the Corynebacterium genus microorganism of the present disclosure, compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, sulfuric acid, etc. may be added to the medium in an appropriate manner to adjust the pH of the medium. In addition, during the cultivation, an antifoaming agent such as fatty acid polyglycol ester may be used to suppress bubble formation. In addition, in order to maintain the aerobic state of the medium, oxygen or an oxygen-containing gas may be injected into the medium, or in order to maintain the anaerobic and microaerobic state, nitrogen, hydrogen, or carbon dioxide gas may be injected without gas injection, but is not limited thereto.

[0147] In the culture of the present disclosure, the culture temperature may be 20°C to 45°C, specifically, 25°C to 40°C, 25°C to 40°C, 25°C to 37°C, 25°C to 35°C, 27°C to 40°C, 27°C to 37°C, 27°C to 35°C, 30°C to 40°C, 30°C to 37°C, or 30°C to 35°C, but is not limited thereto. In the culture of the present disclosure, the culture time may be about 10 to 160 hours, but is not limited thereto.

[0148] L-arginine produced by the culture of the present disclosure may be secreted into the medium or remain within the cells.

[0149] The method for producing L-arginine of the present disclosure may additionally include, for example, a step of preparing a microorganism of the genus Corynebacterium of the present disclosure, a step of preparing a medium for culturing the strain, or a combination thereof (in any order), prior to the culturing step.

[0150] The method for producing L-arginine of the present disclosure may further include a step of recovering L-arginine from a culture medium (a medium in which culture is performed) or a Corynebacterium genus microorganism according to the above-described culturing step. The recovering step may be additionally included after the culturing step.

[0151] The above recovery may be performed by collecting the target L-arginine using a suitable method known in the art according to the culture method of the microorganism of the present disclosure, such as a batch, continuous or fed-batch culture method. For example, various chromatographies such as centrifugation, filtration, treatment with a crystallized protein precipitant (salting out method), extraction, ultrasonic disruption, ultrafiltration, dialysis, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, affinity chromatography, HPLC or a combination thereof may be used, and the target L-arginine may be recovered from the medium or microorganism using a suitable method known in the art.

[0152] Additionally, the L-arginine production method of the present disclosure may additionally include a purification step. The purification may be performed using any suitable method known in the art. In one example, when the L-arginine production method of the present disclosure includes both a recovery step and a purification step, the recovery step and the purification step may be performed sequentially or discontinuously, regardless of order, or may be performed simultaneously or integrated into a single step, but is not limited thereto.

[0153] In the method of the present disclosure, the variants, polynucleotides, vectors, strains, etc. are as described in the other aspects above.

[0154]

[0155] Another aspect of the present disclosure provides a composition for producing L-arginine, comprising a Corynebacterium genus microorganism comprising at least one selected from the group consisting of a protein variant of the present disclosure, a polynucleotide encoding the protein variant, and a vector comprising the polynucleotide; a medium for culturing the same; or a combination of two or more thereof.

[0156] The composition of the present disclosure may further comprise any suitable excipient commonly used in compositions for producing amino acids (e.g., L-arginine), including but not limited to preservatives, wetting agents, dispersing agents, suspending agents, buffering agents, stabilizers, or isotonic agents.

[0157] In the composition of the present disclosure, the variant, polynucleotide, vector, strain, medium, and L-arginine, etc. are as described in the other aspects above.

[0158]

[0159] According to another aspect of the present disclosure, the present disclosure may provide a method for increasing L-arginine production ability of a microorganism, a method for imparting L-arginine production ability to a microorganism, or a method for producing a microorganism with increased L-arginine production ability, the method comprising a step of introducing (e.g., transforming) into a microorganism a novel protein variant of the present disclosure described above, a polynucleotide encoding the variant, and / or a recombinant vector comprising the polynucleotide.

[0160] In the method for producing a microorganism of the present disclosure, the polynucleotide, recombinant vector, and microorganism are as described above.

[0161] According to another aspect of the present disclosure, the present disclosure provides a method for producing L-arginine, and / or preparing an L-arginine-producing microorganism, and / or imparting and / or increasing L-arginine production ability of a microorganism, wherein the method comprises at least one selected from the group consisting of a protein variant of the present disclosure described above; a polynucleotide encoding the protein variant; a recombinant vector comprising the polynucleotide; and a microorganism comprising the protein variant, the polynucleotide encoding the protein variant, and / or the recombinant vector comprising the polynucleotide.

[0162] In the use for producing L-arginine, and / or manufacturing an L-arginine-producing microorganism, and / or imparting and / or increasing the L-arginine production ability of a microorganism, the protein variant, polynucleotide, recombinant vector, and microorganism are as described above.

[0163]

[0164] In another aspect of the present disclosure, the present disclosure provides a composition, method, product, process, or use characterized by one or more elements disclosed in the present disclosure.

[0165]

[0166] When culturing a Corynebacterium genus microorganism comprising the novel protein variant of the present disclosure, high yield L-arginine production is possible compared to a microorganism having an existing unmodified polypeptide.

[0167]

[0168] Hereinafter, the present disclosure will be described in more detail through examples. These examples are intended solely to more specifically illustrate the present disclosure, and it will be apparent to those skilled in the art that the scope of the present disclosure is not limited by these examples, in accordance with the gist of the present disclosure.

[0169]

[0170] Example

[0171] (Throughout this disclosure, "%" used to indicate the concentration of a particular substance, unless otherwise stated, is (weight / weight) % for solid / solid, (weight / volume) % for solid / liquid, and (volume / volume) % for liquid / liquid.)

[0172]

[0173] Example 1. Production of arginine-producing microorganisms

[0174] Example 1-1. Production of Corynebacterium glutamicum CJR2 strain

[0175] To evaluate the production ability of L-arginine, Corynebacterium glutamicum strain CJR2 was produced by introducing △argR and argB (M54V) mutations into wild-type Corynebacterium glutamicum ATCC13869 (Ikeda, Masato et al., Applied and environmental microbiology 75(6)1635-41, 2009).

[0176] First, vectors introducing argR deletion and argB (M54V) mutation were constructed. Using the genomic DNA of Corynebacterium glutamicum ATCC13869 as a template, PCR using primer pairs of SEQ ID NOs: 1 and 2, 3 and 4, and overlapping PCR using primer pairs of SEQ ID NOs: 1 and 4 were performed to obtain a homologous recombination fragment having the argR deletion mutation sequence. In the same manner, PCR using primer pairs of SEQ ID NOs: 5 and 6, 7 and 8, and overlapping PCR using SEQ ID NOs: 5 and 8 were performed to prepare a homologous recombination fragment having the argB (M54V) mutation. The PCR reaction was denatured at 95°C for 5 minutes; After 27 cycles of denaturation at 95°C for 30 seconds, annealing at 60°C for 30 seconds, and polymerization at 72°C for 1 minute, the polymerization reaction was performed at 72°C for 5 minutes. The fragments obtained above were purified, and fusion cloning was performed using the In-Fusion® HD cloning kit (Clontech) according to the manual with the pDC24 vector (SEQ ID NO: 81) digested with SmaI restriction enzyme to obtain plasmids. The constructed vectors were named pDC24-ΔargR and pDC24-argB(M54V), respectively.

[0177] Next, the argR deletion mutation was introduced into wild-type Corynebacterium glutamicum ATCC13869. Transformation was performed using the electric pulse method using the above-constructed pDC24-ΔargR plasmid (van der Rest et al., Appl Microbiol Biotechnol 52:541-545, 1999). Then, a second recombination was performed on a solid plate medium containing 4% sucrose, and PCR was performed using the primer pair of SEQ ID NO: 1 and 4 for the transformant that completed the second recombination, confirming that the deletion mutation was introduced into the argR gene on the chromosome. At this time, the PCR reaction was performed under the same conditions as above, and the transformant obtained in this way was named CJR1.

[0178]

[0179] <Solid plate medium (pH 7.0)>

[0180] Glucose 10 g, peptone 10 g, beef extract 5 g, yeast extract 5 g, brain heart infusion 18.5 g, NaCl 2.5 g, urea 2 g, sorbitol 91 g, agar 20 g (per 1 liter of distilled water)

[0181]

[0182] The argB (M54V) mutation was introduced into the above-mentioned Corynebacterium glutamicum CJR1 using the same method as above. The above-mentioned pDC24-argB (M54V) plasmid was used, and PCR was performed using the primer pair of SEQ ID NO: 5 and 8 on the transformant strain in which the second recombination was completed, confirming that the M54V mutation was introduced into the argB gene on the chromosome. The transformant strain was named CJR2.

[0183] The sequence information of the primers used in Example 1-1 is described in Table 2 below.

[0184] Sequence number name sequence (5'->3')1argR-5'-Ftgaattcgagctcggtaccccactggtgaactccttgtcc2argR-5'-Rttgaactagggcgctttaaaagttttc cggtgttgacgg3argR-3'-Fccgtcaacaccggaaaacttttaaagcgcccctagttcaa4argR-3'-Rgtcgactctagaggatcccccgttgaactgct tgccagcc5argB-5'-Ftgaattcgagctcggtaccctgcggctcgcacggttgctc6argB-5'-Racggtgcgcaagaagaccacgtcggcagcaaaagca gcct7argB-3'-Fggctgcttttgctgccgacgtggtcttcttgcgcaccgtg8argB-3'-Rgtcgactctagaggatccccctcttatcaggccaatcggt

[0185] Example 1-2. Production of Corynebacterium glutamicum CJR100 strain

[0186] Based on the CJR2 strain produced in Example 1-1, a CJR100 strain with an enhanced N-acetyl-gamma-glutamyl-phosphate reductase (argC) gene was produced.

[0187] To enhance the activity of N-acetyl-gamma-glutamyl-phosphate reductase, argC (NCBI registration number BBD29_RS07530), a plasmid was constructed by replacing the wild-type promoter of the argC gene with Po2 using the Po2 promoter (US 10273491 B2), which is known as a strong promoter. The upstream and downstream regions of the argC gene were obtained. Specifically, to produce a strain into which argC with a Po2 promoter was introduced, PCR was performed using the chromosomal DNA of Corynebacterium glutamicum ATCC13869 as a template to amplify the upstream region of the argC gene using primers of SEQ ID NO: 9 and SEQ ID NO: 10, and the downstream region of the argC gene using primers of SEQ ID NO: 11 and SEQ ID NO: 12, respectively. In addition, a Po2 promoter fragment was obtained using the synthesized Po2 promoter as a template using primers of SEQ ID NO: 13 and SEQ ID NO: 14. Pfu UltraTM high-fidelity DNA polymerase (Stratagene) was used as a polymerase for the PCR reaction, and PCR was performed in the same manner as in Example 1-1. As a result, an 86 bp DNA fragment of the Po2 promoter region, a 610 bp DNA fragment upstream of Corynebacterium glutamicum ATCC13869argC, and a 1086 bp DNA fragment downstream of the Po2 promoter region were obtained, respectively. Using the amplified promoter and DNA fragments as templates, PCR was performed using the primers of SEQ ID NO: 9 and SEQ ID NO: 12 in the same manner as in Example 1-1. After DNA purification, the two fragments obtained above were fused to the pDC24 plasmid treated with SmaI restriction enzyme using the In-Fusion® HD cloning kit (Clontech). The resulting vector was named pDC24-Po2-argC.

[0188] Next, the CJR2 strain constructed in Example 1-1 was transformed using the electric pulse method using the pDC24-Po2-argC plasmid constructed above (van der Rest et al., Appl Microbiol Biotechnol 52:541-545, 1999). Then, a second recombination was performed on a solid plate medium containing 4% sucrose, and PCR was performed using primers of SEQ ID NOs: 9 and 14 for the transformant that completed the second recombination, confirming that the argC gene on the chromosome was strengthened by the Po2 promoter. At this time, the PCR reaction was performed under the same conditions as above, and the transformant obtained in this way was named CJR100.

[0189]

[0190] <Solid plate medium (pH 7.0)>

[0191] Glucose 10 g, peptone 10 g, beef extract 5 g, yeast extract 5 g, brain heart infusion 18.5 g, NaCl 2.5 g, urea 2 g, sorbitol 91 g, agar 20 g (per 1 liter of distilled water)

[0192] The sequence information of the primers used in Example 1-2 is described in Table 3 below.

[0193] SEQ ID NO: Name Sequence (5'->3')9argC-5'-FGTGAATTCGAGCTCGGTACCCGCCCCGAAAAGCCGTTAAAAG10argC-5'-RtgccaaaattcacgattattgCTCGAGTCTAGAGAGACGGGTTA11argC-3'-Fttattggag gagatcaaaacaATGACAATCAAGGTTGCAATC12argC-3'-RCAGGTCGGCGTCGCACCTTAAGGGGATCCTCTAGAGTCGACC13Po2-Fcaataatcgtgaattttggca14Po2-Rtgttttgatctcctccaataa

[0194]

[0195] Example 2. Selection of mutant strains with increased arginine production through artificial mutation.

[0196] Example 2-1. Random mutation induction through UV irradiation

[0197] To select mutant strains with increased arginine production, the arginine-producing strain CJR100, constructed in Example 1, was spread on a nutrient medium containing agar and cultured at 30°C for 16 hours. Hundreds of colonies thus obtained were irradiated with UV (ultraviolet mutation) at room temperature to induce random mutations in the genome of the strain. The composition of the nutrient medium is as follows.

[0198] Nutrient medium (pH 7.2)

[0199] Glucose 10 g, meat extract 5 g, polypeptone 10 g, sodium chloride 2.5 g, yeast extract 5 g, agar 20 g, urea 2 g (per 1 liter of distilled water)

[0200]

[0201]

[0202] Example 2-2. Selection of strains with improved L-arginine production capacity

[0203] In order to select a mutant strain with increased arginine production ability compared to the parent strain CJR100, the CJR100 strain and the mutant strain in which random mutations were induced in Example 2-1 were cultured using the following method.

[0204] The above strains were each inoculated into a 96-Deep Well Plate-Dome (Bioneer) containing 400 μl of seed medium and cultured in a plate shaking incubator (TAITEC) at 32°C and 1200 rpm for approximately 48 hours. The arginine concentrations of approximately 3,000 cultured strains were individually confirmed using a near-infrared spectroscopy (NIR) analyzer, and the top four mutant strains with improved arginine production compared to the parent strain CJR100 were selected. The composition of the seed medium is as follows.

[0205] <Seed medium (pH 7.0)>

[0206] Glucose 20 g, peptone 10 g, yeast extract 5 g, urea 1.5 g, KH2PO4 4 g, K2HPO4 8 g, MgSO4·7H2O 0.5 g, biotin 100 ug, thiamine HCl 1000 ug, calcium-pantothenic acid 2000 ug, nicotinamide 2000 ug (based on 1 liter of distilled water)

[0207]

[0208] In order to finally select strains with reproducibly increased L-arginine production ability among the four mutant strains selected above, the L-arginine production concentration was evaluated by culturing them using the following method.

[0209] The four strains and the control group were each inoculated into a 250 ml corner-baffle flask containing 25 ml of the seed medium and cultured at 30°C for 20 hours with shaking at 200 rpm. Then, 1 ml of the seed culture was inoculated into a 250 ml corner-baffle flask containing 24 ml of the production medium and cultured at 30°C for 54 hours with shaking at 200 rpm.

[0210] <Seed medium (pH 7.0)>

[0211] Glucose 20 g, peptone 10 g, yeast extract 5 g, urea 1.5 g, KH2PO4 4 g, K2HPO4 8 g, MgSO4·7H2O 0.5 g, biotin 100 ug, thiamine HCl 1000 ug, calcium-pantothenic acid 2000 ug, nicotinamide 2000 ug (based on 1 liter of distilled water)

[0212] <Production medium (pH 7.2)>

[0213] Glucose 5%, ammonium sulfate 3%, potassium phosphate monobasic 0.1%, magnesium sulfate heptahydrate 0.2%, corn steep liquor 1.5%, NaCl 1%, yeast extract 0.5%, biotin 100 mg / L

[0214]

[0215] After the culture was completed, the L-arginine concentration in the culture solution was analyzed using high-performance liquid chromatography (HPLC), and the L-arginine production concentration of each mutant strain is shown in Table 4 below.

[0216] Strain nameL-Arg (g / L)CJR1005.8CJR100_mt16.0CJR100_mt22.5CJR100_mt36.3CJR100_mt45.9

[0217] As shown in Table 4 above, among the four selected mutant strains, CJR100_mt3 was finally selected as the mutant strain with the greatest increase in L-arginine production.

[0218]

[0219] Example 3. Mutation identification through whole-genome sequencing (WGS)

[0220] Whole-genome sequencing (WGS) was performed on the CJR100_mt3 strain selected in the above Example 2-2, and compared with the parent strain CJR100, genes with changes in protein sequence due to nucleotide sequence mutations were identified. The amino acid sequences of the protein mutants and the nucleotide sequences of the genes are listed in Tables 5 and 6 below.

[0221] Mutation in the CDS (Coding Sequence) region Wild strain Amino acid Protein mutation Position mutation Strain Amino acid Gene ID Gene Name Protein mutant Amino acid sequence Sequence number Mutant nucleotide sequence Sequence number A306 SBBD29_00030-transposase 1521 P65 LBBD29_05930-HNH nuclease 1622 A365 Deletion* BBD29_08260-Cell wall-associated hydrolase 1723 V123 ABBD29_02985 tetR2 TetR family transcriptional regulator 1824 P432 LBBD29_06380-transposase 1925 G922 EBBD29_07445 uvrA excinuclease ABC subunit A2026

[0222]

[0223] * Deletion: Due to a substitution of the base sequence of a gene, the codon that originally encoded the amino acid mutates into a stop codon, resulting in a deletion of the amino acid sequence from that position.

[0224]

[0225] RNA region mutation RNA TYPE name Gene name Expressed protein mutation type CJR100 Nucleotide sequence Sequence number Variant nucleotide sequence Sequence number rRNABBD29_12405 rRNA0123S ribosomal RNA substitution 2730 rRNABBD29_07610 rRNA0423S ribosomal RNA substitution and insertion 2831 rRNABBD29_04520 rRNA0523S ribosomal RNA insertion 2932

[0226]

[0227]

[0228]

[0229]

[0230]

[0231]

[0232]

[0233]

[0234]

[0235] Example 4. Production of an L-arginine-producing strain with a mutant gene introduced.

[0236] Example 4-1. Construction of a recombinant vector for introducing a mutant gene.

[0237] In order to confirm the effect of the protein variant identified in Example 3 above, a vector capable of introducing it onto a chromosome was constructed.

[0238] Specifically, vectors containing target mutations were constructed to introduce each of the BBD29_00030, BBD29_05930, BBD29_08260, BBD29_02985, BBD29_06380, BBD29_07445, BBD29_12405, BBD29_07610, and BBD29_04520 gene mutations into the CJR100 strain.

[0239] Specifically, the genomic DNA of the CJR100_mt3 strain was extracted using a G-spin Total DNA Extraction Mini Kit (Intron, Cat. No. 17045) according to the protocol provided in the kit, and PCR was performed using the genomic DNA as a template. SolgTM Pfu-X DNA polymerase was used as the polymerase, and the PCR conditions were as follows: denaturation at 95°C for 4 minutes; 27 cycles of denaturation at 95°C for 30 seconds, annealing at 60°C for 30 seconds, and polymerization at 72°C for 50 seconds; and polymerization was performed at 72°C for 5 minutes. The sequences of the primer pairs used in the experiment are shown in Table 8 below.

[0240] The obtained mutation introduction fragment and the pDC24 vector (SEQ ID NO: 81) treated with the restriction enzyme SmaI were cloned using the Gibson assembly method (DG Gibson et al., NATURE METHODS, VOL.6 NO.5, MAY 2009, NEBuilder HiFi DNA Assembly Master Mix) to obtain recombinant plasmids, and the vectors containing each mutation introduction fragment were pDC24-BBD29_00030*; pDC24-BBD29_05930*; pDC24-BBD29_08260*; pDC24-BBD29_02985*; pDC24-BBD29_06380*; pDC24-BBD29_07445*; pDC24-BBD29_12405*; pDC24-BBD29_07610*; and named pDC24-BBD29_04520*.

[0241]

[0242] Example 4-2. Production of an L-arginine-producing strain with a mutant gene introduced.

[0243] The nine vectors produced in Example 4-1 were transformed into the CJR100 strain using electroporation, and strains in which the vectors had been inserted into the chromosome by recombination of homologous sequences were selected using kanamycin medium. Thereafter, the strains in which the mutant promoters had been introduced were confirmed through PCR using the primer pairs in Table 9 below, targeting the transformants in which the second recombination was completed.

[0244] Name sequence (5'-> 3') SEQ ID NO: BBD29_00030*_CFGTTACGCGCCGCAGGAGC51BBD29_00030*_CRAGCAGTGTGCACACCAAC52BBD29_05930*_CFTGCGAGCCAGGTGGTCGC53BBD29_05930*_CRCGGGCTCAAACGGCCTCA54BBD29_08260* _CFCAACTGGCTCATGGCGCG55BBD29_08260*_CRGATCTCGATGATTCTCAA56BBD29_02985*_CFCACCGGGAAGTACTTTAC57BBD29_02985*_CRTCTGGCGGTGGGCATCCT58BBD29_06380*_CFAAGCTATCTCGCGACG GT59BBD29_06380*_CRCTACCGCTGGACCGAGTC60BBD29_07445*_CFCGGTTACAAGCCTGGCCG61BBD29_07445*_CRAGCATTGCTGATCTTGGT62BBD29_12405*_CFAAGCCTTTTCGCGGGTGC63BBD29_12405*_CR AGTGAATGTATAGCTGGT64BBD29_07610*_CFGTCAACACGGGTAGAGAA65BBD29_07610*_CRTCACCAACGACTCACACA66BBD29_04520*_CFTGTGTTTCTTGCCGGAGG67BBD29_04520*_CRGGAAGTCGTTACGCCATT68

[0245] The above recombinant strains were each CJR100△BBD29_00030::BBD29_00030*; CJR100△BBD29_05930::BBD29_05930*; CJR100△BBD29_08260::BBD29_08260*; CJR100△BBD29_02985::BBD29_02985*; CJR100△BBD29_06380::BBD29_06380*; CJR100△BBD29_07445::BBD29_07445*; CJR100△BBD29_12405::BBD29_12405*; They were named CJR100△BBD29_07610::BBD29_07610*; and CJR100△BBD29_04520::BBD29_04520*.

[0246]

[0247] Example 5. Evaluation of L-arginine production ability of L-arginine producing strain with introduced mutant gene

[0248] In order to confirm the L-arginine production ability of the recombinant strains produced in Example 4-2 above, they were cultured and evaluated using the following method.

[0249] Each strain was inoculated into a 250 ml corner-baffle flask containing 25 ml of seed medium and cultured at 30°C for 20 hours with shaking at 200 rpm. 1 ml of seed culture was inoculated into a 250 ml corner-baffle flask containing 24 ml of production medium and cultured at 30°C for 54 hours with shaking at 200 rpm. The medium composition was the same as in Example 2-2, and the experiment was repeated three times.

[0250] After the culture was completed, the amount of L-arginine produced was measured using high-performance liquid chromatography (HPLC), and the average value of the analysis results is shown in Table 10 below.

[0251] Strain name L-arginine concentration (g / L) CJR100 5.9 CJR100 △BBD29_00030::BBD29_00030*6.01 CJR100 △BBD29_05930::BBD29_05930*6.12 CJR100 △BBD29_08260::BBD29_08260*6.04 CJR100 △BBD29_02958::BBD29_02958*6.01 CJR100 △BB D29_06380::BBD29_06380*5.98CJR100△BBD29_07445::BBD29_07445*6.26CJR100△BBD29_12405::B BD29_12405*6.01CJR100△BBD29_07610::BBD29_07610*5.99CJR100△BBD29_04520::BBD29_04520*6

[0252] As a result, as shown in Table 10, it was confirmed that most of the arginine-producing strains expressing protein variants had arginine production ability equivalent to or superior to that of the parent strain. In particular, it was confirmed that the CJR100△BBD29_07445::BBD29_07445* strain had a significantly increased arginine production ability compared to the parent strain CJR100.

[0253] Through this, it was confirmed that L-arginine could be produced more efficiently by introducing a protein mutant in which the 922nd amino acid of the protein (excinuclease ABC subunit A) encoded by the BBD29_07445 gene was substituted from glycine (Gly, G) to glutamic acid (Glu, E).

[0254]

[0255] From the above description, those skilled in the art will understand that the present disclosure can be implemented in other specific forms without altering its technical spirit or essential characteristics. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not restrictive. The scope of the present disclosure should be interpreted as encompassing all changes or modifications derived from the meaning and scope of the following claims and their equivalents, rather than the detailed description above.

Claims

A protein variant comprising an amino acid sequence in which the amino acid corresponding to the 922nd position from the N-terminus in the amino acid sequence of SEQ ID NO: 74 is substituted with glutamic acid. In claim 1, the protein variant has an amino acid sequence identity of 90% or more and less than 100% with the amino acid sequence of SEQ ID NO:

74. In claim 1, the protein variant comprises an amino acid sequence of SEQ ID NO:

20. A polynucleotide encoding a protein variant of the first clause. A microorganism of the genus Corynebacterium, comprising at least one member selected from the group consisting of a protein variant of claim 1 and a polynucleotide encoding the protein variant. In claim 5, the microorganism of the genus Corynebacterium is Corynebacterium glutamicum. In claim 5, the microorganism has increased L-arginine production ability compared to a microorganism of the genus Corynebacterium that does not include at least one member selected from the group consisting of the protein variant and a polynucleotide encoding the protein variant. A method for producing L-arginine, comprising the step of culturing the microorganism of claim 5 in a medium. A method for producing L-arginine, wherein the method further comprises a step of recovering L-arginine from a cultured medium or a cultured microorganism. Use of a microorganism according to any one of claims 5 to 7 for producing L-arginine. A composition, method, product, process, or use characterized by one or more elements disclosed herein.

Citation Information

Patent Citations

  • Promoter and uses thereof

    US10273491B2

  • Promoter and use thereof

    US10584338B2

  • Microorganism of the Genus Corynebacterium with Enhanced ability to produce L-Arginine and Method for Producing L-Arginine Using the Same (AS AMENDED)

    US20160145661A1

  • Promoter sequences from Corynebacterium ammoniagenes

    US7662943B2

  • Method for producing L-arginine by using escherichia coli with overexpressed cynX gene and recombinant bacteria used in method

    CN116731947A